CN116676276A

CN116676276A - Tumor targeting oncolytic adenovirus, preparation method and application thereof

Info

Publication number: CN116676276A
Application number: CN202310322417.9A
Authority: CN
Inventors: 杨莉; 田要美; 谢道远
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2022-03-31
Filing date: 2023-03-29
Publication date: 2023-09-01

Abstract

The invention belongs to the field of tumor immunotherapy, and in particular relates to tumor targeting oncolytic adenovirus, a preparation method and application thereof. The invention aims to solve the technical problem that the oncolytic adenovirus tumor specific treatment effect is limited. The technical scheme for solving the technical problems is that a recombinant oncolytic adenovirus is provided: a) The genome of the oncolytic adenovirus is replaced by an exogenous core promoter element or an exogenous promoter by the oncolytic adenovirus self E1 promoter so as to drive the E1A and/or E1B-19K gene expression; b) Operably inserting a gene encoding an RGD peptide into the oncolytic adenovirus genome. The invention combines the tumor specific promoters mhTERT and RGD with high activity to obtain new adenovirus, which can produce synergistic effect and provide new effective selection for the research and development of tumor immunotherapy in the field.

Description

Tumor targeting oncolytic adenovirus, preparation method and application thereof

Technical Field

The invention belongs to the field of tumor immunotherapy, and in particular relates to tumor targeting oncolytic adenovirus, a preparation method and application thereof.

Background

Surgical treatment, radiation therapy, chemotherapy, and the like are currently the conventional means for treating tumors. In recent years, tumor immunotherapy has rapidly progressed, and has become a hotspot of clinical treatment research on tumors. Oncolytic adenoviruses are recombinant replication-competent adenoviruses, and viruses which proliferate only in tumor cells can specifically kill tumor cells without killing activity on normal cells by inserting a tumor-specific promoter or a gene associated with the proliferation of the deleted virus in normal cells. Oncolytic adenovirus has the excellent characteristics of easy production, high efficiency, clinical safety and the like. In recent years, oncolytic adenoviruses have become a hotspot in the field of tumor therapy due to their innovativeness and therapeutic effects.

Although oncolytic adenoviruses have made some progress in tumor therapy, they have failed to exhibit complete anti-tumor effects in most clinical trials, and they have mainly faced several challenges, including limited tumor-specific proliferation capacity of oncolytic adenoviruses, limited spread of intratumoral infection, inability to cope with tumor complexity with monotherapy, tumor-inhibiting microenvironment-inhibiting oncolytic adenoviras, and the like. Aiming at the application challenges of oncolytic adenoviruses, the main solutions are to optimize the proliferation capacity of tumor specific promoters in tumors, express pro-apoptosis proteins to sensitize tumor cells, optimize the transportation mode, mediate immune regulation and the like.

The tumor specific efficient proliferation capability is a source innovation link of oncolytic adenoviruses and is one of the greatest challenges of clinical application. To ensure the safety of oncolytic adenoviruses in normal cells, it is ensured that they proliferate only in tumor cells, mainly by two ways: firstly, utilizing a tumor specific promoter to control genes necessary for virus proliferation, thereby controlling the virus proliferation; secondly, genes which are necessary for virus proliferation in normal cells and are not needed in tumor cells are deleted, so that the virus can only proliferate in tumor cells, and the application of the former is an important strategy in targeted gene virus treatment. Human telomerase reverse transcriptase (Human telomerase reverse transcriptase, hTERT) has been demonstrated to be highly expressed in a variety of malignant tumor tissues, such as lung cancer, esophageal cancer, breast cancer, thyroid cancer, melanoma, cervical cancer, rectal cancer, renal cancer, and leukemia cells, as compared to normal tissues. Therefore, the telomerase promoter can be used as a tumor specific promoter for oncolytic adenovirus treatment, and the prior study shows that the activity of the hTERT promoter as the tumor specific promoter is quite limited, so that the hTERT promoter is difficult to obtain good effect in practical application.

RGD sequence (Arg-Gly-Asp) is a short peptide sequence composed of arginine, glycine and aspartic acid, RGD peptide containing RGD sequence and its derivative can specifically recognize and bind with cell surface integrin receptor proteins (such as alpha v beta 3, alpha 5 beta 1, etc.). Insertion of an RGD peptide with integrin specificity in the HI loop of the fiber protein knob region of adenovirus can increase the efficiency of adenovirus infection of tumor cells, especially tumor cells lacking the Coxsackie virus-adenovirus receptor.

At present, the focus of development and improvement of oncolytic adenoviruses is single, and adenovirus reports with multiple comprehensive characteristics are few.

Disclosure of Invention

The invention aims to solve the technical problems that the tumor specific proliferation capacity and the specific treatment effect of oncolytic adenovirus are limited. The technical scheme for solving the technical problems is to provide a recombinant oncolytic adenovirus.

The recombinant adenovirus: a) The genome of the oncolytic adenovirus is replaced by an exogenous core promoter element or an exogenous promoter by the oncolytic adenovirus self E1 promoter so as to drive the E1A and/or E1B-19K gene expression;

b) Operably inserting a gene encoding an RGD peptide into the oncolytic adenovirus genome.

Wherein, the exogenous core initiation element in the recombinant oncolytic adenovirus is as follows:

1) The nucleotide sequence is shown as SEQ ID No. 1;

or:

2) A nucleic acid molecule having a 1 or several base insertion, deletion and/or substitution mutation in the nucleotide sequence shown in SEQ ID No.1 and still having a promoter function.

Wherein the nucleotide sequence of the core promoter element is shown in any one of SEQ ID No.3, SEQ ID No.4 or SEQ ID No. 5.

Wherein the promoter in the recombinant oncolytic adenovirus is a promoter containing the core promoter element.

Wherein the nucleotide sequence of the promoter is shown as SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8.

Furthermore, at least one E2F binding site is inserted into the promoter of the recombinant oncolytic adenovirus.

Wherein, the nucleotide sequence of the E2F binding site in the recombinant oncolytic adenovirus is shown as SEQ ID No. 15;

wherein, the E2F binding site in the recombinant oncolytic adenovirus is a nucleic acid molecule which has 1 or several base insertion, deletion and/or substitution mutation in the nucleotide sequence shown in the sequence SEQ ID No.15 and still has the function of the E2F binding site.

Wherein the E2F binding site in the recombinant oncolytic adenovirus is inserted at the 5 'and/or 3' end of the core initiation element.

The nucleotide sequence of the promoter in the recombinant oncolytic adenovirus is shown as SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13 or SEQ ID No. 14.

Wherein the adenovirus of the recombinant oncolytic adenovirus is an adenovirus of which the serotype belongs to the subgenera A, subgenera B, subgenera C, subgenera D, subgenera E, subgenera F or subgenera G.

Wherein, the adenovirus in the recombinant oncolytic adenovirus is:

at least one selected from the group consisting of type 12, 18, 31 or 61 of subgenera a;

or at least one selected from the group consisting of types 3, 7, 11, 14, 16, 21, 34, 35, 55, 66, 68, 76, 77, 78 or 79 of subgenera B,

or, at least one selected from the group consisting of types 1, 2, 5, 6, 57, and 89 of subgenera C;

or at least one selected from the group consisting of types 8, 9, 13, 15, 17, 19, 20, 22 to 30, 32, 33, 36 to 39, 46, 48, 49, 53, 54, 56, 58 to 60, 62 to 65, 67, 69 to 75, 80 to 88 and 90 to 103 of the subgenera D;

alternatively, form 4 selected from subgenera E;

alternatively, from the subgenera F, type 40 or 41;

Alternatively, adenovirus type 52 selected from the subgenera G.

Wherein, E1A in the recombinant oncolytic adenovirus is E1A (Delta 24) deleted with 24bp in the middle, and the nucleotide sequence is shown in SEQ ID No. 16. Wherein the nucleotide sequence of the E1B 19K is shown as SEQ ID No. 17. Wherein the fragment containing the E1A and E1B-19K genes is E1A/E1B-19K, and the nucleotide sequence is shown as SEQ ID No. 18.

Wherein, the recombinant oncolytic adenovirus is further operably inserted with a gene encoding RGD peptide.

Wherein the gene encoding the RGD peptide of the recombinant oncolytic adenovirus is inserted into the HI loop of the adenovirus fiber protein knob region.

Wherein the gene encoding the RGD peptide described in the above recombinant oncolytic adenovirus is inserted between 546T and 547P codons in the HI loop of the fiber protein knob region of adenovirus and/or between 581E and 582 stop codons of the HI loop gene of the fiber protein knob region.

Wherein the amino acid sequence of the RGD peptide in the recombinant oncolytic adenovirus is CDCRGDCFC (SEQ ID No. 19).

The invention also provides a host cell containing the recombinant oncolytic adenovirus.

Wherein the host cell is a eukaryotic cell.

The invention also provides the application of the recombinant oncolytic adenovirus or the host cell in preparing antitumor drugs.

On the basis, the invention also provides an anti-tumor medicament. The antitumor drug is prepared by adding pharmaceutically acceptable auxiliary components into the recombinant oncolytic adenovirus or the host cell.

Wherein the tumor in the antitumor drug is at least one of epithelial tissue tumor, mesenchymal tissue tumor, nerve tissue tumor, lymph and hematopoietic tissue tumor.

Further, the antitumor drug satisfies any one of the following:

the epithelial tissue tumor comprises papilloma, adenocarcinoma, cyst adenocarcinoma, mixed carcinoma, transitional epithelium carcinoma and basal cell carcinoma;

the mesenchymal tissue tumor comprises liposarcoma, leiomyosarcoma, fibrosarcoma, rhabdomyosarcoma, hemangiosarcoma, lymphangiosarcoma, osteosarcoma, chondrosarcoma, synovial sarcoma;

the nerve tissue tumor comprises glioblastoma multiforme, myeloblastoma, malignant schwannoma, ganglioblastoma and meningioma;

the lymphopoiesis tissue tumor comprises lymphoma, leukemia and multiple myeloma;

the other tumors comprise testicular cancer, malignant teratoma and malignant melanoma.

The invention also provides a method for preparing the recombinant oncolytic adenovirus.

The method comprises the following steps:

a) Constructing a shuttle plasmid by operably linking an exogenous core promoter element or promoter to a gene necessary for adenovirus proliferation;

b) Operably linking an RGD sequence encoding gene into an HI loop encoding region of an adenovirus backbone plasmid encoding adenovirus fiber protein knob region, and performing RGD modification on the backbone plasmid;

c) Transferring the shuttle plasmid obtained in the step a) and the adenovirus skeleton plasmid obtained in the step b) into packaging cells, and packaging to obtain the oncolytic adenovirus.

Further, the above method also satisfies at least one of the following:

genes required for adenovirus proliferation are E1A and/or E1B-19K;

alternatively, the Shuttle plasmid is at least one of pDC316, pDC311, pDC312, pDC315, pDC511, pDC512, pDC515, pDC516, pShuttle, pShuttle-CMV, pCTAP-shift series plasmid, pNTAP-shift series plasmid, pAdTrack, pAdTrack-CMV, pacAd5 series plasmid, pHBAd series plasmid or pXC1 plasmid;

alternatively, the adenovirus skeleton plasmid is at least one of pBHGloxdelE13cre, pBHGfrtdelE FLP, pAdEasy-1, pAdEasy-2, pBHGE3i or pBHGE10 i;

Alternatively, the packaging cells are HEK293 and HEK293A cells.

Wherein the gene encoding RGD polypeptide described in the above method is inserted between 546T codon and 547P codon and/or between 581E codon and 582 stop codon of HI loop encoding gene of the fiber protein knob region of adenovirus backbone plasmid by homologous recombination.

Wherein, the backbone plasmid described in the above method is prepared as follows:

(1) Co-transferring adenovirus skeleton vector pBHGfrtdele13FLP (abbreviated as pBHGFF) and pRedET (expressed recombinant enzyme) into DH10B bacteria to obtain positive clone DH10B (pBHGFF+pRedET) so as to obtain the strain which expresses recombinant enzyme and contains adenovirus skeleton vector pBHGFF;

(2) Adding L-arabinose into DH10B (pBHGFF+pRedeT) bacterial culture solution to induce expression of homologous recombinase and prepare competent cells, transferring a resistance gene fragment PCR product with homologous arm and restriction endonuclease sequences into the competent cells for recombination reaction, and recovering overnight for culture to obtain recombinant positive clone DH10B (pBHGFF-resistance gene); the resistance gene is inserted between 546T codon and 547P codon or 581E codon and 582 stop codon of HI loop coding gene of adenovirus fiber protein knob region of pBHGFF skeleton plasmid by homologous recombination so as to form pBHGFF-resistance gene intermediate vector;

(3) Restriction enzyme digestion is carried out on the obtained pBHGFF-resistance gene plasmid, gibson recombination assembly reaction is carried out in vitro with RGD-4C nucleic acid fragment with homologous arm, then the recombination product is transformed into DH10B competence, resuscitated and cultured overnight, thus obtaining positive clone DH10B (pBHGFF-RGD); the RGD nucleic acid fragment is inserted between 546T codon and 547P codon or 581E codon and 582 stop codon of HI loop coding gene of coding adenovirus fiber protein knob region of skeleton plasmid by means of homologous recombination so as to form pBHGFF-RGD vector.

The shuttle vector and adenovirus skeleton plasmid are transferred into HEK293 or HEK293A cells by utilizing Lipofectamine 3000 to carry out oncolytic adenovirus packaging.

The beneficial effects of the invention are as follows: the method is characterized in that the method comprises the steps of carrying out genetic modification and optimization modification on a hTERT tumor specific promoter in the early stage to obtain a tumor specific promoter mhTERT with high activity, obviously improving the tumor specific efficient proliferation capacity of the oncolytic adenovirus and realizing the efficient specific killing capacity of the oncolytic adenovirus, and further carrying out RGD modification on an oncolytic adenovirus skeleton plasmid so as to realize efficient infection of tumor cells, especially tumor cells with low expression of coxsackie virus-adenovirus receptor, thereby improving the infection efficiency and targeting of the oncolytic adenovirus. The invention skillfully combines the tumor specific promoters mhTERT and RGD with high activity to obtain adenovirus with multiple advantages, can generate a certain synergistic effect, and provides a new effective choice for the research and development of tumor immunotherapy in the field.

Drawings

FIG. 1RT-PCR detection of mRNA expression of human telomerase reverse transcriptase in different human cells.

FIG. 2 detection of hTERT promoter mutation in different human tumor cells.

FIG. 3 schematic diagram of hTERT WT promoter.

FIG. 4 double fluorescein assay for hTERT point mutation promoter activity. * P <0.05; * P <0.01.

FIG. 5 double fluorescein assay for detecting hTERT point mutation core initiation element activity. * P <0.05; * P <0.01; * P <0.001.

FIG. 6 double fluorescein assay for detecting hTERT point mutation promoter activity after E2F binding site modification. * P <0.05; * P <0.01; * P <0.001.

FIG. 7RT-PCR detection of E1AmRNA expression after oncolytic adenovirus OAd-null infection of cells.

FIG. 8Western blot detection of E1A protein expression following oncolytic adenovirus OAd-null infection of cells.

FIG. 9CCK8 assay for in vitro tumor killing activity of oncolytic adenovirus OAd-null. * P <0.05; * P <0.01; * P <0.001.

FIG. 10 tumor killing activity of OAd-null oncolytic adenoviruses in different tumor models. Tumor volume and tumor size after a375 tumor treatment with oad-null oncolytic adenovirus, symbol x indicates tumor regression; tumor volume and tumor size after treatment of U87MG tumors with oad-null oncolytic adenovirus; tumor volume and tumor size after treatment of SKOV3 tumors with oad-null oncolytic adenovirus. * P <0.05; * P <0.01.

FIG. 11 is a schematic diagram of the construction of pBHGFF-kana using Red/ET recombination method.

FIG. 12 is a schematic diagram of the construction of pBHGFF-RGD using the Gibson assembly method.

The result of EcoRV cleavage verification of pBHGFF-RGD constructed in FIG. 13. Schematic of the theoretical size of pBHGFF-RGD digested with EcoRV. Actual electrophoresis pattern of EcoRV cleavage of pBHGFF-RGD.

FIG. 14 schematic representation of the preparation of oncolytic adenovirus OAd-RGD

FIG. 15CCK8 assay for in vitro tumor killing activity of oncolytic adenovirus OAd-RGD. * P <0.05; * P <0.01. FIG. 16A375 and U87MG tumor models for tumor killing activity of OAd-RGD oncolytic adenoviruses. Tumor volume and tumor size after a375 tumor treatment with oad-RGD oncolytic adenovirus; tumor volume and tumor size after treatment of U87MG tumors with oad-RGD oncolytic adenovirus. * P <0.05; * P <0.001.

FIG. 17 schematic representation of the preparation of oncolytic adenovirus OAd-null

Detailed Description

Oncolytic viruses, particularly oncolytic adenoviruses, currently face challenges, one of which is the limited tumor-specific proliferation capacity of oncolytic adenoviruses. For this reason, the present inventors have made various studies and have made a great deal of creative work for enhancing the intratumoral proliferation capacity of oncolytic viruses, particularly the tumor-specific proliferation capacity.

The invention surprisingly found that by carrying out specific modification on the hTERT promoter, a high-efficiency tumor specific promoter can be obtained. Sequencing the hTERT promoter regions of various tumor cells by earlier work shows that two mutations of the promoter and the mutation of C into T result in high expression of the hTERT gene. It is expected that these two mutations may be related to the strong or weak specific promoter capacity of hTERT promoter, and may be used on oncolytic adenovirus promoters to increase their therapeutic effect. A variety of cells were transfected by ligating fragments of the wild type hTERT promoter (hTERTWT, SEQ ID No. 2), the C69T mutant promoter (SEQ ID No. 6), the C47T mutant promoter (SEQ ID No. 7) and the DT double mutant promoter (SEQ ID No. 8) into plasmids. Experimental results show that the reporter gene controlled by the promoter is not expressed basically in normal cells, but is expressed strongly in various tumor cells, and the mutant promoter has stronger expression capacity than the wild type, and the DT double mutant promoter has the strongest tumor specific expression capacity.

The invention further uses a truncated 181bp core promoter region (SEQ ID No. 1) which has been subjected to a C69T mutation and/or a C47T mutation corresponding to the wild type. The segment is found to have a promoter function and can initiate expression of luciferase in various tumor cells. The activity of the 181bp core promoter segment of the C69T mutation (SEQ ID No. 3), the C47T mutation (SEQ ID No. 4) and the DT double mutation (SEQ ID No. 5) is obviously improved, and particularly, the activity of the 181bp core promoter segment of the DT double mutation is strongest. The truncated 181bp core promoter section is a core promoter element which has the function of independently promoting gene expression and is used as a promoter; other promoters may also be constructed as elements.

The inventors have then further adapted in such a way that the above-described promoter is inserted into the E2F binding site on the E2F-1 promoter. The results indicate that insertion of the E2F binding site on the E2F-1 promoter is effective in enhancing the tumor-specific expression capacity of the above promoters. One skilled in the art can insert one or more (the plurality can be 2, 3, 4, 5, 6 or more) and select an appropriate insertion site. In one example of the invention, the E2F binding site is inserted upstream and/or downstream of the hTERT 181bp core fragment of the promoter. An E2F binding site is inserted between-181 bp and-182 bp of the promoter, an E2F binding site is inserted between +4bp and +5bp of the promoter, and simultaneously, the modified promoters with one E2F binding site inserted at the two positions can improve the tumor specific expression capacity. It can be seen that the above-described core promoter elements and promoters are particularly useful for preparing recombinant vectors that require specific expression in tumor cells. Such as a plasmid vector or a viral vector.

On the basis, the invention also provides an oncolytic virus preparation and tumor treatment scheme involving the core initiation element and the promoter. The above-described promoter can be used for constructing various oncolytic viruses in which expression of genes mainly used for replication or proliferation is initiated, so that a novel oncolytic virus can be prepared. Such as oncolytic adenoviruses, oncolytic parvoviruses, oncolytic herpesviruses, oncolytic poxviruses, oncolytic vesicular stomatitis viruses, oncolytic myxoma viruses, oncolytic retroviruses, oncolytic reoviruses, oncolytic vaccinia viruses, and the like.

Of course, the promoters provided by the present invention are suitable for participation in the construction of novel oncolytic adenoviruses. If adenovirus of different serotypes replaces the original endogenous promoter, and the expression of multiplication essential genes such as E1 and the like is started, so that the replication and multiplication of adenovirus in tumor cells are controlled, and the oncolytic adenovirus with improved tumor specific multiplication capacity is obtained. Can be used for the preparation of oncolytic adenoviruses of various serotypes, such as types 12, 18, 31 and 61 of subgenera A and types 3, 7, 11, 14, 16, 21, 34, 35, 55, 66, 68, 76-79 of subgenera B and types 1, 2, 5, 6, 57 and 89 of subgenera C; types 8, 9, 13, 15, 17, 19, 20, 22 to 30, 32, 33, 36 to 39, 46, 48, 49, 53, 54, 56, 58 to 60, 62 to 65, 67, 69 to 75, 80 to 88, 90 to 103 of the subgenera D; type 4, sub-genus E, type 40 and 41, sub-genus F; the genus G subgenera 52.

Those skilled in the art will appreciate that the preparation of oncolytic viruses, and in particular oncolytic adenoviruses, requires the use of several commonly used vectors. Shuttle vectors and backbone vectors are typically used. The Shuttle vector may be selected from the group consisting of pDC316, pDC311, pDC312, pDC315, pDC511, pDC512, pDC515, pDC516, pShuttle, pShuttle-CMV, pCTAP-Shuttle series vector, pNTAP-Shuttle series vector, pAdTrack, pAdTrack-CMV, pacAd5 series vector, pHBAd series vector, pXC1, etc. The backbone vector may be selected from the group consisting of pBHGloxdelE13cre, pBHGfrtdele13FLP, pAdEasy-1, pAdEasy-2, pBHGE3i, pBHGE10i, etc. And the constructed shuttle vector and skeleton vector are transfected into cells together, so that the packaging and further proliferation of viruses can be realized.

In the examples of the present invention, plasmid pDC316 or pDC516 was used as a shuttle plasmid into which the engineered mhTERT promoter was ligated with the E1A/E1B-19K fragment necessary for adenovirus proliferation. pBHGlox (delta) E1,3Cre or pBHGfrtdele13FLP was also used as backbone plasmid. And co-transfecting the constructed shuttle vector and skeleton vector into HEK293 cells, and packaging to obtain the oncolytic adenovirus OAd-null. The obtained oncolytic adenovirus specifically and efficiently expresses the E1A gene, and simultaneously shows better anti-tumor effect in-vitro and in-vivo anti-tumor tests. The preparation method and structure of the oncolytic adenovirus can be seen in FIG. 17.

Another aspect of the invention is the RGD modification of oncolytic adenovirus backbone plasmids to improve oncolytic adenovirus infection efficiency and targeting. That is, the recombinant oncolytic adenovirus described above can also be operably inserted into the gene encoding the RGD peptide.

Generally, the gene encoding the RGD peptide described above is inserted in the HI loop of the adenovirus fiber protein knob region. Further, the gene encoding the RGD peptide described above may be inserted between 546T and 547P codons in the HI loop of the spike protein knob region of adenovirus and/or between 581E and 582 stop codons in the HI loop gene of the spike protein knob region. RGD peptides that may be used in the present invention include, but are not limited to, CDCRGDCFC polypeptides.

The invention skillfully combines the modification of the high-activity tumor specific promoter mhTERT and RGD polypeptide to obtain adenovirus with multiple advantages, which can generate a certain synergistic effect and improve the effect of tumor immunotherapy.

The present invention of course also provides host cells containing recombinant oncolytic adenoviruses as described above. The host cell is a eukaryotic cell.

The invention also provides an anti-tumor medicament prepared by adding pharmaceutically acceptable auxiliary components into the recombinant oncolytic adenovirus or the host cell.

The antitumor drug can be used for treating tumor types such as epithelial tissue tumor, mesenchymal tissue tumor, nerve tissue tumor, lymph and hematopoietic tissue tumor.

The above-mentioned epithelial tissue tumor includes papilloma, adenocarcinoma, cyst adenocarcinoma, mixed carcinoma, transitional epithelium carcinoma and basal cell carcinoma; the mesenchymal tissue tumor comprises liposarcoma, leiomyosarcoma, fibrosarcoma, rhabdomyosarcoma, hemangiosarcoma, lymphangiosarcoma, osteosarcoma, chondrosarcoma, synovial sarcoma; the nerve tissue tumor comprises glioblastoma multiforme, myeloblastoma, malignant schwannoma, ganglioblastoma and meningioma; the lymphopoiesis tissue tumor comprises lymphoma, leukemia and multiple myeloma; can also be used for treating malignant tumors including testicular cancer, malignant teratoma, malignant melanoma, etc.

The recombinant oncolytic adenovirus of the invention can be prepared by the following method:

b) Operably linking an RGD peptide coding gene into a coding region of HI loop of adenovirus backbone plasmid coding adenovirus fiber protein knob region, and performing RGD modification on the backbone plasmid;

In the present invention, the gene encoding RGD polypeptide may be inserted between 546T codon and 547P codon and/or between 581E codon and 582 stop codon of HI loop encoding gene of the fiber protein knob region of adenovirus backbone plasmid by homologous recombination method. Specifically, the backbone plasmid is prepared as follows:

(1) The adenovirus backbone vector pBHGfrtdele13FLP (abbreviated as pBHGFF) was co-transferred with pRedET (expressed recombinase) into DH10B bacteria to obtain a positive clone DH10B (pBHGFF+pRedET) for the purpose of obtaining a strain expressing the recombinase and containing the adenovirus backbone vector pBHGFF.

(2) L-arabinose is added into DH10B (pBHGFF+pRedeT) bacterial culture solution to induce expression of homologous recombinant enzyme and prepare competent cells, a resistance gene fragment PCR product with homologous arm and restriction enzyme sequence is transferred into the competent cells for recombination reaction, and after recovery and overnight culture, recombinant positive clone DH10B (pBHGFF-resistance gene) is obtained.

(3) And (3) carrying out restriction enzyme digestion on the obtained pBHGFF-resistance gene plasmid, carrying out Gibson recombination assembly reaction with RGD-4C nucleic acid fragment with a homology arm in vitro, then converting the recombination product into DH10B competence, resuscitating and overnight culturing to obtain positive clone DH10B (pBHGFF-RGD), wherein the step can be used for carrying out fixed-point traceless transformation on the RGD-4C insertion of an adenovirus vector to obtain the pBHGFF-RGD vector.

Specifically, the recombinant oncolytic adenovirus of the invention can be prepared by the following method:

1) Connecting the mhTERT promoter-E1A/E1B 19k sequence into a shuttle plasmid by a molecular cloning method to construct a recombinant shuttle plasmid;

2) The pBHGFF vector and pRedET are jointly transferred into DH10B, homologous arm, restriction enzyme and kana resistance gene fragment are transferred into DH10B containing the pBHGFF vector and pRedET, and kana resistance gene is inserted into HI loop region of pBHGF through recombination to form pBHGF-kana intermediate vector; after removing kana resistance gene by restriction enzyme cutting of the pBHGF-kana intermediate vector, recovering a large vector fragment, assembling the large vector fragment with a nucleic acid fragment containing a homology arm and RGD-4C gene by Gibson, transferring the large vector fragment into DH10B, and inserting the nucleic acid fragment of RGD-4C gene into the HI loop region of the pBHGFF vector by recombination to form a recombinant vector containing pBHGFF-RGD;

3) The recombinant shuttle plasmid and the recombinant pBHGFF-RGD are jointly transferred into HEK293 cells by using a transfection reagent, and the oncolytic adenovirus is packaged and marked as oncolytic adenovirus OAd-RGD.

The preparation and structure of OAd-RGD oncolytic adenoviruses described above can be seen in FIG. 14.

"Gene" or "coding sequence" refers to a nucleotide sequence or region of DNA or RNA that "encodes" a particular protein. When placed under the control of a suitable regulatory region, such as a promoter, the coding sequence (DNA) is transcribed (RNA) and translated into a polypeptide. A gene may also comprise several operably linked fragments, such as promoters, 5 'leader sequences, introns, coding sequences and 3' untranslated sequences, and may also comprise polyadenylation sites or signal sequences. Chimeric or recombinant genes are genes that are not normally found in nature, e.g., genes in which, e.g., the promoter is not naturally associated with part or all of the transcribed DNA region. "expression of a gene" refers to the process of transcription of a gene into RNA and/or translation into an active protein.

The process according to the invention is further illustrated by the following examples.

The main reagents used in the examples:

Anti-E1A antibodies were purchased from Santa Cruz Biotechnology.

Balb/cnude mice were purchased from Peking Vietnam laboratory animal technologies Inc.

Reverse transcription kit and SYBR dye detection kit used for RT-PCR were purchased from Nanjinouzan Biotechnology Co., ltd.

CCK8 detection reagent was purchased from MCE company.

The dual luciferase assay kit was purchased from Promega Corporation company.

Other reagents are imported or domestic analytically pure products.

Example one detection of mRNA expression of human telomerase reverse transcriptase in different human cells and mutation detection of hTERT promoter

The cells used in this example were human normal cells, human embryonic lung fibroblasts MRC-5 (ATCC: CCL-171) and human primary dermal fibroblasts PCS-201-010 (ATCC: PCS-201-010) ^TM ) Human tumor cells: glioblastoma cell U87MG (ATCC: HTB-14), melanoma A375 (ATCC: CRL-1619), lung cancer cell A549 (ATCC: CRM-CCL-185), breast cancer cell MCF-7 (ATCC: HTB-22), cervical cancer cell Hela (ATCC: CRM-CCL-2) and ovarian cancer cell SKOV3 (ATCC: HTB-77). Cells were harvested, total cellular RNA was extracted and reverse transcribed into cDNA, and expression of human telomerase reverse transcriptase was detected by RT-PCR, GAPDH as an internal reference.

The results show (FIG. 1) that human telomerase reverse transcriptase was hardly expressed in normal cells MRC-5 and PCS-201-010, whereas human telomerase reverse transcriptase was highly expressed in 6 tumor cells of different tumor origin.

Subsequently, tumor cells U87MG, A375, A549, MCF-7, hela and SKOV3 were collected, the cell genome was extracted, and the hTERT promoter nucleotide sequence was sequenced.

Experimental results show (fig. 2): in U87MG cells, the hTERT promoter has partial double mutation of C69T and C47T; in a375 cells, there is a C69T mutation; in other cells, the hTERT promoter is not mutated. It is thus considered whether these mutations can be applied to promoter optimization of oncolytic adenoviruses and improvement of oncolytic effects.

Example two preliminary optimization of hTERT promoter

1. Construction of the Point mutated hTERT promoter

In this example, the sequence of the +378 to +77 region of the hTERT promoter (from human chromosome 5, TERT 5' regulatory region, SEQ ID: NG_ 055467.1) was used, together with 455bp, and the sequence was designated hTERT WT (designated L-WT in FIG. 3) (SEQ ID No. 2) (see FIG. 3). By studying the sequence, a 181 bp-containing segment of-181- +77 was selected as a core region having strong promoter activity, and labeled as a 181-WT sequence (SEQ ID No. 1) (see FIG. 3). In FIG. 3 +1 represents nucleotide 1 of mRNA sequence, -1 st to 5' nucleotide of transcription initiation site. Both C69T (-69 nucleotide C) and C47T (-47 nucleotide C) indicate that the hTERT promoter sequence has a single cytosine C mutation to thymine T. DT shows that the sequence has double mutations of C.fwdarw.T at positions-47 and-69 as described above. The relevant nucleic acid sequences are shown in Table 1:

TABLE 1 various hTERT promoter nucleic acid sequences

/>

pGL3-basic plasmid (this plasmid is purchased from MicrobixBiosystems Inc) can be used for promoter activity detection, i.e.the region of the multiple cloning site is located upstream of the firefly luciferase gene. After pGL3-basic plasmid was digested with restriction enzymes XhoI and HindIII, the above-mentioned hTERTWT, 181-WT, 181-C69T, 181-C47T, 181-DT, L-C69T, L-C47T and L-DT fragments were ligated with the digested pGL3-basic plasmid, respectively, to construct pGL3-L-WT, pGL3-181-C69T, pGL3-181-C47T, pGL3-181-DT, pGL3-L-C69T, pGL3-L-C47T and pGL3-L-DT, and sequencing was correct.

2. Activity detection of hTERT point mutation promoter

pGL3-basic plasmid carries firefly luciferase gene and can be used for detecting the activity intensity of the promoter. 96-well plates were plated into each well of U87MG 1.5X10 respectively ⁴ Individual cells, 1.5X10 per well of A375 ⁴ Individual cells, MRC-5, PCS-201-010, A549, MCF-7, hela and SKOV3, 1X 10 each ⁴ The individual cells were cultured overnight at 37 ℃.

Packet (1) Control

(2) pGL3-basic (100 ng) +pRL-TK (internal plasmid 10 ng)

(3) pGL3-L-WT (100 ng) +pRL-TK (internal plasmid 10 ng)

(4) pGL3-L-C69T (100 ng) +pRL-TK (internal plasmid 10 ng)

(5) pGL3-L-C47T (100 ng) +pRL-TK (internal plasmid 10 ng)

(6) pGL3-L-DT (100 ng) +pRL-TK (internal plasmid 10 ng)

The plasmids in the above group were transfected into each cell using Lipofectamine 3000 for 24 hours, and then double fluorescence was detected. And (3) injection: pRL-TK is the HSV TK promoter which initiates expression of Renilla luciferase and pCMV-TK is the CMV promoter which initiates expression of Renilla luciferase. The reference plasmid used for MRC-5 and PCS-201-010 is pCMV-TK.

The results showed (as in FIG. 4) that in normal cells MRC-5 and PCS-201-010 cells, little firefly luciferase was detected. In tumor cells, compared with the L-WT sequence, the activity of the promoter of the double mutation of L-DT is obviously increased, which indicates that the activity of the promoter of hTERT WT after the double mutation (-378- +77) is obviously enhanced.

3. Promoter activity detection of hTERT point mutation core promoter element

Further detection of truncated 181bp corePromoter Activity of the core region of the promoter element 96 well plates were spread into each well of U87MG 1.5X10 respectively ⁴ Individual cells, 1.5X10 per well of A375 ⁴ Individual cells, MRC-5, PCS-201-010, A549, MCF-7, hela and SKOV3, 1X 10 each ⁴ The individual cells were cultured overnight at 37 ℃.

Packet (1) Control

(2) pGL3-basic (100 ng) +pRL-CMV (internal plasmid 5 ng)

(3) pGL3-L-WT (100 ng) +pRL-CMV (internal plasmid 5 ng)

(4) pGL3-181-WT (100 ng) +pRL-CMV (internal plasmid 5 ng)

(5) pGL3-181-C69T (100 ng) +pRL-CMV (internal plasmid 5 ng)

(6) pGL3-181-C47T (100 ng) +pRL-CMV (internal plasmid 5 ng)

(7) pGL3-181-DT (100 ng) +pRL-CMV (internal plasmid 5 ng)

The plasmids in the above group were transfected into each cell using Lipofectamine 3000 for 24 hours, and then double fluorescence was detected. And (3) injection: pCMV-TK is a CMV promoter that initiates expression of Renilla luciferase.

The results showed (as in FIG. 5) that in normal cells MRC-5 and PCS-201-010 cells, little firefly luciferase was detected. In tumor cells, compared with 181-WT sequence, the activity of the 181-DT double mutant promoter is obviously increased, which indicates that the activity of the 181bp core promoter element after double mutation is obviously enhanced.

4. Further optimization of hTERT double mutant promoters

The E2F-1 promoter is also reported in the art for oncolytic adenovirus therapy, capable of selective proliferation in Rb deficient cells. The E2F binding site on the E2F-1 promoter is a key site involved in the binding of the E2F-RB complex, and the nucleic acid sequence of the E2F binding site is:

TCGGCGGCTCGTGGCTCTTTCGCGGCAAAAAGGATTTGGCGCGTAAAAGTGG (SEQ ID No. 15). The invention contemplates that complexing it with the hTERT promoter may further enhance its activity by inserting E2F binding sites between-181 and-182 on an L-WT and L-DT basis to form E2F up, between +4 and +5 to form E2F down, and between both sites to form E2F up +down (see table 1 and fig. 3). After pGL3-basic plasmid was digested with restriction enzymes XhoI and HindIII, the fragments L-WT-E2F up, L-WT-E2F down, L-WT-E2Fup+down, L-DT-E2F up, L-DT-E2F down and L-DT-E2F up+down shown in FIG. 3 were ligated with the digested pGL3-basic plasmid to construct pGL3-L-WT-E2F up, pGL3-L-WT-E2F down, pGL3-L-WT-E2F up+down, pGL3-L-DT-E2F up, pGL3-L-DT-E2F down and pGL3-L-DT-E2F up+down, and the sequence was correct.

96-well plates were plated into each well of U87MG 1.5X10 respectively ⁴ Individual cells, 1.5X10 per well of A375 ⁴ Individual cells, MRC-5, PCS-201-010, A549, MCF-7, hela and SKOV3, 1X 10 each ⁴ The individual cells were cultured overnight at 37 ℃.

Grouping:

(1)Control

(2) pGL3-basic (100 ng) +pRL-TK (internal plasmid 10 ng)

(3) pGL3-L-WT (100 ng) +pRL-TK (internal plasmid 10 ng)

(4) pGL3-L-WT-E2F Down (100 ng) +pRL-TK (internal plasmid 10 ng)

(5) pGL3-L-WT-E2Fup (100 ng) +pRL-TK (internal plasmid 10 ng)

(6) pGL3-L-WT-E2Fup+Down (100 ng) +pRL-TK (internal plasmid 10 ng)

(7) pGL3-L-DT (100 ng) +pRL-TK (internal plasmid 10 ng)

(8) pGL3-L-DT-E2F Down (100 ng) +pRL-TK (internal plasmid 10 ng)

(9) pGL3-L-DT-E2Fup (100 ng) +pRL-TK (internal plasmid 10 ng)

(10) pGL3-L-DT-E2Fup+Down (100 ng) +pRL-TK (internal plasmid 10 ng)

The plasmids in the above group were transfected into each cell using Lipofectamine 3000 for 24 hours, and then double fluorescence was detected. The reference plasmid used for MRC-5 and PCS-201-010 was pCMV-TK 50ng, and the reference plasmid used for the remaining tumor cells was pRL-TK 10ng.

The results showed (as in FIG. 6) that in the normal cells MRC-5 and PCS-201-010, little firefly luciferase was detected, but Renilla luciferase could be detected. In tumor cells, compared with pGL3-L-DT sequence, pGL3-L-DT E2F down promoter activity is significantly increased, pGL3-L-DT-E2F down and pGL3-L-DT-E2Fup+down have no significant difference, so that L-DT-E2F down sequence is selected as the optimal promoter sequence in the subsequent experiment, and is marked as mhTRET, and 504bp (SEQ ID No. 12) is shared.

Example packaging and functional verification of Trioncolytic adenoviruses OAd-hTERT (hTERT promoter) and OAd-null (mhTERT promoter)

After the pDC316 plasmid was digested with restriction enzymes XbaI and HindIII, hTERT WT and mhTERT (optimal promoters L-DT-E2F Down (SEQ ID No. 12) in example III) were ligated into the digested pDC316 plasmid with E1A/E1B-19K necessary for adenovirus multiplication, respectively, to construct pDC316-hTERT and pDC316-mhTERT, and an EcoRI cleavage site was added between hTERT and E1A (for convenience of verification).

Transferring pDC316-hTERT and adenovirus skeleton plasmids pBHGlox (delta) E1 and 3Cre into HEK293 cells by using Lipofectamine 3000, and packaging the oncolytic adenovirus, namely oncolytic adenovirus OAd-hTERT; the oncolytic adenovirus packaging was also performed using Lipofectamine 3000 to transfer pDC316-mhTERT and adenovirus backbone plasmids pBHGlox (delta) E1,3Cre into HEK293 cells, labeled oncolytic adenovirus OAd-null.

The 6-well plates were plated into MRC-5, PCS-201-010, U87MG, A375, A549 and SKOV3 wells, respectively, 3X 10 each ⁵ The individual cells were cultured overnight at 37 ℃. The following day, a549 cells were infected with Ad-GFP (adenovirus expressing GFP protein), H101, OAd-hTERT and OAd-null, respectively, according to MOI (pfu) =64, the remaining cells according to MOI (pfu) =32. After 24h of infection, cell pellets were collected and the mRNA expression level and protein expression level of E1A were detected by RT-PCR and Western blot methods, respectively. H101 is a positive control oncolytic adenovirus (available from Shanghai three-dimensional Biotechnology Co., ltd.).

As shown in the results (FIG. 7RT-PCR detection and FIG. 8Western blot detection), mRNA and protein expression of E1A were hardly detected in the normal cells MRC-5 and PCS-201-010 cells. In tumor cells, mRNA and protein expression of E1A could be detected, and E1A was significantly up-regulated after OAd-null infection compared to H101 and OAd-hTERT, indicating that OAd-null proliferated efficiently in tumor cells and did not affect normal cells.

Example in vitro and in vivo detection of tumor killing Activity of tetraoncolytic adenoviruses OAd-hTERT and OAd-null

1. In vitro tumor killing activity detection

The 96-well plates were plated into MRC-5, PCS-201-010, U87MG, A375, A549 and SKOV3 wells, respectively, 3X 10 each ³ The individual cells were cultured overnight at 37 ℃. The following day, MRC-5, PCS-201-010, U87MG, A375 and A549 were infected with OAd-GFP (GFP protein after the hTERT WT promoter), H101, OAd-hTERT and OAd-null prepared in example four, respectively, according to MOI (pfu) =128, 256, 512, 1024, SKOV3 cells according to MOI (pfu) =31.25, 62.5, 250, 1000. The CCK8 method detects cell survival 3-6 days after infection.

The results showed (FIG. 9) that in normal cells MRC-5 and PCS-201-010 cells, the cell survival was better and there was no statistical difference in survival between groups. In contrast, H101 and OAd-hTERT are able to kill tumor cells effectively, whereas OAd-null kills tumor cells with the strongest activity compared to OAd-GFP, with statistical differences.

2. In vivo tumor killing Activity assay

(1) A375 tumor model: balb/c nude mice of 4 weeks size were inoculated subcutaneously 1X 10 ⁷ A375 cells, to a tumor volume of about 50-100mm ³ At the time of administration, the group is as follows:

(1) vehicle 50. Mu.L of sterile PBS;

(2) h101: each 1X 10 ⁷ pfu, volume 50 μl;

(3) OAd-null 1X 10 each ⁷ pfu, volume 50 μl;

the administration mode is as follows: the medicine is administered once every other day, 5 times and intratumorally. The tumor size of the mice was measured periodically.

(2) U87MG tumor model: balb/c nude mice of 4 weeks size were inoculated subcutaneously 2X 10 ⁶ U87MG cells to a tumor volume of about 50-100mm ³ At the time of administration, the group is as follows:

(1) vehicle 50. Mu.L of sterile PBS;

(2) OAd-null 1X 10 each ⁷ pfu, volume 50 μl;

the administration mode is as follows: once a week, 2 times total, intratumoral administration. The tumor size of the mice was measured periodically.

(3)SKOV3 tumor model: balb/c nude mice of 4 weeks size were inoculated subcutaneously 5X 10 ⁶ SKOV3 cells, for tumor volume up to about 50-100mm ³ At the time of administration, the group is as follows:

(1) vehicle 50. Mu.L of sterile PBS;

(2) OAd-null 1X 10 each ⁷ pfu, volume 50 μl;

From the results (fig. 10A), in the a375 tumor model, the tumor growth was faster in the veccle group, and H101 inhibited the tumor growth to some extent, with a tumor inhibition rate of 33% compared to veccle. Whereas OAd-null oncolytic adenovirus was effective in inhibiting tumor growth, tumor inhibition rate reached 77% and tumor regression occurred in 2 mice (symbol X indicated tumor regression). In the U87MG model (FIG. 10B), the tumor growth of the Vehicle group is also relatively quick, and compared with Vehicle, the OAd-null oncolytic adenovirus can effectively inhibit the tumor growth, and the tumor inhibition rate reaches 79 percent. In the SKOV3 model (fig. 10C), tumor growth was also relatively fast in the veccle group, and OAd-null oncolytic adenovirus was able to effectively inhibit tumor growth, up to 75% tumor inhibition, compared to veccle.

EXAMPLE five construction of oncolytic Virus OAd-RGD

1. Construction of recombinant shuttle plasmids

After the pDC516 plasmid was digested with restriction enzymes XbaI and HindIII, the mhTERT promoter and E1A/E1B-19K necessary for adenovirus proliferation were ligated into the digested pDC516 plasmid to construct pDC516-mhTERT.

2. Construction of RGD-containing backbone plasmid

(1) The adenovirus vector pBHGfrtdele13FLP (abbreviated as pBHGFF) was co-transferred with pRedET (expressed recombinant enzyme) into DH10B bacteria to obtain positive clone DH10B (pBHGFF+pRedET), in order to obtain a strain expressing recombinant enzyme and containing adenovirus vector pBHGFF.

(2) L-arabinose was added to DH10B (pBHGFF+pRedeT) bacterial culture to induce expression of homologous recombinant enzyme and prepare competent cells, and PCR products with two homology arms, restriction enzyme SgrDI and kanamycin (kana) resistance gene fragments were transferred thereto for recombination reaction, and after overnight cultivation after recovery, recombinant positive clone DH10B (pBHGFF-kana) was obtained (see FIG. 11 for a schematic diagram of recombination in this step).

(3) The pBHGFF-kana plasmid vector is extracted for SgrDI restriction endonuclease digestion, gibson recombination assembly reaction is carried out in vitro with RGD-4C nucleic acid fragment with homology arm, then the recombination product is transformed into DH10B competence, and is recovered and cultured overnight to obtain positive clone DH10B (pBHGFF-RGD), thus obtaining the traceless modification of RGD-4C insertion of adenovirus vector and obtaining the pBHGFF-RGD vector (the recombination schematic diagram in the step is shown in FIG. 12).

(4) pBHGFF-RGD was verified by EcoRV cleavage, and the results showed that the cleavage result was correct (FIG. 13)

3. Packaging of oncolytic adenoviruses, labeled oncolytic adenovirus OAd-RGD, was performed by transferring pDC516-mhTERT and pBHGFF-RGD into HEK293 cells using Lipofectamine 3000 (see FIG. 14 for packaging schematic).

Example in vitro tumor killing Activity assay of the Hexaoncolytic adenovirus OAd-RGD

The 96-well plates were plated into each of U87MG, A375, A549, SKOV3 and T98G wells by 3X 10, respectively ³ The individual cells were cultured overnight at 37 ℃. The following day, U87MG, A375, SKOV3 and T98G were infected with Ad-null (replication defective adenovirus, which is replication incompetent), OAd-null and OAd-RGD, respectively, according to MOI (pfu) =62.5, 125, 250 and 500, and A549 according to MOI (pfu) =125, 250, 500 and 1000. The CCK8 method detects cell survival 3-6 days after infection.

The results show (FIG. 15) that OAd-null is able to kill these 5 tumor cells effectively compared to Ad-null in tumor cells U87MG, A375, A549, SKOV3 and T98G. OAd-RGD has stronger tumor cell killing activity than OAd-null, and has statistical difference (p < 0.05).

Example seven oncolytic adenoviruses OAd-RGD in vivo tumor killing Activity assay

(1) PBS 50. Mu.L sterile PBS;

(2) OAd-null: each 1X 10 ⁷ pfu, volume 50 μl;

(3) OAd-RGD 1X 10 each ⁷ pfu, volume 50 μl;

the administration mode is as follows: oncolytic viruses were administered less frequently, once a week, 2 times total, intratumorally. The tumor size of the mice was measured periodically.

(1) PBS 50. Mu.L sterile PBS;

(2) OAd-null: each 5X 10 ⁶ pfu, volume 50 μl;

(3) OAd-RGD 5X 10 each ⁶ pfu, volume 50 μl;

From the results (fig. 16A), in the a375 tumor model, PBS group tumor growth was faster, and OAd-null significantly inhibited tumor growth (p < 0.05) compared to PBS with a tumor inhibition rate of 43.2%. The OAd-RGD oncolytic adenovirus has the most obvious tumor growth inhibition effect, and compared with PBS, the tumor inhibition rate is 77 percent (p < 0.001) which is extremely obvious. In the U87MG model (FIG. 16B), the tumor growth of the PBS group is relatively quick, and compared with PBS, the OAd-null oncolytic adenovirus can effectively inhibit the tumor growth (p < 0.05), and the tumor inhibition rate reaches 61.5 percent. While OAd-RGD significantly inhibits the growth of U87MG tumors, the tumor inhibition rate reaches 86.6% compared with PBS, and the tumor inhibition rate reaches 65.5% compared with OAd-null.

Other amino acid and nucleotide sequences useful in the present invention:

nucleotide sequence of SEQ ID No.16 (E1A (Delta 24):

Atgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgatcgatccacccagtgacgacgaggatgaagagggtgaggagtttgtgttagattatgtggagcaccccgggcacggttgcaggtcttgtcattatcaccggaggaatacgggggacccagatattatgtgttcgctttgctatatgaggacctgtggcatgtttgtctacagtaagtgaaaattatgggcagtgggtgatagagtggtgggtttggtgtggtaattttttttttaatttttacagttttgtggtttaaagaattttgtattgtgatttttttaaaaggtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagagaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataaggtgtaaacctgtgattgcgtgtgtggttaacgcctttgtttgctgaatgagttgatgtaagtttaataaagggtgagataatgttt

SEQ ID No.17 (nucleotide sequence of E1B 19K)

TatataatgcgccgtgggctaatcttggttacatctgacctcatggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggttttggaggtttctgtggggctcatcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagTgaagaaacccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggttgtgagacacaagaatcgcctgctactgttgtcttccgtccgcccggcgataataccgacggaggagcagcagcagcagcaggaggaagccaggcggcggcggcaggagcagagcccatggaacccgagagccggcctggaccctcgggaatga

SEQ ID No.18 (nucleotide sequence of E1ADelta24-E1B 19K):

atgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgatcgatccacccagtgacgacgaggatgaagagggtgaggagtttgtgttagattatgtggagcaccccgggcacggttgcaggtcttgtcattatcaccggaggaatacgggggacccagatattatgtgttcgctttgctatatgaggacctgtggcatgtttgtctacagtaagtgaaaattatgggcagtgggtgatagagtggtgggtttggtgtggtaattttttttttaatttttacagttttgtggtttaaagaattttgtattgtgatttttttaaaaggtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagagaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataaggtgtaaacctgtgattgcgtgtgtggttaacgcctttgtttgctgaatgagttgatgtaagtttaataaagggtgagataatgtttaacttgcatggcgtgttaaatggggcggggcttaaagggtatataatgcgccgtgggctaatcttggttacatctgacctcatggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctctaacagtacctcttggttttggaggtttctgtggggctcatcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcgcttttccaagagaaggtcatcaagactttggatttttccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaaggataaatggagTgaagaaacccatctgagcggggggtacctgctggattttctggccatgcatctgtggagagcggttgtgagacacaagaatcgcctgctactgttgtcttccgtccgcccggcgataataccgacggaggagcagcagcagcagcaggaggaagccaggcggcggcggcaggagcagagcccatggaacccgagagccggcctggaccctcgggaatga

SEQ ID No.19 (amino acid sequence of RGD peptide): CDCRGDCFC.

Claims

1. The recombinant oncolytic adenovirus is characterized in that:

a) The genome of the oncolytic adenovirus is replaced by an exogenous core promoter element or an exogenous promoter by the oncolytic adenovirus self E1 promoter so as to drive the E1A and/or E1B-19K gene expression;

b) Operably inserting a gene encoding an RGD peptide into the oncolytic adenovirus genome; the core promoter element of the exogenous promoter is as follows:

1) The nucleotide sequence is shown as SEQ ID No. 1;

or:

2. The recombinant oncolytic adenovirus according to claim 1, wherein: the nucleotide sequence of the core initiation element is shown in any one of SEQ ID No.3, SEQ ID No.4 or SEQ ID No. 5.

3. The recombinant oncolytic adenovirus of claim 2, wherein: the promoter comprises the core promoter element described in claim 1 or 2.

4. The recombinant oncolytic adenovirus of claim 3, wherein: the nucleotide sequence of the exogenous promoter is shown as SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8.

5. The recombinant oncolytic adenovirus according to claim 3 or 4, wherein: the promoter also has inserted therein at least one E2F binding site; further: the nucleotide sequence of the E2F binding site is shown as SEQ ID No. 15;

alternatively, the E2F binding site is a nucleic acid molecule having 1 or more base insertion, deletion and/or substitution mutations in the nucleotide sequence shown in SEQ ID No.15, and still function as an E2F binding site; further, the E2F binding site is inserted at the 5 'and/or 3' end of the core activating element.

6. The recombinant oncolytic adenovirus according to claim 5, wherein: the nucleotide sequence of the promoter is shown as SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13 or SEQ ID No. 14.

7. The recombinant oncolytic adenovirus according to any one of claims 1-6, wherein: the adenovirus is an adenovirus of which the serotype belongs to the subgenera A, subgenera B, subgenera C, subgenera D, subgenera E, subgenera F or subgenera G;

Further, the adenovirus is:

alternatively, selected from form 4 of the subgenera E,

alternatively, from the subgenera F, type 40 or 41;

alternatively, adenovirus type 52 selected from the subgenera G.

8. The recombinant oncolytic adenovirus according to any one of claims 1-7, wherein: the coding gene of the RGD peptide is inserted into the HI loop of the adenovirus fiber protein knob region; further, the coding gene of the RGD peptide is inserted between 546T and 547P codons in HI loop of the adenovirus fiber protein knob region and/or between 581E and 582 stop codons in HI loop of the fiber protein knob region.

9. The recombinant oncolytic adenovirus according to claim 8, wherein: the amino acid sequence of the RGD peptide is CDCRGDCFC.

10. The recombinant oncolytic adenovirus according to any one of claims 1-9, wherein: the E1A is E1A (Delta 24) deleted with 24bp in the middle, and the nucleotide sequence of the E1A is shown in SEQ ID No. 16; alternatively, the nucleotide sequence of the E1B19K is shown as SEQ ID No. 17; alternatively, the fragment containing the E1A and E1B-19K genes is E1A/E1B-19K, and the nucleotide sequence is shown as SEQ ID No. 18.

11. A host cell comprising a recombinant oncolytic adenovirus according to any one of claims 1-10; further, the host cell is a eukaryotic cell.

12. Use of a recombinant oncolytic adenovirus according to any one of claims 1-10 or a host cell according to claim 11 in the preparation of an anti-tumor medicament.

13. An antitumor drug characterized in that: is prepared by adding pharmaceutically acceptable auxiliary components to the recombinant oncolytic adenovirus of any one of claims 1-10 or the host cell of claim 11; further, the tumor is at least one of an epithelial tissue tumor, a mesenchymal tissue tumor, a nerve tissue tumor, a lymph and a hematopoietic tissue tumor, and further, any one of the following is satisfied:

the epithelial tissue tumor is at least one of papilloma, adenocarcinoma, cyst adenocarcinoma, mixed carcinoma, transitional epithelium carcinoma and basal cell carcinoma;

The mesenchymal tissue tumor is at least one of liposarcoma, leiomyosarcoma, fibrosarcoma, rhabdomyosarcoma, hemangiosarcoma, lymphangiosarcoma, osteosarcoma, chondrosarcoma, and synovial sarcoma;

the nerve tissue tumor is at least one of glioblastoma multiforme, myeloblastoma, malignant schwannoma, ganglioblastoma and meningioma;

the lymphocytic and hematopoietic tissue tumor is at least one of lymphoma, leukemia and multiple myeloma;

the other tumors are testicular cancer, malignant teratoma and malignant melanoma.

14. A method of preparing the recombinant oncolytic adenovirus of any one of claims 1-10:

15. The method according to claim 14, wherein: at least one of the following is satisfied:

Genes required for adenovirus proliferation are E1A and/or E1B-19K;

alternatively, the packaging cells are HEK293 and HEK293A cells.

16. The method according to any one of claims 14 or 15, wherein: the coding gene of RGD peptide is inserted between 546T codon and 547P codon in HI loop of adenovirus fiber protein knob region and/or between 581E codon and 582 stop codon in HI loop of fiber protein knob region.

17. The method according to claim 14, wherein: the backbone plasmid described in step b) is prepared as follows: