TW201221650A - Method for detection of enterovirus - Google Patents

Abstract

The present invention relates to primers and probes having a target sequence in the conserved 5'UTR region of enterovirus and/or the VP1 region of EV71 virus.

Description

201221650 VI. Description of the invention: [Ming 斤 彳 ' ' ' ^ ^ ^ ^ ^ ^ ^ 】 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明 发明More specifically, the present invention relates to a primer and a probe which are capable of distinguishing between E71 virus and other viruses which cause hand, foot and mouth disease, in a test mainly based on a polymerase chain reaction. Kits with primers and needles are also provided, as well as the use of the primers and probes in diagnostic methods. L Precursor; j Background of the invention Hand, foot and mouth disease (HFMD) is a common viral disease in children and infants that causes fever and foaming on the hands, feet, and frequency mucosa. The main pathogens belong to the enteroviruses of the picornavirus family, namely enterovirus 71 (EV71), kesaki virus A16 (CA16), kesaki virus B2 (CB2) and yake virus 7 (Echo 7). The picornavirus family is a large and diverse population of single-stranded genomic RNA features. EV71 is an important strain due to its special toxicity, which often leads to neurological complications and rapid death. Neurological complications caused by EV71 include aseptic meningitis, brainstem meningitis, pulmonary edema, and polio-like paralysis. More than 3 individuals have been reported to have recently reported HFMD in Asia. In China, more than 25 reports of recent epidemiology have been reported, of which 250 have caused death. In Singapore, more than 19,000 cases were reported in the 21st year and 12% were found to be caused by EV71. Although all known viral viruses of the enterovirus have been sequenced and

S 3 201221650 is publicly available, but there are few diagnostic methods available for identification of enteroviruses. The diagnostic method for the identification of enterovirus requires the use of cell culture, followed by specific detection of the infected tissue with a specific serotype antiserum neutralization test. Although this method is indeed the "gold standard," this method requires two weeks of growth, and antigen typing may be caused by non-neutralizing viruses due to harmful agglutination, antigenic drift, or multiple viruses in the sample. Obstruction. Has just developed serum methods such as enzyme-bound immunosorbent assay (E LI s A) and immunofluorescence assay (IFA). These methods can be used to detect increased during acute infection or recovery. Neutralizing antibody titers. However, these methods have been shown to have sensitivity limitations. Polymerase chain reaction (PCR) technology has also contributed significantly to laboratory diagnosis of viral infections, although PCR has been provided to improve speed and sensitivity. Techniques to detect enteroviruses, but these methods still suffer from a lack of specificity. Other attempts to improve PCR techniques include the use of reverse transcriptase PCR (RT-PCR) strategies. RT-PCR was found to be more common than conventional diagnostics. The method is more sensitive. However, the two-step RT-PCR is time-consuming and can still be contaminated. The conventional RT-PCR for detection of enterovirus requires about 6 hours of analysis. Although this has provided a relatively rapid diagnostic tool, it still does not meet the criteria for providing rapid and sensitive analysis, especially considering the wide variation in EV71 related to clinical manifestations and its serious neurological complications. And the possibility of a quick death. In addition, due to the increasing number of cases reported each year and the prospect of a serious outbreak, a fast and sensitive analysis is needed. 201221650 Accordingly, there is a need to provide an overcoming or A method of diagnosing EV71 that at least one or more of the above-mentioned disadvantages is disclosed. [Rhyme, Mingnai] Summary of the Invention The present invention has developed an assay for identifying and distinguishing enteroviruses that cause hand, foot and mouth disease. An assay for identifying and distinguishing EV71 viruses from other enteroviruses that cause hand, foot and mouth disease has been developed. The primers, probes, kits and methods of the present invention are designed to ensure optimality and sensitivity. Sequence length, and enables specific amplification of enterovirus and high sensitivity detection and differentiation of EV71 disease The assay of the present invention distinguishes between the newly identified mutant strain of EV71 virus which is different from other EV71 viruses which have been previously identified. Therefore, in the first aspect, a primer or probe having an enterovirus genome sequence is provided. The 5' untranslated region (5' UTR) is the target sequence from the lbp to the 746 bp region. The primer or probe may comprise or consist of the nucleotide sequence of any one of sequence identification numbers 1 to 3' or Its complementary sequence ° is provided in the second aspect with a forward primer as described herein for use in amplifying a nucleotide sequence of enterovirus in a test sample, wherein the primer sequence comprises or consists of: a sequence identification number a nucleotide sequence of 1 or a complement thereof. In a third aspect, there is provided a reverse primer as described herein for use in a nucleic acid sequence for the amplification of enterovirus in a test sample, wherein the primer sequence comprises Or consisting of the nucleotide sequence of any one of the sequence identification numbers 2, or a complementary sequence thereof. 5 201221650 In a fourth aspect, there is provided a probe as described herein, wherein the probe sequence comprises or consists of: a nuclear wicking sequence in sequence identification number 3, or a complementary sequence thereof. In the fifth aspect, there is provided a primer or probe having the sequence of the target in the VP1 region from 2442 bp to 3332 bp, wherein the primer is not the sequence identification number 9. In a specific example, the primer or probe consists of the nucleotide sequence of any one of Sequence Identification Nos. 4 to 6, or a complement thereof. In a sixth aspect, a forward primer as described herein is provided for use in amplifying a nucleotide sequence of an EV71 virus in a test sample, wherein the primer sequence comprises or consists of: sequence identification number 4, 10, U A nucleotide sequence of any one of 12, 13, 14, 15 or 16, or a complement thereof. In a seventh aspect, there is provided a reverse primer as described herein for use in amplifying a nucleotide sequence of an EV71 virus in a test sample, wherein the primer sequence comprises or consists of: sequence identification number 5, 17, a nucleotide sequence of any of 18, 19, 20, 21 22, 23 or 24, or a complement thereof. A probe as described herein is provided in the eighth aspect, wherein the probe sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 6. A primer set for augmenting enterovirus in a test sample is provided in the ninth complaint, comprising a pair of forward and reverse primers, wherein the forward arch scorpion comprises or consists of: sequence identification number 1 Or its complementary sequence; and the reverse primer comprises or consists of: sequence identification number 2 or its complement. In the tenth aspect, there is provided a primer set for amplifying an EV71 virus in a test sample, comprising a pair of forward and reverse primers, wherein the reference 201221650 comprises or is selected from the group consisting of: or Its complementary sequence. Sequence of groups: Groups 2 to 65. In the tenth, a primer set for detecting intestinal diseases in a test sample and a probe ^" are included or consist of the following: a positive direction = or by The following composition, sequence identifier or its complementary sequence; a reverse primer 'contains or consists of: sequence identification number 2 or its complementary sequence, and a pin, inclusion 忐 _ _ . ^ The following composition: sequence identification No. 3 or its complementary sequence. A primer set for detecting a toxic in a twelfth aspect of the test sample, and a probe comprising or consisting of: a primer set 4 and a probe , comprising or consisting of: sequence identification number 6 or its complementary sequence. In the tenth aspect, there is provided a kit for detecting intestinal diseases in a test sample and EV71 'including - used herein For the detection of enterovirus primer sets and probes, and - for the introduction of EV71 primer sets and probes. In the fourteenth aspect there is provided a group described herein or a probe as described herein 'The core (4) sequence of the towel is detectable Labeled, and wherein the detectable label is attached directly or indirectly to the probe. In the specific example, the detectable label comprises a fluorescent moiety attached to the 5' end of the probe. In another embodiment, the nucleotide sequence of the probe additionally comprises a quencher moiety attached to the 3' end of the probe. The specific example of the group or probe described herein is sequence identification. The detectable label of each of the probe sequences of number 3 and sequence identification number 6 is such that the probe sequence 7 201221650 can be independently detected. In the fifteenth aspect, a test is provided - Or no enterovirus material, including 贱_like tree towel = :: acid sequence and "" in this one or probe: 纟: provided in the sixteenth aspect with or without EV71 virus In the method, the biological sample has a step of making the nucleotide sequence obtained from the biological sample and at least the umbrella or the living. New primers or probes or combinations are provided in the seventeenth aspect with or without enterovirus and EV71 disease. The method of extracting or deriving from the biological sample contains the introduction of the enterovirus from the biological sample or the detection of a traitor used in the detection of 丽 ^ A and at least - A step of one-way = or group contact in a specific example of the method used herein. Whether or not there is a miscellaneous condition under the harsh conditions described herein additionally includes the step of determining whether the sample contains at least - a primer or a probe in the step of determining the sequence of the nucleotide acid. virus. Specifically, at least one of the primers or probes of the method described herein detects whether the nucleotide sequence is hybridized to the specific example of the formula r.ui ^ ^ ^ / The method comprises the steps of: obtaining a nucleotide sequence obtained or derived from a sample, under conditions of amplification, and at least one of the conditions described herein for detecting enterovirus ===ι Suitable for detecting enteroviruses, the group of contacts for detecting enterovirus described herein, 201221650 to generate an amplicon of the % disease t gene sequence; and (b) detecting the amplicon And a hybridization reaction between at least one probe suitable for detecting enterovirus as described herein. In a specific example of the method described herein, the method comprises the steps of: (a) obtaining a nucleotide sequence obtained or derived from a biological sample, under amplification conditions, with at least one of the A forward primer suitable for detecting £¥71 and at least one reverse primer suitable for detecting EV71 as described herein, or at least one of the contacts described herein for detecting EV712 contact to produce one of the EV71 gene sequences Amplicon of the region; and (b) detecting the amplicon and at least the hybridization reaction between the probes described herein suitable for detecting EV71. In a specific example of the method described herein, the amplification conditions comprise an amplification reaction, and the amplification reaction is polymerase chain reaction (PCR). In the specific example of the kit described herein, the kit additionally contains an amplification reagent. A method for treating a patient infected with enterovirus or EV71 virus is provided in an eighteenth aspect, comprising: determining the presence of enterovirus or EV71 virus in a biological sample from the patient using the methods described herein, The patient is then administered an antiviral composition or drug or immunotherapy. In a nineteenth aspect there is provided a use of a composition comprising an antiviral composition or a pharmaceutical or immunotherapeutic agent for the manufacture of a medicament for treating a patient suffering from an enterovirus infection, wherein the method described herein has been used Enteroviruses appear in biological samples from this patient. In the eleventh aspect, a composition is provided, which is included for treatment

S 9 201221650 Antiviral composition or drug or immunotherapy of a patient infected with enterovirus, wherein the method described herein has been used to determine the presence of enterovirus in a biological sample from the patient. BRIEF DESCRIPTION OF THE DRAWINGS, Tables, and Sequences Fig. 1 is a schematic diagram of the TaqMan probe analysis method. In the TaqMan probe-based method, the probe contains a fluorescent substance at its 5' end and a quencher (a) at its 3' end. When approached, the two dyes form a quenching system and no fluorescence is observed. After hybridization (b), the 5' exonuclease activity of Taq polymerase will hydrolyze the probe during PCR amplification. Once the luminescent material is separated from the quencher (c) and the emission of the fluorophore is no longer inhibited, glory (d) can be detected (adapted according to Applied Biosystems, USA). Figure 2 shows a plot of specific detection of enterovirus at 520 nm with water as a negative control. Other analyzed enteroviruses include CA16, CB2, CB3, Echo 6, Echo 7. Figure 3 shows the specificity of EV71 at 556 nm, with other enteroviruses and water as negative controls. Figure 4, the 5'UTR sequence of the EV71 virus (sequence identification number 7) 'Displays the region where the forward primer (SEQ ID NO: 1) and the reverse primer (SEQ ID NO: 2) bind and the probe sequence (sequence identification number) 3). Figure 5 'Retained VP1 sequence of EV71 virus (SEQ ID NO: 8) showing the region of the forward primer (SEQ ID NO: 4) and the reverse primer (SEQ ID NO: 5) and the probe sequence (SEQ ID NO: 6) . Figures 6A, B, C, D, E, and F, EV71 alignment report, showing 10 201221650 mutant strain of EV71 different from other previously identified EV71 strains. Sections 7A and B' augmented HFMD-causing enterovirus and EV71-specific serotype using multiplex RT-PCR in the CFX96 real-time PCR detection system. Sections 8A and B' augmented HFMD-causing enterovirus and EV71-specific serotypes using multiplex RT-PCR in the Rotorgene real-time PCR detection system. Table 1. Table 1 for the detection of enteroviruses causing HFMD and specificity detection. A review of the introduction of the VV71 and probe sequences. Table 2 'The nucleotide sequence of EVFPnew. Table 3, the nucleotide sequence of EVFPnew. Table 4. Components of multiple real-time RT-PCR settings. Table 5 shows the components of the volume-adjusted multiple real-time RT-PCR settings. Sequence Sequence Identification No. 1: A forward primer for enterovirus having a nucleotide sequence from position 414 to 434 in the 5' UTR region of enterovirus. Sequence Identification No. 2: A reverse primer for enterovirus, having the nucleotide sequence from position 600 to 577 in the 5' UTR region of enterovirus. Sequence Identification No. 3: Probe for enterovirus, having the nucleotide sequence from position 443 to 467 in the 5' UTR region of enterovirus. Sequence Identification Number 4: A forward primer for EV71 having the nucleotide sequence from position 2466 to 2489 in VP1, where Yi / Y2 represents C/T, respectively. Sequence Identification No. 5: The reverse primer for EV71 has the nucleotide sequence of VP1 from 11 201221650 position 2669 to 2647, where & / ruler 2 represents A/G, respectively. Sequence Identification No. 6: Probe for EV71 having the nucleotide sequence from position 2498 to 2521 in VP1. Sequence Identification No. 7: Retained 5' UTR region of enterovirus (enteric viral genome from 1 to 746). Sequence ID #8: VP71 retained VP1 region (enteric viral genome from 2442 to 3332). Sequence identification number 9: According to the sequence identification number 4, the forward reference of the EV71, where respectively; R system G; and 丫 2 system (:. Sequence identification number 10: according to the sequence identification number 4, the positive reference of the EV71 , which are separately 丫丨 ;; R G G; and 丫 2 丁. Sequence Identification No. 11: According to the serial identification number 4, the positive reference of EV71, respectively; R system A; and 丫 2 system ( Sequence identification number 12: According to the sequence identification number 4, the forward reference of the EV71, which is separately ; ;; R system A; and 丫 2 丁. Sequence identification number 13: according to the serial identification number 4, The positive introduction of EV71, which is separately 丫丨 (:; R is G; and 丫 2 is (:. Sequence identification number 14: according to the serial identification number 4, the positive reference of EV71, which is separately R; R is G; and 丫 2 is D. Sequence identification number 15: According to sequence identification number 4, the positive reference of EV71, where respectively; R system A; and 丫 2 system (:. Sequence identification number 16: According to the sequence identification number 4, the positive reference of the EV71, which is separately Systematic; R is A; and 丫2 is D.

S 12 201221650 Sequence identification number 17: According to the sequence identification number 5, the reverse reference of EV71, where γ is T; Ri is G; and R2 is G. Sequence identification number 18: According to the sequence identification number 5, the reverse reference of the EV71, wherein γ is T; and R2 is A, respectively. Sequence identification number 19: According to the sequence identification number 5, the reverse primer of EV71, wherein γ is T; 1^ is eight; and R2 is G. Sequence identification number 20: According to the sequence identification number 5, the reverse reference of the EV71, wherein γ is T; &amp;八; and 112 is eight. Sequence identification number 21: According to the sequence identification number 5, the reverse reference of the EV71, wherein γ is C; and R2 is G, respectively. Sequence identification number 22: According to the sequence identification number 5, the reverse reference of the EV71, wherein γ is C; and R2 is A, respectively. Sequence identification number 23: According to the sequence identification number 5, the reverse primer of the EV71, wherein γ is C; the heart is eight; and the R2 is G. Sequence identification number 24: According to the sequence identification number 5, the reverse 引 of the EV71' is γ-C; the heart is eight; and the R2 is A. I: Embodiment 3 Detailed Description Throughout this specification and the appended claims, unless the <RTI ID=0.0>&quot;&quot;&quot;&quot;&quot; Exclude any other whole or step or group of steps or steps. The virus in this invention analyzed the following hand, foot and mouth disease viruses: Enterovirus 7 is 13 201221650 (EV71); Shakchi virus A16 (CA16); Shakchi virus B2 (cb2); Shakchi virus B3 (CB3) Iko virus 6 (Ech〇6); and Iko virus 7 (Echo7). Accordingly, the term "enteric virus," as used herein, refers to such viruses. The term "specifically" refers to other enteroviruses. The methods used herein are capable of distinguishing between the enteroviruses listed above, And may additionally distinguish between other enteroviruses not listed above', but the condition is that the primer and the probe can specifically hybridize to the sequence. The primer and the probe are presented here, and unless otherwise specified, the system is continuous. , 5' to 3' nucleotide sequence. The term "amplicon" as used herein means the product of an amplification reaction. Examples of amplicons are PCR, real-time PCR, RT_pCR, competitive rt pCR, ligase chain DNA or RNA products (usually genes, DNA or DNA generated by reaction (LCR), nick LCR, strand displacement amplification (SDA), nucleic acid sequence-dependent (four) method (NASBA) ' mediated amplification (tma), etc. Fragment of rna. The term "primer" as used herein is used to mean any single-stranded oligonucleotide sequence which can be used as a primer in, for example, PCR technology. Thus, the primer finger according to the present invention can act as an extension product of the primer. Starting point of synthesis A private acid sequence that is substantially complementary to the nucleic acid strand to be replicated (forward primer) or substantially complementary to the nucleic acid strand to be replicated (reverse primer). The scorpion or probe phase may be suitable for reductive pCR Techniques. The primers and probe sequences used herein do not include the complete core of the EV71 viral genome, such as a hairy structure formed from a single nuclear pure sequence.

S 14 201221650 The design of the primer, such as its length and specificity sequence, depends on the nature of the dna and/or RNA target and the conditions under which the primer is used, such as temperature and ionic strength. The primer may be composed of the nucleotide sequences described herein, or may be 1 〇, 15, 2 〇, 25, 30, 35, 40 ' 45 ' 50, 75 ' included or present in the sequences described herein. One or more nucleotides, provided that they are suitable for specific binding of the target sequence under severe conditions. In a specific example, the primer sequence is less than 35 nucleotides in length, for example, the length of the primer is less than 34, 33, 32, 3, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18 or 17 nucleotides. The primer and the length or sequence of the probe can be modified slightly to maintain the specificity and sensitivity required in a given environment. In one embodiment of the invention, the length of the probes and/or primers described herein may be extended by 1, 2, 3, 4 or 5 nucleotides or decreased by 1, 2, for example, in each direction. 3, 4 or 5 nucleotides. The term "probe," as is well known in the art, is used herein to mean any single-stranded nucleic acid sequence capable of binding to a nucleic acid and capable of acting as a probe in PCR technology. Any primer and probe sequence can be used. A method well known in the art is synthesized. For example, a nucleotide sequence is available from Fim Base pte Ltd, Singapore. The term "contains," as used herein in connection with the probe and/or primer sequences described herein. Unless otherwise stated or modified, it may be considered to include, for example, a sequence of 丨, 2, 3, 4 or 5 nucleotides in length.

S

15 201221650 "There are 4 hybrids in any other known phase of Yan 2 or to the viral gene strip 2 =: "Severe, hybrid, I, = ^, ^ ^ How to change the temperature, probe length and salt concentration in the public = Γ special-sexual hybridization. Hybridization and washing conditions of the fine probe "specifically combined, or "specifically, to the enterovirus or ^71 virus nuclear bitter acid sequence of its target region" means that the primer or probe under experimental conditions, such as Under stringent hybridization conditions, it will be double-stranded (double-stranded nucleotide sequence) with part of this region or with the entire region, and under these conditions, the primer-probe will not be analyzed. The other regions of the nucleotide sequence present in the sample form a double strand. The term "target sequence" as used herein is a region of the enterovirus or EV71 viral nuclear sequence (DNA or RNA, such as genomic DNA, message RNA or an amplified version thereof), which has a sequence with a probe or primer. The parts (ie, some degree cannot match) or all agree; however, the reverse primer is the reverse complement of the sequence it recognizes (or, to some extent, cannot match). In the context of the primer, the target sequence generally means a region of the enterovirus or EV71 viral sequence which, after being aligned with another enterovirus or EV71 viral nucleotide sequence of the dinus, has a nucleotide difference of less than one nucleotide. And the system - 16 201221650 pieces under the condition that the primer can be combined. As for the probe, the target sequence is usually an "amplicon", that is, a sequence amplified by the primer sequence, and a sequence in which the probe can bind under severe conditions. Of course, the condition is a reverse primer and The reverse complementation of the primer phase conforms to the present invention. The present invention provides a method for detecting a virus and detecting an EV 71 virus. The 5, UTR and/or EV7RVpi of the enterovirus promotes specific detection of enteroviruses. A specific region of the EV71 virus has been identified. In one embodiment of the invention, the enterovirus can be identified by detecting the target sequence in the region defined by the sequence identification number 7. In one embodiment of the present invention, The £, 71 virus is identified by detecting the sequence of the target in the region defined by sequence identification number 8. The sequence shown can be identified by any means known in the art. For example, the primers and/or probes described herein can be used. The needle is used to detect the target sequence. In one embodiment, the primer described herein has the "position" of Table i, the sequence of the target in the identified region. Thus, in one embodiment, a primer or primer set is provided having a sequence of 4 from 1 to 746 bp in the 5' UTR of enterovirus. In another specific example, a primer or primer set is provided which has a target sequence in the region from 2442 to 3332 bp in VP1 of EV71. More specifically, k is provided with a forward primer and a reverse primer as described herein, wherein under amplification conditions, for example, in the methods described herein, the forward and reverse primers are capable of amplifying such The sequence in the zone. Further, there is provided a probe as described herein which is capable of hybridizing to such an amplified sequence. In one embodiment of the invention, the sequence of the primer is located in the region identified by the "location" of Table j. 17 201221650 适田地海引子 or probe can be at least 95% of the length of the primer or probe, preferably more than 95%, such as 6 = 97%, 98%, 99%, And optimally over its length, with 100% of its target viral sequence. The bow tweezers or probes of the present invention may have 1, 2 or more mismatches with the target sequence 全部 at the entire nucleation position of the primer or the abutment, depending, for example, on the length, temperature, and reverse of the probe. Conditions and requirements of analytical methods. Of course, the condition is that the sequence in which the reverse primer is complementary to the reverse complement of the primer sequence meets these conditions. ^ Suitably, each nucleotide of the primer or probe and its counterpart nucleic acid form a hydrogen chain. Preferably, the primer or probe is complementary to the target sequence &amp; MA: Tl^c: G test base pairing degree is evaluated such that adenine (4) ^ material and thymus money (take the right, while bird dung (6) nuclear thief Pair with the thymus shouting, or vice versa. In the RNA form, τ can be replaced by u (uridine). In one example, 'inosine (1) can be included in a sequence that is considered to be complementary to another sequence, given its ability to arbitrarily pair with adenine, thymidine, or nine-mouth. The letter 丫1 or 丫2 used herein when the nucleotide sequence C or T is used in the nucleotide sequence; and the letter &amp; or ruler 2 when using the day temple in the nucleotide sequence Means the nucleotide acid A or G referred to. The use of subscripts is only presented to distinguish between ulnar or purine nucleotides, and there is no other thought about this point. " Biological sample" means a tissue or cell sample from a patient that has been obtained, removed or separated from a patient. The term "obtained or derived from" is used herein to mean a Intrinsic, that is, it means any nucleotide sequence that is isolated directly from a biological sample or any nucleotide sequence derived from the sample.

S 18 201221650 Table 1: Nucleotide sequences for detection of HFMD-causing enteroviruses and specific detection of EV71 specific primers and probes. Primer/probe nucleoside sequence (5'-3') Positional sequence number Victory virus detection 5UTRFP3 ACATGGTGCGAAGAGCCTATT 414 to 434 1 5UTRRP3 GTCACCATAAGCAGCCAATATAAG 600 to 577 2 5UTR probe TAGTAGTCCTCCGGCCCCTGAATGC 443 to 467 3 EV71 detection EVFPnew GAGAGY1TCTATAGGRGAY2AGTGTG 2466-2489 4 EVRPnew TGCYGTACTGTGTGARiTTAAGRzA 2669-2647 5 EV probe ACTTACCCAGGCCCTGCCAGCTCC 2498-2521 6 ,---- Y, /Y2-C/T ' R! /R2-A/G Table 2: EVFPnew forward primer core for EV71 detection Glycosidic acid sequence. Nuclear primordial (5, a 3,) GAGAGY, TCTATAGGRGAY2AGTGTG (SEQ ID NO: 4) Y, R Y2 sequence identification number _ T G C 9 T G T 10 T A c 11 T A T 12 C G c 13 C G T 14 C A c 15 C A T 16

GAGAGTTCTATAGGGGACAGTGTG

GAGAGTTCTATAGGGGATAGTGTG

GAGAGTTCTATAGGAGACAGTGTG

GAGAGTTCTATAGGAGATAGTGTG

GAGAGCTCTATAGGGGACAGTGTG

GAGAGCTCTATAGGGGATAGTGTG

GAGAGCTCTATAGGAGACAGTGTG

GAGAGCTCTATAGGAGATAGTGTG Table 3: Nucleic acid of EVFPnew reverse primer for EV71 detection ------------ Nucleotide sequence (5,-3,) γ Ri R2 ^煸

TGCYGTACTGTGTGAR^TAAGRzA (SEQ ID NQ:5)

TGCTGTACTGTGTGAGTTAAGGA

TGCTGTACTGTGTGAGTTAAGAA

TGCTGTACTGTGTGAATTAAGGA

TGCTGTACTGTGTGAATTAAGAA

TGCCGTACTGTGTGAGTTAAGGA

TGCCGTACTGTGTGAGTTAAGAA

TGCCGTACTGTGTGAATTAAGGA

TGCCGTACTGTGTGAATTAAGAA 19 201221650 Accordingly, the present invention provides a primer or probe comprising the sequence identification numbers 1, 2, 3, 4, 5, 6, 10, 11, 12, 13, 14 shown in Tables 1-3. Nucleotide sequence of any of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24. The invention further provides a primer set for enterovirus detection comprising the following primer pairs: Group 1: Sequence Identification Numbers 1 and 2; The invention additionally provides a primer set for EV71 detection, comprising one or more The following pairs of primers: Group 2: Sequence Identification Numbers 10 and 5; Group 3: Sequence Identification Numbers 11 and 5; Group 4: Sequence Identification Numbers 12 and 5; Group 5: Sequence Identification Numbers 13 and 5; Group: Sequence identification numbers 14 and 5; Group 7: Sequence identification numbers 15 and 5; Group 8: Sequence identification numbers 16 and 5; Group 9: Sequence identification numbers 10 and 17; Group 10: Sequence identification number 11 And 17; Group 11: Sequence Identification Numbers 12 and 17; Group 12: Sequence Identification Numbers 13 and 17; Group 13: Sequence Identification Numbers 14 and 17; Group 14: Sequence Identification Numbers 15 and 17; Group 15 : Sequence identification numbers 16 and 17; Group 16: Sequence identification numbers 10 and 18; Group 17: Sequence identification numbers 11 and 18; Group 18: Sequence identification numbers 12 and 18; Group 19: Sequence identification number 13 and 18; Group 20: Sequence Identification Number 14 18; Group 21: Sequence Identification Numbers 15 and 18; Group 22: Sequence Identification Numbers 16 and 18; Group 23: Sequence Identification Numbers 10 and 19; Group 24: Sequence Identification Numbers 11 and 19; Group 25: Sequence Identification Numbers 12 and 19; Group 26: Sequence Identification Numbers 13 and 19; Group 27: Sequence Identification

S 20 201221650 Identification Nos. 14 and 19; Group 28: Sequence Identification Numbers 15 and i9; Group 29: Sequence Identification Numbers 16 and 19; Group 3: Sequence Identification Numbers 1 and 20; Group 32: Sequence Identification No. u and 2〇; Group 33: Sequence Identification Numbers 12 and 20; Group 34: Sequence Identification Numbers 13 and 2; Group 35: Sequence Identification Numbers 14 and 2; Group 36: Sequence Identification Number 15 and 20; Group 37: Sequence Identification Numbers 16 and 2; Group 38: Sequence Identification Numbers 10 and 21; Group 39: Sequence Identification Numbers 11 and 21; Group 40: Sequence Identification Numbers 12 and 21; Group 41 : Sequence identification numbers 13 and 21; Group 42: Sequence identification numbers 14 and 21; Group 43: Sequence identification numbers 15 and 21; Group 44: Sequence identification numbers 16 and 21; Group 45: Sequence identification number 10 and 22; Group 46: Sequence Identification Numbers 11 and 22; Group 47: Sequence Identification Numbers 12 and 22; Group 48: Sequence Identification Numbers 13 and 22; Group 49: Sequence Identification Numbers 14 and 22; Group 50: Sequence identification numbers 15 and 22; group 51: sequence identification number 16 and 22; Group 52: Sequence Identification Numbers 10 and 23; Group 53: Sequence Identification Numbers 11 and 23; Group 54: Sequence Identification Numbers 12 and 23; Group 55: Sequence Identification Numbers 13 and 23; Group 56: Sequence identification numbers 14 and 23; Group 57: Sequence identification numbers 15 and 23; Group 58: Sequence identification numbers 16 and 23; Group 59: Sequence identification numbers 1 and 24; Group 60: Sequence identification number 11 and 24; Group 61: Sequence Identification Numbers 12 and 24; Group 62: Sequence Identification Numbers 13 and 24; Group 63: Sequence Identification Numbers 14 and 24; Group 64: Sequence Identification Numbers 15 and 24; and Group 65 : Sequence identification numbers 16 and 24. The invention further provides a probe for enterovirus detection comprising a sequence of 21 201221650 or a sequence of tactile number 3. The probe may be composed of a core (four) sequence as shown in sequence identification number 3, or may be 6 7 8 9 , 1 〇, u, 12, 13, i4, b, π, 17, 18, 9 or 20 25 30, 35, 40, 45, 50, 75, 1 or more core acids containing or falling within the sequence of the sequence number 3, provided that they are suitable for the specific H combination described herein. The target sequence within the enterovirus. The invention further provides a probe for EV71 detection, comprising a nuclear (four) sequence of any of sequence identification number 6, the probe may be composed of a nuclear pure sequence shown in sequence identification number 6, or may be 5, 6, 7, 8, 9, 1(), 11 12 13 14, 15, 16, 17, 18, 19 or 2〇25 3〇35, 45 5Q 75, 100 or more containing or falling within sequence identification number 6 The acid in the sequence, provided that it is suitable for the specific sequence of the VP1 region of the EV71 nucleus (tetra) sequence described herein. In one embodiment of the invention, the length of the probe sequence is less than 35 nucleotides', for example, the length of the probe sequence is less than 34, 33, 32, 31, 30, 29 28 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17 or 16 nucleotides. In a specific embodiment of the present invention, wherein the probe is used in combination with a primer pair in the method, the probe corresponds to a part or all of VP1g capable of amplifying a 5, UTR or EV71 viral polynucleotide fragment of enterovirus, and the probe is capable of Bonded thereto or the probe is attached to a solid support. The side primers and/or probes may additionally include a detectable label such that the probe can be detected. Examples of tags that can be used include: Fire Cursor

S 22 201221650 Notes or reporter dyes, for example, 6-carboxyfluorescein (6FAMTM), NEDTM (Applera Corporation), HEXTM or VICTM (Applied Biosystems); TAMR ATM label (Applied Biosystems, CA, US A a chemiluminescent label such as a ruthenium probe; and a radioactive label, for example, ruthenium, in the form of a ruthenium-labeled thymidine. 32_Phosphorus can also be used as a radioactive label. In one embodiment, the detectable label is attached directly or indirectly to the probe. The detectable label can comprise a fluorescent portion attached to the 5' end of the probe. The nucleotide sequence of the probe may further comprise a quencher moiety attached to the probe. In one embodiment, each of the probe sequences described herein, for example, a sequence comprising or consisting of sequence identification number 3 and sequence identification number 6, a detectable label is the probe sequence The detectable label can be independently detected. In one embodiment of the invention, the probe may comprise, at its 5' end, a fluorescent reporter dye as described herein as a detectable label and a quencher moiety at its 3' end. The quencher can comprise a non-fluorescent quencher (NFQ). Optionally, a minor groove binding protein (MGB; Appiied Biosystems) can be added to the probe, such as the 3 ap end of the probe. In a specific example, the quencher moiety can be Black Hole Quencher (BHQ). In another embodiment, the probe can have an Eclipse (TM) Dark Quencher and an MGB (TM) portion located at the 5th end of the probe. The kit is intended to be applied to a specific example of a multiplex PCR technique in which the probe is labeled with any other (four) reflective probe probe (10) detection tool using k methods, each of which is in the probe sequence Same reaction procedure

It can be detected independently in S 23 201221650. That is, in a specific example, a different label, such as a fluorescent dye or a label, can be selected for detecting enteric virus and/or EV71 virus. The ^ sign is attached to the 5 end of the probe. A quencher, for example, BiackH〇le Quencher (BHQ), is attached to the 3' end. In one embodiment, the fluorescent dye is selected from the group consisting of 6_fam, hex, Texas Red, and Cy5. In a particular embodiment, the probe for enterovirus is labeled with 6-FAM and the probe for EV71 is labeled with hex. The sequences of the enterovirus according to the present invention and the E V 7 丨 primer and probe are shown in Table 1. The sequences of various specific examples of the VP1 primer are shown in Tables 2 and 3. The TaqMan probe can independently detect the fluorination of different wavelengths by separately emitting fluorescent light (four) that emits different wavelengths of fluorescence. This allows the EV71 to be distinguished by viewing the fluorescence at different wavelengths &amp; Other enteroviruses. In a specific embodiment, the primers and probes of the present invention may contain or comprise a naturally occurring nucleotide structure or assay, for example, adenine (4), cell spray. Set (C), bird dung W (G), Lin Qian (7) money and urine (9). Muscle pain (1) can be included in the sequence as needed. In another embodiment, an analog of the nuclear structure or a synthetic (4) synthesis may be included in the sequence of the probe. "Modified" or "synthetic," is a non-naturally occurring nuclear-pure structure or test base that can replace the test of the probes, i. 2, 4 (4) ridges. In the specific case, H i 6, 7, 8, 9 or whole thymus can be replaced by 5 singularity du 彳5~ fluorenyl dC' and the 24 201221650 quencher such as BHQ can also be included in the sequence. Provided is a kit for detecting enterovirus comprising the following components: (1) at least one primer or primer set having the sequence of the 5, UTR of the enterovirus as described herein; and (ii) at least one such as Here, the probe having the target sequence within the 5, UTR of the enterovirus amplified by the primer (1). The present invention additionally provides a kit for detecting EV71 comprising the following components: (1) at least one as in a primer or primer set having the sequence of the target within the range of 乂71; and (ii) at least one probe having the sequence of the VP1 of the EV71 amplified by the primer (1) as described herein The present invention further provides a kit for detecting and distinguishing both enteroviruses and EV71, including Component: (i) at least one primer or primer set for enterovirus as described herein and at least one primer or primer set for EV71 as described herein; and (u) at least one as described herein Probe for enterovirus and at least one probe for EV71i as described herein.

In one embodiment, the kit comprises a forward primer, a reverse primer, and a probe sequence having a sequence of rods within the region amplified by the forward and reverse primers. In a specific example, the primer set is capable of amplifying a sequence (amplicon) of a portion of the 5&apos; UTR of the enterovirus, and the probe is capable of hybridizing to the amplicon under stringent conditions. In another embodiment, the scorpion group I is capable of amplifying a sequence of the portion of the 71 virus (the scorpion), and the genomic color is sufficient to hybridize to the amplicon under severe conditions. In a specific example, the set of keys may include: (8)- having or including a sequence identification number! And the introduction of 2 and -

25

S 201221650 probe having or comprising sequence identification number 3; and/or (b) - a pair of primers having or comprising sequence identification numbers 4 and 5, or any of groups 2 through 65 as described herein The primer pair, and a probe having or including the sequence identification number 6, and the primer having the sequence identification number 4 are not the sequence identification number 9. In a specific example of the present invention, the forward primer used in the present invention does not have the sequence identification number 9. For example, in a specific example, the forward reference having sequence identification number 4 is not sequence identification number 9. The kits described herein may further comprise an amplification reagent as desired. For example, 'expansion reagents may include enzymes having polymerase activity, enzyme cofactors such as 'magnesium or manganese; salts; nicotinamide adenine dinucleotide (NAD); and deoxynucleotide tri-disc acid ( dNTPs), (dATP, dGTP, dCTP, and dTTP) 〇 detection method In another embodiment of the present invention, there is provided a method for determining the presence or absence of enterovirus in a biological sample or a test sample, comprising The sample obtains or proceeds from a nuclear thief sequence in combination with at least one of the primers or probes or groups as described herein. In a further embodiment of the invention, there is provided a method for determining the presence or absence of EV71 virus in a biological sample or test sample, comprising subjecting a nuclear derived or derived from a biological sample to at least one species The steps of contacting the primer or probe or group described herein. In another embodiment, there is provided a method for determining the presence or absence of enterovirus and with or without EV71 virus, comprising equating a nucleotide sequence derived from a biological sample or 26 201221650 with at least one as herein The step of introducing the primer or probe or group. In one embodiment, the nucleotide sequence is a biological sample (e.g., a test sample) or has been isolated from a biological sample. The method of the invention may further comprise amplifying the nucleotide sequence and detecting the amplified nucleotide sequence in the sample. Alternatively or additionally, the methods of the invention may further comprise contacting the nucleotide sequence or amplified nucleotide sequence with one or more probes as described herein. In one embodiment, the nucleotide sequence is isolated or purified from a biological sample. In RT-PCR, genomic DNA contamination, such as extra substances from a patient's sample, may result in false positives. In one embodiment, the genomic DNA is removed or substantially removed from the sample to be tested, or is included in the method of the invention. In situ hybridization In one embodiment of the invention, in situ hybridization can be used to detect enteric virus. In one embodiment of the invention, in situ hybridization can be used to detect EV71 virus. "In situ hybridization" means a hybridization reaction that allows direct visualization of the morphological site of a specific DNA or RNA sequence using a primer or probe according to the invention on intact chromosomes, cells or tissues isolated from a patient. . Hybridization of polynucleotides can be carried out using any suitable hybridization method as well as detection systems. Examples of hybridization systems include the conventional dot-point method, the Southern dot method, and the sandwich method. In the case of enterovirus and/or EV71 virus, specific nucleic acid sequences, such as probes or primers described herein, biotin can be used as a marker

S 27 201221650 Wei, then detected hybridization through a bio-(four) 'chain-self-coupled non-radiochromic system. Other reverse hybridization systems can also be used. Tissue Samples The methods described herein are suitable for use in samples of fresh tissue, cold tissue, tissue-preserved tissue, and tissue-preserved tissue. The sample can be a biological sample. Non-limiting examples of biological samples include whole blood or components thereof (eg, blood, serum), urine, saliva, cerebrospinal fluid, bronchoalveolar lavage fluid, breast milk, throat swabs, rectal forceps, and vesicle fluids . In one embodiment, the sample is a whole blood sample. Biological samples contemplated herein include cultured biological materials, including samples derived from cultured cells, such as cultures or cell deposits collected from cultured cells. Accordingly, a biological sample means a lysate, a homogenate or an extract prepared from the entire organism or a tissue, cell or component portion thereof or a segment or portion thereof. Biological samples can also be modified prior to use, for example, purification, dilution, and/or centrifugation of one or more components. Known extraction and purification procedures can be used to separate nucleic acids from the sample. The nucleic acid extracted from the sample can then be used directly, or more preferably after the polynucleotide amplification step (e.g., PCR). In a particular example, such as in reverse hybridization analysis, RNA may need to be reversed to cDNA prior to amplification. In the latter two cases, the amplified polynucleotide is derived from the sample. The invention additionally provides a method of treating a patient comprising: determining whether a patient-derived biological sample tissue contains a nucleotide sequence of enterovirus and/or EV71 virus using the methods described herein, and infecting the hand, foot and mouth 201221650 Or the patient with the relevant symptom or immunotherapy to treat the patient. Accordingly, the present invention provides a method for screening for a human sample from a human patient with or without enterovirus and/or EV7 infection in a clinical application. In one embodiment, a method of diagnosing a patient is provided, comprising the method or method step described herein, wherein the patient is diagnosed with or having enterovirus and/or EV71 virus. In still another specific example of the present invention, there is provided a method of treating a patient comprising determining whether the patient is infected with enterovirus and/or EV71 virus by using the method of the present invention, and then administering the composition, Pharmacy or immunotherapy' to clear the infection or reduce secondary symptoms or prevent or slow the recurrence of the disease. The primers and probes of the present invention can be used to detect enteroviruses and/or EV71 using any of the methods known in the art, non-limiting examples of which include polymerase chain reaction (PCR), such as immediate reverse transcription (rt) pCr. Polymerase chain reaction (PCR) PCR is an enzyme-mediated reaction used to amplify specific target DNA sequences. By amplifying the target DNA sequence in the DNA template, it is then possible to produce a million copies of the target DNA sequence. This is useful when the biological sample contains only a small amount of DNA. The PCR system is carried out in a mixture containing DNA polymerase, primer pairs (forward and reverse) and four deoxynucleotide triphosphates (dNTPs) and with the aid of thermal cycling. Although the PCR method is used to amplify DNA, RNA can also be amplified by converting an RNA into cDNA by performing an additional reverse transcription step prior to starting the analysis. The primers used in the methods described herein are selected based on their ability to amplify the 5' UTR of the enteric disease 29 201221650 and/or the νρι region of the EV71 viral nucleotide sequence. For example, the 'forward primer and the reverse primer are based on their amplification of the 5'UTR of the enterovirus nucleotide sequence and/or the vplg of the EV71 nucleotide sequence, thereby generating the 5'UTR and/or the enterovirus nucleotide sequence. Or the ability of the amplicon of the V P1 region of the EV71 nucleotide sequence to be selected. Thereafter, the probe is selected based on the force of its hybridization to the sequence of the amplicon thus produced, for example, the probe is based on its 5' UTR and/or eV71 nuclear acid. The ability of the sequence VP1 amplicon is selected. Immediate Reverse Transcription Polymerase Chain Reactions Thus, the primers and probes described herein can be used to detect nucleic acid sequences via nucleic acid amplification techniques. This is the most commonly used technique in today's laboratories. Detection is performed using real-time reverse transcription polymerase chain reaction (RT-PCR), nested PCR or nucleic acid sequence-dependent amplification (NASBA). In one embodiment of the invention, the amplification reaction is RT-PCR. The RT-PCR can be a 3-step PCR method or a 2-step PCR method. In the specific examples of the invention described herein, the RT-PCR reaction conditions comprise a 3-step PCR method comprising, for example, 40 thermal cycles in a CFX96 real-time PCR detection system or in a Rotorgene real-time PCR detection system. The procedure of reading the reaction mixture at 95 seconds for 30 seconds at 60 ° C for 30 seconds and at 72 ° C for 30 seconds can be as shown in Table 4 or 5. For example, in one embodiment, the reaction mixture can be as shown in Table 5. Optionally, the methods described herein can comprise the step of synthesizing cDNA from RNA at 10 °C for 10 minutes followed by deactivation of the reverse transcriptase at 95 °C for 5 minutes. 30 201221650 Instant PCR is a modified form of conventional PCR. In conventional PCR, the amplicon is detected by endpoint analysis, that is, after the reaction is completed, the DNA is electrophoresed on a Qiongyue gel. However, real-time PCR is capable of accumulating the product to be detected just as the reaction proceeds. This makes it possible to report an increase in the amount of DNA by the addition of fluorescent molecules (such as DNA-binding dyes) and probes in the immediate PCR reaction, as the fluorescence signal is proportionally increased. The probes generally used are TaqMan probes. In the endpoint PCR plot, the 'X-axis represents the number of PCR cycles. The amount of PCR product doubles in each cycle until it is sufficient to produce a fluorescent signal. The number of cycles in which it occurs is called the threshold period (Ct). A standard curve ' is drawn to make an absolute amount by continuously diluting a control sample of known concentration. The amplified standard dilution continuous map can be machine plotted, Ct vs. starting copy number or logarithm of concentration. Thus the number or concentration of copies starting at one of the unknown samples can be quantified by comparing Ct with the help of a standard curve. TAQMAN Probe Chemistry Figure 1 shows an illustration of the TaqMan® probe. In one embodiment, the probe consists of two types of fluorescent light: a fluorescent portion of the (R) dye and a quencher (Q) attached to or away from the template DNA and prior to the action of the polymerase. This probe uses the fluorescence resonance energy transfer (FRET) theory. The reporter dye can be found at the 5&apos; end of the probe and the quencher is at the 3&apos; end. The TaqMan probe is attached to a specific fragment of the sample DNA after the denaturation step. After the reaction mixture has cooled down, the primer will bind to the DNA. After all in place, as shown in the lb diagram, 'Thg polymerase begins to add nucleotide acid and begins to interrupt the TaqMan probe from the dna plate. The reporter gene was first interrupted. Separate from the quencher 1 31 201221650, the reporter gene is free to release its energy. This is shown in lc-d. Fluorescence can be quantified. The invention will be further illustrated by the following non-limiting examples, in which RT-PCR refers to reverse transcription polymerase bond reaction: Example 1 Design of enterovirus primer and TaqMan probe enterovirus 5'UTR region encoding RNA Synthesis and translation. The VP1 region possesses a high degree of antigenicity and genetic diversity that can be used to distinguish enterovirus serotypes. The 5' UTR and VP1 regions were analyzed from the GenBank database maintained by National Institutes of Health, USA. (http://www.ncbi.nlm.nih.gov). The primers and probes are designed to confirm the specificity and the optimal sequence length for sensitivity. The 5' UTR retention region is from lbp to 746 bp, and VP1 is from 2442 bp to 3332 bp. Primers and probes were designed using the Lasergene 7 software. The specificity of the primers and probes was analyzed using the BLAST assay in GenBank at the NCBI website (http://www.ncbi.nlm.nih.gov/BLAST). The pair is named 5UTRFP3/5UTRRP3 (sequence ID numbers 1 and 2) and EVFPnew/EVRPnew for vpi (sequence ID numbers 4 and 5). Named 5UTR probe (sequence number 3) and EV probe (sequence identification number TaqMan probe; designed from the 5'uTR and ν71 virus νρι regions, respectively, for specific amplification Enterovirus and £71. Choose a different kind of firefly that can distinguish between the 5'UTR area and the VP1 area.

S 32 201221650 Light dye. Let (10) administer the probe. The quencher, version kH〇le Quencher (BHQ)' was attached to the 3' end. For the 5, the glory dye selected by Utr is 6-FAM, and the choice for γΡ1 is 1^Father. The sequences for the 5'UTR and VP1 primers and probes are shown in the illusion. The TaqMan probes are labeled with different fluorescent dyes that emit fluorescence at different wavelengths. This enables detection and differentiation of enteroviruses at different bands and differentiation of EV71. This system eliminates the spectral crosstalk&apos; in the detection band and enables high sensitivity to read fluorescence from each sample. ° 6-FAM (6-stable luciferin)-5'UTR (520 nm). HEX (six gas fluorescein) _VP1 (556nm) The label of each probe is shown below: -6-FAM (6-carboxy luciferin) is labeled on the 5' end of the 5UTR probe - HEX (six gas fluorescence) The standard is labeled on the 5' end of the EV probe - BHQ 1 is labeled on the 5UTR and on the 3' end of the EV probe. The details of the primer and the probe sequence, as well as the 5' UTR and the region of the VP1 gene, are provided in Figures 4 and 5. Example 2

Extraction of viral RNA RNA was extracted from the supplied hand, foot and mouth patient samples using the QIAamp® Virus RNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions and stored at -20 °C. All extractions are performed in the Biosafety Level 2 standard to prevent any accidental infection with live hand, foot and mouth virus RNA. 33 201221650 Example 3 Multiple-in-time RT-PCR analysis Multiple real-time RT-PCR analysis was performed using the CFX96 real-time PCR detection system from Bio-Rad Laboratories, United States and the components listed in Table 2. Table 4: Multiple Instant RT-PCR Set Components Reagent Volume One Step RT-PCR Reaction Mixture 12.5 μΙ&gt; Reverse Transcriptase Ο.Ομί 5UTRFP3 (ΙΟμΜ) 1.25μί 5UTRRP3 (10μΜ) 1.25μί EVFP(lOpM) Ι.Ομί ΕνΐΙΡ(ΙΟμΜ) Ι.Ομί 5UTR3 probe (10μΜ) Ι.Ομί EV probe (10μΜ) Ι.Ομί Nuclease-free 2.520 2.5μί RNA sample 2.5μί Final reaction volume 25.0μί Set the following conditions for real-time PCR reaction : cDNA was synthesized from RNA at 5 CTC for 10 minutes, followed by reverse transcriptase deactivation at 95 °C for 5 minutes. Forty thermal cycles were performed in the CFX96 real-time PCR detection system at 10 seconds at 95 °C, 30 seconds at 60 °C, and 30 seconds at 72 °C. Example 4

Real-time RT-PCR using the CFX96 real-time PCR detection system The CFX96 real-time PCR detection system from Bio-Rad Laboratories, United States was used for real-time RT-PCR analysis. Its use is established

S 34 201221650 The optical technology on the C1000TM thermal cycler and the six-band platform combined with advanced optics technology create precise thermal control for accurate and reliable detection with a detectable range from 450-730mn fluorescence/ The wavelength is emitted. When performing an instant PCR experiment, it can be done with the help of CFX Manager software. The solid-state optical technology of the CFX96 system consists of six LEDs with filters, each with a corresponding optical diode with a filter, which maximizes the fluorescence detection of specific dyes in a specific band, providing accurate quantitative and target identification. Sensitive detection of force. The scanning is performed directly above the sample platform, and the optical shuttle individually illuminates and reads the fluorescence of each hole with high sensitivity and no stringing. In the mother positioning and each scan, the optical shuttle is repositioned above each hole, so the light path is always optimal, without sacrificing the data collection of one of the waves 4 in order to The passive reference is normalized. Example 5 When using instant multiplex RT-PCR, the primers and probe specificity were designed using the sequence shown in Table 1, and the enterovirus caused by hand, foot and mouth disease was obtained according to the method described in Examples 丨 to 4. Specificity detection and discrimination and specificity discrimination of the serotype of EV71 are shown in Fig. 2 and Fig. 3. In Fig. 2, the amplification results of all the enteroviruses analyzed were observed in the fluorescence band of 52 〇rim. When the fluorescent band was converted to 556 nm, fluorescence emission was observed only in the result of amplification of EV71 (Fig. 3). All other enteroviruses showed negative. The TaqMan probe is labeled with a different glory dye that emits fluorescence at different wavelengths. This allows the detection of enterovirus in one band while discriminating the serotype of EV71 in another band, 201221650. This system eliminates spectral crosstalk in the detection band and its high sensitivity reads fluorescence from each sample well. Example 6 EV71 Sequence Alignment Report A comparison report was made for the EV71 design specific primer (EVFP and EVRP) and probe (EV probe), as shown in Figure 6. The alignment was performed with 17 EV71 strains (S41, S10 'MS, 1585 JVP1 ' 2933 JVP1, 75JVP1, 962JVP1, NUH0012-08, NUH0013-08, NUH0037-08, NUH0043-08, NUH0047-08, NUH0049-08, NUH0075). -08, NUH0083-08, NUH0085-08, NUH0086-08) and the VP 1 sequences of two CA16 strains (CA16, CA16-2). All sequences were obtained from GenBank. According to the alignment report, the points indicated by dots represent the retained nucleotides (A, T, G or C) across all 19 strains. The top column (represented by &quot;majority&quot;) represents the reserved nucleotide. In the comparison report, the following positions correspond to the primers: EVFP, EVRP; and the probe: EV probe. Location 25 - 48 - EVFP Position 57 - 80 -EV probe Position 206 to 228 - EVRP Example 7 Re-optimization of PCR analysis Re-optimization of PCR analysis using PCR master mix (BioRad Laboratories). The volume of the primer and probe is also readjusted, as shown in Table 5.

S 36 201221650 Table 5: Components of multiple real-time RT_pCR settings for volume re-adjustment. Reagent volume iQ Multiplex Powermix 12_5μί&gt; iS criptTM reverse transcriptase 0.5pL 5UTRFP3 (ΙΟμΜ) 0·75μί 5UTRRP3 (ΙΟμΜ) 0.75μί ΕνΡΡ(ΙΟμΜ) 0.75μί ΕνΐΙΡ(ΙΟμΜ) 0.75μί 5UTR3 probe (ΙΟμΜ) 0.5μί EV Needle (ΙΟμΜ) 0.5μί Nuclease-free pure water η2ο 5.5pL RNA sample 2.5μί Final reaction volume. 25.0μί The PCR conditions used were the same as described in Example 3: Synthesis from RNA at 50 ° C for 10 minutes cDNA, followed by reverse transcriptase deactivation at 95 ° C for 5 minutes. Forty thermal cycles were performed in the CFX96 real-time PCR detection system at 1 °C at 95 °C, 30 seconds at 60 °C, and 30 seconds at 72 °C. The same conditions were also evaluated on the R〇t〇rgene instant pCR platform from Qiagen. The specificity and efficacy of this assay was analyzed using EV71 and CA16 RNA. The results are shown in Figures 7A, 7B and 8A, 8B. Fluorescence signals in the two real-time PCR platforms, as shown in the amplification label 'shown', show greater stability and specificity in their respective bands. All results were collected, showing that this reoptimized invention can be applied across two different instant PCR platforms commonly used in the laboratory. Brief Description of C Schematic 3 Figure 1 Schematic diagram of the TaqMan probe analysis method. In the TaqMan probe

37 201221650 In the main method, the probe contains a fluorescent substance at its 5' end and a quencher (a) at its 3' end. When approached, the two dyes form a quenching system and no fluorescence is observed. After hybridization (b), the 5&apos; exonuclease activity of Taq polymerase will hydrolyze the probe during PCR amplification. Once the fluorescent material is separated from the quencher (c) and the emission of the fluorescent light is no longer inhibited, fluorescent (4) can be detected (adapted according to Applied Biosystems, USA). Figure 2 shows a plot of specific detection of enterovirus at 520 nm with water as a negative control. Other analyzed enteroviruses including CAi6, CB2, CB3, Echo 6, Echo 7 〇 Figure 3 show a map of specific detection of EV71 at 556 nm, and other enteroviruses and water as negative controls. Figure 4, the 5'UTR sequence of the EV71 virus (SEQ ID NO: 7) showing the combination of the forward primer (SEQ ID NO: 1) and the reverse primer (SEQ ID NO: 2) and the probe sequence (sequence identification number) 3). Figure 5, VP71 sequence of EV71 virus (SEQ ID NO: 8) showing the combination of the forward primer (SEQ ID NO: 4) and the reverse primer (SEQ ID NO: 5) and the probe sequence (SEQ ID NO: 6) . Figures 6A, B, C, D, E, and F, EVV1 alignment reports showing mutant strains of EV71 that differed from other previously identified EV71 strains. Sections 7A and B' augmented HFMD-causing enterovirus and EV71-specific serotype using multiplex RT-PCR in the CFX96 real-time PCR detection system. In Figures 8A and B, the HFMD-causing enterovirus and the EV71-specific serotype were amplified using multiplex RT-PCR in the Rotorgene real-time PCR detection system. [Explanation of main component symbols] 201221650 Sequence Listing &lt;110&gt;Singapore Institute of Technology &lt;120&gt; Method for detecting enterovirus&lt;130&gt; 10757SG51 &lt;160&gt; 24 &lt;170&gt; Patentln version 3.5 &lt;210&gt; 1 &lt;211 〉 21 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; 5UTRFP3 &lt;400&gt; 1 acatggtgcg aagagcctat t 21 &lt;210> 2 &lt;211> 24 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; 5 UTRRP3 &lt;400&gt; 2 gtcaccataa gcagccaata taag 24 &lt;210> 3 &lt;211&gt; 25 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; 5 UTR Probe &lt;400&gt; 3 tagtagtcct ccggcccctg aatgc 25 &lt;210> 4 &lt;211&gt; 24 &lt;212> DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; EVFPnew &lt;220&gt;&lt;221&gt; £ 201221650 &lt;222> (6)..(6) &lt;223&gt; y is c or t &lt;220&gt;&lt;221> y &lt;222&gt; (18)..(18) &lt;223&gt; y is c or t &lt;400> 4 gagagytcta taggrgayag tgtg &lt;210> 5 &lt;211&gt; 23 &lt;212> DNA &lt;213>synthetic &lt;220&gt;&lt;223&gt; EVRPnew &lt;220&gt;&lt;221&gt; r &lt;222> (16)..(16) &lt;223&gt; r is a or g &lt;220&gt;&lt;221&gt; r &lt;222&gt; (22). (22) &lt;223&gt; r is a or g &lt;400&gt; 5 tgcygtactg tgtgarttaa gra &lt;210&gt; 6 &lt;211> 24 &lt;212> DNA &lt;213&gt; Synthetic &lt;220&gt; EV probe &lt;400&gt; 6 acttacccag gccctgccag ctcc &lt;210> 7 &lt;211&gt; 746 &lt;212&gt; DNA &lt;213>synthetic &lt;220&gt;&lt;223&gt; retaining 5_UTR sequence &lt;400&gt; 7 ttaaaacagc tgtgggttgt tcccactcac agggcccact gggcgctagc actctgattt tacgaaatcc ttgtgcgcct gttttatatc ccttccctaa ttcgaaacgt agaagcaatg 2 180 201221650 cgcaccactg atcaatagta ggcgtaacgc gccagttacg tcatgatcaa gcatatctgt tcccccggac tgagtatcaa tagactgctt acgcggttga aggagaaaac gttcgttatc cggctaacta cttcgagaag cccagtaaca ccatggaagc tgcagggtgt ttcgctcagc acttcccccg tgtagatcag gtcgatgagc cactgcaatc cccacaggtg attgtggcag tggctgcgtt ggcggcctgc ctatggggag acccatagga cgctctaatg tggacatggt gcgaagagcc tattgagcta gttagtagtc ctccggcccc tgaatgcggc ta atcctaac tgcggagcac atgccttcaa cccagagggt agtgtgtcgt aatgggcaac tctgcagcgg aaccgactac tttgggtgtc cgtgtttctt tttattctta tattggctgc ttatggtgac aattacagaa ttgttaccat atagctattg gattggccat ccggtgtgta atagagctgt tatataccta tttgttggct ttgtaccact aactttaaaa tctataacta ccctcaactt tatattaacc ctcaatacag ttgaac &lt; 210 &gt; 8 &lt; 211> 891 &lt; 212> DNA &lt; 213> Synthetic &lt; 220 &gt; &lt; 223> reserved VP1 sequence &lt; 400 &gt; 8 ggagatagag tggcagatgt gatagagagc tctataggag atagtgtgag tagggcactt acccaggccc tgccagctcc aacaggtcag aacacgcagg tgagcagtca tcgactagac actggtgaag ttccagcgct ccaagctgct gaaatagggg catcgtcaaa tactagtgat gagagtatga ttgagacacg atgcgttctt aattcacaca gtacggcaga gaccaccctg gacagcttct tcagtagggc aggcttggta ggagagatag atctccctct tgagggtacc actaatccaa atggttatgc taattgggat atagacataa ctggttacgc Acaaatgcgc aggaaagtgg agctgttcac ctacatgcgc tttgatgcgg aattcacttt tgttgcgtgc actcctactg gtgaggttgt cccacaatta cttcagtata tgtttgttcc ccctggtgct cccaaaccag agtctagaga atcacttgct tggcagacag ccacaaa ccc ctcagttttt gtcaagttga ctgatccccc ggcacaggtc tcagttccgt tcatgtcacc cgcgagcgct taccagtggt tttacgacgg gtaccccacg tttggagaac acaaacagga gaaagacctt gagtatggag cgtgccctaa taatatgatg ggcactttct cggtgcgaac tgtgggttca tcaaagtcca agtatccttt ggttgtcagg atatatatga gaatgaagca tgtcagggcg 240 300 360 420 480 540 600 660 720 746 60 120 180 240 300 360 420 480 540 600 660 720 780 3 201221650 tggatacctc gcccgatgcg caaccaaaac tacctgttta aagccaatcc aaactatgcc 840 ggtaactcca tcaaaccgac cggcactagt cgtactgcca ttactaccct t 891 &lt;210> 9 &lt;211> 24 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; Sequence identification number 9 &lt;400&gt; 9 gagagttcta taggggacag tgtg 24 &lt;210> 10 &lt;211&gt; 24 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; Sequence Identification Number 10 &lt;400&gt; 10 gagagttcta taggggatag tgtg 24 &lt ; 210> 11 &lt; 211 &gt; 24 &lt;212 > DNA &lt; 213 > Synthetic &lt; 220 &lt; 223 &gt; Sequence Identification Number 11 &lt; 400 &gt; 11 gagagttcta taggagacag tgtg 24 &lt;210&gt; 12 &lt;211&Gt; 24 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; Sequence Identification Number 12 &lt;400> 12 gagagttcta taggagatag tgtg 24 &lt;210&gt; 13 &lt;211&gt; 24 &lt;212&gt;&lt;213&gt; Synthetic 4 &lt;220> 201221650 &lt;223&gt; Sequence Identification Number 13 &lt;400&gt; 13 gagagctcta taggggacag tgtg 24 &lt;210&gt; 14 &lt;211> 24 &lt;212&gt; DNA &lt;213&gt;&lt;220&gt;&lt;223> Sequence identification number 14 &lt;400&gt; 14 gagagctcta taggggatag tgtg 24 &lt;210&gt; 15 &lt;211> 24 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; Sequence identification number 15 &lt;400> 15 gagagctcta taggagacag tgtg 24 &lt;210&gt; 16 &lt;211> 24 &lt;212> DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; Sequence identification number 16 &lt;400&gt; 16 gagagctcta taggagatag tgtg 24 &lt;210&gt; 17 &lt;211&gt; 23 &lt;212> DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; Sequence identification number 17 &lt;400&gt; 17 tgctgtactg tgtgagttaa gga 23 &lt;210&gt 18 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Synthetic 5 2 01221650 &lt;220> &lt;223&gt; Sequence identification number 18 &lt;400&gt; 18 tgctgtactg tgtgagttaa gaa &lt;210> 19 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; Sequence identification number 19 &lt;400&gt; 19 tgctgtactg tgtgaattaa gga &lt;210> 20 &lt;211> 23 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; Sequence identification number 20 &lt;400> 20 Tgctgtactg tgtgaattaa gaa &lt;210> 21 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Synthetic &lt;220&gt;&lt;223&gt; Sequence Identification Number 21 &lt;400> 21 tgccgtactg tgtgagttaa gga &lt;210> 22 &lt;; 211 &gt; 23 &lt;212> DNA &lt; 213 > Synthetic &lt; 220 &lt; 223 &gt; Sequence Identification Number 22 &lt; 400 &gt; 22 tgccgtactg tgtgagttaa gaa &lt;210&gt; 23 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213&gt; Synthetic 201221650 &lt;220&gt;&lt;223&gt; Sequence Identification Number 23 &lt;400> 23 tgccgtactg tgtgaattaa gga &lt;210&gt; 24 &lt;211&gt; 23 &lt;212&gt; DNA &lt;213> Synthetic &lt;220&gt;&lt;223&gt; Sequence Identification Number 24 &lt;400> 24 tgccgt Actg tgtgaattaa gaa

Claims (1)

201221650 VII. Patent application scope: 1. A primer or probe having the sequence of the enterovirus gene sequence 5, the target sequence in the UTR from the lbp to *746bp region. 2. A primer or probe according to item 1 of the U.S. range, comprising or consisting of the nucleotide sequence of any one of the sequence identification numbers' or its complementary sequence. 3. If the positive scorpion of the first or second item of the application is used for amplifying the nuclear phase of the intestines in the test sample, the primer sequence includes the following or consists of: _ number i (4) acid sequence, or its complementary sequence. 4. The reverse scorpion scorpion of claim 1 or liigl is used for amplifying the acid sequence of the enterovirus of the test sample, and the primer sequence comprises the following or consists of: sequence identification Nucleotide sequence number 2, or its complement. 5. The probe of claim 2, wherein the probe sequence comprises or consists of: the nucleotide sequence of SEQ ID NO: 3 or its complement. 6. A primer or probe having the sequence of the target in the VP1 region from 2442 bp to 3332 bp in EV71 where the primer is not sequence identification number 9. 7. A primer or probe according to item 6 of the patent application, which is constituted by the nucleotide sequence of any one of Sequence Identification Nos. 4 to 6, or a complementary sequence thereof. 8. The forward primer of claim 6 or 7 is for the nucleotide sequence of the EV71 virus in the amplified test sample, wherein the primer sequence package 201221650 comprises or consists of: sequence identification A nucleotide sequence U' sequence of any of 鱿4, U, 13, 14, 15 or 16. · , or its complementary application patent range 6 or 7 reverse y. If the nuclear (4) sequence of the EV71 virus in the sample, the expansion test contains the following or consists of: sequence identification number 5 sequence package D , the nucleotide sequence of 20, 21, 22, 23 or 24, or the mutual probe thereof, 18, 1 〇, as in the probe of claim 6 or 7 wherein the probe sequence is read. The following or consists of: sequence identification number 6 歹丨匕 3 11 - am i nucleotide sequence. A pair of enteroviruses for augmenting a test sample, a scoop human orientation and a reverse primer pair, wherein the forward primer comprises the following sequence: sequence identification number 1 or its complementary sequence; The following or consists of: a sequence reverse complementary sequence. (d) No. 2 or its subgroup, including the list or the group of the group below, for the amplification of the EV71 virus in the test sample, the forward and reverse primer pairs, wherein the primer includes the following Composition: selected from the group consisting of Group 2 to Group 65 or its complementary sequence. - a group of enteroviruses for use in a test sample, and a probe, comprising or consisting of: a forward bowed scorpion comprising or consisting of: sequence identification number 1 or Its complementary sequence; ^reverse primer 'comprises the following: money consists of: phase recognition coding = its complementary sequence; and - probe, consisting of or consisting of the following sequence identification number 3 or its complement. 201221650 14. A primer set for detecting an EV71 virus in a test sample, and a probe comprising the following or consisting of: a primer set according to the scope of the patent application and a probe comprising the following Or consists of: sequence identification number 6 or its complementary sequence. 15. A kit for detecting enterovirus and a test sample in a test sample, comprising (a) a primer set and a probe as in claim 13 of the patent application, and (b) a primer as in claim 14 Group and probe. 16. The probe of any one of claims U to 14 or the probe of any one of claims 1, 2, 5, 6, 7, or 10, wherein the nucleoside of the sputum The acid sequence is labeled with a detectable label and the label in which the sigma is detectable is attached directly or indirectly to the probe. 17. The group or probe of claim 16, wherein the detectable label comprises a flu〇rescent moiety attached to the 5' end of the probe. 18. The set or probe of claim 17 wherein the nucleotide sequence of the probe further comprises a quencher moiety attached to the 3' end of the probe 〇 19. The group or probe of any one of claims 16 to 18, wherein each of the sequence identification number 3 of δ hai 4 and the detectable label of the probe sequence of SEQ ID NO: 6 enable the probe sequence to be A detectable label that is independently detected. 20. A method for determining the presence or absence of enterovirus in a biological sample, comprising equating a nucleotide sequence obtained or derived from a biological sample with at least one of claims 1 to 5, 11 or 13 The primer of any of the items or the step of the S 3 201221650 probe or group contact. 21. A method for determining the presence or absence of an EV71 virus in a biological sample, comprising equating a nucleotide sequence obtained or derived from the biological sample with at least one of claims 6 to 10, 12 or 14 of the scope of the patent application The primer or probe or group contact step of any of them. 22. A method for determining the presence or absence of enterovirus and EV71 virus in a biological sample, comprising equating a nucleotide sequence obtained or derived from the biological sample with at least one of claims 1 to 5, 11 Or the primer or probe or group of any one of the items of the present invention, and/or the step of contacting at least one primer or probe or group of any one of claims 6 to 10, 12 or 14. 23. The method of claim 20, 21 or 22, further comprising the step of determining whether the nucleotide sequence is hybridized to the at least one primer or probe under stringent conditions, thereby detecting whether the sample contains The virus. The method of any one of claims 20 to 23, wherein in situ hybridization is used to detect whether the nucleotide sequence is hybridized to the at least one primer or probe. 25. The method of claim 20 or 22, comprising the steps of: (a) subjecting a nucleotide sequence obtained or derived from the biological sample, under amplification conditions, to at least one of the patent claims a forward primer of item 3 and at least one reverse primer as in claim 4 of the patent application, or at least one group as in claim 11 of the patent application, in order to generate an amplicon of a region of the enterovirus genome sequence And 201221650 (b) detecting the hybridization reaction between the amplicon and at least one probe as in item 5 of the patent application. 26. The method of claim 21, wherein the method comprises the steps of: (a) obtaining a nucleotide sequence obtained or derived from a biological sample, under amplification conditions, and at least one of a positive primer of 8 items and at least one reverse primer as in claim 9 of the patent application scope, or at least one group contacted as group 12 of the patent application to generate an amplicon of a region of the EV71 gene sequence; (b) detecting the hybridization reaction between the amplicon and at least one probe as in claim 10 of the patent application. 27. The method of claim 25, wherein the amplification condition comprises an amplification reaction, and wherein the amplification reaction is polymerase chain reaction (PCR). 28. The method of claim 25, 26 or 27, wherein the amplification condition comprises a 3-step PCR reaction. 29. The method of claim 25, 26, 27 or 28, wherein the method comprises the step of providing a reaction mixture, and wherein the reaction mixture is as shown in Table 4 or 5. 30. The kit of claim 15 wherein the kit further comprises (c) an amplification reagent. 31. For the kit of claim 14 or 15, the components (a), (b) and (c) are provided in quantities as shown in Table 4 or Table 5. 32. A method of treating a patient infected with enterovirus or EV71 virus, comprising: using a method as claimed in any one of claims 20 to 29, 201221650 determining the presence of a bowel in a biological sample derived from the patient The virus or EV71 virus is then administered to the patient with an antiviral composition or drug or immunotherapy. 33. Use of a composition comprising an antiviral composition or a pharmaceutical or immunotherapeutic agent for the manufacture of a medicament for treating a patient suffering from an enterovirus infection, wherein any one of claims 20 to 29 has been used. The method of determining the presence of enterovirus in a biological sample from the patient. 34. A composition comprising an antiviral composition or a drug or immunotherapy for treating a patient infected with enterovirus, wherein the method of any one of claims 20 to 29 has been used, Enteroviruses are present in biological samples from this patient.