TW202207964A - Use ofrubus fruticosusextract for manufacturing a skincare composition - Google Patents

Abstract

The present disclosure provides a use ofRubus fruticosus extract for manufacturing a skincare composition, where the composition is used for reducing oxidative damage caused by reactive oxygen species in cells, reducing the amount of hemoglobin in skin, inhibiting melanin production, reducing skin redness spots, and enhance the skin's moisturizing ability.

Description

Use of dewberry extract in the preparation of a composition for conditioning the skin

This case concerns the use of a dewberry ( Rubus fruticosus ) extract, in particular the use of the dewberry extract for the preparation of a composition for conditioning the skin.

With environmental changes, the UV index and air pollution are becoming more and more serious. UV radiation in sunlight is the main cause of skin damage, aging, and tanning. Long-term exposure of the skin to the sun will even produce melanin, forming spots, which are difficult to fade away. In addition, ultraviolet radiation in sunlight can promote the production of reactive oxygen species (ROS, also known as free radicals) in skin cells, resulting in skin aging, loss of luster, dryness, and even redness.

In addition, skin cells gradually age with age, and the skin texture becomes rougher and wrinkles appear. Due to the slowing down of the metabolism of skin cells, the recovery speed of the skin becomes slower and slower. In addition, the long-term exposure to external environment such as air pollution Stimulation, accumulation of a large amount of reactive oxygen species and melanin, etc. cannot be completely metabolized in time, resulting in the inability to improve the skin condition.

Conventional cosmetics, skin care products and health foods are mostly made of chemical ingredients. Long-term use is not only harmful to human health, but also irritates sensitive skin and aggravates skin redness. In addition, the manufacturing process is harmful to the environment and the environment. The ecology is not friendly, causing environmental pollution, and even entering the ecosystem through the drainage system.

In order to solve the above problems, it is urgent for those skilled in the art to develop a skin conditioning composition with anti-ultraviolet rays, anti-oxidation, inhibiting melanin production, reducing skin red spots, soothing redness and improving skin moisturizing ability, so as to benefit the the majority of the population with this need.

In view of this, the purpose of the present invention is to provide the use of a dewberry ( Rubus fruticosus ) extract for preparing a composition for conditioning skin, wherein the composition is used for inhibiting the production of melanin and reducing red spots in the skin by reducing the amount of The expression level of melanin-related genes can inhibit melanin production, wherein the composition is used to reduce oxidative damage caused by reactive oxygen species in cells to achieve antioxidant effect, protect skin cells, achieve anti-oxidation, whitening and reduce skin red spots.

Another object of the present invention is to provide the use of a dewberry ( Rubus fruticosus ) extract for preparing a composition for conditioning skin, reducing the hemoglobin content of the skin, soothing the redness of the skin, improving the moisturizing ability of the skin, increasing the Skin radiance, delay skin aging.

Use of a dewberry ( Rubus fruticosus ) extract for preparing a composition for conditioning skin, wherein the dewberry extract is extracted with a water-containing solvent.

In some embodiments, the total polyphenol content of the Rubus fruticosus extract is between 8000 and 11000 ppm.

In some embodiments, the composition is used to reduce oxidative damage caused by reactive oxygen species in cells.

In some embodiments, the composition is used to reduce the hemoglobin content of the skin.

In some embodiments, the composition is used to inhibit melanin production.

In some embodiments, the composition is used to achieve the inhibition of melanogenesis by reducing the expression of melanin-related genes in the cells.

In some embodiments, the melanin-related genes include: tyrosinase-related protein-1 (TYRP1), tyrosinase (TYR), microphthalmia-related transcription factor (MITF), melanocortin receptor 1 ( MC1R).

In some embodiments, the composition is used to reduce skin red spots.

In some embodiments, the composition is used to enhance the moisturizing ability of the skin.

In some embodiments, the composition is used to increase the moisturizing ability of the skin by increasing the expression of moisturizing-related genes in cells.

In some embodiments, the composition is further prepared into a skin care product composition, a health food composition, a cosmetic composition or an external preparation for skin.

To sum up, the dewberry extract of any embodiment can inhibit the production of reactive oxygen species, reduce melanin-related genes in cells (for example: tyrosinase-related protein-1 (TYRP1), tyrosinase (TYR) ), microphthalmia-related transcription factor (MITF), and melanocortin receptor 1 (MC1R)) can inhibit the production of melanin, so dewberry extract can effectively prevent a variety of skin aging phenomena caused by ultraviolet rays, Achieve anti-oxidation, whitening and reduce skin red spots, provide skin protection against UV rays and blue light.

In addition, the dewberry extract reduces the skin's hemoglobin content, soothes the appearance of redness, and enhances the skin's moisturizing ability, increasing the skin's radiance.

Some specific implementation aspects of this case will be described below. Without departing from the spirit of this case, this case can still be practiced in many different forms, and the scope of protection should not be limited to the conditions specifically stated in the description.

The case used Excel software for statistical analysis. Data are presented as mean ± standard deviation (SD), and differences between groups were analyzed by Student's t-test.

The numerical values used herein are approximate, all experimental data are expressed within the range of plus or minus 10%, and the optimum is within the range of plus or minus 5%.

As used herein, the term "extract" refers to a product prepared by extraction. The extract may be presented as a solution in a solvent, or the extract may be presented as a concentrate or essence free or substantially free of solvent.

Dewberry (scientific name: Rubus fruticosus , also known as blackberry) is the fruit of a shrub of the genus Rubus in the Rosaceae family.

"Dewberry" as used herein generally refers to the fruit of a plant, wherein the fruit may comprise raw, dried or otherwise physically processed fruit to facilitate handling, which may further comprise whole, chopped, diced, milled, ground or Fruit otherwise processed to affect the size and physical integrity of the raw material.

In some embodiments, "dewberry extract" may be the juice of the fruit of dewberry extracted. For example, in some embodiments, the fruit of dewberry is obtained by crushing, squeezing and removing the pomace and finer suspended matter, and then concentrating it to a certain sugar content. In other embodiments, the dewberry extract may also be prepared during other procedures that do not substantially affect its efficacy as described herein, such as fermentation, for flavor enhancement or other uses.

In some embodiments, the "dewberry extract" can also be an extract obtained by extracting the fruit of dewberry using a suitable extraction solvent. For example, dewberry can be immersed in water for an appropriate time at room temperature for extraction, and then filtered to remove solid impurities to obtain dewberry fruit extract.

In some embodiments, the juice extracted from dewberry fruit (sometimes referred to as "dewberry extract") inhibits free radical production, reduces skin hemoglobin, inhibits melanin production, and reduces the number of red spots on the skin and enhances the skin's moisturizing ability. Thus, dewberry extract can be used to prepare a skin conditioning composition that inhibits free radical production, reduces the skin's hemoglobin content, inhibits melanin production, reduces the number of skin red spots, and enhances the skin's moisturizing ability.

In some embodiments, the aforementioned composition can be a pharmaceutical composition, a skin care product composition, a food composition, or a health food composition.

Pharmaceutical compositions can be manufactured in a dosage form suitable for enterally, parenterally or topically using techniques well known to those skilled in the art. For example, it can be: injection [eg, sterile aqueous solution or dispersion], sterile powder, external preparation, or the like.

The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier that is widely used in pharmaceutical manufacturing techniques. For example, a pharmaceutically acceptable carrier may contain one or more of the following carriers: emulsifier, suspending agent, decomposer, disintegrating agent, dispersing agent ), binding agent, excipient, stabilizing agent, chelating agent, diluent, gelling agent, preservative, Wetting agents, lubricants, absorption delaying agents, liposomes and the like. The choice and amount of these carriers are optional for those skilled in the art.

Taking the oral dosage form as an example, any suitable method can be used to provide the pharmaceutical composition in a dosage form suitable for oral administration, wherein, the liquid dosage form suitable for oral administration includes syrup, oral liquid, suspension, elixirs, etc., suitable for oral administration. Solid dosage forms for oral administration include powders, granules, buccal lozenges, sugar-coated lozenges, enteric-coated lozenges, chewable lozenges, foam lozenges, film-coated lozenges, capsules, and long-acting sustained-release lozenges. Any pharmaceutically acceptable carrier that does not adversely affect the desired benefits of the active ingredient (ie, Bifidobacterium lactis TCI604 and/or its metabolites) may be included in the pharmaceutical composition provided according to the present invention. By way of example, but not limitation, examples of pharmaceutically acceptable carriers for the aforementioned liquid dosage forms include: water, saline, dextrose, glycerol, ethanol or the like, oils (such as olive oil, castor oil, cottonseed oil, peanut oil, corn oil, and germ oil), glycerin, polyethylene glycol, and combinations of the foregoing; examples of pharmaceutically acceptable carriers for the foregoing solid dosage forms include: cellulose, starch, kaolin clay (kaolinite), bentonite (bentonite), sodium citrate, gelatin, agar, carboxymethyl cellulose, acacia, algin, glyceryl monostearate, calcium stearate, and combination of the foregoing.

In some embodiments, the pharmaceutically acceptable carrier may comprise one of the following solvents: water, normal saline, phosphate buffered saline (PBS), aqueous solution containing alcohol alcohol) and any other suitable solvent.

In some embodiments, the pharmaceutical composition can be administered by any of the parenteral routes described below: subcutaneous injection, intraepidermal injection, intradermal injection ) and intralesional injection.

In some embodiments, the pharmaceutical composition can be manufactured as an external preparation suitable for topical application to the skin using techniques well known to those skilled in the art. For example, it can be any of the following, but not limited to: emulsion, gel, ointment, cream, patch, liniment ( liniment), powder, aerosol, spray, lotion, serum, paste, foam, drop, suspension ( suspension, salve, and bandage.

In some embodiments, the topical formulation is prepared by admixing the pharmaceutical composition with a base well known to those skilled in the art.

In some embodiments, the substrate may contain one or more of the following additives: water, alcohols, glycols, hydrocarbons (such as petroleum, jelly) and white petrolatum (white petrolatum,)], waxes (such as paraffin and yellow wax), preserving agents, antioxidants (antioxidants), surfactants (surfactants), absorption enhancers ( absorption enhancers, stabilizing agents, gelling agents [such as carbopol® 974P, microcrystalline cellulose and carboxymethylcellulose], Active agents, humectants, odor absorbers, fragrances, pH adjusting agents, chelating agents, emulsifiers, occlusive agents occlusive agents, emollients, thickeners, solubilizing agents, penetration enhancers, anti-irritants, colorants and propellants (propellants) et al. The selection and quantity of these additives are within the professional and routine skills of those skilled in the art.

In some embodiments, the skin care product may contain an acceptable adjuvant that is widely used in skin care product manufacturing techniques. For example, the acceptable adjuvant may comprise one or more of the following adjuvants: solvents, gelling agents, active agents, preservatives, antioxidants, screening agents, chelating agents, surfactants, coloring agents agent), thickening agents, fillers, fragrances and odor absorbers. The selection and quantity of these reagents can be appropriately adjusted according to actual needs.

In some embodiments, the skin care product may be manufactured in a form suitable for skincare or makeup using techniques well known to those skilled in the art, which may be any of the following, but not limited thereto : Aqueous solution, aqueous-alcohol solution or oily solution, oil-in-water type, water-in-oil type) or combination emulsions, gels, ointments, creams, masks, patches, packs, liniments, powders, aerosols, sprays, lotions, serums, pastes, foams, Dispersion, drops, mousse, sunblock, sunscreen serum, sunscreen lotion, sunscreen spray, tonic water, foundation, makeup remover products, Soap and other body cleansing products, etc.

In one embodiment of the present invention, cosmetic compositions and personal care products are provided comprising a pigmented composition capable of exhibiting discoloration, such as a pigment grind comprising pigment particles in a carrier and a styrene-maleic anhydride copolymer. The cosmetic composition can be in the form of any cosmetic or personal care product that provides color to human skin. For example, the cosmetic composition may be, but is not limited to, a lipstick, lip gloss, moisturizing lipstick, nail polish, foundation, face powder, primer, concealer, blush, eye shadow, eyeliner, mascara, or bronzer. Personal care products can be in any suitable form for imparting color to human skin. For example, personal care products can include day creams or lotions, night creams or lotions, sunscreen lotions, creams or oils and other SPF products, moisturizers, ointments, ointments, gels, body lotions, artificial browning compositions, Hair removal etc.

The cosmetic compositions and personal care products of the present invention are applied to the human skin system, including skin, lips, nails, hair, and other keratinous surfaces. The term "keratinous surface" as used herein refers to the portion of the human skin system comprising keratin, including but not limited to mammalian, preferably human skin, lips, hair (including scalp, eyelashes, eyebrows, facial and body hair, and nails) (Toenails, nails, nail epithelium, etc.).

Cosmetic or personal care products capable of showing discoloration are applied to any area of the skin and preferably the face, neck, hands, feet or other areas of the body such as walls, legs and back.

In some embodiments, the skin care product may also be used in combination with one or more of the following known active external use agents: whitening agents [such as tretinoin, catechin] catechin, koji acid, arbutin and vitamin C], humectants, bactericides, ultraviolet absorbers, plant extracts [such as aloe extract] , skin nutrients, anesthetics, anti-acne agents, antipruritics, analgesics, antidermatitis agents, anti-hyperkeratosis antihyperkeratolytic agents, anti-dry skin agents, antipsoriatic agents, antiaging agents, antiwrinkle agents, antiseborrheic agents, Wound-healing agents, corticosteroids, and hormones. The selection and quantity of these topical preparations fall within the scope of the professionalism and routine skills of those skilled in the art.

In some embodiments, the pharmaceutical composition can be regarded as a food additive, which is added during the preparation of raw materials by conventional methods, or added during the production of food, and is formulated with any edible material. Made into food products for consumption by humans and non-human animals.

In some embodiments, the types of food products may be, but are not limited to, beverages, fermented foods, bakery products, health foods, and dietary supplements.

The pharmaceutical composition provided according to the present invention can be in any suitable form without special limitation, and is in a corresponding appropriate dosage form depending on the intended use; for example, but not limited thereto, the pharmaceutical composition The substance can be administered to an individual in need thereof by oral administration. Depending on the form of use and purpose, a pharmaceutically acceptable carrier can be selected to provide the pharmaceutical composition, wherein the carrier is well known to those skilled in the pharmaceutical technology, including excipients, diluents, adjuvants, and stabilizers , Absorption accelerator, disintegrating agent, solubilizer, emulsifier, antioxidant, binder, binder, tackifier, dispersant, suspending agent, lubricant, hygroscopic agent, etc.

The food composition provided according to the present invention can be a beverage, a solid food, or a semi-solid food, and can be provided in the form of health food, health food, functional food, nutritional supplement or special nutritional food. For example, but not limited to this, the food composition can be dairy products, processed meat products, bread, pasta, biscuits, ice products, lozenges, capsules, juices, teas, sparkling water, Alcoholic beverages, sports beverages, nutritional beverages, infant weaning food and other products. Preferably, the food composition is provided in the form of health food or health food.

In addition, depending on the usage form and requirements, any suitable food additives may be included in the food composition provided according to the present invention. Examples include, but are not limited to, preservatives, bactericides, antioxidants, bleaching agents, color retention agents, bulking agents, nutritional additives, coloring agents, flavoring agents (eg, sweeteners), thickening agents, binding agents , Food industry chemicals, emulsifiers, and quality improvement, brewing and food manufacturing agents.

The recommended usage amount, the usage standards and conditions of specific groups (for example: pregnant women, children, etc.), Or the recommendations for co-administration with other foods or medicines, so that users can take it by themselves without safety concerns without the guidance of doctors, pharmacists or relevant deacons.

Unless otherwise specified, the experimental steps in the following examples were carried out at room temperature (25±5°C) and normal pressure (1 atm).

[Example 1]: Preparation of extract of dewberry ( Rubus fruticosus )

First, the fruit of Rubus fruticosus (from Chile) was cut into 12mm size, and then the berries were homogenized and extracted with water, alcohol, hydrous alcohol or a combination thereof as the extraction solvent. , wherein the extraction temperature ranges from 75°C to 95°C, preferably 80°C to 90°C, and the volume ratio of the extraction solvent to the dewberry ranges from 5 to 20:1 to 5, preferably 5:1. The extraction temperature is within the range of 50°C to 100°C, preferably 80°C to 90°C. In this embodiment, the extraction time is 0.5 to 3 hours, preferably 1 hour.

After the dewberry extract obtained in the above extraction step is cooled to room temperature, it can be further centrifuged at 15°C to 25°C for 5 to 10 minutes at a speed of 800 to 1300 rpm to obtain a supernatant, which can be 400 mesh ( mesh) to remove residual solids. It is further concentrated under reduced pressure at 55°C to 65°C to obtain a concentrated product. In one embodiment, in order to obtain a solid dewberry extract, the dewberry extract concentrated under reduced pressure can be spray-dried to remove the solvent, thereby obtaining dewberry extract powder. In another embodiment, 2.5 g of the above-mentioned concentrated dewberry extract is added to 50 mL of water or beverage to obtain a dewberry extract drink with a concentration of 0.05 mg/mL. The sugar content of the dewberry extract drink is 0.05 mg/mL. is 5.0±0.3 °Bx.

[Example 2]: Detection of total flavonoids and total polyphenols in dewberry extract

The analytical method for the detection of total flavonoids mainly refers to the method described in Zhishen Jia et al., (1999), Food Chemistry, 64: 555-559 and modified, taking 200 μL of the properly diluted sample and adding 1000 μL of H ₂ O, After mixing evenly, 200 μL of 5% sodium citrate was added, and after standing for 6 minutes, 200 μL of 10% aluminum nitrate was added, and the mixture was left standing for 6 minutes. Finally, 2 mL of 4% sodium hydroxide and 1.4 mL of H ₂ O were added, mixed uniformly, and analyzed at 500 nm. A standard curve was drawn with Rutin as the standard. In this example, the total flavonoid content of the dewberry extract of Example 1 is between 1000 and 3000 ppm, preferably between 2000 and 3000 ppm, specifically 2248.9 ppm.

The analytical method for the detection of total polyphenol content is to dilute each sample 10 times with water and take 100 mL of it into a centrifuge tube. Next, 500 μL of Folin-Ciocalteu phenol reagent was added to the centrifuge tube, mixed with the diluted sample and allowed to stand for 3 minutes, and then 400 μL of 7.5% sodium carbonate was added and mixed for 30 minutes to obtain the reaction solution to be tested. After standing for the second time, 200 μL of the reaction solution to be tested was taken into a 96-well plate, and the absorbance of the reaction solution to be tested at 750 nm was measured. Then, a calibration curve was prepared using gallic acid as a standard. In this example, the total polyphenol content of the dewberry extract of Example 1 is between 8000 and 11000 ppm, preferably between 9000 and 10000 ppm, specifically 9364.6 ppm.

[Example 3]: Cell Experiment - Dewberry Extract Inhibits Reactive Oxygen Species (ROS) Generation

Here, the fluorescent probe DCFH-DA was used in conjunction with flow cytometry to determine the changes in the content of reactive oxygen species in human dermal fibroblasts CCD-966sk treated with the dewberry extract composition.

Materials and Instruments 1. Cell line: human skin fibroblasts CCD-966sk (Biological Resources Conservation and Research Center (BCRC), No. 60153), hereinafter referred to as CCD-966sk cells. 2. Medium: basal medium containing 10 vol% FBS (fetal bovine serum, purchased from Gibco). Among them, the basal medium is Eagle's minimum essential medium (Eagle's minimum essential medium (MEM), purchased from Gibco, product number 15188-319) additionally added components to make it contain 1 mM sodium pyruvate (sodium pyruvate, purchased from Gibco), 1.5 g/L sodium bicarbonate (purchased from Sigma) and 0.1 mM non-essential amino acid solution (purchased from Gibco) were prepared. 3. Phosphate-buffered saline solution (PBS solution): purchased from Gibco, product number 10437-028. 4. DCFH-DA solution: Dissolve dichlorodihydrofluorescein diacetate (2,7-dichloro-dihydro-fluorescein diacetate, DCFH-DA; product number SI-D6883, purchased from Sigma) in dimethyl dimethyl sulfoxide (DMSO, purchased from Sigma, product number SI-D6883-50MG) to prepare a 5 mg/mL solution of DCFH-DA. 5. Flow cytometry, Beckman, Catalog No. 660519. 6. Hydrogen peroxide (H ₂ O ₂ ): purchased from Sigma-Aldrich, product number 95299-1L. 7. Trypsin (Trypsin-EDTA): 10X Trypsin-EDTA (purchased from Gibco) was diluted 10 times in 1X PBS solution. 8. Dewberry Extract: The dewberry extract used in this experiment was obtained through Example 1 above.

Experimental Procedures The experiment will be divided into an experimental group, a blank control group (group without dewberry extract, and without hydrogen peroxide treatment), and a control group (group without dewberry extract, but treated with hydrogen peroxide) Three groups were carried out, and each group was carried out in duplicate experiments: 1. CCD-966sk cells were seeded in a 6-well culture dish containing 2 mL of medium in each well in the form of 1×10 ⁵ cells per well. 2. Incubate the plate in 5% CO ₂ at 37°C for 24 hours. 3. Remove the medium. 4. Add 2 mL of experimental medium to each well of the culture plate and incubate at 37 °C for 1 hour. The experimental medium of the experimental group was 2 mL of cell culture medium supplemented with 5 μL of dewberry extract (that is, the volume percentage of dewberry extract in the cell culture medium was 0.25%). The experimental medium of the control group was simple 2 mL cell culture medium (ie, without dewberry extract). The experimental medium of the control group was simply 2 mL of cell culture medium (ie, without dewberry extract). 5. Add 2 μL of DCFH-DA solution at a concentration of 5 μg/mL to the cell culture medium in each well, and let DCFH-DA treat the cells for 15 minutes. 6. After DCFH-DA treatment, add H ₂ O ₂ to the experimental medium of the experimental group and the experimental medium of the control group, respectively, and react at 37 °C for 1 hour. Specifically, 35% wt hydrogen peroxide was first diluted to 100 mM (10 μL of hydrogen peroxide was added to 990 μL of double distilled water), and then 20 μL of 100 mM hydrogen peroxide was added to a 2 mL cell culture dish. 7. After the reaction, rinse each well twice with 1 mL of 1X PBS solution. 8. Add 200 μL trypsin to each well and react in the dark for 5 minutes. After the reaction, add 6 mL of cell culture medium to stop the reaction. 9. Collect the cells and cell culture medium in each well into a corresponding 1.5 mL centrifuge tube, and centrifuge the centrifuge tube containing the cells and culture medium at 400 x g for 10 minutes. 10. After centrifugation, remove the supernatant and re-lyse the cell pellet with 1X PBS solution. 11. Centrifuge again at 400 x g for 10 minutes. 12. After centrifugation, remove the supernatant and resuspend the cells with 1 mL of 1X PBS solution in the dark to obtain the cell solution to be tested. 13. Use a flow cytometer to detect the fluorescent signal of DCFH-DA in the cell fluid to be tested in each well. The excitation wavelength for fluorescence detection is 450-490 nm, and the emission wavelength is 510-550 nm. Since DCFH-DA enters cells, it will first be hydrolyzed to DCFH (dichlorodihydrofluorescein), and then oxidized by reactive oxygen species to DCF (dichloroluciferin) that emits green fluorescence, which is treated by DCFH-DA. The fluorescence intensity of the cells can reflect the content of reactive oxygen species in the cells, and thus the ratio of the number of cells with high expression of reactive oxygen species in the cells to the original number of cells can be known. Since the experiment was performed in duplicate, the measurement results of the duplicate experiments in each group were averaged to obtain an average value, and then the average value of the control group was taken as 100% of the relative ROS generation amount, and the average value of the control group and the experimental group was calculated. The values were converted to relative ROS generation, as shown in Figure 1.

Experimental results

As shown in Figure 1, comparing the results of the control group and the control group, it can be seen that after hydrogen peroxide treatment, the relative generation of ROS will be greatly increased by about 280% through high fluorescence performance; it shows that hydrogen peroxide treatment will indeed lead to intracellular production of reactive oxygen species Substances, which in turn cause subsequent damage to skin fibroblasts. On the other hand, according to the results of comparing the control group and the experimental group, when the cells were treated with dewberry extract, the relative ROS generation was significantly reduced by about 29%, even lower than the control group; it shows that dewberry extract can effectively Reduce the production or accumulation of reactive oxygen species in cells. In other words, dewberry extract acts as a reactive oxygen species scavenger. That is, dewberry extract can reduce the oxidative damage caused by reactive oxygen species in cells by reducing the content of reactive oxygen species in cells.

[Example 4] Cell experiment - dewberry extract enhances the expression of moisturizing genes

In this example, RNA extraction kit, reverse transcriptase, KAPA SYBR® FAST qPCR reagent kit and quantitative PCR instrument are used. Please refer to Example 3 for the experimental method. genetic changes.

For example, moisturizing related genes are KRT10 gene (Gene ID: 3858), KRT1 gene (Gene ID: 3848) and SMPD1 gene (Gene ID: 6609).

Among them, keratin 10 (keratin 10, KRT10) and keratin 1 (keratin 1, KRT1) are responsible for encoding keratin, the main constituent of the skin, while sphingomyelin phosphodiesterase (Sphingomyelin Phosphodiesterase 1, SMPD1), tyramine Tyrosinase related protein-1 (TYRP1) is responsible for encoding sphingomyelin phosphodiesterase, which converts sphingomyelin to ceramide.

Materials and Instruments 1. Cell line: Cell line: Human primary epidermal keratinocytes (Human primary epidermal keratinocytes) (CELLnTEC (Switzerland), HPEK-50). 2. Medium: Keratinocyte-SFM (purchased from Thermo, No. 17005042). 3. RNA extraction reagent kit (purchased from Geneaid, Taiwan, Lot No. FC24015-G). 4. SuperScript® III Reverse Transcriptase (Invitrogen, USA, No. 18080-051). 5. Measure target gene primers, including SRD5A1 gene, SRD5A2 gene, AR gene, KROX20 gene, SCF gene, VEGF gene, IGF1 gene, TGF-B gene, and internal control group (TBP gene). 6. KAPA SYBR® FAST qPCR reagent set (purchased from Sigma Company, USA, No. 38220000000). 7. ABI StepOnePlusTM real-time PCR system (ABI StepOnePlusTM Real-Time PCR system (Thermo Fisher Scientific, USA)). 8. Dewberry Extract: The dewberry extract used in this experiment was obtained through Example 1 above.

Experimental procedure

First, take 1.5x105 human primary skin keratinocytes into a six-well cell culture dish containing 2 ml of the above-mentioned medium in each well, and culture at 37°C for 24 hours. The cultured primary human skin keratinocytes in each well are based on the following test conditions Divided into control group and experimental group (two groups in total) to deal with the human primary skin keratinocytes cultured in each well.

Test Conditions

In the control group, 2 ml of culture medium was used to culture primary human skin keratinocytes, and no other supplements were added. In the experimental group, 2 mL of the culture medium with a concentration of 0.25 mg/mL of the dewberry extract prepared in the above example was used to culture primary human skin keratinocytes for 24 hours, and each group was repeated three times.

The treated primary human skin keratinocytes (ie, the control group and the experimental group) were broken into cell membranes with cell lysate to form two groups of cell solutions. Next, the RNAs in the four groups of cell solutions were extracted with RNA extraction reagent kits (purchased from Geneaid, Taiwan, Lot No. FC24015-G). Next, 1000 nanograms (ng) of the extracted RNA was used as a template for each group, and the extracted RNA was reverse transcribed into the corresponding cDNA by SuperScript ^® III reverse transcriptase (purchased from Invitrogene, USA, No. 18080-051). . Then by ABI StepOnePlus ^TM real-time PCR system (ABI StepOnePlus ^TM Real-Time PCR system (Thermo Fisher Scientific Company, USA)), KAPA SYBR FAST (purchased from Sigma Company, USA, No. 38220000000) and the primers (SEQ ID) of Table 1 NO: 1~8) Quantitative real-time reverse transcription polymerase chain reaction was performed on the cDNAs of the two groups to observe the KRT10 gene, KRT1 gene and SMPD1 in the primary human skin keratinocytes of the two groups gene expression. The instrument setting conditions for quantitative real-time reverse transcription polymerase chain reaction were 95°C for 20 s, followed by 95°C for 3 s, 60°C for 30 s, and repeated 40 cycles, and the 2-ΔCt method was used to perform gene Quantitative. Here, quantitative real-time reverse transcription polymerase chain reaction with cDNA can indirectly quantify the mRNA expression levels of KRT10 gene, KRT1 gene and SMPD1 gene, and then infer the expression levels of proteins encoded by KRT10 gene, KRT1 gene and SMPD1 gene. [Table 1]: Introductory name serial number primer sequence KRT10-F SEQ ID NO: 1 TCCTACTTGGACAAAGTTCGGG KRT10-R SEQ ID NO: 2 CCCCTGATGTGAGTTGCCA KRT1-F SEQ ID NO: 3 AGAGTGGACCAACTGAAGAGT KRT1-R SEQ ID NO: 4 ATTCTCTGCATTTGTCCGCTT SMPD1-F SEQ ID NO: 5 CTGACTCTCGGGTTCTCTGG SMPD1-R SEQ ID NO: 6 TCCACCATGTCATCCTCAAA TBP-F SEQ ID NO: 7 TATAATCCCAAGCGGTTTGC TBP-R SEQ ID NO: 8 GCTGGAAAACCCAACTTCTG

*F is FORWARD forward direction, R is REVERSE reverse direction.

It should be noted that the relative gene expression of KRT10 gene, KRT1 gene and SMPD1 gene shown in the figures described below is presented in relative magnification, wherein the standard deviation is calculated using the STDEV formula of Excel software, and is expressed in Excel software as A one-tailed Student t-test was used to analyze whether there were statistically significant differences. In the graph, "*" represents a p-value less than 0.05, "**" represents a p-value less than 0.01, and "***" represents a p-value less than 0.001. The more "*", the more significant the statistical difference.

See Figure 2. The expression level of the TBP gene in the control group was regarded as 1-fold, the expression level of the KRT10 gene in the experimental group was 31.6 times that of the control group, the expression level of the KRT1 gene in the experimental group was 34.7 times that of the control group, and the expression level of the experimental group was 34.7 times compared with that of the control group. The expression level of the SMPD1 gene in the control group was 9.9-fold. It can be seen that when human melanoma cells were treated with 0.25mg/mL dewberry extract, the KRT10 gene and KRT1 gene were positively correlated with the formation of keratin, and there was a natural moisturizing factor NMF in keratin. Lessen, resist the invasion of external stimuli, protect the dermis, and avoid skin damage and inflammation. The results are shown in FIG. 2 , the dewberry extract of the present invention can enhance the gene expression of moisturizing genes (KRT10 gene, KRT1 gene and SMPD1 gene) in cells, so that the dewberry extract has a moisturizing effect on the skin.

[Example 5] Cell Experiment - Dewberry Extract Reduces Expression of Melanin Gene

In this example, RNA extraction kit, reverse transcriptase, KAPA SYBR® FAST qPCR reagent kit and quantitative PCR instrument were used to measure the changes of whitening genes in human melanoma cells after treatment with dewberry extract.

For example, the melanin-related genes are TYR gene (Gene ID: 7299), TYRP1 gene (Gene ID: 7306), MITF gene (Gene ID: 4286), and MC1R gene (Gene ID: 4157).

Among them, microphthalamia-associated transcription factor (MITF) is a transcription factor required for the development of normal skin melanocytes, which can regulate the gene expression of several other proteins involved in melanin formation, such as tyrosinase (tyrosinase, TYR), tyrosinase related protein-1 (tyrosinase related protein-1, TYRP1) and other genes expression. Melanocortin 1-receptor (MC1R) gene is a key gene in the process of melanin synthesis in human skin.

Therefore, in this example, TYR gene, TYRP1 gene, MITF gene and MC1R gene are used as the analysis targets.

Materials and Instruments 1. Cell line: human melanoma cell (human melanoma cell) A375.S2 (ATCC, number CRL-1872). 2. Medium: containing 10% fetal bovine serum (FBS) (GIBCO, No. 10438-026, USA), 1% Antibiotic-Antimycotic (Gibco, No. 15240-062) , 1 mM sodium pyruvate (Gibco company, No. 11360-070) in MEM-NAA medium (Gibco company, No. 41500-03). 3. RNA extraction reagent kit (purchased from Geneaid, Taiwan, Lot No. FC24015-G). 4. SuperScript® III Reverse Transcriptase (Invitrogen, USA, No. 18080-051). 5. Measure the target gene primers, including TYRP1 gene, TYR gene, MITF gene and MC1R gene, and also include the internal control group (GAPDH gene). 6. KAPA SYBR® FAST qPCR reagent set (purchased from Sigma Company, USA, No. 38220000000). 7. ABI StepOnePlusTM real-time PCR system (ABI StepOnePlusTM Real-Time PCR system (Thermo Fisher Scientific, USA)). 8. Dewberry Extract: The dewberry extract used in this experiment was obtained through Example 1 above.

Experimental procedure

First, take 1.5x105 human melanoma cells into a six-well cell culture dish containing 2 ml of the above-mentioned medium in each well and culture at 37°C for 24 hours, and divide the cultured human melanoma cells into each well according to the following test conditions. The control group and the experimental group (two groups in total) were used to treat the cultured human melanoma cells in each well.

Test Conditions:

The experimental control group simply used 2 ml of culture medium to culture human melanoma cells without adding other supplementary ingredients. In the experimental group, human melanoma cells were cultured for 24 hours with 2 mL of the culture medium with a concentration of 0.125 mg/mL of the dewberry extract prepared in the above example.

The treated human melanoma cells (ie, the control group and the experimental group) were divided into cell membranes with cell lysate to form two groups of cell solutions. Next, the RNAs in the four groups of cell solutions were extracted with RNA extraction reagent kits (purchased from Geneaid, Taiwan, Lot No. FC24015-G). Next, 1000 nanograms (ng) of the extracted RNA was used as a template for each group, and the extracted RNA was reverse transcribed into the corresponding cDNA by SuperScript® III reverse transcriptase (purchased from Invitrogene, USA, No. 18080-051). . Then by ABI StepOnePlusTM real-time PCR system (ABI StepOnePlusTM Real-Time PCR system (Thermo Fisher Scientific Company, USA)), KAPA SYBR FAST (purchased from Sigma Company, USA, No. 38220000000) and the primers in Table 2 (SEQ ID NO: 9~18) Quantitative real-time reverse transcription polymerase chain reaction was performed on the cDNA of each group to observe the TYRP1 gene, TYR gene, MITF gene and MC1R in human melanoma cells of the three groups gene expression. The instrument setting conditions for quantitative real-time reverse transcription polymerase chain reaction were 95°C for 20 s, followed by 95°C for 3 s, 60°C for 30 s, and repeated 40 cycles, and the 2-ΔCt method was used to perform gene Quantitative. Here, quantitative real-time reverse transcription polymerase chain reaction with cDNA can indirectly quantify the mRNA expression levels of TYRP1 gene, TYR gene, MITF gene and MC1R gene, and then infer the proteins encoded by TYRP1 gene, TYR gene, MITF gene and MC1R gene. performance. [Table 2]: Introductory name serial number primer sequence TYRP1-F SEQ ID NO: 9 GACACGCCTCCTTTTTATTCCA TYRP1-R SEQ ID NO: 10 ATGGGTTTGTCCCCCTGTTC TYR-F SEQ ID NO: 11 CTCAAAGCAGCATGCACAAT TYR-R SEQ ID NO: 12 GCCCAGATCTTTGGATGAAA MITF-F SEQ ID NO: 13 GCCTCCAAGCCTCCGATAAG MITF-R SEQ ID NO: 14 GCACTCTCTGTTGCATGAACT MC1R-F SEQ ID NO: 15 CATCATCGACCCCCTCATCTAC MC1R-R SEQ ID NO: 16 CAGGAACCAGACCACACAATATCA GAPDH-F SEQ ID NO: 17 CTGGGCTACACTGAGCACC GAPDH-R SEQ ID NO: 18 AAGTGGTCGTTGAGGGCAATG *F is FORWARD forward, R is REVERSE reverse.

It should be noted that the relative gene expression of TYR gene, TYRP1 gene, MITF gene and MC1R gene shown in the diagrams described below are presented in relative magnifications. A one-tailed Student t-test was used to analyze statistically significant differences in software. In the graph, "*" represents a p-value less than 0.05, "**" represents a p-value less than 0.01, and "***" represents a p-value less than 0.001. The more "*", the more significant the statistical difference.

See Figure 3. Taking the expression level of GAPDH gene in the control group as 1, the expression level of the TYR gene in the experimental group relative to the control group was 0.12 times, the expression level of the TYRP1 gene in the experimental group relative to the control group was 0.86 times, and the expression amount of the experimental group relative to the control group was 0.86 times. The expression level of the MITF gene in the experimental group was 0.75 times that of the control group, and the expression level of the MC1R gene in the experimental group was 0.65 times that of the control group. Compared with the control group, the expression level of the gene was reduced by 14%, the expression level of the MITF gene in the experimental group was reduced by 25% compared with the control group, and the expression level of the MC1R gene in the experimental group was reduced by 35% compared with the control group. It can be seen that when human melanoma cells are treated with 0.125 mg/mL dewberry extract, since MC1R and MITF genes are positively correlated with melanin formation, the results are shown in Figure 3, the dewberry extract of the present invention can inhibit the The gene expression of TYR gene, TYRP1 gene, MC1R gene, and MITF gene in melanoma cells makes dewberry extract have inhibitory effect on melanin formation.

[Example 6] Cell Experiment - Dewberry Extract Reduces Melanin Production

Here, the changes of the melanin content of the melanoma cell line B16F10 after being treated with the dewberry extract were measured by an enzyme-linked immunosorbent assay reader.

Materials and Instruments 1. Cell line: mouse melanoma cell B16F10, purchased from American Type Culture Collection (American Type CμLture Collection, ATCC®, No. 6475), hereinafter referred to as B16F10 cells. 2. Medium: Dulbecco's modified minimal essential medium (DMEM, purchased from Gibco, Cat. 12100-038) was added with additional components to contain 1 vol% of an antibiotic solution (Antibiotic Antimycotic Solution, purchased from Gibco, 15240-062) and 10 vol% of FBS (fetal bovine Serum, available from Gibco, 10437-028). 3. Phosphate-buffered saline solution (PBS solution): purchased from Gibco, product number 10437-028. 4. Prepare a solution of 1N NaOH (available from Sigma, Prod. No. 221465) in double distilled water. 5. ELISA reader (purchased from BioTek, product number FLx 800). 6. Dewberry Extract: The dewberry extract used in this experiment was obtained through Example 1 above.

Experimental procedure

The experiment will be divided into three groups: the experimental group, the control group and the control group. Each group will carry out three replicate experiments: 1. B16F10 cells are inoculated into 6 cells containing 3 mL of medium in each well in the form of 1.5×10 ⁵ cells per well. well in the culture dish. 2. Incubate the plate in 5% CO ₂ at 37°C for 24 hours. 3. Then, without disturbing the attached cells, remove the medium from each well. 4. This experiment is divided into control group, control group and experimental group. Among them, 2 mL of fresh DMEM medium was added to each group. The culture medium of the control group was additionally added with Kojic acid at a concentration of 0.25 mg/mL, of which kojic acid has been widely recognized as a substance that has the effect of reducing the production of melanin; the culture medium of the experimental group was additionally added with dewberry extract substance to a concentration of 0.25 mg/mL. Groups were replicated in triplicate and incubated at 37°C for 24 hours. 5. Move the experimental group and the control group after the reaction to a blue light box, and let them receive blue light irradiation at room temperature (25±5℃) for 3 hours. Additionally, the control group was moved to a dark room and allowed to stand at room temperature for 3 hours. 6. After the reaction, the cells were incubated at 37°C for 48 hours. 7. Then, remove the medium and wash the cells twice with PBS solution. 8. Add 200 μl trypsin (Trypsin-EDTA (10X), available from Gibco; Product No. 15400-054) to each well for 3 minutes. After the reaction, 6 mL of medium solution was added to stop the reaction. Then, the suspended cells and medium in each well were collected into corresponding 15 mL centrifuge tubes, and each centrifuge tube was centrifuged at 400 x g for 5 minutes to pellet the cells. 9. After washing the pelleted cells twice with PBS, resuspend the cells with 200 μL of PBS. 10. Freeze the cell suspension in liquid nitrogen for 10 minutes and allow to thaw completely at room temperature for about 30 minutes. 11. After complete thawing, centrifuge the tube at 12,000g for 3 minutes. 12. Remove the supernatant, resuspend the cell pellet with 120 μL of 1N sodium hydroxide solution, and dry the test tube at 60°C for 1 hour to obtain the sample to be tested. 13. Transfer 100 μL of the sample to be tested into a 96-well plate, and use an ELISA plate reader to measure the absorbance of the cell solution at 450 nm.

Experimental results

The relative expression of melanin in the experimental group and the control group was calculated according to the following formula: relative expression of melanin (%)=(OD ₄₅₀ value of each group/OD ₄₅₀ value of control group)×100%. Since the experiment was performed in triplicate, the results of the triplicate experiments were averaged and shown in Figure 4 .

As shown in FIG. 4 , under the treatment of the dewberry extract of the present invention, the effect of reducing the production of melanin can be achieved. Specifically, the production of melanin in the experimental group (dewberry extract) was 78.81% relative to the control group, and the production of melanin in the control group relative to the control group was 67.42%. Compared with the control group, the production of melanin in the experimental group was reduced by about 21.19%. And the effect of the dewberry extract in this case is similar to the effect of koji acid in reducing the production of melanin. Therefore, the dewberry extract prepared in the embodiment of the present invention can indeed effectively reduce the melanin produced by melanocytes, so it can be used in the components of related compositions for reducing skin dark spots, enhancing skin luster, and whitening skin.

It can be seen from the above multiple cell experiments that dewberry extract can indeed reduce the production of reactive oxygen species (ROS) in skin fibroblasts and prevent skin damage caused by ultraviolet rays. And dewberry extract can reduce the expression of melanin-related genes (TYRP1 gene, MC1R gene, MITF gene), and inhibit melanin production, reduce skin dark spots caused by blue light, and maintain fair skin.

In order to confirm the efficacy of wild dewberry extract on the human body, relevant human experiments are also carried out as follows.

[Example 7] Detection of relative amount of skin ultraviolet red spots (UV spots)

The facial skin is photographed with UV light of the VISIA Complexion Analysis System (Canfield scientific, USA). UV light can be absorbed by melanin, improve the visibility of pigmented spots, and detect melanin spots in the epidermis that are invisible to the naked eye. The higher the measured value, the more UV stains.

The dewberry extract of the present case and water were formulated into dewberry extract drinks to provide subjects with a suitable effective dose. In this example, 7 subjects (general men and women aged 20-65 years) were asked to drink the prepared drink at the daily intake of one bottle of dewberry extract drink (50 mL) with a concentration of 0.005 mg/mL. Dewberry Extract Drink for 8 weeks. And before the start of the experiment (the 0th week, not drinking), the 4th week and the 8th week, the subject's cleansed facial skin was tested with a full-face skin quality detector (7th Generation VISIA Complexion Analysis System; Canfield, USA ) to determine the number and area of red spots on the whole face skin of these subjects.

The number of red spots on the subject's skin and the actual change in appearance are shown in Fig. 5A and Fig. 5B, respectively. Figure 5A shows that before the subject ingests the dewberry extract drink, the value measured by the instrument according to the number and area of red spots is 100%, and records the subjects ingesting the dewberry extract drink for 4 weeks and 8 weeks after the drink. Measured based on the number/area of red spots. FIG. 5B is an image of the facial skin of one of the subjects taken by the detector in the 0th week, the 4th week and the 8th week.

As shown in Figure 5A, when the subjects ingested the dewberry extract drink for 4 weeks, they could start to observe a reduction in the number/area of red spots. After 4 weeks of continuous intake, the number of red spots on the facial skin decreased to the original level 2.4%, and after 8 weeks of continuous intake, the number of red spots on the facial skin dropped to 4.1% of the original. It can also be found in the real-shot image in Figure 5B that with the increase of the period of ingestion of the dewberry extract drink, the number and area of red spots on the skin were significantly reduced, and the number of people improved by 86%, which has the effect of resisting the formation of pigmentation spots.

[Example 8] Detection of the relative amount of hemoglobin in skin redness

The facial skin of the subject in the above Example 7 was photographed with the RBX polarized light technology of the VISIA Complexion Analysis System (Canfield scientific, USA), and blood vessels or hemoglobin in the deep layers of the skin were detected. The higher the measurement value, the more severe the redness of the skin.

As shown in Figure 6A, when the subjects ingested the dewberry extract drink for 4 weeks, the relative amount of hemoglobin was reduced. After 4 weeks of continuous intake, the hemoglobin index of the facial skin dropped to 7.4% of the original , and after 8 weeks of continuous intake, the hemoglobin index of the facial skin dropped to 9.3% of the original. It can also be found in the real-shot image in FIG. 6B that with the increase of the period of ingestion of the dewberry extract drink, the hemoglobin index on the skin is significantly reduced, and the number of people improved by 100%. The result shows that the dewberry extract drink of the present invention is effective. Improve individual skin redness, maintain stable skin health, and have good skin soothing effects.

[Example 9] Detection of skin gloss

The skin glossiness detection probe Glossymeter GL200 (C+K Multi Probe Adapter System, Germany) was reflected by direct reflection and scattered reflection of light irradiated to the skin surface of the subject in Example 7 above. The higher the measurement, the more radiant the skin is.

As shown in Figure 7A, when the subjects ingested the dewberry extract drink for 4 weeks, the increase in gloss was observed. After 4 weeks of continuous intake, the gloss of the facial skin increased to 4.2% of the original. And after 8 weeks of continuous intake, the hemoglobin index of the facial skin increased to 9.4% of the original. It can also be found in the real-shot image of FIG. 7B that with the increase of the period of ingesting the dewberry extract drink, the glossiness on the skin is significantly increased, and the number of people improved by 86%. The result shows that the dewberry extract drink of the present invention has improved The effect of brightening the skin.

In conclusion, this case proves that dewberry extract can inhibit free radical production and reduce melanin-related genes in cells (for example: tyrosinase-related protein-1 (TYRP1), tyrosinase (TYR), The expression of microphthalmia-related transcription factor (MITF) and melanocortin receptor 1 (MC1R) can inhibit the production of melanin, so dewberry extract can effectively prevent various skin aging phenomena caused by ultraviolet rays and provide skin In addition to the protection of UV rays and blue light, this case also confirmed that dewberry extract can reduce red spots caused by UV rays, relieve skin redness, increase skin radiance, and improve skin moisturizing ability. According to this, dewberry extract can make the whole skin achieve anti-oxidation, whitening and luster, and prevent the skin from being damaged by ultraviolet rays and prevent skin aging.

without

Fig. 1 is a graph comparing the results of the proportion of cells with high expression of reactive oxidizing substances (ROS) in the blank control group, the control group, and the experimental group. ###p value < 0.001 vs. blank control group, ***p value < 0.001 vs. control group. Figure 2 is a graph showing the comparison of the expression levels of moisturizing-related genes in the blank control group and the experimental group. ***p value < 0.001 compared to blank control group. Fig. 3 is a graph comparing the results of the expression levels of melanin-related genes in the blank control group and the experimental group. **p value < 0.01, ***p value < 0.001, compared to blank control group. FIG. 4 is a graph comparing the results of the melanin content of the blank control group, the control group, and the experimental group. ***p value < 0.001 compared to blank control group. Fig. 5A and Fig. 5B are respectively the results of the comparison of the number of skin ultraviolet red spots after the subjects continuously ingested the drinks containing the experimental group after the 0th week, the 4th week and the 8th week, and the images taken by the detector. , taking the number of UV-red spots in subjects before administration as 100%. *p value < 0.1 compared to week 0. Fig. 6A and Fig. 6B are respectively the skin hemoglobin index of the subjects who continuously ingested the drinks containing the experimental group after the 0th week, the 4th week and the 8th week and the images taken by the detector, so as to be tested before application. The patient's skin hemoglobin index was 100%. *p value < 0.1, ***p value < 0.001, compared to week 0. Fig. 7A and Fig. 7B are respectively the changes of skin gloss after the subjects continuously ingested the drink containing the experimental group after the 0th week, the 4th week and the 8th week, and the images taken by the detector, so that the subjects received the drink before application. The test subject's skin radiance was 100%. *p value < 0.1 compared to week 0.

Claims (11)

Use of a dewberry extract for preparing a composition for conditioning skin, wherein the dewberry extract is extracted with a water-containing solvent. The use according to claim 1, wherein the total polyphenol content of the dewberry extract is between 8000 and 11000 ppm. The use of claim 1, wherein the composition is for reducing oxidative damage caused by reactive oxygen species in cells. The use of claim 1, wherein the composition is for reducing the hemoglobin content of the skin. The use of claim 1, wherein the composition is for inhibiting melanin production. The use according to claim 5, wherein the composition is used to achieve the inhibition of melanin production by reducing the expression of melanin-related genes in cells. The use according to claim 6, wherein the melanin-related genes include: tyrosinase-related protein-1 (TYRP1), tyrosinase (TYR), microphthalmia-related transcription factor (MITF), melanocortin receptor 1 (MC1R). The use of claim 1, wherein the composition is used to reduce red spots on the skin. The use according to claim 1, wherein the composition is used to improve the moisturizing ability of the skin. The use according to claim 9, wherein the composition is used to improve the moisturizing ability of the skin by increasing the expression of moisturizing-related genes in cells. The use according to claim 1, wherein the composition is further prepared into a skin care product composition, a health food composition, a cosmetic composition or an external preparation for skin.

Images