CN113999782B

CN113999782B - Saccharomyces cerevisiae, starter and preparation method thereof, application of starter and starter in preparation of fermented food, and preparation method of beer

Info

Publication number: CN113999782B
Application number: CN202111212008.0A
Authority: CN
Inventors: 李慧; 赵凯; 卢玉; 祁雪; 李小燕; 佟恩杰
Original assignee: Cofco Malt Dalian Co ltd; Cofco Nutrition and Health Research Institute Co Ltd
Current assignee: Cofco Malt Dalian Co ltd; Cofco Nutrition and Health Research Institute Co Ltd
Priority date: 2021-10-18
Filing date: 2021-10-18
Publication date: 2023-09-01
Anticipated expiration: 2041-10-18
Also published as: CN113999782A

Abstract

The invention relates to the field of fermentation, and discloses saccharomyces cerevisiae, a starter and a preparation method thereof, application of the saccharomyces cerevisiae and the starter in preparation of fermented foods and a preparation method of beer. The preservation number of the saccharomyces cerevisiae is CGMCC No.21162. The Saccharomyces cerevisiae of the invention has strong passage capability, stable fermentation performance of 10 generations of beer fermentation, and the autolysis rate of the yeast is not more than 5%. The Saccharomyces cerevisiae of the invention is used for brewing beer, has stable flavor, low content of substances with bad flavors such as yeast flavor, diacetyl flavor, trans-2-nonanal and the like, and can effectively delay the aging of beer. The Saccharomyces cerevisiae of the present invention may also be used to ferment flour products.

Description

Saccharomyces cerevisiae, starter and preparation method thereof, application of starter and starter in preparation of fermented food, and preparation method of beer

Technical Field

The invention relates to the field of fermentation, and discloses a saccharomyces cerevisiae, a starter, a preparation method of the starter and the starter prepared by the method, wherein the saccharomyces cerevisiae or the application of the starter in preparation of fermented food and a preparation method of beer.

Background

Saccharomyces cerevisiae (Saccharomyces cerevisiae) is the soul of alcoholic fermented foods and fermented pasta. Saccharomyces cerevisiae is subjected to various stress factors such as osmotic stress, high or low temperature stress, and alcohol stress during fermentation of food. Environmental stress can induce cells to generate a large amount of Reactive Oxygen Species (ROS), not only can destroy proteins, but also can cause oxidative degradation of cell membrane lipid, and cell death is caused, so that the application of saccharomyces cerevisiae in the fermented food industry, especially the beer fermentation industry, is affected.

In the repeated passage of yeast and beer fermentation process, the yeast is easy to self-dissolve and die under oxidative stress, and the repeated use algebra of the yeast is affected. In addition, when more than 5% of the dead yeasts undergo autolysis, beer may develop a yeast taste, an aged taste, etc., resulting in irreparable deterioration of the beer quality.

The breeding of the yeast strain with high ageing resistance increases the repeated use times of the yeast, reduces the autolysis rate of the yeast, reduces the ageing of beer, is beneficial to stabilizing the quality of the beer and directly reduces the production cost of beer enterprises.

Disclosure of Invention

In order to solve the technical problems, the invention provides a saccharomyces cerevisiae, a starter, a preparation method of the starter and the starter prepared by the method, wherein the saccharomyces cerevisiae or the application of the starter in preparation of fermented food and a preparation method of beer. The saccharomyces cerevisiae is used for brewing beer, has stable flavor and low content of substances with bad flavors such as yeast flavor, acetaldehyde, diacetyl flavor and the like, and can effectively delay the aging of the beer; the fermentation performance of the beer fermentation for 10 generations is stable, and the yeast autolysis rate is not more than 5%.

In order to achieve the above purpose, the first aspect of the present invention provides a strain of Saccharomyces cerevisiae Saccharomyces cerevisiae, which has a preservation number of CGMCC No.21162.

In a second aspect the invention provides a starter comprising Saccharomyces cerevisiae (Saccharomyces cerevisiae) as described above.

In a third aspect, the present invention provides a process for the preparation of a starter comprising fermentation culturing a Saccharomyces cerevisiae as described above in a fermentation medium.

In a fourth aspect the invention provides a starter culture prepared according to the preparation method described above.

In a fifth aspect the invention provides the use of a Saccharomyces cerevisiae as described above or a starter as described above in the preparation of a fermented food product.

In a sixth aspect, the present invention provides a method of preparing beer, the method comprising: the Saccharomyces cerevisiae as described above or the starter as described above is contacted with wort and fermented to obtain beer.

The beneficial effects of the invention are as follows:

1. safety and health: the saccharomyces cerevisiae is a safe strain which is screened from old yeast reserved in Gansu farmers and can be used for food, is green and natural, and is nutritional and healthy; can be widely applied to the field of fermentation products and can also be used for preparing a starter.

2. The Saccharomyces cerevisiae of the invention has good passaging, the fermentation performance of 10 generations of beer fermentation is stable, and the death rate of the yeast is not more than 5%.

3. The brewing yeast of the invention is used for brewing beer, has fast fermentation speed, stable flavor, low content of substances with bad flavors such as yeast flavor, acetaldehyde, diacetyl flavor, trans-2-nonanal and the like, and can effectively delay the aging of beer.

3. The beer Saccharomyces cerevisiae CGMCC No.21162 is easy to culture and prepare, and the prepared starter has high concentration of active Saccharomyces cerevisiae.

Additional features and advantages of the invention will be set forth in the detailed description which follows.

Preservation of organisms

The Saccharomyces cerevisiae (Saccharomyces cerevisiae) provided by the invention is preserved in China general microbiological culture Collection center (CGMCC) at 11 months and 11 days in 2020, and has a preservation number of CGMCC No.21162 and a preservation address of Beijing Chaoyang area North Xiylu No. 1 and 3, and is abbreviated as CGMCC.

Drawings

In order that the invention may be more readily understood, a more particular description of the invention will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings, in which,

FIG. 1 shows the colony morphology of Saccharomyces cerevisiae of the present invention on a culture medium;

FIG. 2 shows the microscopic morphology of Saccharomyces cerevisiae of the present invention.

Detailed Description

The endpoints and any values of the ranges disclosed herein are not limited to the precise range or value, and are understood to encompass values approaching those ranges or values. For numerical ranges, one or more new numerical ranges may be found between the endpoints of each range, between the endpoint of each range and the individual point value, and between the individual point value, in combination with each other, and are to be considered as specifically disclosed herein.

The first aspect of the invention provides a strain of saccharomyces cerevisiae Saccharomyces cerevisiae, and the preservation number of the saccharomyces cerevisiae is CGMCC No.21162.

The saccharomyces cerevisiae is obtained by screening old yeast reserved in Gansu farmers, and the saccharomyces cerevisiae CGMCC No.21162 has the following properties:

(1) Morphological features: the shape of the yeast is round and oval, and the diameter is 1.5-3.0 mu m; after the YPD solid culture medium grows for 48 hours, a colony with the diameter of about 3.0mm can grow, and the colony is a glossy yellow white dot, and has the advantages of regular edge, uniform texture and easy picking.

(2) Fermentation power: the fermentation speed is high, the main fermentation time is 5 days, and the real fermentation degree is high (86.77%).

(3) The passage capacity is strong: the fermentation performance of beer fermentation for 10 generations is stable, and the death rate of yeast is not more than 5%.

(4) The fermented beer has good flavor stability: the beer contains isoamyl alcohol, n-propanol, ethyl acetate, isoamyl acetate, ethyl caproate and other flavor components, and can maintain the original flavor of the beer well after 30 days of treatment at 30 ℃.

(5) The ageing resistance is good: the beer obtained by fermentation has low contents of diacetyl, acetaldehyde and trans-2-nonanal, which are respectively lower than 0.1mg/L, 10mg/L and 0.11 mug/L.

The Saccharomyces cerevisiae provided by the present invention can produce a large amount of living cells of Saccharomyces cerevisiae by liquid culture, and the method of the culture is not particularly limited as long as the method can proliferate the Saccharomyces cerevisiae, for example, 10 ⁶ -10 ⁸ The living bacteria of the saccharomyces cerevisiae are inoculated into a saccharomyces cerevisiae culture medium in the inoculation amount of CFU/mL, and the culture solution is obtained after the living bacteria are cultured for 12 to 48 hours at the temperature of 20 to 25 ℃ under the aerobic condition. The Saccharomyces cerevisiae medium may be any of a variety of suitable media known in the art for culturing Saccharomyces cerevisiae, for example molasses and/or 5 Bessel juice and/or YPD medium.

Wherein the YPD medium formulation preferably comprises: 5-15g/L of yeast extract, 15-25g/L of peptone and 15-25g/L of glucose. The YPD medium can be sterilized at 118-123 deg.C for 15-25min. When the medium is a solid medium, it preferably further comprises agar 15-20g/L.

The method of the present invention is not particularly limited as long as the method is capable of enriching the cells from the culture solution, and the method may be, for example, a method of centrifugation and/or filtration, and the conditions of the centrifugation and the filtration may be known conditions, and the present invention is not described in detail herein.

The form of the starter according to the present invention may be not particularly limited, for example, the starter may be a liquid starter, a semi-liquid starter, a concentrated starter, a compressed starter, or a solid starter.

The preparation method may be a preparation method conventional in the art.

According to the present invention, the fermentation medium may be any of various media conventionally used in the art for culturing Saccharomyces cerevisiae, for example, YPD medium as described above, or various media suitable for culturing Saccharomyces cerevisiae such as wort medium and molasses medium.

The preparation method of the molasses culture medium comprises the following steps: the molasses is diluted to 6-10 DEG Be, and 1-3g/L yeast powder and 0.2-0.8g/L ammonium sulfate are added. Then, the mixture can be prepared by autoclaving at 115 ℃ for 15min.

In one embodiment of the invention, the starter may be prepared as follows:

(1) Fermenting Saccharomyces cerevisiae CGMCC No.21162 in a fermentation medium to obtain viable count of 10 ⁸ cfu/mL is higher than that of the liquid fermentation agent;

(2) Mixing the fermentation liquor obtained in the step (1) with a fermentation substrate to obtain a semi-liquid starter;

(3) Concentrating the fermentation broth obtained in the step (1) to obtain a concentrated or compressed yeast starter;

(4) Concentrating the fermentation broth obtained in the step (1), then flushing with a buffer solution, adding a protective agent, and adjusting the concentration of viable bacteria to 10 ¹⁰ And (3) mixing the above cfu/mL uniformly, and drying to obtain the solid fermentation agent.

(5) And adding the starter into lactobacillus, and uniformly mixing to obtain the mixed starter.

According to the present invention, in the mode (2), the fermentation substrate may be different depending on the intended use of the fermentation cylinder, and may be selected as desired by those skilled in the art.

Wherein the amount of the substrate is not particularly limited as long as the liquid leaven obtained in step (1) can be converted into a semi-liquid leaven.

According to the present invention, in the modes (3) and (4), the concentration method may be a technical means conventional in the art as long as concentration of the fermentation broth can be achieved, for example, centrifugation, filtration, etc., as long as activity of Saccharomyces cerevisiae is not significantly affected.

According to the present invention, the centrifugation of the fermentation broth may be performed according to a method conventional in the art, for example, the cell pellet may be obtained by centrifugation in a refrigerated centrifuge at 5000-12000rpm for 5-20min.

According to the present invention, in the mode (4), the buffer may be a buffer which is conventional in the art, for example, may be PBS buffer or physiological saline.

According to the present invention, in the mode (4), the drying mode includes, but is not limited to, lyophilization, drying, air drying, vacuum drying, spray drying, and the like.

According to the present invention, the protective agent may be various protective agents conventional in the art, and for example, may be at least one of skim milk powder, maltodextrin, trehalose, dextran, glycerin, and the like. The amount of the protective agent can be selected and adjusted as desired by those skilled in the art.

According to the present invention, the lactic acid bacteria may be introduced in any form in any step, for example, in the mode (2), the lactic acid bacteria may be mixed with the fermentation broth of Saccharomyces cerevisiae in the form of a lactic acid bacteria fermentation broth, and then a substrate is introduced, thereby obtaining a semi-liquid fermentation agent containing Saccharomyces cerevisiae and lactic acid bacteria; or in the step (4), the lactobacillus is mixed with the concentrated fermentation liquor of the saccharomyces cerevisiae in the form of the concentrated fermentation liquor, and then a protective agent is introduced; alternatively, the lactobacillus agent in solid form is directly added into the solid fermentation agent.

Wherein the lactic acid bacteria may be conventionally used probiotics beneficial to human body, for example, the lactic acid bacteria may be selected from the group consisting of lactobacillus, lactococcus and pediococcus. Preferably, the lactobacillus is lactobacillus plantarum and/or pediococcus pentosaceus.

According to the present invention, the addition amount of the lactic acid bacteria may be selected within a wide range, and preferably, the addition amount of the lactic acid bacteria is such that the ratio of the number of viable bacteria of Saccharomyces cerevisiae and lactic acid bacteria in the obtained starter may be 1: (10 ^-11 -10 ¹¹ ) More preferably 1: (10 ^-4 -10 ⁴ )。

The method for fermenting and culturing Saccharomyces cerevisiae CGMCC No.21162 according to the present invention has been described in detail above, and will not be repeated here for the sake of avoiding unnecessary repetition.

Preferably, the fermented food is alcoholic fermented food or fermented pasta.

Preferably, the alcoholic fermented food is beer.

Preferably, the fermented pasta is a fermented bread.

The fermentation of beer can be to inoculate Saccharomyces cerevisiae CGMCC No.21162 into raw materials (such as wort) to be treated according to the conventional use in the conventional production process of fermenting cereal fermented wine such as beer, and ferment or survive under the temperature and pressure capable of propagating Saccharomyces cerevisiae CGMCC No.21162. The CGMCC No.21162 is added into the fermentation substrate, so that the metabolite of the CGMCC No.21162 ensures that the fermented wine has excellent characteristics of certain appearance, fragrance and the like, and improves the organoleptic quality characteristics of the product.

According to the present invention, the conditions for the fermentation may be conventional conditions for beer fermentation culture known in the art, for example, the temperature of the fermentation culture may be 10 to 30 ℃.

The wort may be wort conventionally used in the art, which may be prepared from at least one of barley malt, wheat malt and black malt as a main raw material. It will be appreciated that other adjuvants may also be present in the wort, and that one skilled in the art may choose depending on the desired flavour.

The specific preparation of beer can be carried out according to methods conventional in the art and will not be described in detail herein.

Examples

The medium formulations referred to in the examples below were as follows:

YPD medium (wt%): yeast powder (1%), peptone (2%), glucose (2%), and heating for dissolving, and autoclaving at 121deg.C for 15-20min.

Wort medium: barley malt was crushed according to 1:4, water is added in proportion, the temperature is kept at 45 ℃ for 30min, the temperature is kept at 64 ℃ for 40min, the temperature is kept at 70 ℃ for 20min, and the temperature is kept at 115 ℃ for 15min in an autoclave.

The reagents and materials used were all commercially available without specific description.

Unless otherwise indicated, the operations are all conventional in the art.

The commercial yeast used as a control strain was the England Ehrlichia pastoris CY115 from Angel yeast.

Example 1

The embodiment is used for explaining the separation, purification and characteristic identification of the saccharomyces cerevisiae CGMCC No.21162.

The Saccharomyces cerevisiae CGMCC No.21162 is separated from old yeast reserved in Gansu farmers.

Taking old ferment, and gradient diluting to 10 with sterile physiological saline ^-6 Each dilution gradient YPD plate was incubated at 28.+ -. 1 ℃ for 72h. The inoculating needle picks out the colonies with different colony forms to the YPD plate for streaking until single colony with uniform size and uniform form appears.

Selecting bacterial strains with round and oval cell morphology and budding reproduction. The strain which is separated into the tentative saccharomycetes is activated for 3 generations in YPD liquid culture medium, physiological and biochemical identification and molecular biological identification are carried out, and a plurality of aspects such as the growth, fermentation performance, appearance quality characteristics, texture characteristics, fermentation flavor substances, sensory quality and the like of the saccharomycetes are researched, and a strain of saccharomyces cerevisiae with the number of PAT-Y165 is finally screened from a plurality of wild saccharomycetes through multiple rounds of research and demonstration.

(1) Morphological identification

The selected Saccharomyces cerevisiae was incubated at 28.+ -. 1 ℃ for 48 hours, and the colonies were round, smooth, moist, opaque on YPD medium as shown in FIG. 1. As shown in FIG. 2, the cell morphology under the microscope of Saccharomyces cerevisiae was oval.

(2) Physiological and biochemical identification

The screening strain PAT-Y165 was subjected to physiological and biochemical identification by using French Mei Liai API identification system, and the identification results are shown in Table 1 below. The strain is Saccharomyces cerevisiae (Saccharomyces cerevisiae) after physiological and biochemical identification.

TABLE 1

Note [ ]. In the table, "+" indicates positive biochemical reaction results, and "-" indicates negative biochemical reaction results.

(3) Molecular characterization

Cloning and sequencing the ITS1/ITS4 of the isolated strain, wherein the nucleotide sequence of the ITS1/ITS4 gene is as follows, and comparing the ITS1/ITS4 sequence of the strain with the sequence of Saccharomyces cerevisiae, the similarity of the ITS1/ITS4 sequence (SEQ ID NO: 1) of the strain with the sequence of Saccharomyces cerevisiae reaches 99.99%.

SEQ ID NO：1

ATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTG

Combining the morphological and biochemical identification results, determining the isolated strain as Saccharomyces cerevisiae (Saccharomyces cerevisiae), and preserving in China general microbiological culture Collection center, preserving address: the collection number of the microbiological institute of China is CGMCC No.21662, and the collection date is 11 months and 11 days in 2020.

Example 2

This example is used to illustrate the study of the use of Saccharomyces cerevisiae in beer fermentation.

Beer brewing was performed using the Saccharomyces cerevisiae and the control strain of the present invention, respectively, and evaluated.

(1) The beer brewing method comprises the following steps: activating yeast with wort culture medium, inoculating yeast liquid with 10% inoculum size into 12°p wort culture medium, fermenting at 20deg.C, and storing at 4deg.C until diacetyl content meets national standard requirement. Determination of CO Using a weighing method ₂ Loss of weight as CO ₂ The loss of weight within 0.1 g/day indicates the end of fermentation.

When the Saccharomyces cerevisiae of the present invention is used for brewing beer, the fermentation end point is reached on the 5 th day of fermentation, and the control strain reaches the fermentation end point on the 6 th day.

(2) Determination of the true beer fermentation:

100g of beer sample is weighed, all beer sample is moved into a 500mL distillation flask with known mass, 50mL of water and several glass beads are added, a snake-shaped condenser tube is arranged, cooling water is started, a 100mL volumetric flask with known mass is used for receiving distillate (externally added ice bath), distillation is slowly heated (the water temperature at the outlet of the condenser tube is not more than 20 ℃), about 96mL distillate is collected (distillation is completed within 30-60 min), the volumetric flask is taken down, the liquid temperature is adjusted to 20 ℃, and water is accurately added to 100g, and the mixture is uniformly mixed. The relative density of the distillate was determined using a density bottle. The alcohol content (A) and true concentration (Z) of the sample were obtained from "a table of comparison of the relative density of aqueous alcohol solution and alcohol content (ethanol content) (20 ℃)," a table of correction of the relative density of sugar solution and the percent Plato or extract content (20 ℃) and the empirical formula of raw wort concentration ", and are expressed as Plato or mass fraction (°P or%).

Based on the measured alcohol content and the true concentration, the true degree of fermentation (RDF) of the sample was calculated as follows:

RDF＝100×(2.0665×A)/(2.0665×A+Z)

wherein:

RDF-true degree of fermentation of sample,%;

a is the mass fraction of the alcoholic strength of the sample,%;

the true concentration of the Z-sample is in terms of Plarad or mass%.

The true degree of fermentation of the beer brewed by the Saccharomyces cerevisiae of the present invention was 86.77% and that of the control strain was 67.70% as calculated.

Example 3

This example is intended to illustrate the fermentation passaging capacity of Saccharomyces cerevisiae beer.

The Saccharomyces cerevisiae and the control strain of the present invention were inoculated into a triangle bottle containing 2L of 12℃P wort at an inoculum size of 10% respectively for beer fermentation test, and after fermentation at a constant temperature of 20℃for 5 days, yeast slurry was collected and recorded as generation 0. Transferring the generation 0 yeast to a new wort culture medium to perform a second round of beer fermentation, and collecting yeast mud after the fermentation is finished, and recording as generation 1. And the like, continuously fermenting for 10 times, and detecting the death rate and the real fermentation degree of the yeast cells after each fermentation.

Yeast mortality assay: uniformly mixing 0.1% of methine blue staining solution and an equal amount of saccharomycete solution, adding a drop of mixed solution in the center of a glass slide, and covering the glass slide; the pellet was left for about 3min and then subjected to microscopic examination.

Yeast mortality = (blue yeast cells/total yeast cells) ×100%

The method for detecting the true fermentation degree of beer is as described in example 2.

After the Saccharomyces cerevisiae of the invention is fermented for 10 times continuously, the death rate of the yeast is not more than 5%, the real fermentation degree of the beer is kept 86.77 +/-0.5%, and the fermentation performance is stable. The death rate of the control strain is more than 6.5%, and the real fermentation degree of the beer is reduced by 10%.

Example 4

This example is intended to illustrate the flavor stability of a Saccharomyces cerevisiae fermented beer.

After the beer product brewed in example 2 was stored at 30℃for 30 days, 5mL to 20mL of the beer solution was sucked into a screw headspace sample bottle, 150. Mu.L of an internal standard solution of trichloropropane (10 mg/L) was accurately added, and the mixture was shaken well to determine the flavor substance therein.

Flavour in beer was determined by gas chromatography, 50/30 μm DVB/CAR/PDMS solid phase microextraction head and extraction handle were purchased from Supelco company, usa; 6890N-5973I gas chromatograph is available from Agilent company, U.S.A.

The solid phase microextraction head was inserted into the sample inlet of the gas chromatograph, aged at 270 ℃ for 1h, and subjected to a blank experiment until no chromatographic peak appeared. Filling a sample into a sample bottle, wherein the liquid filling amount is 1/3-1/2 of the whole volume of the sample bottle, adding 2g of sodium chloride, inserting a solid-phase microextraction head into the sample bottle, extracting at 45 ℃ for 45min, desorbing at 270 ℃ for 5min in a sample inlet of a gas chromatograph-mass spectrometer, and carrying out sample injection analysis.

Gas Chromatography (GC) conditions: HP-INNOWAX MS column (30 m×250 μm×0.25 μm); the carrier gas is helium (He) with the flow rate of 1mL/min; the column temperature is 50 ℃ at the beginning, the temperature is kept for 5min, the temperature is increased to 160 ℃ at 6 ℃/min, the temperature is kept for 3min, and the temperature is increased to 230 ℃ at 20 ℃/min; and the sample injection is not split. Mass Spectrometry (MS) conditions: the ionization mode is electron ionization (electron ionization, EI) source, electron energy is 70eV, emission current is 200 mu A, ion source temperature is 230 ℃, four-level rod is 150 ℃, full scanning mode is adopted, scanning quality range is 50-550 amu, and solvent delay is avoided.

Accurately transferring 1mL of 1,2, 3-trichloropropane standard solution with the concentration of 1000mg/L, diluting with methanol to a volume of 100mL of a volumetric flask, and obtaining 10mg/L of trichloropropane internal standard solution; the type of flavor chemical in the sample is characterized by means of NIST spectrogram library retrieval. And the relative concentration was calculated from the ratio of the compound peak area to the internal standard peak area.

X-the relative content of flavor compounds in the sample in mg/L;

vi-the volume of the internal standard added to the sample in mL;

vs-volume of sample solution added to headspace bottle, unit mL;

ci-concentration of internal standard solution in mg/L;

ii-internal standard peak area intensity;

is-flavor compound peak area intensity.

According to the determination, the Saccharomyces cerevisiae brewed beer contains isoamyl alcohol, n-propanol, ethyl acetate, isoamyl acetate, ethyl caproate and other flavor substance components, and the contents of diacetyl, acetaldehyde and trans-2-nonanal are low and are respectively 0.08mg/L, 8.96mg/L and 0.10 mug/L. After the beer obtained by fermentation is treated for 30 days at 30 ℃, the original wine flavor can be well reserved by sensory evaluation of the flavor. After 30 days of treatment at 30 ℃ for beer brewing by the control strain, the diacetyl and the acetaldehyde are respectively lower than 0.1mg/L and 10mg/L, but the trans-2-nonanal content is 0.21 mug/L.

Example 5

This example is used to illustrate the study of the use of Saccharomyces cerevisiae in fermented bread.

Fermented bread was prepared using the Saccharomyces cerevisiae and the control strain of the present invention, respectively, according to the following procedure.

The steps are as follows: weighing ingredients, stirring dough to form a film, standing, cutting into blocks, rounding, standing, exhausting and shaping, proofing and baking.

The tissue state of the bread was observed and the toast texture was measured. After cooling the baked bread for 1 hour, it was cut into toast slices 15mm thick.

The full texture analysis method comprises the following steps:

toast breadcores were taken, cut into 1.5cm thick slices, and subjected to full texture analysis using a ta.xt.plus texture analyzer. The P36R probe was selected and used in TPA test mode at a test speed of 1.0mm/s compressed to 50% of the original height with a relaxation time of 5s between 1 st and 2 nd compressions, each sample measured 5 times and averaged. The experimental results are shown in table 1.

TABLE 1

Strain	Hardness of	Cohesive property	Tackiness of the adhesive	Masticatory properties
					No.21162	330.282	0.692	200.361	260.006
Control strain	400.415	0.737	295.460	286.522

The Saccharomyces cerevisiae of the present invention is useful for baking bread, and the resulting bread is softer than the bread obtained from the control strain.

The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, a number of simple variants of the technical solution of the invention are possible, including combinations of the individual technical features in any other suitable way, which simple variants and combinations should likewise be regarded as being disclosed by the invention, all falling within the scope of protection of the invention.

SEQUENCE LISTING

<110> middle food nutrient health institute Co., ltd

COFCO Malt (Dalian) Co., Ltd.

<120> Saccharomyces cerevisiae, starter, process for producing the same, use thereof in producing fermented food, and beer production

Preparation method

<130> I69989COF

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 763

<212> DNA

<213> Saccharomyces cerevisiae

<400> 1

atggattttt ttgttttggc aagagcatga gagcttttac tgggcaagaa gacaagagat 60

ggagagtcca gccgggcctg cgcttaagtg cgcggtcttg ctaggcttgt aagtttcttt 120

cttgctattc caaacggtga gagatttctg tgcttttgtt ataggacaat taaaaccgtt 180

tcaatacaac acactgtgga gttttcatat ctttgcaact ttttctttgg gcattcgagc 240

aatcggggcc cagaggtaac aaacacaaac aattttattt attcattaaa tttttgtcaa 300

aaacaagaat tttcgtaact ggaaatttta aaatattaaa aactttcaac aacggatctc 360

ttggttctcg catcgatgaa gaacgcagcg aaatgcgata cgtaatgtga attgcagaat 420

tccgtgaatc atcgaatctt tgaacgcaca ttgcgcccct tggtattcca gggggcatgc 480

ctgtttgagc gtcatttcct tctcaaacat tctgtttggt agtgagtgat actctttgga 540

gttaacttga aattgctggc cttttcattg gatgtttttt ttttccaaag agaggtttct 600

ctgcgtgctt gaggtataat gcaagtacgg tcgttttagg ttttaccaac tgcggctaat 660

cttttttata ctgagcgtat tggaacgtta tcgataagaa gagagcgtct aggcgaacaa 720

tgttcttaaa gtttgacctc aaatcaggta ggagtacccg ctg 763

Claims

1. The Saccharomyces cerevisiae Saccharomyces cerevisiae is characterized by having a preservation number of CGMCC No.21162.

2. A starter culture, characterized in that it comprises the saccharomyces cerevisiae (Saccharomyces cerevisiae) according to claim 1.

3. The starter of claim 2, wherein the starter is a liquid starter, a semi-liquid starter, a concentrated starter, or a solid starter.

4. A process for producing a starter, which comprises culturing the Saccharomyces cerevisiae of claim 1 in a fermentation medium.

5. A starter culture prepared by the method according to claim 4.

6. Use of the saccharomyces cerevisiae of claim 1 or the starter of any of claims 2-3 and 5 for the preparation of fermented food.

7. The use according to claim 6, wherein the fermented food is alcoholic fermented food or fermented pasta.

8. The use according to claim 7, wherein the alcoholic fermented food product is beer; and/or

The fermented flour food is fermented bread.

9. A method of preparing beer, the method comprising: contacting and fermenting Saccharomyces cerevisiae according to claim 1 and/or any one of claims 2-3 and 5 with wort to obtain beer.

10. The method of claim 9, wherein the fermentation temperature is 10-30 ℃.