TW202100177A - Panax lycium fermented liquid and making method thereof - Google Patents

Abstract

A method for preparing a panax lyceum fermented liquid includes providing a culture medium, fermenting the culture medium and multiple strains in a magnetic field for 4 to 15.5 days to from a basis fermentation, adjusting a Brix of the basis fermentation to from the panax lyceum fermented liquid. Therefore, the panax lyceum fermented liquid has a higher content of active ingredients.

Description

Ginseng wolfberry fermentation liquid and preparation method thereof

The invention relates to a fermented liquid drink, in particular to a ginseng and wolfberry fermented liquid drink and a preparation method thereof.

Foods fermented by microorganisms have advantages such as easier digestion, increased flavor, and improved storage time. For example: kimchi, natto, fruit vinegar, etc. are all popular fermented foods.

In the beverage industry, fermented beverages are becoming more and more popular among consumers. Fermented beverages are often prepared with dairy, vegetables, fruits, beans, etc. as the raw material base, and then through the action of different types of microorganisms.

In view of this, the present invention provides a ginseng wolfberry fermented liquid beverage and a preparation method thereof, which can further improve the function of the fermented beverage. Here, based on Chinese medicinal materials, high-efficiency strains are selected, and the fermentation liquid of ginseng and wolfberry is prepared through a magnetic field fermentation process.

In one embodiment, the preparation method of ginseng wolfberry fermentation broth includes: providing a culture broth; fermenting the culture broth and plural strains in a magnetic field for 4 to 15.5 days to obtain a fermentation stock solution; adjusting the sugar content of the fermentation stock solution to form a ginseng wolfberry fermentation liquid. Among them, the culture solution includes a ginseng wolfberry solution formed by 1 part by weight of ginseng, 1 part by weight of wolfberry and 50 parts by weight of water, and 10% glucose of the total weight of the ginseng wolfberry solution. The plural bacterial species include 0.01%~0.5% yeast, 0.01%~0.25% lactic acid bacteria relative to the culture solution, and 3~10% acetic acid bacteria relative to the culture solution.

In one embodiment, the step of fermenting the culture broth and strains in a magnetic field includes: fermenting yeasts in a magnetic field for 1 to 2.5 days to form a first initial fermentation broth; adding lactic acid bacteria in the first initial fermentation broth and Ferment in a magnetic field for 1 to 3 days to form a second primary fermentation broth; add acetic acid bacteria to the second primary fermentation broth and ferment in a magnetic field for 3 to 10 days to form a primary fermentation broth; filter the primary fermentation broth to obtain the fermentation stock.

In one embodiment, the step of filtering the initial fermentation broth includes concentrating under reduced pressure at 60° C. and filtering the initial fermentation broth with 200 mesh.

In one embodiment, the sugar content of the fermentation stock solution is less than or equal to 4°Bx.

In one embodiment, the step of providing the culture solution includes: mixing the ginseng wolfberry solution and glucose to form a mixed solution; extracting the mixed solution at 50-100° C. for 0.5-1.5 hours to obtain the culture solution.

In one embodiment, the yeast is Saccharomyces cerevisiae , the lactic acid bacteria is Lactobacillus plantarum , and the acetic acid bacteria is Acetobacter aceti .

In one embodiment, the step of adjusting the sugar content of the fermentation stock solution includes: adding oligosaccharides to the fermentation stock solution so that the sugar content of the fermentation stock solution reaches 40°Bx to form a ginseng wolfberry fermentation broth.

In one embodiment, the present invention provides a ginseng wolfberry fermentation broth, which is prepared by the above-mentioned preparation method of ginseng wolfberry fermentation broth.

In one embodiment, the total polyphenol content of the fermentation broth of ginseng and wolfberry is more than 436 μg/ml.

In one embodiment, the flavonoid content of the fermentation broth of ginseng wolfberry is more than 12703 µg/ml.

In summary, the preparation method of ginseng wolfberry fermentation broth according to any embodiment can increase the functionality of the ginseng wolfberry fermentation broth, shorten the fermentation time, and increase the content of polyphenols and flavonoids in the ginseng wolfberry fermentation broth. In one embodiment, during the fermentation process, multiple strains are added sequentially and the fermentation time of each strain is controlled, so that the strains can grow optimally, and the effective ingredient concentration of the ginseng wolfberry fermentation broth is further increased . In one embodiment, the initial fermentation broth is concentrated to facilitate subsequent adjustment of the flavor and mouthfeel of the ginseng and wolfberry fermentation broth. In one embodiment, the pH value and sugar content during the fermentation process are monitored to ensure the smooth completion of the fermentation process. In one embodiment, heating the glucose and ginseng wolfberry solution together helps to dissolve the glucose and avoid contamination of the culture solution. In one embodiment, oligosaccharides are used to adjust the sweetness and mouthfeel to reduce calories.

In the description of the following embodiments, unless otherwise specified, the symbol "%" refers to percentage by weight.

Refer to Figure 1. In one embodiment, the preparation method of ginseng wolfberry fermentation broth includes the following steps: providing a culture broth (step S01), fermenting the broth and plural strains in a magnetic field for 4 to 15.5 days to obtain a fermentation stock (step S02), And adjust the degree of brix (Degrees Brix, °Bx) of the fermentation stock solution to complete the ginseng wolfberry fermentation broth (step S03).

In step S01, the culture solution includes a ginseng wolfberry solution formed by 1 part by weight of ginseng, 1 part by weight of wolfberry and 50 parts by weight of water, and 10% glucose of the total weight of the ginseng and wolfberry solution. In some embodiments, ginseng ( Panax ginseng ) uses unprocessed dry white ginseng roots. Lycium chinense ( Lycium chinense ) uses dried medlar fruits.

In one embodiment, step S01 may include: mixing ginseng, wolfberry, and glucose in the above-mentioned ratio to form a mixed solution; and extracting the mixed solution at 50-100° C. for 0.5-1.5 hours to obtain a culture solution. Here, the glucose and ginseng wolfberry solution are combined to perform an extraction process to help dissolve the glucose and avoid contamination.

In another embodiment, step S01 includes: extracting ginseng, wolfberry and water at 50-100° C. for 0.5-1.5 hours to form an aqueous extract; and adding glucose to the aqueous extract to obtain a culture solution. Here, the ginseng and wolfberry are extracted separately to facilitate the reliable release of the effective ingredients in the ginseng and/or wolfberry.

In some embodiments, extraction refers to maintaining the mixed solution at 50-100°C and standing for 0.5-1.5 hours. In one embodiment, extraction refers to maintaining the mixed solution at 95° C. and letting it stand for 1 hour.

In one embodiment, the sugar content of the culture solution is 9°Bx~10°Bx. In this regard, sufficient sugar content can ensure the smooth progress of subsequent fermentation, and the bacteria can have sufficient nutrients.

Subsequently, the culture broth and the plurality of bacterial species are fermented in a magnetic field for 4 to 15.5 days to obtain a fermentation stock solution (step S02). Among them, the plural bacterial species include 0.01% to 0.5% yeast relative to the culture solution, 0.01% to 0.25% lactic acid bacteria relative to the culture solution, and 3-10% Acetobacter aceti relative to the culture solution. In one embodiment, the culture solution is directly added to the strain for fermentation without filtering out the internal solids (extracted ginseng and/or wolfberry), so that the strains are used to further extract the active ingredients in the solids.

In one embodiment, the yeast may be commercially available Saccharomyces cerevisiae ( Saccharomyces cerevisiae ). For example, purchase beer yeast with the strain number BCRC20271 (International Deposit ATCC26602) from the Food Work Development Research Institute.

In one embodiment, the lactic acid bacteria may be commercially available Lactobacillus plantarum, commercially available Streptococcus thermophiles or Lactobacillus plantarum. For example, use the Lactobacillus embryonicum TCI028 with the deposit number BCRC910805 (International Deposit DSM33108) strain or the Lactobacillus embryonicum TCI378 with the deposit number BCRT910760 (International Deposit DSM32451) strain. For another example, the strain of Streptococcus thermophilus TCI633 with the deposit number BCRC910636 (International Deposit DSM28121) is used.

In one embodiment, the acetic acid bacteria with the deposit number BCRC11688 (International Deposit ATCC15973) strain is purchased from the American Type Culture Collection.

Refer to Figure 2. In an embodiment, step 02 may include: fermenting yeasts in a magnetic field for 1 to 2.5 days to form a first initial fermentation broth (step S21); adding lactic acid bacteria to the first initial fermentation broth and fermenting in the magnetic field for 1~ A second primary fermentation broth is formed after 3 days (step S22); acetic acid bacteria are added to the second primary fermentation broth and fermented in a magnetic field to form a primary fermentation broth after 3-10 days (step S23); and the primary fermentation broth is filtered to obtain a fermentation stock (Step S24).

In step S21, by first adding yeast, the culture solution can be fermented to produce alcohol; here, the alcohol is advantageous in extracting different effective components in the wolfberry. In some embodiments, the PH value of the first initial fermentation broth is less than 4, and its sugar content is about 9°Bx.

In step S22, by adding lactic acid bacteria, the glucose in the first initial fermentation broth can be further consumed to reduce the sugar content and produce lactic acid, so as to reduce the PH value of the first initial fermentation broth; here, reduce the pH of the first initial fermentation broth. The value is conducive to the further extraction of other different effective ingredients in the Chinese wolfberry. In some embodiments, the PH value of the second primary fermentation broth is less than 3.5, and its sugar content is about 6°Bx.

In step S23, the alcohol in the second primary fermentation broth can be consumed by adding acetic acid bacteria, and the glucose content can be further reduced. In some embodiments, the PH value of the initial fermentation broth is less than 3.5, and its sugar content is about 3°Bx.

In an embodiment of step S24, the primary fermentation liquid may be filtered and concentrated to obtain the fermentation raw liquid. In an exemplary embodiment, the concentration method may be concentration under reduced pressure at 60° C., and the filtration method may be 200 mesh filtration. In some embodiments, the sugar content of the fermentation stock is about 2°Bx. In some embodiments, the pH value of the fermentation stock is less than 3.5.

In an embodiment of step S03, oligosaccharides may be added to the fermentation stock solution so that the sugar content of the fermentation stock solution reaches 40°Bx to form a ginseng wolfberry fermentation broth. Here, oligosaccharides refer to oligosaccharides formed by the polymerization of 3-10 monosaccharide molecules. Among them, the oligosaccharides can be fructooligosaccharides, galactooligosaccharides, xylo-oligosaccharides, isomalto-oligosaccharides and the like. In an embodiment, the added oligosaccharide may be an oligosaccharide solution containing 40% to 70% isomalt oligosaccharide.

In one embodiment, the total polyphenol content of the ginseng wolfberry fermentation broth obtained in step S03 is 436.33 µg/ml. In one embodiment, the flavonoid content of the ginseng wolfberry fermentation broth is 12703 µg/ml.

Demonstration example 1: Preparation of ginseng and wolfberry fermentation broth

Mix ginseng, wolfberry, water and glucose into a mixed solution. In the mixed solution, ginseng is 1 part by weight, wolfberry is 1 part by weight, and water is 50 parts by weight, and glucose is 10% of the total weight of the ginseng and wolfberry solution formed by ginseng, wolfberry and water. Next, the mixed solution was extracted at 95°C for 1 hour to obtain a culture solution. After the culture solution is cooled, it is placed in a fermenting barrel equipped with a magnet on its periphery. The brewer's yeast of BCRC20271 strain at 0.01% relative to the culture broth was added to the culture broth in the fermenter, and then fermented at 30°C for 1 day to form the first initial fermentation broth. Then add 0.05% of the BCRC910805 strain Lactobacillus embryo to the first primary fermentation broth in the fermenter, and then ferment for 1 day to form the second primary fermentation broth. Finally, 5% of the acetic acid bacteria of the BCRC11688 strain was added to the second primary fermentation broth in the fermentation tank, and then the fermentation was carried out for 5 days to obtain the fermentation stock solution. After obtaining the fermentation stock, concentrate under reduced pressure at 60° C. and filter the initial fermentation broth with 200 mesh to obtain the fermentation stock. Then, the ratio of 60% isomalt-oligosaccharide and 40% of the fermentation stock is mixed so that the sugar content of the fermentation stock reaches 40°Bx to form a group A ginseng wolfberry fermentation broth. Here, the magnet provided on the periphery of the fermenting barrel can form a magnetic field in the fermenting barrel, so that the aforementioned solution in the fermenting barrel undergoes various stages of fermentation in the magnetic field.

In addition, the same raw material ratio and fermentation procedure as the fermentation broth of group A ginseng and wolfberry are used, but the magnet is not set on the periphery of the fermentation barrel to prepare the fermentation broth of group B ginseng and wolfberry.

Experiment 1: Measurement results of PH value and sugar content in the fermentation stage

The pH value and sugar content of the solution formed at each stage of the preparation process are determined as follows.

Table I Stage/Group Group A ginseng wolfberry fermentation broth Group B ginseng wolfberry fermentation broth pH value Brix °Bx pH value Brix °Bx Culture medium 4.9 10.5 4.86 10.6 First fermentation broth 4.27 8.6 4.36 9.4 Second primary fermentation broth 4.12 6.1 4.31 8.2 Initial fermentation broth 3.76 3.6 4.13 4.2

It can be seen from the above table that the PH value and sugar content of the ginseng and wolfberry fermentation broth of group A are lower than those of the ginseng wolfberry fermentation broth of group B at all stages; its representative is compared with the ginseng wolfberry fermentation broth of group B. The fermentation proceeded more smoothly, the activity of the bacteria was better, the metabolites were more, and the utilization rate of glucose was better. In other words, fermentation in a magnetic field can significantly improve the efficiency of fermentation.

Experiment 2: Total polyphenol content test

Take the group A ginseng wolfberry fermentation broth and the B group ginseng wolfberry fermentation broth obtained in Example 1 above as samples. Dilute each sample 10 times with water and take 100 mL into a centrifuge tube. Then, add 500 μL of Folin-Ciocalteu phenol reagent to the centrifuge tube and mix with the diluted sample and let it stand for 3 minutes, then add 400 μL of 7.5% sodium carbonate and mix and let it stand for 30 minutes to obtain the reaction solution to be tested. After standing for the second time, take 200 μL of the reaction solution to be tested into a 96-well plate, and measure the absorbance of the reaction solution to be tested at 750 nm.

In addition, a standard curve was prepared using gallic acid as a standard. Here, prepare 0μL/mL, 20μL/mL, 40μL/mL, 60μL/mL, 80μL/mL, and 100μL/mL gallic acid standard solutions, and take 100μL of each concentration standard solution to 10mL centrifugation In the tube. Add 500μL of Folin-Ciocalteu phenol reagent to the centrifuge tube and mix with the standard solution and let it stand for 3 minutes, then add 400μL of 7.5% sodium carbonate and mix and let it stand for 30 minutes to obtain the standard reaction solution. Take 200μL of the standard reaction solution in a 96-well plate, and measure its absorbance at 750nm to obtain a standard curve.

Then, use the standard curve to convert the absorbance value of the reaction solution to be tested into the total polyphenol content. From this, the total polyphenol content of the fermentation broth of group A ginseng and wolfberry is 436.33μg/ml and the total polyphenol content of the fermentation broth of group B ginseng and wolfberry is 202μg/ml, as shown in Figure 3.

It can be seen from the experimental results that the total polyphenol content of the fermentation broth of ginseng and wolfberry in group A is increased by 21% compared with the total polyphenol content of the fermentation broth of ginseng and wolfberry in group B; this shows that fermentation in a magnetic field is more conducive to the extraction of effective ingredients.

Experiment 3: Total flavonoid content test

Take the group A ginseng wolfberry fermentation broth and the B group ginseng wolfberry fermentation broth obtained in Example 1 above as samples. Dilute each sample 20 times with water to 1200ul, and add 200μL of 5% sodium nitrite and mix and let it stand for 6 minutes, then add 200μL of 10% aluminum nitrate and mix and let it stand for 6 minutes, then add 2ml of 4% oxygen sodium oxide and mix, and finally add 1.4ml of water and mix to obtain the reaction solution to be tested. Put the test reaction solution into a 96-well plate, and measure the absorbance value of the test reaction solution at 500 nm with a spectrophotometer.

In addition, rutin was used as a standard to prepare a standard curve. Here, prepare standard solutions of Brutin at 0μg/mL, 400μg/mL, 600μg/mL, 1000μg/mL and 1200μg/mL. Add 200μL of 5% sodium nitrite to each standard solution and mix and let it stand for 6 minutes, then add 200μL of 10% aluminum nitrate and mix and let it stand for 6 minutes, then add 2ml of 4% sodium oxynitride and mix. Finally, add 1.4ml of water and mix to obtain the standard solution to be tested. Transfer 200μL of the standard solution to be tested to a 96-well plate, and use a spectrophotometer to measure the absorbance of the reaction solution to be tested at 500nm. The absorbance at 500nm is 0.035 and the absorbance at 400μg/mL is 0.13. The absorbance value of 600μg/mL is 0.183, the absorbance value of 1000μg/mL is 0.273, and the absorbance value of 1200μg/mL is 0.335, and the above results are calculated by linear regression to obtain the standard curve.

Then, use the standard curve to convert the absorbance value of the reaction solution to be tested into the total flavonoid content. From this, the total flavonoid content of the ginseng wolfberry fermentation broth of group A was 12703 µg/ml and the total flavonoid content of ginseng wolfberry fermentation broth of group B was 8315 µg/ml, as shown in Figure 4.

According to the experimental results, the total flavonoid content of the fermentation broth of ginseng and wolfberry of group A was increased by 52% compared with the total flavonoid content of the fermentation broth of ginseng and wolfberry of B; based on this, it can be seen that fermentation in a magnetic field can greatly increase the extraction of effective ingredients.

Experiment 4: Mitochondrial activity experiment

This experiment uses mouse skeletal muscle cells (C2C12, ATCC® CRL-1772). Here, the medium includes DMEM cell culture medium (Dulbecco’s modified Eagle’s medium), 1% penicillin-streptomycin (Gibco) and 10% fetal bovine serum (FBS, Gibco).

The cells were divided into four groups. The first to third groups included 2ml of the above-mentioned medium and inoculated with 1×10 ⁵ cells and samples. The first group of samples was the fermentation broth of group A ginseng and wolfberry obtained in Example 1 above, and the second The samples in group B are the fermentation broth of ginseng and wolfberry, the samples in the third group are the culture broth formed in the preparation process of Example 1, and the cells in the fourth group are not treated with any solution (ie blank control group). The above groups were cultured at 37°C for 24 hours. Here, the sample concentration in the culture medium of the first to third groups is 0.03125%.

After 24 hours, the blank and treated cells were stained with BD™, MitoScreen, (JC-1) dye for 15 minutes, and then washed twice with JC-1 analysis buffer, and then BD Accuri C6 Plus was used. The cytometer measures the membrane potential of PBMC mitochondria to obtain mitochondrial membrane potential activity data. In order to avoid experimental operation errors, each group performed the same steps three times. The experimental data is shown in Table 2 below:

Table II Grouping Experimental data 1 Experimental data 2 Experimental data 3 average value First group 46.9 48.4 46.4 47.2 Second Group 39.4 40.6 40.2 40.1 The third group 37.5 38.6 37.8 38.0 Fourth group 37.2 39.7 39.7 38.9

Figure 5 is drawn based on the average of the above three sets of experimental data. It can be seen from Figure 5 that after analysis and conversion, the relative activity of the first group is 47.2%, the relative activity of the second group is 40.1%, the relative activity of the third group is 38.0%, and the relative activity of the fourth group is 38.92; Both the ginseng and wolfberry fermentation broth and the B group ginseng and wolfberry fermentation broth can increase the activity of mitochondria in skeletal muscle cells, and the A group ginseng and wolfberry fermentation broth has the most significant increase.

Experiment 5: Basal metabolic rate improvement experiment

This experiment uses mouse skeletal muscle cells (C2C12, ATCC CRL-1772). Here, the culture medium includes DMEM cell culture medium (Dulbecco's modified Eagle's medium), 3.7g/L sodium bicarbonate, 100I.U. penicillin, 100μg/mL streptomycin (Penicillin-streptomycin, Gibco) and 10% fetal bovine serum ( FBS, Gibco).

The cells were divided into four groups. The first to third groups included 2ml of the above-mentioned medium and inoculated with 1×10 ⁵ cells and samples. The first group of samples was the fermentation broth of group A ginseng and wolfberry obtained in Example 1 above, and the second The samples in group B are the fermentation broth of ginseng and wolfberry, the samples in the third group are the culture broth formed in the preparation process of Example 1, and the cells in the fourth group are not treated with any solution (ie blank control group). Here, the sample concentration in the culture medium of the first to third groups is 0.03125%.

Next, process each group of cells according to the following procedure. Incubate the cells with conditioned medium (DMEM containing 1% FBS and 1% horse serum) to differentiate into mitochondria, add the above sample to treat the cells for 48 hours, lyse the cells with 100 μL pyruvate buffer, and place the cells at 4°C Centrifuge at 10000g for 10 minutes and collect the supernatant. Add 20μL of solution (Lysates) to the supernatant and add pyruvate assay buffer to a total volume of 50μL. Mix into the reaction mixture (pyruvate assay buffer 46μL, pyruvate probe 2μL and enzyme mixture 2μL) and incubate for 30 minutes, and measure the absorbance of the reaction solution to be tested at 570nm with a spectrophotometer.

In addition, pyruvic acid was used as a standard to prepare a standard curve. Here, prepare 0, 2, 4, 6, 8 and 10 nmol/μL standard solutions of pyruvate. According to the above results and the standard curve, the pyruvate content can be obtained by linear regression calculation to confirm the metabolic state of the cells. Here, the measured relative content of pyruvate is shown in Figure 6.

It can be seen from Figure 6 that compared to the blank control group (that is, the relative expression rate of the fourth group of cells is 1), the relative expression rate of the first group of cells is 3.23, and the relative expression rate of the second group of cells is 2.39. The relative expression rate of the third group of cells was 2.34. It can be seen that the ginseng and wolfberry fermentation broth of group B can increase the basal metabolic rate of cells by 239%, and the ginseng and wolfberry fermentation broth of group A can even increase the basal metabolic rate of cells by 320%.

Experiment 6: Gene performance experiment to enhance immunity

This experiment uses human monocytes (THP-1 cell line, ATCC TIB202). Here, the medium includes a culture medium (RPMI-1640, Gibco) as a base, supplemented with 10% fetal bovine serum (Gibco), 0.05 Mm disulfide ethanol, 100 units/ml penicillin and 100 μg/mL streptomycin.

The experiment was divided into four groups. The first to third groups were experimental groups. The first group of samples was the fermentation broth of ginseng and wolfberry from the first example, the second group was the fermentation broth of ginseng and wolfberry from the third group. Group samples are the culture solution formed during the preparation process of Exemplary Example 1, and the fourth group of cells are not treated with any solution (ie, blank control group).

Next, process the cells according to the following procedure. Extract 2ml of the above medium and inoculate 1×10 ⁵ cells, add the above sample to treat the cells for 24 hours, use RNA extraction reagent (Geneaid) to extract RNA, use reverse transcriptase (SuperScript®III) to reverse transcription of RNA into cDNA, and The ABI Step One Plus Real-Time PCR system is used to perform qPCR to quantify the target gene. The melting curve of the PCR reaction is confirmed during the quantitative real-time PCR reaction. The SCORE method was used to confirm the relative quantification of gene expression.

The gene expression rate of IL-1β and IL-10 of the THP-1 cell line was observed with a polymerase chain reaction (PCR) instrument using the primers shown in the following table three (Primer). The results are shown in Figure 7 and Figure 8.

Table Three gene Introduction sequence Primer length IL-1β IL-1β-F AGCTACGAATCTCCGACCAC 20 IL-1β-R CGTTATCCCATGTGTCGAAGAA twenty two IL-10 IL-10-F TCAAGGCGCATGTGAACTCC 20 IL-10-R GATGTCAAACTCACTCATGGCT twenty two *R is REVERSE reverse, F is FORWARD forward.

It can be seen from Figure 7 that compared to the blank control group (the relative expression rate is 1), the relative expression rate of IL-1β of the first group of cells is 1.53, and the relative expression rate of IL-1β of the second group of cells is 0.41 , And the relative expression rate of IL-1β in the third group of cells was 0.36. It can be seen from Figure 8 that compared to the blank control group (the relative expression rate is 1), the relative expression rate of IL-10 in the first group of cells is 1.14, and the relative expression rate of IL-10 in the second group of cells is 1.14 0.87, while the relative expression rate of IL-10 in the third group of cells was 0.6. It can be seen that the fermentation liquid of ginseng and wolfberry can enhance immunity.

In some embodiments, the obtained ginseng and wolfberry fermentation liquid can be further used as a food additive, so that a food composition containing ginseng and wolfberry fermentation liquid is obtained. Herein, the ginseng wolfberry fermentation liquid of any embodiment can be added during the preparation of raw materials by a conventional method, or the ginseng wolfberry fermentation liquid of any embodiment can be added during the food production process, and it can be combined with any edible material Formulated into food products (ie food compositions) for human and non-human animals to eat.

In some embodiments, the types of food products include, but are not limited to: beverages, fermented foods, bakery products, health foods, and dietary supplements.

Although the technical content of the present invention has been disclosed in the preferred embodiments as above, it is not intended to limit the present invention. Anyone who is familiar with this technique and makes some changes and modifications without departing from the spirit of the present invention should be covered by the present invention Therefore, the scope of protection of the present invention shall be subject to the scope of the attached patent application.

S01~S24: steps

[Figure 1] is a flowchart of a method for preparing fermentation broth according to an embodiment of the present invention. [Fig. 2] It is a detailed flowchart of step S02 in Fig. 1. [Figure 3] Department of total polyphenol content test results data diagram. [Figure 4] A diagram showing the test results of total flavonoids. [Figure 5] The data graph of the relative mitochondrial activity detection results. [Figure 6] The relative pyruvate content result data graph. [Figure 7] The relative expression rate data graph of the gene of the IL-1B primer. [Figure 8] The relative expression rate data graph of the gene of the IL-10 primer.

S01~S03: steps

Claims (10)

A preparation method of ginseng wolfberry fermentation broth, comprising: providing a culture broth, the culture broth comprising 1 part by weight of ginseng ( Panax ginseng ), 1 part by weight of wolfberry ( Lycium chinense ) and 50 parts by weight of water. Ginseng wolfberry solution and 10% glucose of the total weight of the ginseng wolfberry solution; ferment the culture solution and plural strains in a magnetic field for 4 to 15.5 days to obtain a fermentation stock solution, wherein the strains include relative to the culture The liquid is 0.01%~0.5% yeast, 0.01%~0.25% lactic acid bacteria relative to the culture broth, and 3~10% acetic acid bacteria relative to the culture broth; and adjusting the sugar content of the fermentation stock solution to form the ginseng Lycium barbarum fermentation broth. The method for preparing ginseng wolfberry fermentation broth according to claim 1, wherein the step of fermenting the culture broth and the strains in the magnetic field includes: The yeast is fermented in the magnetic field for 1 to 2.5 days to form a first initial fermentation broth; Adding the lactic acid bacteria to the first primary fermentation broth and fermenting in the magnetic field for 1 to 3 days to form a second primary fermentation broth; Adding the acetic acid bacteria into the second primary fermentation broth and fermenting in the magnetic field for 3-10 days to form the primary fermentation broth; and The primary fermentation broth is filtered to obtain the raw fermentation broth. The method for preparing ginseng wolfberry fermentation broth according to claim 2, wherein the step of filtering the primary fermentation broth includes: The initial fermentation broth was concentrated under reduced pressure at 60°C and filtered with 200 mesh. The method for preparing ginseng wolfberry fermentation broth according to claim 3, wherein the sugar content of the fermentation raw broth is less than or equal to 4°Bx. The method for preparing ginseng and wolfberry fermentation broth according to claim 1, wherein the step of providing the culture broth includes: Mixing the ginseng wolfberry solution and the glucose to form a mixed solution; and The mixed solution is extracted at 50-100°C for 0.5-1.5 hours to obtain the culture solution. The method for preparing ginseng wolfberry fermentation broth according to claim 1, wherein the yeast is Saccharomyces cerevisiae, the lactic acid bacteria is Lactobacillus plantarum, and the acetic acid bacteria is Acetobacter aceti. The method for preparing ginseng wolfberry fermentation broth according to claim 1, wherein the step of adjusting the sugar content of the fermentation stock comprises: adding an oligosaccharide to the fermentation stock so that the sugar content of the fermentation stock reaches 40°Bx to form the Ginseng wolfberry fermentation broth. A ginseng wolfberry fermentation broth is prepared by the method for preparing a ginseng wolfberry fermentation broth according to any one of claims 1 to 7. The ginseng wolfberry fermentation broth according to claim 8, wherein the total polyphenol content of the ginseng wolfberry fermentation broth is more than 436 µg/ml. The ginseng wolfberry fermentation broth according to claim 8, wherein the flavonoid content of the ginseng wolfberry fermentation broth is more than 12703 µg/ml.

Images