TW202115262A - Kit and method for multiplex detection of chikungunya virus and zika virus - Google Patents

Abstract

A kit for multiplex detection of Chikungunya virus and Zika virus includes a first primer set specific to Chikungunya and a second primer set specific to Zika. The first primer set includes a forward primer with SEQ ID NO: 1 and a reverse primer with SEQ ID NO: 2. The second primer set includes a first forward primer with SEQ ID NO: 4, a second forward primer with SEQ ID NO: 5, and a reverse primer with SEQ ID NO: 6. The kit also includes a probe specific to Chikungunya with SEQ ID NO: 3 and a probe specific to Zika with SEQ ID NO: 7. The kit further includes an internal control template, which is in vitro transcribed RNA of proA gene fromPectobacterium carotovorum , a forward primer with SEQ ID NO: 8, a reverse primer with SEQ ID NO: 9, and a probe with SEQ ID NO: 10.

Description

Multi-detection kit and method for Tragong virus and Zika virus

This case is related to the multiple detection of Tragong virus and Zika virus, especially the kit and method for multiple detection of Tragong virus and Zika virus.

Chikungunya virus (CHIKV) is an arbovirus, which belongs to the family of Alphavirus and Togaviridae in taxonomy. The virus is spread from person to person through the bite of the virus-carrying mosquito (Aedes mosquitoes). This virus was first isolated from serum and mosquitoes in 1953.

Qu Gong's disease usually occurs in Africa and Asia, but due to climate change and globalization, epidemics have also broken out in Europe and the Americas. The symptoms of this disease range from asymptomatic to extremely sick. Quercus disease usually starts in an acute fever period of up to 40°C and lasts for several days to a week, followed by long-term joint disease, which affects the joints of the extremities, and the pain caused by the infection of the joints of the flexor joints can last for several weeks. Or months. It is believed that the term "qugong" is derived from the local African dialect (Makan German "bend"), which describes the patient's distorted posture due to extreme joint pain. Other non-specific symptoms may include headache, conjunctivitis, digestive discomfort, and mild photophobia.

Zika virus is a flavivirus transmitted by mosquitoes. It was first discovered in monkeys in Uganda in 1947 and then in humans in Uganda and the United Republic of Tanzania in 1952. The virus is spread from person to person through the bite of the virus-carrying mosquito (Aedes mosquitoes).

Before 2015, Zika virus outbreaks usually occurred in Africa, Southeast Asia and Pacific Islands. However, due to the phenomenon of globalization, the most serious epidemic occurred in March 2015. It started in Brazil and soon spread to the Americas, Africa, Asia and Europe. The symptoms of this disease range from asymptomatic to mild symptoms, such as fever, rash, headache, joint pain, and conjunctivitis and muscle pain. Usually, mild symptoms last from a few days to a week, and the infected person may not even realize that they are infected. However, according to recent findings, Zika virus infection can cause neurological diseases, such as Guillain-Barré syndrome and serious congenital defects called congenital Zika syndrome. The most obvious symptom in newborns of infected mothers is severe microcephaly.

The three technologies commonly used for the diagnosis of these viruses are virus isolation (for Zika virus), serological testing, and real-time reverse transcription polymerase chain reaction (real-time RT-PCR). These technologies use virus detection, virus-specific antibody detection, and viral RNA detection to confirm virus infection. For virus isolation, live virus must be used in cell culture, and the cytopathic effect (CPE) caused by the virus must be observed, and then antiserum specific to Tragonia virus should be used to neutralize CPE to confirm CPE. The main disadvantage of this diagnostic method is that it must be performed in a level 3 biosafety laboratory, and it takes 1-2 weeks to complete the test. Although serological testing can provide definite results within 15 minutes to 2-3 days, this method involves the detection of IgM and IgG antibodies in the patient's serum, and these antibodies only appear a few days after the onset of clinical symptoms (such as fever). In addition, the possibility of false positives due to cross-reactions between other arboviruses and IgM, especially if the patient has a previous history of infection with other flaviviruses, makes the specificity of serological testing still questionable. Instant reverse transcription polymerase chain reaction is a relatively new diagnostic method that can solve the shortcomings of the above methods. Due to its high sensitivity, real-time reverse transcription polymerase chain reaction can more quickly detect Tragodon virus gene body and Zika virus gene body, even in the early stage of infection, and because of its high specificity, false positives The probability is also low.

Although the sensitivity and specificity of the detection of Tragong virus and Zika virus have been improved in recent years, the speed provided by the current real-time reverse transcription polymerase chain reaction detection is still insufficient because of the typical reverse transcription polymerase chain reaction process. The time is almost an hour and a half. Therefore, there is still an urgent need to provide a Point-of-Care (POC) diagnostic method for sensitive and specific detection of Trigonitis and Zika virus, and to provide a faster processing time.

The purpose of the embodiment of the present case is to provide a multiple detection of Tragonia virus and Zika virus, which has high sensitivity, high specificity, and shortened reaction time.

Another purpose of the embodiment of this case is to provide a multiple detection of Tragonivirus and Zika virus, so as to simultaneously detect Tragonivirus and Zika virus in the same reaction.

In order to achieve the above purpose, one embodiment of this case provides a multiple detection kit for Trigonitis virus and Zika virus, including a first primer set specific for Trigonitis virus and a second primer specific for Zika virus At least one of the group. The first primer set is selected from: (a) a forward primer having the nucleotide sequence of SEQ ID NO: 1 and a reverse primer having the nucleotide sequence of SEQ ID NO: 2; and (b) having the same nucleotide sequence as SEQ ID NO: 2; ID NO: 1 has a forward primer with a nucleotide sequence of at least 90% identity and a reverse primer with a nucleotide sequence of at least 90% identity with SEQ ID NO: 2. The second primer set is selected from: (a) a forward primer having the nucleotide sequence of SEQ ID NO: 4 and a reverse primer having the nucleotide sequence of SEQ ID NO: 6; (b) having SEQ ID NO : A forward primer of the nucleotide sequence of 5 and a reverse primer of the nucleotide sequence of SEQ ID NO: 6; (c) a first forward primer of the nucleotide sequence of SEQ ID NO: 4 , A second forward primer having the nucleotide sequence of SEQ ID NO: 5, and a reverse primer having the nucleotide sequence of SEQ ID NO: 6; and (d) having and being selected from SEQ ID NO: 4 At least one forward primer with a nucleotide sequence that has at least 90% identity with the sequence of SEQ ID NO: 5 and a reverse primer with a nucleotide sequence that has at least 90% identity with the sequence of SEQ ID NO: 6.

In one embodiment, the multiple detection kit further includes a probe specific for Tragong virus, wherein the probe has a nucleotide sequence selected from the following group: (a) the nucleus of SEQ ID NO: 3 A nucleotide sequence; (b) a nucleotide sequence complementary to SEQ ID NO: 3; and (c) a nucleotide sequence that has at least 90% identity with SEQ ID NO: 3 or its complementary sequence. A reporter dye is connected to the 5'end of the probe, and a quencher is connected to the 3'end.

In one embodiment, the multiple detection kit further includes a probe specific to Zika virus, wherein the probe has a nucleotide sequence selected from the following group: (a) the nucleus of SEQ ID NO: 7 A nucleotide sequence; (b) a nucleotide sequence complementary to SEQ ID NO: 7; and (c) a nucleotide sequence that has at least 90% identity with SEQ ID NO: 7 or its complementary sequence. A reporter dye is connected to the 5'end of the probe, and a quencher is connected to the 3'end.

In one embodiment, the multiple detection kit further includes an internal control template, which is an RNA derived from in vitro transcription of the proA gene of Pectobacterium carotovorum (Pectobacterium carotovorum).

In one embodiment, the multiple detection kit further includes a control primer set specific to the proA gene, wherein the control primer set is selected from: (a) a forward direction having the nucleotide sequence of SEQ ID NO: 8 Primer and a reverse primer having the nucleotide sequence of SEQ ID NO: 9; and (b) a forward primer having a nucleotide sequence that is at least 90% identical to SEQ ID NO: 8 and having the same nucleotide sequence as SEQ ID NO: 8 NO: 9 A reverse primer with at least 90% identical nucleotide sequence.

In one embodiment, the multiple detection kit further includes a probe specific to the proA gene, wherein the probe has a nucleotide sequence selected from the following group: (a) a nucleoside of SEQ ID NO: 10 Acid sequence; (b) a nucleotide sequence complementary to SEQ ID NO: 10; and (c) a nucleotide sequence that has at least 90% identity with SEQ ID NO: 10 or its complementary sequence. A reporter dye is connected to the 5'end of the probe, and a quencher is connected to the 3'end.

In order to achieve the above purpose, another embodiment of this case is to provide a multiple detection method for Drokon virus and Zika virus, including the steps: (a) contacting the biological sample with the aforementioned multiple detection kit; (b) expanding from the biological sample Enhance the nucleic acid of Tragonivirus and/or Zika virus; and (c) detect the presence of the amplified nucleic acid of Tragonivirus and/or Zika virus.

In one embodiment, the method further includes a step of extracting nucleic acid from the biological sample before step (a).

In one embodiment, step (b) of this method includes the sub-steps: (b1) reverse transcription of viral genomic RNA into complementary DNA; and (b2) use real-time polymerase chain reaction to amplify complementary DNA.

When the term "one" is used in conjunction with the term "including/including" in the scope of patent application and/or specification, it may mean "one", but it can also mean "one or more", "at least one", and "one or The meaning of "greater than one" is the same.

The term "or" in the scope of the patent application means "and/or" unless it is clearly stated that only alternatives or alternatives are mutually exclusive, even if the disclosure supports only the definition of alternatives and "and/or".

The other objects, features, and advantages of the present invention will become apparent from the following detailed description. However, it should be understood that although the detailed description and specific examples indicate specific embodiments of the present invention, these specific embodiments are for illustrative purposes only, because through this detailed description, various changes and modifications within the spirit and scope of the present invention It is obvious to those who are familiar with the art.

Some embodiments embodying the features and advantages of this case will be described in detail in the following description. It should be understood that this case can have various changes in different aspects, which do not depart from the scope of this case, and the description and drawings therein are essentially for illustrative purposes, rather than limiting the case.

This case provides multiple detections of trichotillovirus and Zika virus to simultaneously detect trichotillovirus and Zika virus, with high sensitivity, high specificity, and shortened response time. The example of this case utilizes real-time reverse transcription polymerase chain reaction (real-time RT-PCR), also known as quantitative reverse transcription polymerase chain reaction (quantitative reverse transcription polymerase chain reaction, (Referred to as qRT-PCR), with a probe-based detection system (probe-based detection) for rapid, sensitive and specific diagnosis of human Tragonivirus and Zika virus infection. The real-time RT-PCR mainly consists of two steps. The first step is to reverse transcribe the viral genomic RNA (gRNA) of Trakonosaurus or Zika virus into Complementary DNA (cDNA), and then use real-time polymerase chain reaction (real-time PCR) in the second step with a primer pair specific to Trakong virus or Zika virus To amplify the cDNA. In particular, in real-time PCR, specific forward primers, reverse primers, and probes will hybridize to the cDNA target of Tragong virus or Zika virus. The 5'end is connected with a reporter dye, and the 3'end is connected with a quencher. During the PCR amplification reaction, the probe is cleaved to separate the reporter dye from the quencher, and the fluorescence emitted by the reporter dye can be detected.

The example of this case provides a test kit for the virus and Zika virus. These two kits can be used separately to detect the virus and the Zika virus respectively, or they can be used in combination to simultaneously detect the virus and the Zika virus. Multiple detection kits for Zika virus. The design of primers and probes used in these sets will be described in detail below.

Tragong virus is a single-stranded RNA virus with 11826 bases (S27 virus strain; NCBI reference sequence database NC_004162.2). In the example of this case, the nonstructural protein 1 (nsP1) gene of Tragong virus was selected as the detection target. The Tragong virus detection kit includes a forward primer and a reverse primer, and may additionally include a probe.

Figure 1 shows the partial cDNA sequence of the non-structural protein 1 gene of Tragong virus (denoted by SEQ ID NO: 11, corresponding to positions 1051 to 1225 of the NC_004162.2 gene sequence), as well as forward primers, reverse primers and probes The binding position on the nonstructural protein 1 gene sequence. The forward primer has the nucleotide sequence of SEQ ID NO: 1 (5'-GCGACCATTTGTGATCAAATGACC-3'), starts at position 1082 of the gene sequence, and is 24-mer in size. The reverse primer has the nucleotide sequence of SEQ ID NO: 2 (5'-GTTCTGCCGTTAACCACTATTCTCTG-3'), starts at the 1191th position of the gene sequence, and is 26-mer in size. The probe is a retro probe with the nucleotide sequence of SEQ ID NO: 3 (5'-AGCTTCTGTGCATCCTCCGGCGTGAC-3'), starting at the 1149th position in the gene sequence, and having a size of 26-mer. Using the aforementioned forward primer and reverse primer, an amplicon with a size of 110-bp can be amplified.

Zika virus is a single-stranded RNA virus with 10675 bases (PRVABC59 virus strain; NCBI reference sequence database KU501215.1). In this example, the envelope (E) gene of Zika virus was selected as the detection target. The Zika virus detection kit includes at least one forward primer and one reverse primer, and may additionally include a probe.

Figure 2 shows the partial cDNA sequence of the mantle gene of Zika virus (identified as SEQ ID NO: 12, corresponding to positions 2101 to 2275 of the KU501215.1 gene sequence), as well as forward primers, reverse primers and probes in the jacket The position of adhesion on the membrane gene sequence. The first forward primer has the nucleotide sequence of SEQ ID NO: 4 (5'-GGAGTGGCAGCACCATTG-3'), starts at the 2181th position of the gene sequence, and is 18-mer in size. The second forward primer has the nucleotide sequence of SEQ ID NO: 5 (5'-GGAGTGGCAGTACCATTG-3'), also starts at the 2181th position of the gene sequence, and is 18-mer in size. The reverse primer has the nucleotide sequence of SEQ ID NO: 6 (5'-CAGGCTGTGTCTCCCAAGA-3'), starts at position 2262 of the gene sequence, and is 19-mer in size. The probe is a reverse probe with the nucleotide sequence of SEQ ID NO: 7 (5'-TTCTCTTGGCACCTCTCACAGTGGCTTCAA-3'), which starts at the 2237th position in the gene sequence and is 30-mer in size. Using the aforementioned forward primer (with the sequence of SEQ ID NO: 4 or SEQ ID NO: 5) and the reverse primer, an amplicon with a size of 82-bp can be amplified.

The second forward primer with the sequence of SEQ ID NO: 5 has only one nucleotide change compared to the first forward primer with the sequence of SEQ ID NO: 4, and the first and second forward primers The primers may be used to detect different Zika virus strains. In one embodiment, the Zika virus detection kit includes a first forward primer having the sequence of SEQ ID NO: 4 and a reverse primer having the sequence of SEQ ID NO: 6. In another embodiment, the Zika virus detection kit includes a second forward primer having the sequence of SEQ ID NO: 5 and a reverse primer having the sequence of SEQ ID NO: 6. Or in another embodiment, the Zika virus detection kit includes a first forward primer having the sequence of SEQ ID NO: 4, a second forward primer having the sequence of SEQ ID NO: 5, and a second forward primer having the sequence of SEQ ID NO: : The reverse primer of the 6 sequence.

In order to confirm that the primers and probes used are specific to Tragong virus, each primer and probe (SEQ ID NO: 1 to 3) uses the NCBI BLAST system to add transcription (human genomic plus transcript) and nuclear Nucleotide collection and other two databases were compared, and the comparison results showed that no other similar species had exactly the same sequence fragments as the primers and probes designed in this case. This result shows that the primers and probes designed in this case have very high specificity for the Tragong virus, and can be used to amplify and detect the non-structural protein 1 gene of Tragong virus. In an embodiment of the present case, the aforementioned primers and probes can only be used to amplify and detect the non-structural protein 1 gene of Trakong virus.

To confirm that the primers and probes used are specific to Zika virus, each primer and probe (SEQ ID NO: 4 to 7) uses the NCBI BLAST system to add transcription (human genomic plus transcript) and nuclear Nucleotide collection (nucleotide collection) and other two databases were compared, and the comparison results showed that no other similar species have the same SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 7 designed in this case. The same sequence fragment, however, SEQ ID NO: 6 has 100% similarity with Dengue serotype 3 (Dengue serotype 3). Since the primers and probes are grouped for detection, even if the reverse primer (SEQ ID NO: 6) can be combined with the genomic material of the third serotype of dengue virus, the forward primer (SEQ ID NO: 4 or 5) and the reverse The probe (SEQ ID NO: 7) will also not bind to the genomic material of the third serotype of dengue virus. That is, the primer and probe combination of the embodiment of this case will not produce a false positive detection result for the third serotype of dengue fever virus, and can still detect the mantle gene of Zika virus specifically. In other words, the primers and probes designed in this case are very specific to Zika virus, and can be used to amplify and detect the mantle gene of Zika virus. In an embodiment of this case, the aforementioned primers and probes can only be used to amplify and detect the mantle gene of Zika virus.

In addition, the example of this case also provides a kit for detecting internal control template, which is derived from in vitro transcription of proA gene of soft rot bacteria (Pectobacterium carotovorum SCRI121 strain; NCBI reference sequence database HM157163.1) The RNA (in vitro transcribed RNA, referred to as IVT-RNA). The proA internal control detection kit includes a forward primer and a reverse primer, and can additionally include a probe.

Figure 3 shows the partial cDNA sequence of the proA gene (denoted by SEQ ID NO: 13, corresponding to positions 291 to 490 of the HM157163.1 gene sequence), and the adhesion of forward primers, reverse primers and probes to the proA gene sequence position. The forward primer has the nucleotide sequence of SEQ ID NO: 8 (5'-CTGCTGGTCAATCAACGTATCG-3'), starts at the 301st position of the gene sequence, and is 22-mer in size. The reverse primer has the nucleotide sequence of SEQ ID NO: 9 (5'-GGTCGTTAGAAAGCCATTCATCG-3'), starts at the 478th position of the gene sequence, and is 23-mer in size. The probe is a forward probe with the nucleotide sequence of SEQ ID NO: 10 (5'-TCCATGCCAGTCCTTCAGCGATGCCTTA-3'), starting at the 377th position of the gene sequence, and 28-mer in size. Using the aforementioned forward primer and reverse primer, amplicons with a size of 178-bp can be amplified.

In one embodiment, the multiple detection kits for tricot virus and Zika virus include a tricot virus detection kit, a Zika virus detection kit, and a proA internal control detection kit. The primers and probes used in this multiple detection kit are listed in Table 1. Table 1 SEQ ID NO Sequence (5' → 3') Primer / probe name direction 1 GCGACCATTTGTGATCAAATGACC CHIK_nsP1_1082_1105_F Forward introduction 2 GTTCTGCCGTTAACCACTATTCTCTG CHIK_nsP1_1191_1166_R Reverse primer 3 AGCTTCTGTGCATCCTCCGGCGTGAC CHIK_nsP1_1149_1124_P Reverse probe 4 GGAGTGGCAGCACCATTG ZIKA_E_2181_2198_F1 Forward introduction 5 GGAGTGGCAGTACCATTG ZIKA_E_2181_2198_F2 Forward introduction 6 CAGGCTGTGTCTCCCAAGA ZIKA_E_2262_2244_R Reverse primer 7 TTCTCTTGGCACCTCTCACAGTGGCTTCAA ZIKA_E_2237_2208_P Reverse probe 8 CTGCTGGTCAATCAACGTATCG ProA_301_322_F Forward introduction 9 GGTCGTTAGAAAGCCATTCATCG ProA_478_456_R Reverse primer 10 TCCATGCCAGTCCTTCAGCGATGCCTTA ProA_377_404_P Forward probe

In some embodiments, the primers and probes in this case are not limited to those with the same sequence as SEQ ID NO: 1-10. It is worth noting that the hybrid sequence does not require perfect complementarity to provide a stable hybrid. In many cases, when the base mismatch ratio is less than 10%, a stable hybrid can still be formed. In addition, there may also be genetic mutations in specific Tragong virus strains or Zika virus strains. Therefore, primers and probes with sequences that have at least 90% identity with SEQ ID NO: 1 to 10 may have similar specificity to the original sequence, and therefore can also be used for multiplex detection of Tragonia virus and Zika virus.

In some embodiments, since the primer pair composed of the corresponding forward primer and the reverse primer can specifically detect Tragonia virus (SEQ ID NO: 1 and 2) and Zika virus (SEQ ID NO: 4 to 6) , Or proA internal control (SEQ ID NO: 8 and 9), so as long as it is a sequence located between the corresponding forward primer and reverse primer positions, it can be designed as a probe sequence. Therefore, the probe sequence is not limited The aforementioned probe sequence (SEQ ID NO: 3, 7 and 10). In addition, since the probe can be hybridized to any strand of DNA, the complementary sequence at the same position can be used as the probe sequence. Therefore, it is complementary to the aforementioned probe sequence (SEQ ID NO: 3, 7 and 10). The sequences can also be used as probe sequences for the detection of Tragong virus, Zika virus, and proA internal control, respectively.

Based on the above, the embodiment of the present case provides a multiple detection kit for tricot virus and Zika virus, which includes at least one of the first primer set specific for trigonitis virus and the second primer set specific for Zika virus one. The first primer set is selected from: (a) a forward primer having the nucleotide sequence of SEQ ID NO: 1 and a reverse primer having the nucleotide sequence of SEQ ID NO: 2; and (b) having the same nucleotide sequence as SEQ ID NO: 2; ID NO: 1 has a forward primer with a nucleotide sequence of at least 90% identity and a reverse primer with a nucleotide sequence of at least 90% identity with SEQ ID NO: 2. The second primer set is selected from: (a) a forward primer having the nucleotide sequence of SEQ ID NO: 4 and a reverse primer having the nucleotide sequence of SEQ ID NO: 6; (b) having SEQ ID NO : A forward primer of the nucleotide sequence of 5 and a reverse primer of the nucleotide sequence of SEQ ID NO: 6; (c) a first forward primer of the nucleotide sequence of SEQ ID NO: 4 , A second forward primer having the nucleotide sequence of SEQ ID NO: 5, and a reverse primer having the nucleotide sequence of SEQ ID NO: 6; and (d) having and being selected from SEQ ID NO: 4 At least one forward primer with a nucleotide sequence that has at least 90% identity with the sequence of SEQ ID NO: 5 and a reverse primer with a nucleotide sequence that has at least 90% identity with the sequence of SEQ ID NO: 6.

In one embodiment, the multiple detection kit of Tragonivirus and Zika virus further includes a probe specific for Tragonivirus, wherein the probe has a nucleotide sequence selected from the following groups: (a ) The nucleotide sequence of SEQ ID NO: 3; (b) the nucleotide sequence complementary to SEQ ID NO: 3; and (c) the nucleus that has at least 90% identity with SEQ ID NO: 3 or its complementary sequence Nucleotide sequence.

In one embodiment, the multiplex detection kit for Tragonivirus and Zika virus further includes a probe specific to Zika virus, wherein the probe has a nucleotide sequence selected from the following groups: (a ) The nucleotide sequence of SEQ ID NO: 7; (b) the nucleotide sequence complementary to SEQ ID NO: 7; and (c) the nucleus having at least 90% identity with SEQ ID NO: 7 or its complementary sequence Nucleotide sequence.

In one embodiment, the multiple detection kits for Tragonia virus and Zika virus further include an internal control template, which is an RNA derived from in vitro transcription of the proA gene of Pectobacterium carotovorum (Pectobacterium carotovorum). Accordingly, the multiple detection kits for Tragong virus and Zika virus further include a control primer set specific to the proA gene, wherein the control primer set is selected from: (a) nucleotides having SEQ ID NO: 8 A forward primer of the sequence and a reverse primer having the nucleotide sequence of SEQ ID NO: 9; and (b) a forward primer having a nucleotide sequence that is at least 90% identical to SEQ ID NO: 8 And a reverse primer with a nucleotide sequence that is at least 90% identical to SEQ ID NO: 9. In addition, the multiple detection kits for Tragong virus and Zika virus further include a probe specific to the proA gene, wherein the probe has a nucleotide sequence selected from the following groups: (a) SEQ ID NO: A nucleotide sequence of 10; (b) a nucleotide sequence complementary to SEQ ID NO: 10; and (c) a nucleotide sequence that has at least 90% identity with SEQ ID NO: 10 or its complementary sequence.

The aforementioned specific primers and probes are designed to hybridize and amplify target genes. Therefore, this case also provides a multiplex detection method for Tragonivirus and Zika virus. This method includes the steps: (a) Contacting the biological sample with the aforementioned multiplex detection kit; (b) Amplifying Tragonivirus and Zika virus from the biological sample / Or the nucleic acid of Zika virus; and (c) detecting the presence of the amplified nucleic acid of Trakong virus and/or Zika virus.

In one embodiment, the method further includes a step of extracting nucleic acid from the biological sample before step (a).

In one embodiment, step (b) of this method includes the sub-steps: (b1) reverse transcription of viral genomic RNA into complementary DNA; and (b2) use real-time polymerase chain reaction to amplify complementary DNA.

The probe used for the real-time polymerase chain reaction is connected to the reporter dye at the 5'end and the quencher at the 3'end. During the PCR amplification reaction, the probe is cleaved to separate the reporter dye from the quencher, and the fluorescence emitted by the reporter dye can be detected. In the multiple detection of different target genes, the different probes used to detect Trakong virus, Zika virus, and the internal control of proA can be labeled with different reporter dyes with distinguishable fluorescent colors to facilitate the observation of the detection results. In one embodiment, the reporter dye can be selected from fluorescent dyes such as ROX, FAM, HEX, Cy5, TET, and Texas Red, but is not limited to this. In one embodiment, the quencher is a dark quencher, such as Iowa black FQ quencher or Black Hole quencher, but not limited thereto.

The primers and probes provided in the examples of this case are optimized for the rapid detection of Tragonivirus and Zika virus through real-time reverse transcription polymerase chain reaction, and the real-time reverse transcription polymerase chain reaction system is in a rapid cycle mode ( fast cycling mode). Table 2 shows the temperature profile of the real-time reverse transcription polymerase chain reaction in the fast cycling mode. In one embodiment, the rapid cycle mode refers to the temperature profile of the real-time reverse transcription polymerase chain reaction as follows: (1) 42 ^o C for 5 minutes of reverse transcription retention period; then (2) 95 ^o C for 10 seconds of enzyme Activation maintenance phase; followed by 45 cycles of (3) PCR phase, this phase is at 95 ^o C for 5 seconds, and 60 ^o C for adhesion/extension for 18 seconds. Therefore, the total reaction time of the instant reverse transcription polymerase chain reaction in the example of this case is 23 minutes. However, in the commercially available competitive products, the reverse transcription takes 20 minutes, the enzyme activation takes 2 minutes, plus a 45-cycle PCR stage, which takes 15 seconds for denaturation, 45 seconds for adhesion, and extension. It takes 15 seconds, so the total reaction time is about 77 minutes. Table 2 step time temperature Reverse transcription 5 minutes 42 ^o C Enzyme activation 10 seconds 95 ^o C 45 cycles transsexual 5 seconds 95 ^o C Bonding/Extending 18 seconds 60 ^o C

In the fast cycle mode of the embodiment of this case, the following four aspects can save a lot of time. First, the bonding/extending time is shortened to 18 seconds, which saves time. On the contrary, it usually takes 60 seconds for commercially available competitive products. Second, the denaturation time is shortened to 5 seconds, which saves time. In contrast, commercially available competitive products usually take 15 seconds. Third, the reverse transcription time is shortened to 5 minutes, compared to 20 minutes for commercially available competitive products. Fourth, the enzyme activation time is shortened to 10 seconds, compared to 2 minutes for commercially available competitive products.

Therefore, on the same type of thermal cycler, the time saved by adopting the rapid cycling mode of the primers and probes of the examples in this case reduces the total reaction time by at least 70% compared with the standard reverse transcription polymerase chain reaction. The embodiment of this case can complete the detection of Tragon virus and Zika virus in less than 30 minutes. In other words, by optimizing the design to reduce the denaturation/adhesion/extension time of each cycle, reduce the reverse transcription time and reduce the enzyme activation time, the total reaction time is shortened by at least 70%, so that the primers and probes of the examples in this case can be used by The real-time reverse transcription polymerase chain reaction achieves rapid multiple detection of Tragonivirus and Zika virus, and these are achieved under the premise of not affecting the sensitivity and specificity of the detection of Tragonivirus and Zika virus.

The following will describe the multiple detection examples of Tragonivirus and Zika virus in the embodiment of this case, and the reaction mixture is shown in Table 3. The real-time reverse transcription polymerase chain reaction was carried out using the fast cycle mode described above, and the reaction mixture included One Step PrimeScript ^TM RT-PCR kit (Perfect Real Time; #RR064A) purchased from Takara, 500 nM forward primer ( SEQ ID NO: 1), 500 nM reverse primer (SEQ ID NO: 2), 200 nM probe (SEQ ID NO: 3), 500 nM forward primer (SEQ ID NO: 4), 500 nM Forward primer (SEQ ID NO: 5), 500 nM reverse primer (SEQ ID NO: 6), 200 nM probe (SEQ ID NO: 7), 250 nM forward primer (SEQ ID NO: 8) , 250 nM reverse primer (SEQ ID NO: 9), 100 nM probe (SEQ ID NO: 10), 1000 copies of proA internal control IVT-RNA, and appropriate amount of RNA extraction sample, and the total volume is 20 µL . However, the reaction mixture is not limited to the above-mentioned enzyme and buffer system. table 3 Real-time reverse transcription polymerase chain reaction component Volume per reaction (µl) Concentration per reaction TaKaRa set 2X One Step RT-PCR Buffer III 10 1X TaKaRa Ex Taq HS 0.4 2.5 U/µl PrimeScript RT enzyme Mix II 0.4 - RNase Free dH ₂ O - - SEQ ID NO: 1 - 500 nM SEQ ID NO: 2 - 500 nM SEQ ID NO: 3 - 200 nM SEQ ID NO: 4 - 500 nM SEQ ID NO: 5 - 500 nM SEQ ID NO: 6 - 500 nM SEQ ID NO: 7 - 200 nM SEQ ID NO: 8 - 250 nM SEQ ID NO: 9 - 250 nM SEQ ID NO: 10 - 100 nM proA internal control IVT-RNA - 1000 copies RNA extraction sample - - Total volume: 20 µl

In order to further experimentally confirm the specificity of the primers and probes to Tragonia virus and Zika virus in the multiplex detection, the cross-reactivity of the primers and probes with several common mosquito-borne viruses, including dengue virus first to The fourth serotype (Dengue virus serotypes 1 to 4), and this experiment is carried out in the presence of a large amount of genomic RNA (approximately 10 ⁶ to 10 ⁷ copies of gRNA). Figures 4 and 5 respectively show the results of the specificity analysis of Tragonivirus and Zika virus, in which CHIK, DEN1 to DEN4, and ZIKA represent the serotypes from Tragonivirus, Dengue virus first to fourth serotypes, and Zika virus, respectively. Genome RNA sample of card virus, and NTC means no template control group. In the fluorescence channel for the detection of tragonivirus, as shown in Figure 4, except for the amplification reaction of the tragoniform RNA sample, no amplification reaction was observed in the other groups. Similarly, in the Zika virus detection fluorescence channel, as shown in Figure 5, except for the amplification reaction of the Zika gene body RNA sample, no amplification reaction was observed in the other groups. In other words, no cross-reaction occurred in this experiment, thus confirming the specificity of the primers and probes in this case in multiple detection.

The example of this case can detect only a few copies of the tragopanic genomic RNA in each reaction in the multiplex detection in less than 30 minutes. Reactions containing 1, 3, 5, 8, 10, and 15 copies of Tragodon gene RNA in each reaction were analyzed in 6 replicates respectively, and the cutoff value of positive detection was set to a Ct value of 38. The results showed that the positive detection rates of reactions containing 1, 3, 5, 8, 10 and 15 copies in each reaction were 3/6, 5/6, 5/6, 6/6, 6/6 and 6/6. In other words, in the reactions containing 8, 10, and 15 copies in each reaction, Tragonivirus was detected in all 6 replicates. Therefore, the limit for detection (LoD) of Tragon virus in multiple detection can be predicted to be about 8 to 10 copies, showing a fairly high sensitivity. In addition, the bottom line of the test is to confirm that each reaction contains 10 copies of tragopanic gene RNA for 20 replicate analyses. As a result, all the 20 replicates get a positive test result. Therefore, the bottom line of the test is confirmed to be 10 copies per reaction ( The positive detection rate based on 20/20 has greater than 95% confidence).

The example of this case can also detect only a few copies of Zika gene body RNA in each reaction in the multiplex detection in less than 30 minutes. Each reaction containing 1, 3, 5, 8, 10, and 15 copies of Zika gene body RNA was analyzed in 6 replicates, and the cutoff value of positive detection was set to a Ct value of 38. The results showed that the positive detection rates of reactions containing 1, 3, 5, 8, 10 and 15 copies in each reaction were 3/6, 2/6, 5/6, 3/6, 6/6 and 6/6. In other words, in each reaction containing 10 and 15 copies, Zika virus was detected in all 6 replicates. Therefore, the limit for detection (LoD) of Zika virus in multiple detection can be predicted to be about 10 to 15 copies, showing a fairly high sensitivity. In addition, the confirmation of the bottom line of the test is to further analyze the reaction with 10 copies of Zika gene body RNA in each reaction to carry out 20 repeat analysis. As a result, 19 reactions out of the 20 repeats yielded a positive test result. Therefore, the bottom line of the test is confirmed as per reaction. 10 copies (95% confidence based on the positive detection rate of 19/20).

The examples of this case can jointly detect Tragonivirus and Zika virus in the same real-time reverse transcription polymerase chain reaction. Two reactions are analyzed in a multiplex test. One reaction has 100 copies of Tragodon gene RNA and 100 copies of Zika gene RNA, and the other reaction has 10 copies of Tragodon gene RNA and 10 copies. Copies of Zika Genome RNA. Fig. 6A and Fig. 6B show the results of the joint detection of Tragong virus and Zika virus. As shown in Fig. 6A and Fig. 6B, when 100 copies of Tragonella gene RNA and 100 copies of Zika gene RNA are present in the reaction simultaneously, multiple detection can detect Tragonella virus and Zika virus at the same time. . And when 10 copies of Tragodonta genomic RNA and 10 copies of Zika genomic RNA are present in the reaction at the same time, the multiplex detection will detect Tragogonia virus in the two-repetition analysis, and one of the two-repetition analysis. One detected Zika virus. Therefore, even if the viral RNA content is low, multiple detection can simultaneously detect Trakong virus and Zika virus.

The example of this case can quantify the genomic RNA of tragopan in less than 30 minutes. Figure 7 shows the amplification curves generated from different copy numbers of Tragodon genomic RNA. Qugong Ji using primers and probes embodiment example of the case, and each copy number serially diluted with reaction ⁽¹⁰⁷ to 10 copies) of the body due to RNA samples were tested to determine the linearity of the multi-well flexion detection assay. Figure 8 shows the flexion analysis standard curve generated from the results in Figure 7. According to the obtained standard curve, the amplification efficiency is 102%, and the R ² value is 1.00. Since the R ² value is the best theoretical value of 1.0, this multiple detection can be extended to quantitative analysis to estimate the amount of tragopanic genomic RNA during POC detection.

The example of this case can also quantify Zika gene body RNA in less than 30 minutes. Figure 9 shows the amplification curves generated from different copy numbers of Zika virus genomic RNA. Using the primers and probes of the examples of this case, ^{the Zika gene body RNA samples with serial dilution copies (2×10 6} to 20 copies) per reaction were tested respectively to determine the linearity of the Zika detection in the multiple detection. Figure 10 shows the Zika analysis standard curve generated from the results in Figure 9. According to the obtained standard curve, the amplification efficiency is 104%, and the R ² value is 1.00. Since the R ² value is the best theoretical value of 1.0, this multiple detection can be extended to quantitative analysis to estimate the amount of Zika gene body RNA during POC detection.

The multiple detections of tricot virus and Zika virus in the examples of this case are further compared with two commercially available tricot test kits or two commercially available Zika test kits. Comparative experiments are performed with a small amount of viral RNA, such as 10 or 100 copies of genomic RNA per reaction. Figure 11 shows the comparison between the multiple tests in this case and the two commercially available Trigonometry test kits, and Figure 12 shows the comparison between the multiple tests in this case and the two Zika test kits on the market.

As shown in Figure 11, when a small amount of Tragopan RNA is added to the reaction, the average Ct values of the multiple detection, commercial kit 1, and commercial kit 2 for the detection of 100 copies of genomic RNA in this case are respectively They are 31.673, 34.055, and 33.196; and for the detection of 10 copies of genomic RNA, the average Ct values of multiple detection, commercial kit 1, and commercial kit 2 in this case are 34.415, 37.617, and 36.461, respectively. Therefore, the multiple detection in this case can detect tragodontic virus at an earlier Ct. Therefore, the multiple detection in this case is better than the two commercially available kits when detecting a small amount of tragodontic RNA. In addition, the total reaction time of the real-time reverse transcription polymerase chain reaction of the multiple detection, commercial kit 1, and commercial kit 2 in this case are 23 minutes, 77 minutes, and 62 minutes, respectively, so they are comparable to the commercial kits. In contrast, the multiple detection in this case took a significantly shorter time to complete the real-time reverse transcription polymerase chain reaction.

As shown in Figure 12, when a small amount of Zika RNA is added to the reaction, for the detection of 100 copies of genomic RNA, the average Ct values of multiple detection, commercial kit 1, and commercial kit 2 in this case are respectively They are 31.953, 33.711, and 32.101; and for the detection of 10 copies of genomic RNA, the average Ct values of multiple detection, commercial kit 1, and commercial kit 2 in this case are 35.983, 36.304, and 35.480, respectively. Therefore, the multiple detection in this case can detect Zika virus with an earlier Ct or a comparable Ct. Therefore, when detecting a small amount of Zika RNA, the multiple detection in this case is better than or comparable to the two commercially available sets. In addition, the total reaction time of the real-time reverse transcription polymerase chain reaction of the multiple detection, commercial kit 1, and commercial kit 2 in this case are 23 minutes, 77 minutes, and 62 minutes, respectively, so they are comparable to the commercial kits. In contrast, the multiple detection in this case took a significantly shorter time to complete the real-time reverse transcription polymerase chain reaction.

In summary, the embodiment of this case provides multiple detection kits and methods for Tragonivirus and Zika virus, which utilize real-time reverse transcription polymerase chain reaction and specific primers and probes for detection. The multiple detection kit and method of the embodiment of the present case have the advantages of being able to simultaneously detect Tragonivirus and Zika virus with high sensitivity and high specificity. The multiple detection kit and method of the embodiment of the present case can detect low-copy number drotong and Zika RNA, and can be used for quantitative detection. The multiple detection kit and method of the embodiment of the present case has the advantage of reducing the reaction time, and it is realized under the premise of not affecting the sensitivity and specificity. Therefore, this case provides rapid, sensitive, specific, and multiple tests that can simultaneously detect Tragonivirus and Zika virus, which can effectively treat infection and prevent transmission.

Even though the present invention has been described in detail by the above-mentioned embodiments, it can be modified in many ways by those skilled in the art, but it does not deviate from the scope of the attached patent application.

no

Figure 1 shows the partial cDNA sequence of Tragong virus non-structural protein 1 gene, as well as the binding positions of forward primer, reverse primer and probe on the sequence. Figure 2 shows the partial cDNA sequence of the mantle gene of Zika virus, as well as the binding positions of forward primers, reverse primers and probes on the sequence. Figure 3 shows the partial cDNA sequence of the proA gene of soft rot bacteria, as well as the binding position of the forward primer, reverse primer and probe on the sequence. Figures 4 and 5 show the results of the specificity analysis of Tragonia virus and Zika virus, respectively. Fig. 6A and Fig. 6B show the results of the joint detection of Tragong virus and Zika virus. Figure 7 shows the amplification curves generated from different copy numbers of Tragodon genomic RNA. Figure 8 shows the flexion test standard curve generated from the results in Figure 7. Figure 9 shows the amplification curves generated from different copy numbers of Zika gene body RNA. Figure 10 shows the Zika test standard curve generated from the results in Figure 9. Figure 11 shows the comparison between the multiple test in this case and the two commercially available test kits. Figure 12 shows the comparison between the multiple test in this case and the two commercially available Zika test kits.

Claims (19)

A multiple detection kit for Tragong virus and Zika virus, comprising at least one of a first primer set specific to Tragong virus and a second primer set specific to Zika virus, The first primer group is selected from: (a) a forward primer having the nucleotide sequence of SEQ ID NO: 1 and a reverse primer having the nucleotide sequence of SEQ ID NO: 2; and (b) a forward primer having a nucleotide sequence that is at least 90% identical to SEQ ID NO: 1 and a reverse primer that has a nucleotide sequence that is at least 90% identical to SEQ ID NO: 2, The second primer group is selected from: (a) A forward primer with the nucleotide sequence of SEQ ID NO: 4 and a reverse primer with the nucleotide sequence of SEQ ID NO: 6; (b) A forward primer with the nucleotide sequence of SEQ ID NO: 5 and a reverse primer with the nucleotide sequence of SEQ ID NO: 6; (c) A first forward primer with the nucleotide sequence of SEQ ID NO: 4, a second forward primer with the nucleotide sequence of SEQ ID NO: 5, and a core with SEQ ID NO: 6 A reverse primer of the nucleotide sequence; and (d) has at least one forward primer with a nucleotide sequence that is at least 90% identical to a sequence selected from SEQ ID NO: 4 and SEQ ID NO: 5, and has at least 90% identity with SEQ ID NO: 6 A reverse primer for identical nucleotide sequences. The multiple detection kit according to claim 1, further comprising a probe specific to Tragong virus, wherein the probe has a nucleotide sequence selected from the following groups: (a) The nucleotide sequence of SEQ ID NO: 3; (b) A nucleotide sequence complementary to SEQ ID NO: 3; and (c) A nucleotide sequence that has at least 90% identity with SEQ ID NO: 3 or its complementary sequence. The multiple detection kit according to claim 2, wherein a reporter dye is connected to the 5'end of the probe, and a quencher is connected to the 3'end of the probe. The multiple detection kit according to claim 1, further comprising a probe specific to Zika virus, wherein the probe has a nucleotide sequence selected from the following groups: (a) The nucleotide sequence of SEQ ID NO: 7; (b) A nucleotide sequence complementary to SEQ ID NO: 7; and (c) A nucleotide sequence that has at least 90% identity with SEQ ID NO: 7 or its complementary sequence. The multiple detection kit according to claim 4, wherein a reporter dye is connected to the 5'end of the probe, and a quencher is connected to the 3'end of the probe. The multiple detection kit as described in claim 1, further comprising an internal control template, which is an RNA obtained by in vitro transcription of the proA gene of Pectobacterium carotovorum (Pectobacterium carotovorum). The multiple detection kit according to claim 6, further comprising a control primer set specific to the proA gene, wherein the control primer set is selected from: (a) a forward primer having the nucleotide sequence of SEQ ID NO: 8 and a reverse primer having the nucleotide sequence of SEQ ID NO: 9; and (b) A forward primer having a nucleotide sequence that is at least 90% identical to SEQ ID NO: 8 and a reverse primer that has a nucleotide sequence that is at least 90% identical to SEQ ID NO: 9. The multiple detection kit according to claim 7, further comprising a probe specific to the proA gene, wherein the probe has a nucleotide sequence selected from the following groups: (a) The nucleotide sequence of SEQ ID NO: 10; (b) A nucleotide sequence complementary to SEQ ID NO: 10; and (c) A nucleotide sequence that has at least 90% identity with SEQ ID NO: 10 or its complementary sequence. The multiple detection kit according to claim 8, wherein a reporter dye is connected to the 5'end of the probe, and a quencher is connected to the 3'end of the probe. A multiple detection method for Tragong virus and Zika virus, including the steps: (a) Bring a biological sample into contact with the multiple detection kit as described in claim 1; (b) Amplify the nucleic acid of Tragonivirus and/or Zika virus from the biological sample; and (c) Detect the presence of the amplified nucleic acid of Tragonia virus and/or Zika virus. The multiple detection method according to claim 10, wherein before step (a), a step of extracting nucleic acid from the biological sample is further included. The multiple detection method according to claim 10, wherein step (b) includes sub-steps: (b1) Reverse transcription of viral genome RNA into complementary DNA; and (b2) Amplify the complementary DNA using real-time polymerase chain reaction. The multiple detection method according to claim 10, wherein the multiple detection kit further comprises a first probe specific for Tragonella virus and/or a second probe specific for Zika virus, Wherein the first probe has a nucleotide sequence selected from the following group: (a) The nucleotide sequence of SEQ ID NO: 3; (b) A nucleotide sequence complementary to SEQ ID NO: 3; and (c) A nucleotide sequence that has at least 90% identity with SEQ ID NO: 3 or its complementary sequence, Wherein the second probe has a nucleotide sequence selected from the following group: (a) The nucleotide sequence of SEQ ID NO: 7; (b) A nucleotide sequence complementary to SEQ ID NO: 7; and (c) A nucleotide sequence that has at least 90% identity with SEQ ID NO: 7 or its complementary sequence. The multiple detection method according to claim 13, wherein the first probe and the second probe are both connected to a reporter dye at the 5'end, and a quencher is connected to the 3'end. The multiple detection method according to claim 14, wherein the 5'ends of the first probe and the second probe are connected with different reporter dyes. The multiple detection method according to claim 10, wherein the multiple detection kit further includes an internal control template, which is an RNA obtained by in vitro transcription of the proA gene of Pectobacterium carotovorum (Pectobacterium carotovorum). The multiple detection method according to claim 16, wherein the multiple detection kit further includes a control primer set specific to the proA gene, wherein the control primer set is selected from: (a) a forward primer having the nucleotide sequence of SEQ ID NO: 8 and a reverse primer having the nucleotide sequence of SEQ ID NO: 9; and (b) A forward primer having a nucleotide sequence that is at least 90% identical to SEQ ID NO: 8 and a reverse primer that has a nucleotide sequence that is at least 90% identical to SEQ ID NO: 9. The multiple detection method according to claim 17, wherein the multiple detection kit further includes a probe specific to the proA gene, wherein the probe has a nucleotide sequence selected from the following groups: (a) The nucleotide sequence of SEQ ID NO: 10; (b) A nucleotide sequence complementary to SEQ ID NO: 10; and (c) A nucleotide sequence that has at least 90% identity with SEQ ID NO: 10 or its complementary sequence. According to the multiple detection method described in claim 18, the 5'end of the probe is connected with a reporter dye, and the 3'end is connected with a quencher.

Images