WO2018169550A1 - Real-time rt-pcr assay for detection of dengue, chikungunya, and zika viruses - Google Patents

Abstract

A real-time RT-PCR method for detecting and differentiating dengue virus (DENV), chikungunya virus (CHIKV) and Zika virus (ZIKV) nucleic acid is described. The method allows for the detection of any of the three viruses in a single sample. Also described are primers and probes that can be used for detecting DENV, CHIKV or ZIKV nucleic acid, as well as kits for detecting these viruses.

Description

REAL-TIME RT-PCR ASSAY FOR DETECTION OF DENGUE, CHIKUNGUNYA AND

ZIKA VIRUSES

FIELD

This disclosure concerns virus-specific primers and probes and a real-time RT-PCR assay for qualitative detection and differentiation of RNA from dengue, chikungunya and Zika viruses in biological samples.

BACKGROUND

Dengue virus, chikungunya virus and Zika virus are arboviruses that have rapidly expanded across the globe in recent years, with large-scale outbreaks occurring in Western Hemisphere territories in close proximity to the United States. Mosquitos of the genus Aedes, particularly A. aegypti and A. albopictus, which are responsible for transmission of these viruses, have recently been shown to inhabit a larger portion of the United States (Patterson et al. , West J Emerg Med 17(6):671-679, 2016). The symptoms of dengue virus, chikungunya virus and Zika virus infection can be similar, presenting challenges for an accurate diagnosis.

According to the World Health Organization (WHO), dengue virus (DENV) is the most prevalent and rapidly spreading arbovirus worldwide. DENV is a member of the flavivirus genus that also includes yellow fever virus, West Nile virus, Japanese encephalitis virus and Zika virus. The most prominent method of DENV spread is through human-mosquito-human transmission, however this virus can also be transmitted vertically during pregnancy and via blood (Patterson et al , West J Emerg Med 17(6):671-679, 2016).

Zika virus (ZIKV) is a flavivirus that is closely related to DENV. Zika virus was first isolated from a Rhesus macaque from the Zika Forest of Uganda in 1947. Zika was relatively unknown outside small outbreaks in Africa and Southeast Asia until 2007, when a large outbreak occurred in Micronesia (Duffy et al. , N Engl J Med 360(24(2536-2543, 2009). Outbreaks subsequently occurred in the Pacific islands before spreading to the Western Hemisphere in 2015 (Baden et al , N Engl J Med 374(16): 1552-1563, 2016). ZIKV is primarily transmitted by mosquito bites, however blood-borne and sexual transmission have been reported. ZIKV has also been detected in urine, saliva and breast milk (Sampathkumar et al. , Mayo Clinic Proceedings 91(4):514-521, 2016; Musso et al , Clin Microbiol Rev 29(3):487-524, 2016).

Chikungunya virus (CHIKV) is an alphavirus of the Togaviridae family. This virus was first isolated in Tanzania in 1953 (Patterson et al , West J Emerg Med 17(6):671-679, 2016). CHIKV infection was rarely reported up until 2004, when outbreaks occurred in Africa and Asia. The first report of CHIKV in the Western Hemisphere was in 2013, and by December 2015 it had spread to 44 countries and territories (Weaver and Forrester, Antiviral Res 120:32-39, 2015).

SUMMARY

Disclosed herein are primers, probes, kits and methods for detection of dengue virus

(DENV), chikungunya virus (CHIKV) and Zika virus (ZIKV) nucleic acid in a sample, such as for diagnosing a DENV, CHIKV or ZIKV infection in a susceptible subject.

Provided herein are isolated oligonucleotides, such as primers and probes, for detection of

DENV, CHIKV or ZIKV nucleic acid. Also provided are collections of oligonucleotides for detection of DENV nucleic acid, CHIKV nucleic acid or ZIKV nucleic acid. In some

embodiments, the collection includes a forward primer, a reverse primer and a probe that hybridizes with a DENV, CHIKV or ZIKV nucleic acid.

Further provided are kits for detecting DENV, CHIKV and ZIKV nucleic acid in a sample.

In some embodiments, the kit includes primers and a probe specific for DENV nucleic acid;

primers and a probe specific for CHIKV nucleic acid; and primers and a probe specific for ZIKV nucleic acid. In some embodiments, the kit further includes primers and a probe specific for human ribonuclease P (RNase P).

Also provided herein are methods for detecting DENV, CHIKV and ZIKV nucleic acid in a sample. In some embodiments, the method includes subjecting the sample to a reverse

transcription polymerase chain reaction (RT-PCR) using primers and a probe specific for DENV nucleic acid, primers and a probe specific for CHIKV nucleic acid, and primers and a probe specific for ZIKV nucleic acid, to produce a DENV, CHIKV or ZIKV nucleic acid amplification product; and detecting the DENV, CHIKV or ZIKV nucleic acid amplification product. In some embodiments, the RT-PCR further includes primers and a probe specific for RNase P. In some embodiments, the biological sample is a biological fluid sample, such as a sample comprising serum, cerebrospinal fluid (CSF), urine or amniotic fluid.

The foregoing and other objects, features, and advantages of the invention will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic showing an algorithm for interpreting test results of the Trioplex realtime RT-PCR assay. FIG. 2 is a pair of graphs showing exemplary linear (left) and log (right) views of PCR curves for Trioplex real-time RT-PCR. The exponential log phase, linear phase and plateau phase of each amplification plot are indicated.

FIG. 3 is a pair of graphs showing exemplary Trioplex RT-PCR curves for false positives that do not amplify exponentially.

FIG. 4 shows an exemplary Trioplex RT-PCR amplification plot of a sample with a flat line ("wandering line"), which indicates no amplification (left), and the corresponding fluorescence view (right).

FIG. 5 is an amplification plot of three samples in the linear view (left) and the

corresponding background fluorescence view (right). Shown are a moderately weak positive with ε C_T of 36.6, a very weak positive with a C_T of 42.1, and a negative control. The weak positive (C_T= 42.1) is verified to be positive by the sharp increase in fluorescence observed in the background fluorescence view.

SEQUENCE LISTING

The nucleic acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file, created on March 13, 2017, 2.82 KB, which is incorporated by reference herein. In the

accompanying sequence listing:

SEQ ID NO: 1 is the DENV-F primer sequence.

SEQ ID NO: 2 is the DENV-R1 primer sequence.

SEQ ID NO: 3 is the DENV-R2 primer sequence.

SEQ ID NO: 4 is the DENV-P probe sequence.

SEQ ID NO: 5 is the CHIKV-F primer sequence.

SEQ ID NO: 6 is the CHIKV-R primer sequence.

SEQ ID NO: 7 is the CHIKV-P probe sequence.

SEQ ID NO: 8 is the ZIKV-F primer sequence.

SEQ ID NO: 9 is the ZIKV-R primer sequence.

SEQ ID NO: 10 is the ZIKV-P probe sequence.

SEQ ID NO: 11 is the RP-F primer sequence.

SEQ ID NO: 12 is the RP-R primer sequence.

SEQ ID NO: 13 is the RP-P probe sequence. DETAILED DESCRIPTION

I. Abbreviations

BHQ™ Black Hole Quencher™

CHIKV chikungunya virus

CSF cerebrospinal fluid

CT cycle threshold

DENV dengue virus

ELISA enzyme-linked immunosorbent assay

GCE genome copy equivalent

HSC human specimen control

LoD limit of detection

PC positive control

PCR polymerase chain reaction

PRNT plaque reduction neutralization titer

RNase P ribonuclease P

RP ribonuclease P

RT reverse transcription

SLEV St. Louis encephalitis virus

WNV West Nile virus

YFV yellow fever virus

ZIKV Zika virus

II. Terms and Methods

Unless otherwise noted, technical terms are used according to conventional usage.

Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632- 02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:

Amplification: Increasing the number of copies of a nucleic acid molecule, such as a gene or fragment of a gene, for example at least a portion of a DENV, CHIKV or ZIKV nucleic acid molecule. The products of an amplification reaction are called amplification products. An example of in vitro amplification is the polymerase chain reaction (PCR), in which a sample (such as a biological sample from a subject) is contacted with a pair of oligonucleotide primers, under conditions that allow for hybridization of the primers to a nucleic acid molecule in the sample. The primers are extended under suitable conditions, dissociated from the template, and then re- annealed, extended, and dissociated to amplify the number of copies of the nucleic acid molecule. Other examples of in vitro amplification techniques include real-time PCR, quantitative real-time PCR (qPCR), reverse transcription PCR (RT-PCR), quantitative RT-PCR (qRT-PCR), loop- mediated isothermal amplification (LAMP; see Notomi et al, Nucl. Acids Res. 28:e63, 2000); reverse-transcription LAMP (RT-LAMP); strand displacement amplification (see U.S. Patent No. 5,744,311); transcription-mediated amplification (U.S. Patent No. 5,399,491) transcription-free isothermal amplification (see U.S. Patent No. 6,033,881); repair chain reaction amplification (see WO 90/01069); ligase chain reaction amplification (see U.S. Patent No. 5,686,272); gap filling ligase chain reaction amplification (see U.S. Patent No. 5,427,930); coupled ligase detection and PCR (see U.S. Patent No. 6,027,889); and NASBA™ RNA transcription-free amplification (see U.S. Patent No. 6,025,134).

Biological sample: A sample obtained from a subject (such as a human or veterinary subject). Biological samples, include, for example, fluid, cell and/or tissue samples. In some embodiments herein, the biological sample is a fluid sample. Fluid sample include, but are not limited to, serum, urine, blood, plasma, feces, saliva, cerebral spinal fluid (CSF), amniotic fluid and bronchoalveolar lavage (BAL) fluid.

Chikungunya virus (CHIKV): A positive -sense single- stranded RNA virus of the alphavirus genus in the family Togaviridae. This virus is primarily transmitted by Aedes mosquitoes, particularly A. albopictus and A. aegypti. The symptoms of CHIKV infection include rash, high fever and joint pain. CHIKV was first isolated in Tanzania in 1952. Since its re- emergence in Kenya in 2004, CHIKV has infected millions of people in Africa, Europe, and Asia. The evolution and spread of this virus into new geographic areas, and the disease severity resulting from CHIKV infection, present a serious public health concern.

Contacting: Placement in direct physical association; includes both in solid and liquid form. "Contacting" is often used interchangeably with "exposed." For example, contacting can occur in vitro with one or more primers and/or probes and a biological sample (such as a sample including nucleic acids) in solution.

Control: A reference standard, for example a positive control or negative control. A positive control is known to provide a positive test result. A negative control is known to provide a negative test result. However, the reference standard can be a theoretical or computed result, for example a result obtained in a population.

Degenerate variant: A degenerate variant of a probe or primer includes sequences that have altered nucleic acid sequences, but retain their ability to bind to the target sequences (and identify or amplify the target) with sufficient specificity. In some particular examples, no more than about 1, 2, 5, or 10 nucleic acids are changed from the original sequence. In other examples, the probe or primer retains at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the original sequence. Degenerate variants also include probe or primer sequences to which additional sequence has been added, while still retaining the noted specificity of the probe or primer.

Dengue virus (DENV): An RNA virus of the family Flaviviridae, genus Flavivirus. There are four serotypes of dengue virus, referred to as DENV-1, DENV-2, DENV-3 and DENV-4. All four serotypes can cause the full spectrum of dengue disease. Infection with one serotype can produce lifelong immunity to that serotype. However, severe complications can occur upon subsequent infection by a different serotype. Dengue virus is primarily transmitted by Aedes mosquitoes, particularly A. aegypti. Symptoms of dengue virus infection include fever, headache, muscle and joint pain and a skin rash similar to measles. In a small percentage of cases, the infection develops into a life-threatening dengue hemorrhagic fever, typically resulting in bleeding, low platelet levels and blood plasma leakage, or into dengue shock syndrome characterized by dangerously low blood pressure.

Detectable label: A compound or composition that is conjugated (e.g. , covalently linked) directly or indirectly to another molecule (such as a nucleic acid molecule) to facilitate detection of that molecule. Specific non- limiting examples of labels include fluorescent and fluorogenic moieties (e.g., fluorophores), criminogenic moieties, haptens (such as biotin, digoxigenin, and fluorescein), affinity tags, and radioactive isotopes (such as ³²P, ³³P, ³⁵S, and ¹²⁵I). The label can be directly detectable (e.g., optically detectable) or indirectly detectable (for example, via interaction with one or more additional molecules that are in turn detectable). Methods for labeling nucleic acids, and guidance in the choice of labels useful for various purposes, are discussed, e.g., in Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Fourth Edition, 2012, and Ausubel et al. , Short Protocols in Molecular Biology, Current Protocols, Fifth Edition, 2002.

Fluorophore: A chemical compound, which when excited by exposure to a particular wavelength of light, emits light (i.e. , fluoresces), for example at a different wavelength than that to which it was exposed. Also encompassed by the term "fluorophore" are luminescent molecules, which are chemical compounds which do not require exposure to a particular wavelength of light to fluoresce; luminescent compounds naturally fluoresce. Therefore, the use of luminescent signals eliminates the need for an external source of electromagnetic radiation, such as a laser. An example of a luminescent molecule includes, but is not limited to, aequorin (Tsien, 1998, Ann. Rev. Biochem. 67:509).

In some embodiments herein, a probe is labeled with a fluorophore, such as at the 5' end of the probe. Probes used for real-time PCR assays typically include a fluorophore and a quencher. Fluorophores suitable for use with real-time PCR assays, such as TaqMan™ PCR, include, but are not limited to, 6-carboxyfluorescein (FAM), tetrachlorofluorescein (TET), tetramethylrhodamine (TMR), hexachlorofluorescein (HEX), JOE, ROX, CAL Fluor™, Pulsar™, Quasar™, Texas Red™, Cy™3 and Cy™5.

Other examples of fluorophores are provided in U.S. Patent No. 5,866,366. These include: 4-acetamido-4'-isothiocyanatostilbene-2,2'disulfonic acid, acridine and derivatives such as acridine and acridine isothiocyanate, 5-(2'-aminoethyl)amino-naphthalene-l-sulfonic acid (EDANS), 4- amino-N-[3-vinylsulfonyl)phenyl]-naphthalimide-3,5 disulfonate (Lucifer Yellow VS), N-(4- anilino-l-naphthyl)-maleimide, anthranilamide, Brilliant Yellow, coumarin and derivatives such as coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcouluarin (Coumaran 151); cyanosine; 4',6-diaminidino-2-phenylindole (DAPI); 5', 5"-dibromopyrogallol- sulfonephthalein (Bromopyrogallol Red); 7-diethylamino-3-(4'-isothiocyanatophenyl)-4- methylcoumarin; diethylenetriamine pentaacetate; 4,4'-diisothiocyanatodihydro-stilbene-2,2'- disulfonic acid; 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid; 5-[dimethyl-amino]naphthalene- 1-sulfonyl chloride (DNS, dansyl chloride); 4-(4'-dimethyl-aminophenylazo)benzoic acid

(DABCYL); 4-dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin and derivatives such as eosin and eosin isothiocyanate; erythrosin and derivatives such as erythrosin B and erythrosin isothiocyanate; ethidium; fluorescein and derivatives such as 5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF), 2'7'-dimethoxy-4'5'-dichloro-6- carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), and QFITC (XRITC); fluorescamine; IR144; IR1446; Malachite Green isothiocyanate; 4-methylumbelliferone; ortho cresolphthalein; nitrotyrosine; pararosaniline; Phenol Red; B-phycoerythrin; o-phthaldialdehyde; pyrene and derivatives such as pyrene, pyrene butyrate and succinimidyl 1-pyrene butyrate;

Reactive Red 4 (Cibacron™ Brilliant Red 3B-A); rhodamine and derivatives such as 6-carboxy-X- rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101 and sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); riboflavin; rosolic acid and terbium chelate derivatives.

Other fluorophores include thiol-reactive europium chelates that emit at approximately 617 nm (Heyduk and Heyduk, Analyt. Biochem. 248:216-27, 1997; /. Biol. Chem. 274:3315-22, 1999).

Other fluorophores include cyanine, merocyanine, stryl, and oxonyl compounds, such as those disclosed in U.S. Patent Nos. 5,627,027; 5,486,616; 5,569,587; and 5,569,766, and in published PCT application no. US98/00475, each of which is incorporated herein by reference. Specific examples of fluorophores disclosed in one or more of these patent documents include Cy3 and Cy5, for instance, and substituted versions of these fluorophores.

Other fluorophores include GFP, Lissamine™, diethylaminocoumarin, fluorescein chlorotriazinyl, naphthofluorescein, 4,7-dichlororhodamine and xanthene (as described in U.S. Patent No. 5,800,996 to Lee et al., herein incorporated by reference) and derivatives thereof. Other fluorophores are known to those skilled in the art, for example those available from Molecular Probes (Eugene, OR).

Hybridization: Oligonucleotides (such as primers and probes) and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing." More specifically, A will hydrogen bond to T or U, and G will bond to C. "Complementary" refers to the base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.

"Specifically hybridizable" and "specifically complementary" are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or its analog) and the DNA or RNA target. The oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable when there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific hybridization. Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na⁺ and/or Mg⁺⁺ concentration) of the hybridization buffer will determine the stringency of hybridization, though wash times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2^nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, chapters 9 and 11; and Ausubel et al. Short Protocols in Molecular Biology, 4^th ed., John Wiley & Sons, Inc., 1999.

For purposes of the present disclosure, "stringent conditions" encompasses conditions under which hybridization will only occur if there is less than 25% mismatch between the hybridization molecule and the target sequence. "Stringent conditions" may be broken down into particular levels of stringency for more precise definition. Thus, as used herein, "moderate stringency" conditions are those under which molecules with more than 25% sequence mismatch will not hybridize; conditions of "medium stringency" are those under which molecules with more than 15% mismatch will not hybridize, and conditions of "high stringency" are those under which sequences with more than 10% mismatch will not hybridize. Conditions of "very high stringency" are those under which sequences with more than 6% mismatch will not hybridize.

Isolated: An "isolated" or "purified" biological component (such as a nucleic acid, peptide, protein, protein complex, or virus-like particle) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, that is, other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins that have been "isolated" or "purified" thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acids or proteins. The term "isolated" or "purified" does not require absolute purity; rather, it is intended as a relative term. Thus, for example, an isolated biological component is one in which the biological component is more enriched than the biological component is in its natural environment within a cell, or other production vessel. Preferably, a preparation is purified such that the biological component represents at least 50%, such as at least 70%, at least 90%, at least 95%, or greater, of the total biological component content of the preparation.

Label: A detectable compound or composition that is conjugated directly or indirectly to another molecule to facilitate detection of that molecule. Specific, non-limiting examples of labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent molecules, haptens and enzymes. Labels may be natural or synthetic, and may also be heterologous in the sense that they do not naturally occur in combination with the molecule to which it is conjugated. Conjugation can occur, for example, by covalent attachment of the label to the other molecule.

Primer: Primers are short nucleic acids, generally DNA oligonucleotides 10 nucleotides or more in length (such as 10-60, 15-50, 20-40, 20-50, 25-50, or 30-60 nucleotides in length). Primers may be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs or sets of primers (such as 2, 3, 4, 5, 6, or more primers) can be used for amplification of a target nucleic acid, e.g. , by PCR, RT-PCR, LAMP, RT- LAMP, or other nucleic acid amplification methods known in the art.

Probe: A probe typically comprises an isolated nucleic acid (for example, at least 10 or more nucleotides in length, such as 10-60, 15-50, 20-40, 20-50, 25-50, or 30-60 nucleotides in length) with an attached detectable label or reporter molecule. Exemplary labels include radioactive isotopes, ligands, haptens, chemiluminescent agents, fluorescent molecules (e.g. , fluorophores), and enzymes. Methods for labeling oligonucleotides and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Fourth Edition, 2012, and Ausubel et al. , Short Protocols in Molecular Biology, Current Protocols, Fifth Edition, 2002.

Quencher: A substance that absorbs excitation energy from a fluorophore when in close proximity. Probes used for real-time PCR assays, such as TaqMan™ PCR, typically include a fluorophore and a quencher. Quenchers suitable for use with real-time PCR assays include, but are not limited to, ZEN™, Iowa Black™ FQ (IBFQ), Iowa Black™ RQ (IBRQ), tetramethylrhodamine (TAMRA), Black Hole Quencher™ (BHQ)l, BHQ2, BHQ3, nonfluorescent quencher (NFQ) and 4-(4'-dimethylaminophenylazo)benzoic acid (DABCYL). In some cases, a probe contains two quenchers.

Recombinant nucleic acid: A nucleic acid molecule that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of nucleotide sequence. This artificial combination is accomplished by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques such as those described in Sambrook and Russell, in Molecular Cloning: A Laboratory Manual, 3^rd Ed., Cold Spring Harbor Laboratory Press (2001). The term "recombinant" includes nucleic acids that have been altered solely by addition, substitution, or deletion of a portion of a natural nucleic acid molecule. A recombinant nucleic acid also includes a heterologous nucleic acid that is inserted in a vector. A "heterologous nucleic acid" refers to a nucleic acid that originates from a different genetic source or species.

Reverse-transcription PCR (RT-PCR): A method for detecting, quantifying, or utilizing RNA present in a sample by a procedure wherein the RNA serves as a template for the synthesis of cDNA by a reverse transcriptase followed by PCR to amplify the cDNA. Real-time RT-PCR can be used to measure the quantity of RNA in a sample.

Sample: Encompasses a sample obtained from an animal, plant, or the environment, whether unfixed, frozen, or fixed in formalin or paraffin. As used herein, samples include all clinical samples useful for detection of viral infection in subjects, including, but not limited to, cells, tissues, and bodily fluids. In some embodiments, the sample is a biological sample obtained from a human or veterinary subject, such as, for example, a fluid, cell and/or tissue sample. In some examples herein, the biological sample is a fluid sample. Fluid samples include, but are not limited to, serum, blood, plasma, urine, feces, saliva, cerebral spinal fluid (CSF), amniotic fluid or other bodily fluid. Biological samples can also refer to cells or tissue samples, such as biopsy samples (for example, skin biopsies), tissue sections (such as brain tissue), corneal tissue samples, or isolated leukocytes. Samples also include samples obtained from inanimate objects or reservoirs within an indoor or outdoor environment, including, but not limited to: soil, water, dust, and air samples.

Sequence identity/similarity: The identity/similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences.

Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, /. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Set USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5: 151-3, 1989; Corpet et al, Nuc. Acids Res. 16: 10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al, Meth. Mol. Bio. 24:307-31, 1994. Altschul et al, J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.

The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al , J. Mol. Biol.

215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, MD 20894) and on the Internet, for use in connection with the sequence analysis programs, such as BLASATN, which is used to compare nucleic acid sequences.

Serum: The fluid portion of the blood that separates out from clotted blood. Serum contains many proteins, including antibodies, but does not contain clotting factors.

Subject: In the context of the present disclosure, "subject" includes humans and non- human primates, model animals (such as mice), and mosquitos, such as mosquitos of the genus Aedes, particularly A. aegypti and A. albopictus.

Zika virus (ZIKV): A member of the virus family Flaviviridae and the genus Flavivirus. Other members of this genus include dengue virus, yellow fever virus, Japanese encephalitis virus, West Nile virus and Spondweni virus. ZIKV is spread by the daytime-active mosquitoes Aedes aegypti and A. albopictus. This virus was first isolated from a Rhesus macaque from the Zika Forest of Uganda in 1947. Since the 1950s, ZIKV has been known to occur within a narrow equatorial belt from Africa to Asia. The virus spread eastward across the Pacific Ocean in 2013- 2014, resulting in ZIKV outbreaks in Oceania to French Polynesia, New Caledonia, the Cook Islands, and Easter Island. In 2015, ZIKV spread to Mexico, Central America, the Caribbean and South America, where ZIKV has reached pandemic levels. Infection by ZIKV generally causes either no symptoms or mild symptoms, including mild headache, maculopapular rash, fever, malaise, conjunctivitis and joint pain. ZIKV causes symptoms in about 20% of infected individuals, and no deaths from the virus have yet been reported. However, ZIKV infection has been linked to the birth of microcephalic infants following maternal infection, as well an increase in cases of GBS. Reports have also indicated that ZIKV has the potential for human blood-borne and sexual transmission. ZIKV has also been found in human saliva and breastmilk.

III. Primers and Probes for Detection of DENV, CHIK and ZIKV

Primers and probes (such as isolated nucleic acid primers and probes) suitable for use in the disclosed methods and kits are described herein. In some examples, the primers are suitable for detection of DENV, CHIKV or ZIKV nucleic acids by RT-PCR.

Provided herein are isolated oligonucleotides for detection of DENV, CHIKV or ZIKV nucleic acid. In some embodiments, the sequence of the oligonucleotide is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to any one of SEQ ID NOs: 1-10. In some examples, the sequence of the oligonucleotide comprises or consists of any one of SEQ ID NOs: 1- 10. In some examples, the oligonucleotide is conjugated to a detectable label. In particular examples, the detectable label comprises a fluorophore or a quencher, or both. Further provided are isolated oligonucleotides for detection of human RNase P, which can be used as a positive control in the RT-PCR assay disclosed herein. In some embodiments, the sequence of the oligonucleotide is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to any one of SEQ ID NOs: 11-13. In some examples, the sequence of the oligonucleotide comprises or consists of any one of SEQ ID NOs: 11-13. In some examples, the oligonucleotide is conjugated to a detectable label. In particular examples, the detectable label comprises a fluorophore or a quencher, or both.

Also provided herein is a collection of oligonucleotides for detection of DENV nucleic acid. In some embodiments, the collection includes a forward primer comprising a sequence at least

80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 1; a first reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 2; a second reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 3; and a probe comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 4. In some examples, the sequence of the forward primer comprises or consists of SEQ ID NO: 1; the sequence of the first reverse primer comprises or consists of SEQ ID NO: 2; the sequence of the second reverse primer comprises or consists of SEQ ID NO: 3; and the sequence of the probe comprises or consists of SEQ ID NO: 4.

Also provided herein is a collection of oligonucleotides for detection of CHIKV nucleic acid. In some embodiments, the collection includes a forward primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 5; a reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 6; and a probe comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 7. In some examples, the sequence of the forward primer comprises or consists of SEQ ID NO: 5; the sequence of the reverse primer comprises or consists of SEQ ID NO: 6; and the sequence of the probe comprises or consists of SEQ ID NO: 7.

Further provided herein is a collection of oligonucleotides for detection of ZIKV nucleic acid. In some embodiments, the collection includes a forward primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 8; a reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 9; and a probe comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 10. In some examples, the sequence of the forward primer comprises or consists of SEQ ID NO: 8; the sequence of the reverse primer comprises or consists of SEQ ID NO: 9; and the sequence of the probe comprises or consists of SEQ ID NO: 10.

Also provided herein is a collection of oligonucleotides for detection of human RNase P. In some embodiments, the collection includes a forward primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 11; a reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 12; and a probe comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 13. In some examples, the sequence of the forward primer comprises or consists of SEQ ID NO: 11; the sequence of the reverse primer comprises or consists of SEQ ID NO: 12; and the sequence of the probe comprises or consists of SEQ ID NO: 13.

In some embodiments, the disclosed primers and probes are between 10 and 50 nucleotides in length (for example 12-50, 14-40, 15-30, or 16-24 nucleotides in length). In some examples, the primers or probes are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 29, 30, 31, 32, 32, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length and are capable of hybridizing to CHIKV, DENV or ZIKV nucleic acid molecules. In some examples, the primers or probes are at least 12, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. In other examples, the primers or probes may be no more than 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. In some examples, the disclosed primers and probes include RT-PCR primers and probes for amplification and detection of CHIK, DENV, ZIKV or human RNase P nucleic acid. The primers and probes include nucleic acid sequences with at least 80% sequence identity (for example, at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity) to any one of the following:

TAGTCTRCGTGGACCGACAAG (SEQ ID NO: 1)

CAGTTGACACRCGGTTTCTC (SEQ ID NO: 2)

GGGTTGATACGCGGTTTCTC (SEQ ID NO: 3)

CGYCTWTCAATATGCTGAAACGCG (SEQ ID NO: 4)

ACCATCGGTGTTCCATCTAAAG (SEQ ID NO: 5)

GCCTGGGCTCATCGTTATT (SEQ ID NO: 6)

ACAGTGGTTTCGTGTGAGGGCTAC (SEQ ID NO: 7)

CCGCTGCCCAACACAAG (SEQ ID NO: 8)

CCACTAACGTTCTTTTGCAGACAT (SEQ ID NO: 9)

AGCCTACCTTGACAAGCAGTCAGACACTCAA (SEQ ID NO: 10)

AGATTTGGACCTGCGAGCG (SEQ ID NO: 11)

GAGCGGCTGTCTCCACAAGT (SEQ ID NO: 12)

TTCTGACCTGAAGGCTCTGCGCG (SEQ ID NO: 13)

In some embodiments of the isolated oligonucleotides and collections, at least one of the primers or probes includes a detectable label, such as a fluorophore, radiolabel, hapten (such as biotin), chromogen or quencher. In some examples, a detectable label is attached (e.g. , covalently or non-covalently attached) to an oligonucleotide. The attachment may be to any portion of the oligonucleotide, including to a base, sugar, phosphate backbone, or 5 or 3' end of the

oligonucleotide. The label may be directly attached to the oligonucleotide or indirectly attached, for example through a linker molecule. In particular examples, an RT-PCR primer or probe (e.g., one of SEQ ID NOs: 1-13) includes a fluorophore at the 5 or 3' end. In some examples, the fluorophore is HEX, FAM, TET, fluorescein, fluorescein isothiocyanate (FITC), or QFITC (XRITC). In other examples, the primer or probes includes a quencher at the 5' or 3' end, such BHQ-1, BHQ-2 or any other suitable quencher. One of skill in the art can select additional suitable fluorophores and/or quenchers (see, e.g., The Molecular Probes Handbook, Life Technologies, 11^th Edition, 2010). In specific embodiments, the probe is conjugated to a fluorophore and a quencher. In some examples, the probe comprises a fluorophore on its 5' end and a quencher on its 3' end. In particular examples, the DENV probe includes FAM on its 5' end and BHQ-1 on its 3' end. In particular examples, the CHIKV probe includes HEX on the 5' end and BHQ-1 on its 3' end. In particular examples, the ZIKV probe includes Texas Red™ on its 5'end and BHQ-2 on its 3' end.

Although exemplary primer and probe sequences are provided herein, the primer or probe sequences can be varied slightly by moving the primer or probe a few nucleotides upstream or downstream from the nucleotide positions that they hybridize to on the target nucleic molecule acid, provided that the probe and/or primer is still specific for the target nucleic acid sequence. For example, variations of the primers disclosed as SEQ ID NOs: 1-13 can be made by "sliding" the probes or primers a few nucleotides 5' or 3' from their positions, and such variations will still be specific for the respective target nucleic acid sequence.

Also provided by the present disclosure are primers or probes that include variations to the nucleotide sequences shown in any of SEQ ID NOs: 1-13, as long as such variations permit detection of the target nucleic acid molecule. For example, a primer or can have at least 80% sequence identity such as at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to a nucleic acid including the sequence shown in any of SEQ ID NOs: 1-13. In such examples, the number of nucleotides does not change, but the nucleic acid sequence shown in any of SEQ ID NOs: 1-13 can vary at a few nucleotides, such as changes at 1, 2, 3, 4, 5, or 6 nucleotides.

The present application also provides primers and probes that are slightly longer or shorter than the nucleotide sequences shown in any of SEQ ID NOs: 1-13, as long as such deletions or additions permit amplification and/or detection of the desired target nucleic acid molecule. For example, a primer or probe can include a few nucleotide deletions or additions at the 5'- or 3 '-end of the primers or probes shown in any of SEQ ID NOs: 1-13, such as addition or deletion of 1, 2, 3, 4, 5, or 6 nucleotides from the 5'- or 3'-end, or combinations thereof (such as a deletion from one end and an addition to the other end). In such examples, the number of nucleotides may change.

Also provided are primers and probes that are degenerate at one or more positions (such as

1, 2, 3, 4, 5, or more positions), for example, a primer or probe that includes a mixture of nucleotides (such as 2, 3, or 4 nucleotides) at a specified position in the primer or probe. In other examples, the primers and probes disclosed herein include one or more synthetic (e.g., non- naturally occurring) bases or alternative bases (such as inosine). In other examples, the primers and probes disclosed herein include one or more modified nucleotides or nucleic acid analogues, such as one or more locked nucleic acids (see, e.g., U.S. Patent No. 6,794,499), an altered sugar moiety, an inter-sugar linkage, a non-naturally occurring nucleotide linkage, a phosphorothioate oligodeoxynucleotide, a peptide nucleic acid (PNA), or one or more superbases (Nanogen, Inc., Bothell, WA). The nucleic acid primers and probes disclosed herein can be supplied in the form of a kit, for example, for use in the detection or amplification of CHIKV, DENV or ZIKV nucleic acid, as discussed below. IV. Kits for Detection of DENV, CHIK and ZIKV

Provided herein are kits for detecting DENV, CHIK and ZIKV nucleic acid in a biological sample. The disclosed kits allow for the detection of all three viruses using a single sample. The kits include primer and probe sets for DENV, CHIKV and ZIKV, and optionally for human RNase P as a positive control (for example, for confirming extraction of RNA from the sample).

In some embodiments, the kit includes a DENV forward primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 1; a first DENV reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 2; a second DENV reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 3; a DENV probe comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 4; a CHIKV forward primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 5; a CHIKV reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 6; a CHIKV probe comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 7; a ZIKV forward primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 8; a ZIKV reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 9; and/or a ZIKV probe comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 10. In some examples, the sequence of the DENV forward primer comprises or consists of SEQ ID NO: 1; the sequence of the first DENV reverse primer comprises or consists of SEQ ID NO: 2; the sequence of the second DENV reverse primer comprises or consists of SEQ ID NO: 3; the sequence of the DENV probe comprises or consists of SEQ ID NO: 4; the sequence of the CHIKV forward primer comprises or consists of SEQ ID NO: 5; the sequence of the CHIKV reverse primer comprises or consists of SEQ ID NO: 6; the sequence of the CHIKV probe comprises or consists of SEQ ID NO: 7; the sequence of the ZIKV forward primer comprises or consists of SEQ ID NO: 8; the sequence of the ZIKV reverse primer comprises or consists of SEQ ID NO: 9; and/or the sequence of the ZIKV probe comprises or consists of SEQ ID NO: 10.

The kit may also include additional primers and probes, such as primers or probes specific for positive control sequences. In some examples, the kit further includes a forward primer, a reverse primer and a probe for detection of human ribonuclease P (RNase P). In particular examples, the RNase P forward primer comprises a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 11; the RNase P reverse primer comprises a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 12; and/or the RNase P probe comprises a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 13. In specific non-limiting examples, the sequence of the RNase P forward primer comprises or consists of SEQ ID NO: 11; the sequence of the RNase P reverse primer comprises or consists of SEQ ID NO: 12; and/or the sequence of the RNase P probe comprises or consists of SEQ ID NO: 13.

In some embodiments, at least one of the DENV, CHIKV, ZIKV and RNase P probes is conjugated to a fluorophore, a quencher, or both. In some examples, the DENV, CHIKV, ZIKV and RNase P probes are each conjugated to a different fluorophore. In some examples, the DENV, CHIKV, ZIKV and RNase P probes are each conjugated to a quencher. In specific, non-limiting examples, all four probes have a fluorophore on their 5' end and a quencher on their 3' end. In one example, the DENV probe includes FAM on its 5' end and BHQ-1 on its 3' end. In one example, the CHIKV probe includes HEX on the 5' end and BHQ-1 on its 3' end. In one example, the ZIKV probe includes Texas Red™ on its 5 'end and BHQ-2 on its 3' end.

In some embodiments, the kit further includes one or more components for performing an RT-PCR assay. In some examples, the kit includes buffer, reverse transcriptase, DNA polymerase, dNTPs, master mix, or any combination thereof. The additional reagents may be in separate container(s) from the primer(s)/probe(s) or may be included in the same container as the primer(s)/probe(s) .

In the disclosed kits, one or more of the oligonucleotide primers or probes (such as one or more of SEQ ID NOs: 1-13) are provided in one or more containers or in one or more individual wells of a multi-well plate or card. Nucleic acid primers and probes may be provided suspended in an aqueous solution or as a freeze-dried or lyophilized powder, for instance. The container(s) in which the nucleic acid(s) are supplied can be any conventional container that is capable of holding the supplied form, for instance, microfuge tubes, multi-well plates, ampoules, or bottles.

One or more positive and/or negative control primers and/or nucleic acids also may be supplied in the kit. Exemplary negative controls include non-ZIKV/non-CHIKV/non-DENV nucleic acids (such nucleic acids from other viruses). Exemplary positive controls include purified DENV, CHIKV or ZIKV nucleic acid or a vector or plasmid including the viral target sequence. One of skill in the art can select suitable positive and negative controls for the assays disclosed herein.

In some embodiments, the kit further includes instructions for use, such as the instructions provided in the Examples herein.

V. RT-PCR Assay for Detection of DENV, CHIK and ZIKV

Disclosed herein is a real time RT-PCR assay for the detection and differentiation of DENV, CHIK and ZIKV nucleic acid in a biological sample. The method described herein allows for the detection of all three viruses in a single sample.

Provided herein is a method for detecting DENV, CHIKV or ZIKV nucleic acid in a biological sample. In some embodiments, the method includes subjecting the sample to a reverse transcription polymerase chain reaction (RT-PCR) using primers and a probe specific for DENV nucleic acid, primers and a probe specific for CHIKV nucleic acid, and primers and a probe specific for ZIKV nucleic acid, to produce a DENV, CHIKV or ZIKV nucleic acid amplification product; and detecting the DENV, CHIKV or ZIKV nucleic acid amplification product.

In some examples, the primers and probes include a DENV forward primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 1; a first DENV reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 2; a second DENV reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 3; a DENV probe comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 4; a CHIKV forward primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 5; a CHIKV reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 6; a CHIKV probe comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 7; a ZIKV forward primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 8; a ZIKV reverse primer comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 9; and/or a ZIKV probe comprising a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 10.

In particular examples, the sequence of the DENV forward primer comprises or consists of SEQ ID NO: 1; the sequence of the first DENV reverse primer comprises or consists of SEQ ID NO: 2; the sequence of the second DENV reverse primer comprises or consists of SEQ ID NO: 3; the sequence of the DENV probe comprises or consists of SEQ ID NO: 4; the sequence of the CHIKV forward primer comprises or consists of SEQ ID NO: 5; the sequence of the CHIKV reverse primer comprises or consists of SEQ ID NO: 6; the sequence of the CHIKV probe comprises or consists of SEQ ID NO: 7; the sequence of the ZIKV forward primer comprises or consists of SEQ ID NO: 8; the sequence of the ZIKV reverse primer comprises or consists of SEQ ID NO: 9; and/or the sequence of the ZIKV probe comprises or consists of SEQ ID NO: 10.

The method may also include the use of additional primers and probes, such as primers or probes specific for positive control sequences. In some examples, the RT-PCR method uses a forward primer, a reverse primer and a probe for detection of human RNase P. In particular examples, the RNase P forward primer comprises a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 11; the RNase P reverse primer comprises a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 12; and/or the RNase P probe comprises a sequence at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 13. In specific non-limiting examples, the sequence of the RNase P forward primer comprises or consists of SEQ ID NO: 11; the sequence of the RNase P reverse primer comprises or consists of SEQ ID NO: 12; and/or the sequence of the RNase P probe comprises or consists of SEQ ID NO: 13.

In some embodiments, at least one of the DENV, CHIKV, ZIKV and RNase P probes is conjugated to a fluorophore, a quencher, or both. In some examples, the DENV, CHIKV, ZIKV and RNase P probes are each conjugated to a different fluorophore. In some examples, the DENV, CHIKV, ZIKV and RNase P probes are each conjugated to a quencher. In specific, non-limiting examples, all four probes have a fluorophore on their 5' end and a quencher on their 3' end. In one example, the DENV probe includes FAM on its 5' end and BHQ-1 on its 3' end. In one example, the CHIKV probe includes HEX on the 5' end and BHQ-1 on its 3' end. In one example, the ZIKV probe includes Texas Red on its 5 'end and BHQ-2 on its 3' end.

In some embodiments, detecting the DENV, CHIKV or ZIKV nucleic acid amplification product comprises detecting fluorescence. For example, fluorescence can be detecting using a realtime RT-PCR instrument, a flow cytometer or other instrument known to those of skill in the art.

In some embodiments, the biological sample is a biological fluid sample. In specific examples, the biological fluid sample comprises serum, cerebrospinal fluid (CSF), urine or amniotic fluid. In specific, non-limiting examples, the biological sample to detect DENV is a serum or CSF sample. In other specific, non-limiting examples, the biological sample to detect CHIKV is a serum or CSF sample. In other specific, non-limiting examples, the biological sample to detect ZIKV is a serum, CSF, urine or amniotic fluid sample.

The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.

EXAMPLES

Example 1: Trioplex Real-Time RT-PCR Assay Materials and Methods

This example describes a real-time (TaqMan^®) RT-PCR assay for detection and

differentiation of RNA from dengue, chikungunya and Zika viruses in serum and cerebrospinal fluid (CSF), and for the detection of Zika virus RNA in urine and amniotic fluid. The protocol d e s c r i b e d b e l o w has been designed to facilitate simultaneous testing for the presence of dengue, chikungunya and Zika viruses using a single sample. In this assay, the tests for dengue, chikungunya and Zika viruses are run in the same rRT-PCR plate well (multiplex). Assay Use

The Trioplex Real-time RT-PCR Assay (Trioplex rRT-PCR) is used for the qualitative detection and differentiation of RNA from Zika virus, dengue virus, and chikungunya virus in sera and cerebrospinal fluid collected from individuals suspected of being infected with one of these viruses. For example, the individual may meet CDC Zika clinical and/or epidemiological criteria (for example clinical signs and symptoms associated with Zika virus infection, history of residence in or travel to a geographic region with active Zika transmission at the time of travel, or other epidemiologic links for which testing may be indicated as part of a public health investigation). The assay is also used for the qualitative detection of Zika virus RNA in urine and amniotic fluid.

Assay results are for the identification of dengue, chikungunya and Zika viral RNA. Viral RNA is generally detectable in serum during the acute phase of infection (approximately 7 days following onset of symptoms, if present). Positive results are indicative of current infection.

Negative Trioplex rRT-PCR results do not rule out dengue, chikungunya and/or Zika virus infections and should not be used as the sole basis for patient management decisions. Negative results are combined with clinical observations, patient history, and epidemiological information.

Assay Principle

The Trioplex r RT-PCR assay disclosed herein includes primers and dual-labeled hydrolysis (Taqman^®) probes for the in vitro qualitative detection of dengue virus, chikungunya virus and Zika virus RNA isolated from clinical specimens including serum, CSF, urine, and amniotic fluid. A reverse transcription step produces cDNA from RNA present in the sample. The probe binds to the target DNA between the two unlabeled PCR primers. For the dengue virus-specific probe, the signal from the fluorescent dye (FAM) on the 5' end is quenched by BHQ-1 on its 3' end. For the chikungunya virus-specific probe, the signal from the fluorescent dye (HEX) on the 5' end is quenched by BHQ-1 on its 3' end. For the Zika virus-specific probe, the signal from the fluorescent dye (Texas Red™ [TxRd]) on the 5 'end is quenched by BHQ-2 on its 3' end. During PCR, Taq polymerase extends the unlabeled primers using the template strand as a guide, and when it reaches the probe it cleaves the probe separating the dye from the quencher allowing it to fluoresce. The real-time PCR instrument detects this fluorescence from the unquenched dye. With each cycle of PCR, more probes are cleaved resulting in an increase in fluorescence that is proportional to the amount of target nucleic acid present.

Sample Specimens

For CHIKV and DENV, samples include serum and cerebral spinal fluid (CSF). For ZIKV, samples include serum, CSF, urine and amniotic fluid.

Materials

The Trioplex Real-time RT-PCR Assay Primer and Probe Set includes a DENV forward primer (DENV-F), two DENV reverse primers (DENV-R1 and DENV-R2) and a DENV probe (DENV-P); a CHIKV forward primer (CHIKV-F), a CHIKV reverse primer (CHIKV-R) and a CHIKV probe (CHIKV-P); and a ZIKV forward primer (ZIKV-F), a ZIKV reverse primer (ZIKV- R) and a ZIKV probe (ZIKV-P). A primer and probe set for human RNase P is used to verify a successful extraction (RP-F, RP-R and RP-P).

For extraction of RNA, one of any number of commercially available kits can be used, such as one of the following: MagNA Pure LC Total Nucleic Acid Isolation Kit (192 reactions) (Roche, catalog #03 03 85 05001); MagNA Pure 96 DNA and Viral NA Small Volume Kit (Roche, catalog #0654388001); Qiagen QIAamp® Viral RNA Mini kit (Qiagen catalog #52904 or 52906); and

Qiagen QIAmp® DSP Viral RNA Mini kit (Qiagen catalog #61904). The rRT-PCR master mix kit may include Superscript^® III Platinum® One-Step qRT-PCR Kit (ThermoFisher Scientific catalog # 11732088 and/or 11732020) or qScript™ One-Step qRT-PCR kit, Low Rox™ (Quanta, catalog # 95059-050 and/or 95059-200). Reactions also require molecular-grade water, nuclease- free. Equipment and Consumables

The following equipment may be used with the Trioplex rRT-PCR assay: Applied

Biosystems 7500 Fast Dx Real-Time PCR Instrument (ThermoFisher Scientific; catalog #446985 or #4406984); a vortex mixer; a microcentrifuge; 96-well cold block (or ice); micropipettes (2 or 10 μί, 20 μί, 200 and 1000 μί); and multichannel micropipettes (5-50 μί). Optional automated RNA extraction instruments include MagNA Pure LC 2.0 instrument (Roche; catalog #

05197686001) and MagNA Pure 96 Instrument (Roche; catalog # 5195322001).

The following consumables may be used with the Trioplex rRT-PCR assay: surface decontaminants, such as DNA Away (Fisher Scientific; catalog # 21-236-28) or RNase Away (Fisher Scientific; catalog #21-236-21; this product eliminates RNase and DNA), 10% bleach (1:10 dilution of commercial 5.25-6.0% hypochlorite bleach) or DNAZap™ (ThermoFisher Scientific; cat. #AM9890) or equivalent; disposable, powder-free gloves and disposable gowns; laboratory marking pen; aerosol barrier sterile pipette tips for P2/P10, P40, P200, and P1000; 1.5 mL microcentrifuge tubes; racks for 1.5 mL microcentrifuge tubes; 0.1 mL PCR reaction plates (ThermoFisher Scientific; catalog #4346906 or #4366932) and optical caps (Applied Biosystems; catalog #4323032); MicroAmp^® Optical Adhesive Film Kit (ThermoFisher Scientific; catalog # 4311971 or #4360954).

Assay Controls

Assay controls are run concurrently with all test samples.

Extraction control: Human specimen control (HSC) - noninfectious cultured human cell material used as an extraction control and positive control for the RNase P primer and probe set (RP) that is extracted concurrently with the test samples and included as a sample during rRT-PCR set-up. Should generate negative results with DENV, CHIKV and ZIKV primer and probe sets, but positive results for RP.

Positive controls for agent-specific primer and probe sets: DENV PC (inactivated dengue virus); CHIKV PC (inactivated chikungunya virus); and ZIKV PC (inactivated Zika virus). These components are extracted using, for example, one of the RNA extraction methods described herein. Extracted positive nucleic acid is aliquoted and stored at <-20°C until use and repeated freeze-thaw cycles are avoided.

RNase P Primer and Probe Set (RP): The clinical samples and the HSC are tested for human RNase P gene (using the RP primer and probe set) to control for specimen quality and as an indicator that nucleic acid resulted from the extraction process.

No Template Control (NTC): NTC reactions include PCR-grade water in place of specimen RNA and are included for each reaction mixture (one for the ZIKV, CHIKV and DENV reaction and one for the RP reaction) in each run. The NTC is a control for contamination or improper function of assay reagents resulting in false positive results.

Table 1: Overview of positive and negative controls

Example 2: Trioplex rRT-PCR Kit Instructions

In some embodiments of the rRT-PCR kit disclosed herein, the kit includes the instructions provided below.

Stock Reagent Preparation

1. Preparation of Real-time Primers/Probes

• Prior to rehydration, store kits at 2-8°C in the dark.

• Precautions: These reagents are handled in a clean area and stored at appropriate

temperatures (see below) in the dark. Freeze-thaw cycles are avoided. Maintain cold when thawed.

• Carefully rehydrate lyophilized reagents in 250 of 10 mM Tris, pH 7.4 to 8.2 or PCR grade (nuclease free) water and allow to rehydrate for 15 min at room temperature in the dark.

• Vortex each tube to obtain a uniform mix and aliquot primers/probe mix in 50

volumes into 5 pre-labeled tubes. Store rehydrated aliquots of primers and probes at -20°C or below. Do not store in frost- free freezers.

Rehydrated primers and probes can be stored frozen for up to 24 months.

Thawed aliquots of probes and primers can be stored in the dark up to 4 months at 2-8°C during frequent use.

Do not re-freeze thawed aliquots.

Table 2: Primer and Probe Descriptions and Sequences

2. Assay Controls

• Nucleic acid extracted from inactivated dengue virus

• Nucleic acid extracted from inactivated chikungunya virus

• Nucleic acid extracted from inactivated Zika virus 3. No Template Control (NTCs)

• Sterile, nuclease-free water

• Aliquot in small volumes

• Used to check for contamination during specimen extraction and/or plate set-up

4. HSC extraction control

• Human Specimen Control is extracted and processed with each batch of samples to be tested following the same procedure as with patient samples.

• Do not dilute extracted RNA prior to testing

5. Master mix

NOTE: Either Superscript^® III Platinum^® One-Step Quantitative RT-PCR System or qScript™ One-Step qRT-PCR kit, Low Rox™ are used.

a. Superscript^® III Platinum^® One-Step qRT-PCR System

• Place 2X PCR Master Mix and Superscript III RT/Platinum Taq enzyme mix in a cold rack at 2-8°C.

• Completely thaw the 2X PCR Master Mix vial.

• Mix the 2X PCR Master Mix by inversion 10 times.

b. qScript™ One-Step qRT-PCR kit, Low Rox™

• Thaw all components, except qScript One-Step RT, at room temperature.

• Mix vigorously.

• Centrifuge to collect contents to bottom of tube before using.

• Place all components on ice after thawing.

Equipment Preparation

• Turn on Applied Biosystems 7500 Fast Dx Real-Time PCR Instrument and allow the block to reach optimal temperature.

• Perform plate set up and select cycling protocol on the instrument (see Table 5). Master Mix and Plate Set-up

Note: Plate set-up configuration can vary with the number of specimens and work day organization. NTCs and assay controls are included in each run.

• In the reagent set-up room clean hood, place primer/probes on ice or cold-block. Keep cold during preparation and use.

• Thaw 2X Reaction Mix (Superscript III or qScript) prior to use.

• Mix primer/probes by briefly vortexing.

• Briefly centrifuge primers/probes and return to ice or cold block.

• Determine the number of reactions (N) to set up per assay. It is necessary to make

excess reaction mix for the NTC reactions and for pipetting error (see Table 2).

• Use the following guide to determine N:

o If the number of samples (n) including controls equals 1 through 14, then N = n + 1 o If the number of samples (n) including controls is greater than 15, then N = n + 2

Prepare reaction mixture according to the following table (Table 3). Keep reaction mixture on ice or in cold block.

Table 3: Trioplex rRT-PCR Reaction Mixture

NOTE: The same reaction mixture volumes may be used for either the Superscript III or qScript

Table 4: RP PCR Reaction Mixture

PCR Plate Setup

a. In the reagent set-up room clean hood, while maintaining PCR plate on ice (or cold

block), add 15 of reaction mixture to all wells being utilized.

b. Before moving the plate to the nucleic acid handling area, add 10 μΐ, of nuclease-free water to the NTC wells

c. Loosely apply optical strip caps or optical tape to the tops of the reaction wells and move plate to the nucleic acid handling area on cold block or ice.

d. Remove optical strip caps or optical tape and add 10 μΐ, of extracted sample RNA to each corresponding sample well. Change tips after each sample addition.

e. Add 10 μΐ, of DENV-1-4 Positive Control, CHIKV positive Control, ZIKV Positive Control and HSC (RP positive control) to separate wells as indicated in Table 5.

f. Seal plate with optical tape or caps and load plate on Applied Biosystems 7500 Fast Dx Real-Time PCR Instrument. Table 5: Example of Trioplex rRT-PCR plate layout for 3 samples

Mastermix Layout

Positive controls: E12-H12

2. PCR Run

a. Launch the ABI 7500 software and select Create new document.

b. Select Standard 7500 on the Run Mode menu and click Next.

c. Create a new detector for each target by clicking on New Detector, name DENV, select reporter dye FAM and leave Quencher Dye as none.

d. Repeat for CHIKV, select reporter dye VIC and leave Quencher Dye none.

e. Repeat for ZIKV, select reporter dye Texas Red and leave Quencher Dye none.

f. Repeat for RP, select reporter dye FAM and leave Quencher Dye none. g. On the Select Detectors screen, select DENV and click on Add. h. Switch Passive Reference from ROX to none.

i. On the Select Detectors screen, select CHIKV and click on Add.

j . Switch Passive Reference from ROX to none.

k. On the Select Detectors screen, select ZIKV and click on Add

1. Switch Passive Reference from ROX to none,

m. On the Select Detectors screen, select RP and click on Add

n. Switch Passive Reference from ROX to none.

o. On the Set Up Sample Plate window, highlight corresponding wells and select DENV,

CHIKV, and ZIKV detectors,

p. Double click each well to enter sample name.

q. Select Instrument tab and define thermocycling conditions according to the master mix used:

(1) Stage 1: 30 min at 50°C; 1 rep.

(2) Stage 2:

• Superscript III: 2 min at 95 °C; 1 rep

• qScript: 5 min at 95 °C; 1 rep

(3) Stage 3, step 1: 15 sec at 95 °C

(4) Stage 3, step 2: 1 min at 60°C

(5) Stage 3: change reps to 45 cycles

(6) Under Settings, change volume to 25 μL

(7) Under Settings, Run Mode, select Standard 7500

(8) Stage 3, step 2 is highlighted in yellow indicating data collection

r. Select Save As, designate file name and folder s. Click Start. Instrument will initialize and calculate time of run. Data Analysis

After completion of the run, the data are saved and analyzed following the instrument manufacturer's instructions. Analyses are performed separately for each target using a manual threshold setting. Thresholds are adjusted to fall within the beginning of the exponential phase of the fluorescence curves and above any background signal. The procedure chosen for setting the threshold is used consistently.

Test Validity Determination

Before the results can be determined for each clinical specimen, the plate run is determined to be valid. For a test to be valid, the controls yield the expected results:

• Assay controls (nucleic acid extracted from inactivated DENV, CHIKV, and ZIKV) are positive and within the expected Ct value range. If assay controls are negative

o Repeat the plate.

• NTCs should be negative. If NTCs are positive

o Clean potential DNA contamination from bench surfaces and pipettes in the reagent setup and template addition work areas,

o Extract and test multiple NTCs.

o Discard working reagent dilutions and remake from fresh stocks.

o Repeat samples only for the targets that are inappropriately amplified.

• HSC (extraction control) should be

o Positive with RP primer/probe set due to the human DNA in the HSC

o Negative with virus primer/probe sets. A positive result with the HSC and virus

primer/probes would indicate cross-contamination has occurred. If a positive result is obtained, follow the cleaning procedure described above.

• RP Assay for each specimen should be positive.

o If RP Assay for a specimen sample is negative and the Trioplex rRT-PCR assays are all negative for specimen samples:

i. Report result as Inconclusive

ii. Follow the instructions below:

a. If RP Assay for a specimen sample is negative, but DENV, CHIKV, and/or ZIKV is positive for specimen samples:

• Do not repeat rRT-PCR test and consider the results of the Trioplex rRT-PCR valid.

ntrols have been performed appropriately, proceed to analyze each target.

True positives produce exponential curves with logarithmic, linear, and plateau phases (FIG. 2).

(Weak positives will produce high Ct values that are sometimes devoid of a plateau phase; however, the exponential plot will be seen.)

For a sample to be a true positive, the curve crosses the threshold in a similar fashion as shown in FIG. 2, rather than crossing the threshold and then diving back below the threshold.

FIG. 3 shows examples of false positives that do not amplify exponentially.

To better understand and evaluate challenging curves more effectively, use the background fluorescence view (Rn versus Cycle with AB software) to determine if the curve is actually positive. In this view, a sharp increase in fluorescence indicates a true positive while a flat line (or wandering line) indicates no amplification.

o FIG. 4 shows a curve with a CT value of 29.2 though it is evident that the sample is negative by looking at the background fluorescence view,

o FIG. 5 shows an amplification plot with 3 curves: a moderately weak positive with a CT of 36.6 (black), a very weak positive with a CT of 42.1 (red), and a negative control (blue). The weak positive (CT= 42.1) is verified to be positive by the sharp increase in fluorescence seen in the background fluorescence view.

• Weak positives are interpreted with caution. If curves are true exponential curves, the reaction is interpreted as positive.

o If repeat testing of a weak specimen is necessary, repeat the sample in replicates as a single repeat test run has a high likelihood of generating a discrepant result, o If re-extracting and re-testing the specimen, it may be helpful to elute in a lower volume to concentrate the sample. Specimen Interpretation

All test controls are examined prior to interpretation of patient results. If the controls are not valid, the patient results cannot be interpreted. The result generated for a primer and probe set is interpreted as positive if the reaction generates a fluorescence growth curve that crosses the threshold within (<) 38 cycles.

The result generated for a primer and probe set is interpreted as negative if:

• the reaction generates a fluorescence growth curve that crosses the threshold at or above (>) 38 cycles, OR

• the reaction fails to generate a fluorescence growth curve that crosses the threshold. Table 6: Trioplex rRT-PCR Interpretation and Reporting for Serum and CSF Specimens

Table 7: Trioplex rRT-PCR Interpretation and Reporting for Urine an Amniotic Fluid

Specimens

An algorithm for interpreting test results is shown in FIG. 1.

Example 3: Performance Characteristics of Trioplex rRT-PCR

This example reports limit of detection, inclusivity and exclusivity characteristics of the assay and evaluates performance with clinical specimens. Limit of Detection

The limits of detection (LoD) for the Trioplex rRT-PCR were established and re- verified over a number of studies. Findings for these are summarized in Table 8.

Table 8: Overall limit of detection data summary (GCE/mL)

GCE = genome copy equivalent

MP 96 = MagNA Pure 96 Extraction Instrument

1. ZIKV LoD

Limit of detection for the ZIKV primer and probe set was evaluated in both normal human serum and in urine using the French Polynesia 2013 strain of Zika virus. Five 10-fold serial dilutions in each matrix were prepared. For each matrix, each concentration was extracted 20 times using the MagNA Pure LC 2.0 Instrument and tested by the Trioplex rRT-PCR using the

Superscript III master mix. Results for serum are summarized in Table 9. Results for urine are in Table 10.

Table 9: ZIKV LoD in serum

Based on concentration of dilution 4. In the absence of positive results at this concentration, quantification could not be determined for this dilution using the standard curve.

ND = not detected

* Based on concentration of dilution 4. In the absence of positive results at this concentration, quantification could not be determined for this dilution using the curve.

ND = not detected 2. DENV LoD

Limit of detection for the DENV primer and probe set was evaluated in normal human serum using a representative strain from each dengue virus serotype (DENV-1 Puerto Rico 1998, DENV-2 Puerto Rico 1998, DENV-3 Puerto Rico 2004, DENV-4 Puerto Rico 1998). Five 10-fold serial dilutions of each strain in each matrix were prepared. For each matrix, each concentration was extracted 20 times using the MagNA Pure LC 2.0 Instrument and tested by the Trioplex rRT- PCR using the Superscript III master mix. Results are summarized in Table 11.

Based on concentration of dilution 4. In the absence of positive results at this concentration, quantification could not be determined for this dilution using the standard curve.

ND = not detected 3. CHIKV LoD

Limit of detection for the CHIKV primer and probe set was evaluated in normal human serum using the Puerto Rico 2014 strain of chikungunya virus. Five 10-fold serial dilutions in each matrix were prepared. For each matrix, each concentration was extracted 20 times using the MagNA Pure LC 2.0 Instrument and tested by the Trioplex rRT-PCR using the Superscript III master mix. Results for serum are summarized in Table 12.

Table 12: CHIKV LoD in serum

* Based on concentration of dilution 4. In the absence of positive results at this concentration, quantification could not be determined for this dilution using the standard curve.

ND = not detected Inclusivity

1. DENV inclusivity evaluation

Inclusivity of the DENV primer and probe set was evaluated using a panel of RNA from 29 international isolates of dengue virus, representing contemporary strains from all clinically relevant genotypes. Testing was conducted using the Superscript III master mix. A summary of test results are in Table 13.

Table 13: DENV inclusivity across dengue viruses

2. ZIKV, DENV and CHIKV sequence analysis

In silico analysis of the Trioplex rRT-PCR primers and probe sequences was performed to verify reagent sequence homology with each corresponding virus and target region. A total of 514 current and historical dengue virus strains including 104 DENV-1, 142 DENV-2, 154 DENV-3 and 114 DENV-4, 206 chikungunya virus strains and 33 Zika virus strains were selected for this study. All primer and probe sequences showed 100% sequence identity with their expected target, predicting no false negative results are likely to occur. Table 14 contains a summary of these findings.

Exclusivity

1. Near-neighbor exclusivity evaluation

Evaluation of the cross-reactivity of each component of the Trioplex rRT-PCR with the viruses targeted by the other components was evaluated extensively as a part of all LoD, bridging and contrived specimen evaluations. No cross-reactivity between the component primers and probes and these three viruses was observed.

Three additional flaviviruses (WNV, YFV and SLEV) were selected to evaluate the specificity of the DENV, ZIKV and CHIKV primer and probe sets. Tissue culture supernatant of WNV (NY99 strain), YFV (17D strain), and SLEV (MSI-7 strain) were extracted with the Roche MagNA Pure LC 2.0 Instrument and tested using the Superscript III master mix. All three viruses were tested in duplicate at three 10-fold dilutions. No cross-reactivity was observed. All controls performed as expected.

Table 15: Near neighbor cross-reactivity

*Cross-reactivity findings for these three viruses were extrapolated from data presented in limit of detection, bridging, archived clinical specimen and contrived specimen evaluations. 2. Non- Arbovirus exclusivity evaluation

A panel of viruses and organisms known to cause similar signs and symptoms to the viruses detected by the Trioplex rRT-PCR were selected for inclusion in an exclusivity evaluation. The nucleic acid was prepared from quantified stocks of qualified strains of each of the listed organisms. All organisms were tested in triplicate at one high concentration: 100 pg nucleic acid/reaction. No cross-reactivity was observed. All controls performed as expected.

3. In silico evaluation

Additional evaluation of the analytical specificity of the Trioplex rRT-PCR was performed through in silico analysis of each primer and probe sequence against other common causes of acute febrile illness in humans. BLAST analysis queries of the Trioplex rRT-PCR primers and probes were performed against the GenBank public domain nucleotide sequences and showed no significant combined homologies (primer target and probe target) with other conditions that would predict potential false positive rRT-PCR results. Conditions and associated causative agents covered in the in silico specificity analysis are presented in Table 17. Table 17: Organisms evaluated during in silico specificity analysis

Bridging Studies

1. qScript and Superscript III master mix evaluations:

Four pools of material were prepared for evaluation: three pools of serum and one of urine. One pool of serum and one of urine were spiked with French Polynesia 2013 strain of Zika virus at the viral stock dilution factor identified as the LoD for ZIKV with Superscript III. One pool of serum was spiked with dengue virus (Puerto Rico 1998, serotype 2) at the viral stock dilution factor identified as the LoD for DENV with Superscript III. And one pool of serum was spiked with chikungunya virus (Puerto Rico 2014) at the viral stock dilution factor identified as the LoD for CHIKV with Superscript III.

Each pool was extracted using the MagNA Pure LC 2.0 Instrument 20 times. Each resulting RNA sample was tested by the Trioplex rRT-PCR using both the Superscript III master mix and the qScript master mix. Results show comparable performance between the Superscript III and qScript master mix. A standard curve was included in testing of each master mix. Both master mixes are acceptable for use with the assay. A summary of results is presented in Table 18 and Table 19. Table 18: ZIKV qScript bridging summary

Table 19: DENV and CHIKV qScript bridging summary

2. MagNA Pure 96 Instrument extraction evaluation

This study represented a repeat of the initial LoD study with the MagNA Pure 96

Instrument. The one difference is that a single dengue virus (Puerto Rico 2004, serotype 3) was selected for this evaluation instead of conducting the evaluation across all four serotypes. Results of the LoD evaluation for ZIKV are summarized in Table 20 and Table 21. DENV results are summarized in Table 22; CHIKV in Table 23. The MagNA Pure 96 is acceptable for use with the assay.

Table 20: MagNA Pure 96 Instrument Evaluation - Zika in serum

* Based on concentration of dilution 4. In the absence of positive results at this concentration, quantification could not be determined for this dilution using the standard curve.

ND = not detected

Table 21: MagNA Pure 96 Instrument Evaluation - Zika in urine

* Based on concentration of dilution 4. In the absence of positive results at this concentration, quantification could not be determined for this dilution using the standard curve.

ND = not detected

Table 22: MagNA Pure 96 Instrument Evaluation - dengue in serum

* Based on concentration of dilution 3. In the absence of positive results at this concentration, quantification could not be determined for this dilution using the standard curve.

ND = not detected Table 23: MagNA Pure 96 Instrument Evaluation - chikungunya in serum

* Based on concentration of dilution 3. In the absence of positive results at this concentration, quantification could not be determined for this dilution using the standard curve.

ND = not detected

3. QIAamp extraction evaluation

One pool of urine and one of serum were spiked using the French Polynesia 2013 strain of Zika virus to the dilution factor of viral stock identified as the LoD for ZIKV with the MagNA Pure LC 2.0 Instrument. Each pool was extracted 20 times using the Qiagen QIAamp DSP Viral RNA Mini Kit and tested with the Trioplex rRT-PCR using the Superscript III master mix. Results support that the Qiagen QIAamp DSP Viral RNA Mini Kit performs in a non-inferior manner to the MagNA Pure LC 2.0 Instrument in the preparation of nucleic acid for subsequent testing by the Trioplex rRT-PCR and is acceptable for use in the assay.

Table 24: QIAamp extraction bridging summary

Clinical evaluation

1. Clinical performance of Trioplex rRT-PCR

From the archival collection of the CDC Dengue Branch in Puerto Rico, 130 serum specimens were selected to evaluate the performance of the Trioplex rRT-PCR. Forty-eight specimens from dengue cases (12 from each serotype), 12 from chikungunya cases, 20 from Zika cases and 50 negative specimens from symptomatic individuals were included in this specimen set. Upon removal from the archive (-70°C), specimens were tested with the Trioplex rRT-PCR (using Superscript III and the MagNA Pure LC 2.0 Instrument), the FDA-cleared DENV 1-4 rRT-PCR, singleplex in-house Zika NS3 and chikungunya nSPl rRT-PCR assays. Results of testing with the DENV 1-4 rRT-PCR, in-house Zika and chikungunya rRT-PCR assays matched the previous determination associated with all but one of the repository specimens.

One archived Zika specimen generated negative results with the in-house Zika NS3 assay (Ct. 38.45, assay positive cutoff <38) and positive Zika result with the Trioplex rRT-PCR. Due to the in-house Zika NS3 assay result, the archived Zika specimen was re-classified as a negative specimen and the Trioplex result analyzed as a false positive. Trioplex rRT-PCR results of testing are compared to this archival specimen category in the table below.

Table 25: Trioplex rRT-PCR performance with archived clinical specimens

* One archived Zika specimen, when tested upon retrieval from archive, gave a Ct value just above the cutoff for the in-house Zika NS3 assay. Thus the specimen was re-classified as a negative specimen. The specimen gave a Zika positive result with the Trioplex assay, presented as a false positive result.

**One dengue specimen (serotype 4) generated a Ct of 39.87, which is a negative result. DENV 1-4 assay test result for the specimen was positive for serotype 4. 2. Urine specimen data

Two urine specimens collected from symptomatic female patients suspected of Zika virus infection during the current Zika outbreak were analyzed. These specimens were tested with the Trioplex rRT-PCR using the MagNA Pure LC 2.0 Instrument and Superscript III master mix. Specimens were also tested with the ZIKV primer and probe set run singleplex and with an in- house Zika NS3 rRT-PCR assay. Each specimen was tested alongside a patient-matched serum specimen collected the same day the urine was collected. Results are presented in Table 26.

Table 26: Urine specimen data

3. Amniotic fluid data

Seven amniotic fluid specimens collected from patients suspected of Zika virus infection were obtained for testing by rRT-PCR. Specimens were extracted with the QIAamp Viral RNA Mini Kit. rRT-PCR was performed using the ZIKV primer and probe sequences, but on the BioRad iCycler. All seven specimens were submitted alongside additional patient specimens. Data for specimens from all seven patients are presented in Table 27.

Table 27: Amniotic specimen testing

4. CSF data

No acute phase CSF specimens from Zika cases have been collected for rRT-PCR analysis. Two CSF specimens collected during the acute phase of a suspected Zika infection were collected alongside patient-matched serum specimens. Neither proved to be a Zika case. PCR was performed using the ZIKV primer and probe sequences, but on a different PCR instrument. Data from testing of these specimens are presented in Table 28. Table 28: CSF Testing Data

5. Contrived specimen evaluation

Testing was conducted in two rounds. For the first round, 50 negative human serum specimens were used to prepare contrived specimens to evaluate the performance of the Trioplex rRT-PCR. Each specimen was aliquoted into 3 tubes. One aliquot from each specimen was not spiked (50 of specimen group 15). The remaining aliquots (n=100) were distributed into subgroups and spiked with whole virus as outlined in Specimen groups 1-13 in Table 29 below. For the second round of testing, an additional 25 contrived serum specimens were prepared: 15 as defined for specimen group 14, and 10 more negatives (specimen group 15) to mix in with them.

Low spiking level for Zika (French Polynesia 2013) was approximately 1.5-3 x LoD, moderate was approx. 100 x LoD, and high was approximately 1000 x LoD. For dengue (serotype 2, Puerto Rico 1998) and chikungunya (Puerto Rico 2014), low spiking level was 5-10 x LoD, high was 100-150 x LoD.

Aliquots were blinded and passed on to an operator for testing by the Trioplex rRT-PCR.

Extraction was performed using the MagNA Pure LC 2.0 Instrument and rRT-PCR was conducted with the Superscript II master mix. Results of testing are summarized in Table 30. Agreement between expected results and testing results for all three primer and probe sets was 100%.

Table 29: Spiking plan for contrived specimen study

In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

1. An isolated oligonucleotide for detection of dengue virus (DENV) or chikungunya virus (CHIKV) nucleic acid, wherein the sequence of the oligonucleotide is at least 90% identical to any one of SEQ ID NOs: 1-7.

2. The isolated oligonucleotide of claim 1, wherein the sequence of the oligonucleotide is at least 95% identical to any one of SEQ ID NOs: 1-7.

3. The isolated oligonucleotide of claim 1 or claim 2, wherein the sequence of the oligonucleotide comprises or consists of any one of SEQ ID NOs: 1-7.

4. The isolated oligonucleotide of any one of claims 1-3, wherein the oligonucleotide is conjugated to a detectable label.

5. The isolated oligonucleotide of claim 4, wherein the detectable label comprises a fluorophore, a quencher, or both.

6. A collection of oligonucleotides for detection of DENV nucleic acid, comprising: a forward primer comprising a sequence at least 90% identical to SEQ ID NO: 1;

a first reverse primer comprising a sequence at least 90% identical to SEQ ID NO: 2;

a second reverse primer comprising a sequence at least 90% identical to SEQ ID NO: 3; and a probe comprising a sequence at least 90% identical to SEQ ID NO: 4.

7. The collection of claim 6, wherein:

the sequence of the forward primer comprises or consists of SEQ ID NO: 1;

the sequence of the first reverse primer comprises or consists of SEQ ID NO: 2;

the sequence of the second reverse primer comprises or consists of SEQ ID NO: 3; and the sequence of the probe comprises or consists of SEQ ID NO: 4.

8. A collection of oligonucleotides for detection of CHIKV nucleic acid, comprising: a forward primer comprising a sequence at least 90% identical to SEQ ID NO: 5;

a reverse primer comprising a sequence at least 90% identical to SEQ ID NO: 6; and a probe comprising a sequence at least 90% identical to SEQ ID NO: 7.

9. The collection of claim 8, wherein:

the sequence of the forward primer comprises or consists of SEQ ID NO: 5;

the sequence of the reverse primer comprises or consists of SEQ ID NO: 6; and

the sequence of the probe comprises or consists of SEQ ID NO: 7.

10. The collection of any one of claims 6-9, wherein the probe comprises a fluorophore, a quencher, or both.

11. The collection of claim 10, wherein the probe comprises a fluorophore on its 5' end and a quencher on its 3 ' end.

12. A kit for detecting dengue virus (DENV), chikungunya virus (CHIKV) and Zika virus (ZIKV) nucleic acid in a biological sample, comprising:

a DENV forward primer comprising a sequence at least 90% identical to SEQ ID NO: 1; a first DENV reverse primer comprising a sequence at least 90% identical to SEQ ID NO:

2;

a second DENV reverse primer comprising a sequence at least 90% identical to SEQ ID

NO: 3;

a DENV probe comprising a sequence at least 90% identical to SEQ ID NO: 4;

a CHIKV forward primer comprising a sequence at least 90% identical to SEQ ID NO: 5; a CHIKV reverse primer comprising a sequence at least 90% identical to SEQ ID NO: 6; a CHIKV probe comprising a sequence at least 90% identical to SEQ ID NO: 7;

a ZIKV forward primer comprising a sequence at least 90% identical to SEQ ID NO: 8; a ZIKV reverse primer comprising a sequence at least 90% identical to SEQ ID NO: 9; and a ZIKV probe comprising a sequence at least 90% identical to SEQ ID NO: 10.

13. The kit of claim 12, wherein:

the sequence of the DENV forward primer comprises or consists of SEQ ID NO: 1;

the sequence of the first DENV reverse primer comprises or consists of SEQ ID NO: 2; the sequence of the second DENV reverse primer comprises or consists of SEQ ID NO: 3; the sequence of the DENV probe comprises or consists of SEQ ID NO: 4;

the sequence of the CHIKV forward primer comprises or consists of SEQ ID NO: 5;

the sequence of the CHIKV reverse primer comprises or consists of SEQ ID NO: 6; the sequence of the CHIKV probe comprises or consists of SEQ ID NO: 7; the sequence of the ZIKV forward primer comprises or consists of SEQ ID NO: 8;

the sequence of the ZIKV reverse primer comprises or consists of SEQ ID NO: 9; and the sequence of the ZIKV probe comprises or consists of SEQ ID NO: 10.

14. The kit of claim 12 or claim 13, further comprising a forward primer, a reverse primer and a probe for detection of human ribonuclease P (RNase P), wherein:

the RNase P forward primer comprises a sequence at least 90% identical to SEQ ID NO: 11; the RNase P reverse primer comprises a sequence at least 90% identical to SEQ ID NO: 12; and

the RNase P probe comprises a sequence at least 90% identical to SEQ ID NO: 13.

15. The kit of claim 14, wherein:

the sequence of the RNase P forward primer comprises or consists of SEQ ID NO: 11; the sequence of the RNase P reverse primer comprises or consists of SEQ ID NO: 12; and the sequence of the RNase P probe comprises or consists of SEQ ID NO: 13.

16. The kit of any one of claims 12-15, wherein the DENV, CHIKV, ZIKV and RNase P probes comprise a fluorophore, a quencher, or both.

17. The kit of claim 16, wherein the DENV, CHIKV, ZIKV and RNase P probes comprise a fluorophore on their 5' end and a quencher on their 3' end.

18. A method for detecting dengue virus (DENV), chikungunya virus (CHIKV) or Zika virus (ZIKV) nucleic acid in a biological sample, comprising:

(i) subjecting the sample to a reverse transcription polymerase chain reaction (RT-PCR) using primers and a probe specific for DENV nucleic acid, primers and a probe specific for CHIKV nucleic acid, and primers and a probe specific for ZIKV nucleic acid, to produce a DENV, CHIKV or ZIKV nucleic acid amplification product, wherein the primers and probes comprise:

a DENV forward primer comprising a sequence at least 90% identical to SEQ ID

NO: 1;

a first DENV reverse primer comprising a sequence at least 90% identical to SEQ ID NO: 2; a second DENV reverse primer comprising a sequence at least 90% identical to SEQ ID NO: 3;

a DENV probe comprising a sequence at least 90% identical to SEQ ID NO: 4; a CHIKV forward primer comprising a sequence at least 90% identical to SEQ ID NO: 5;

a CHIKV reverse primer comprising a sequence at least 90% identical to SEQ ID

NO: 6;

a CHIKV probe comprising a sequence at least 90% identical to SEQ ID NO: 7; a ZIKV forward primer comprising a sequence at least 90% identical to SEQ ID NO: 8;

a ZIKV reverse primer comprising a sequence at least 90% identical to SEQ ID NO:

9; and

a ZIKV probe comprising a sequence at least 90% identical to SEQ ID NO: 10; and (ii) detecting the DENV, CHIKV or ZIKV nucleic acid amplification product, thereby detecting DENV, CHIKV or ZIKV in the biological sample.

19. The method of claim 18, wherein:

the sequence of the DENV forward primer comprises or consists of SEQ ID NO: 1;

the sequence of the first DENV reverse primer comprises or consists of SEQ ID NO: 2; the sequence of the second DENV reverse primer comprises or consists of SEQ ID NO: 3; the sequence of the DENV probe comprises or consists of SEQ ID NO: 4;

the sequence of the CHIKV forward primer comprises or consists of SEQ ID NO: 5;

the sequence of the CHIKV reverse primer comprises or consists of SEQ ID NO: 6;

the sequence of the CHIKV probe comprises or consists of SEQ ID NO: 7;

the sequence of the ZIKV forward primer comprises or consists of SEQ ID NO: 8;

the sequence of the ZIKV reverse primer comprises or consists of SEQ ID NO: 9; and the sequence of the ZIKV probe comprises or consists of SEQ ID NO: 10.

20. The method of claim 18 or claim 19, wherein the RT-PCR further uses a forward primer, a reverse primer and a probe for detection of human ribonuc lease P (RNase P), wherein: the RNase P forward primer comprises a sequence at least 90% identical to SEQ ID NO: 11; the RNase P reverse primer comprises a sequence at least 90% identical to SEQ ID NO: 12; and

the RNase P probe comprises a sequence at least 90% identical to SEQ ID NO: 13.

21. The method of claim 20, wherein:

the sequence of the RNase P forward primer comprises or consists of SEQ ID NO: 11; the sequence of the RNase P reverse primer comprises or consists of SEQ ID NO: 12; and the sequence of the RNase P probe comprises or consists of SEQ ID NO: 13.

22. The method of any one of claims 18-21, wherein the DENV, CHIKV, ZIKV and RNase P probes comprise a fluorophore, a quencher, or both.

23. The method of claim 22, wherein the DENV, CHIKV, ZIKV and RNase P probes comprise a fluorophore on their 5' end and a quencher on their 3' end.

24. The method of any one of claims 18-23, wherein detecting the DENV, CHIKV or ZIKV nucleic acid amplification product comprises detecting fluorescence.

25. The method of any one of claims 18-24, wherein the biological sample is a biological fluid sample.

26. The method of claim 25, wherein the biological fluid sample comprises serum, cerebrospinal fluid (CSF), urine or amniotic fluid.