TW201217536A - Method for preparing alpha-ketopimelic acid by C1-elongation - Google Patents

Abstract

The invention relates to a method for preparing alpha-ketopimelic acid, comprising converting alpha-ketoglutaric acid into alpha-ketoadipic acid and converting alpha-ketoadipic acid into alpha-ketopimelic acid, wherein at least one of these conversions is carried out using a heterologous biocatalyst catalysing at least one of these conversions, wherein the heterologous biocatalyst comprises a. an NifV enzyme or another Aks enzyme having homo(n)citrate activity or a homologue thereof having homo(n)citrate activity; b. an AksD enzyme having homon-aconitase activity or a homologue thereof having homon-aconitase activity, c. an AksE enzyme having homon-aconitase activity or a homologue thereof having homon-aconitase activity, d. an AksF enzyme having homon- isocitrate dehydrogenase or a homologue thereof having homon-aconitase activity.

Description

201217536 VI. Description of the invention: [Ming Hujin is a good cold sheet 3 The invention relates to the preparation of Ot-ketopimelic acid (hereinafter also referred to as 'ΑΚΡ'; ΑΚΡ is also known as 2-side oxygen- The method of pimelic acid). The present invention is further directed to a process for the preparation of 5-valeric acid (hereinafter also referred to as '5-FVA,) and a process for preparing 6-aminocaproic acid (hereinafter also referred to as '6_aCA,). The invention also relates to a process for the preparation of hexamethylenediamine (also known as i,6 hexanediamine). The invention further relates to a heterologous cell which can be used in the method according to the invention. The present invention further relates to a heterologous cell for the preparation of a crosslinking agent for ε-caprolactam (hereinafter referred to as "caprolactam"), 6-aminocaproic acid, adipic acid or η amide resin. It is known that the preparation of ruthenium through hexane = and as an epoxy acid (adipic acid) is especially useful for other purposes. In addition, the fermented acid can be used for plasticizers, lubricants, and 2-mercaptoamines. This polytetracarboxylic acid (tetra) is a lipid. Other uses of fatty acids are used in a variety of applications for adhesives, insecticides, tanning and dyeing: . A precipitating agent, which should contain a method for the preparation of cyclohexanol or a ring Q with nitric acid, containing an internal amine-type, an internal oil, a 3" oil). Nylon-6 or nylon_612 (a type which can be used for the production of polyfluorene) Amine 'planted indoleamine and ten-^'). Various from the bulk chemical 'amine copolymerization of caprolactam' method of heart Μ 3 201217536, and including from cyclohexanone, toluene, phenol, ring Preparation of caprolactam from hexanol, benzene or cyclohexane. These intermediate compounds are generally obtained from mineral oils. It is better to provide the need to use more sustainable technology to prepare materials. A method in which caprolactam is produced from an intermediate compound obtainable from a biological regeneration source, or at least an intermediate compound which is converted into caprolactam by using a biochemical method. Further, it is preferred to provide a compound The method, which utilizes less energy than conventional chemical methods, in the use of bulk chemicals from petrochemical sources. It is known to prepare caprolactam from 6-ACA as described in US-A 6,194,572. The disclosure of WO 2005/068643, 6-ACA can be via A biochemical method is prepared by converting 6-aminohex-2-carboxylic acid (6-anthracene) in the presence of an enzyme having α,β-diol reductase activity. 6-ΑΗΕΑ can be obtained by, for example, biochemical methods or via Pure chemical synthesis, prepared from lysine. Although it is possible to prepare a 6-ACA system by reducing 6-oxime as disclosed in WO 2005/068643, the inventors have found that - under reducing reaction conditions - 6 - ΑΗΕΑ may spontaneously and substantially irreversibly cyclize to form undesirable by-products, particularly beta-homoamine. This cyclization may be a bottleneck in the production of 6-ACA and may result in considerable Loss of yield. A novel method is disclosed in WO 2009Π13855, in which 6-ACA is prepared from different compounds, namely hydrazine, via a biocatalytic process. WO 2009/113855 mentions several methods for obtaining hydrazine: chemical methods A method obtained from a natural source or a biocatalytic method. The biocatalytic pathway recommended in WO 2009/113855 generally uses the Aks enzyme system to prepare AKP in a catalytic manner of 201217536, wherein the AKP is in the α-ketopentane acid( AKG) is obtained by extending C1. However, it is preferable to provide a method for preparing Ακρ by biocatalysis, which has an increase in the yield of AKP, or further converts the product obtained by the biocatalytic method to obtain 6-ACA. An increase in the yield of other products (e.g., hexamethylenediamine). One object of the present invention is to provide a process for the preparation of AKP which can be used in particular for the preparation of 6-ACA, hexamethylenediamine or other compounds of interest, In particular, this process has improved yields over a relatively long reaction time.A further object is to provide a novel biocatalyst suitable for catalyzing one or more reaction steps in a process for the preparation of AKP. One or more other objects that may be solved in accordance with the present invention will follow the description below. SUMMARY OF THE INVENTION The present inventors have recognized that it is possible to prepare an AKP system using a specific biocatalyst comprising several enzyme activities, wherein at least one of the enzyme activities is selected from a specific group of enzyme activities. Accordingly, the present invention relates to a process for the preparation of α-ketopimelic acid, which comprises converting CC-ketoglutaric acid to 1 ketoadipate and converting fluorenone adipic acid to (X-ketopimelate) Wherein at least one of such conversions is carried out using a heterologous biocatalyst that catalyzes at least one of such conversions, wherein the heterologous biocatalyst comprises - AksD enzyme having high η-aconitase activity or同源-Aconitase activity homologue, 201217536 - AksE enzyme with 咼n-aconitase activity or homologue with high _alkyrosinase activity, • High η-isocitrate dehydrogenation Enzyme activity 2AksF enzyme or a homolog thereof having high a-aconitase activity, at least one selected from the AksD enzyme, the ^AksE enzyme, and the octa (4) enzyme and homologs thereof The enzyme is an Aks enzyme or a functional analog thereof derived from Helminthosporium variabilis (Tear (6) (10)). In a preferred method of the present invention, the biocatalyst further comprises NifV enzyme having high (8)-citric acid activity. Or another Aks enzyme or its high (ηΓ citrate live The hydrazine, for example, can be used as an intermediate for the preparation of 5-methylpentanoic acid (5fva). Accordingly, the present invention further relates to a process for the preparation of 5 FVA2 comprising biocatalytic removal The carboxyl group of the AKP prepared according to the method of the present invention is thereby formed to form 5-FVA. The 5-FVA, for example, is suitable for the preparation of & aca, caprolactam, adipic acid or An intermediate compound of a diamine. The AKP 'is, for example, used as an intermediate for the preparation of aminopimelic acid (AAp). Accordingly, the present invention relates to a method for preparing AAp, which comprises The biocatalytic mode is subjected to transamination of Ακρ prepared in the process according to the invention 'by this to form ααρ. This ΑΑΡ 'is, for example, a suitable intermediate compound for the preparation of 6-ACA or caprolactam. 201217536 6-ACA 'for example, can be converted to caprolactam or hexamethylene diamine. The invention further provides a heterologous cell comprising a heterologous nucleic acid sequence of one or more weights of one or more heterologous enzymes, the difference Source enzymes can catalyze the production of (X-ketoglutaric acid) At least one reaction step of α-keto pimelic acid. The cell is particularly useful as a biocatalyst in a process for preparing at least one compound selected from the following wrinkles: AKP, 5 FVA, 6-ACA, Hexamethylenediamine and caprolactam. According to the present invention, when 6-ACA and optionally caprolactam are formed, it is not perceived that the intermediate product is cyclized, resulting in a loss of yield. As an example, when using acne-producing bacteria (from sputum & like) or the genus Aks enzyme _, the product of AKP or the AKP can be achieved in a specific reaction time. The yield of such as 6 iron or broad (〇6-aminopimelic acid) increases. C Unless otherwise indicated, the term “or” as used herein is defined as “and/or”. The term "a" as used herein is "at least one of". Unless otherwise specified, the definition refers to the singular noun (such as the number form. 'compound, additive, etc.), which means including the complex-turtle (four) its lack, paper call, such as 6-ACA, AAP, and other medium I. raw HfAKP , these terms are meant to include protonated acid groups (ie, their counterparts, etc., which are equivalent to the total number of salts and their 201217536 salts. When referring to amino acids, such as 6_ACA, The term is meant to include an amino acid of the formula (wherein the silk group is protonated and the tickrate group is in a deprotonated form); wherein the amine group is protonated and enemies An amino acid in the form of a k-group; and an amino acid whose ortho-amino group is in a deprotonated form in a neutral form; and a salt thereof; When a stereoisomer is present in the compound, the compound may be any one or a combination of the stereoisomers. Therefore, when the fluorenyl is present, the amino acid may be L-mirromeric If the natural stereoisomer is present, the compound is preferably a day Stereoisomers ^ When referring to the type of enzyme between parentheses (when Ε〇, the enzyme species are enzymes according to the enzyme provided by the Nomenclature Committee 〇f the International Union of Biochemistry and Molecular Biology (NC-IUBMB) The naming method is the type of classification (this naming method can be found at http://www.chem.qmul.ac.uk/iubmb/enzyme/). Others are not classified into specific categories, but can be classified accordingly. Suitable enzymes. The term "homolog" as used herein, particularly with respect to a polynucleotide or polypeptide, has a sequence identity of at least 30%, preferably at least 4%, more preferably at least 60% 'better. At least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%. The homologue generally has the same number of polynucleotides as 201217536 and (the respective polypeptide is a homolog thereof) The desired function 'like coding can catalyze the same reaction separately (typical Converting the same matrix to the same compound) or the same peptide of similar reaction. 'Similar reactions' are typically the same type of reaction, such as decarboxylation, amine conversion, ci-prolongation. According to the rule of thumb, homologous enzymes can be classified into three numbers of EC species preceding the common EC species (xyz), such as EC 4.1.1, which is a carboxylase. Typically, in a similar reaction, The substrate of the same type of substrate (e.g., amine, carboxylic acid, amino acid) is converted to the same type of product as the product of the reaction (similar to the similar reaction). Similar reactions specifically include reactions defined by the same chemical transformations defined by the same KEGG RDM pattern, where R_atoms and D-atoms indicate chemical transformations (KEGG RDM patterns: Oh, M. et al. (2007) Systematic analysis Of enzyme-catalyzed reaction patterns and prediction of microbial biodegradation pathways. J.

Chem· Inf. Model·, 47, 1702-1712). The term "homolog" is also meant to include a nucleic acid sequence (polynucleotide sequence) that differs from another nucleic acid sequence by the degeneracy of the gene code or that encodes the same polypeptide sequence. The term "functional analog" is used herein to refer to the enzyme, which is capable of catalyzing the same reaction' and can replace the enzyme in any C1-prolongation reaction from AKG to AKP, but does not seriously affect the conversion of AKG to AKP. rate. Typically, the functional analog is a homolog, in particular a homolog having a relatively high sequence identity to the enzyme (the homolog is a functional analogue thereof) preferably having at least sequence identity. 60%, more preferably at least 201217536

65% more preferably at least 7〇%, particularly at least 75%, more preferably at least 8%, at least °°, more particularly at least 娜, at least (four), at least 92%, %, at least At least 95%, at least 96%, at least 98% or at least 99%. ^97%, as used herein, the term "functional analog," - "sequence" which is the same as the sequence specified by the analogy of the nucleic acid sequence, but which encodes the same amino acid code, wins A homologue of a peptide, in particular, a host cell which is preferably of interest, has a similarity with (referred to as its functional class = similar, phase material _ expression material (four) column acid sequence, 孰 此 this sticky ^人丄成(The person with this skill should understand that if you need to express the victory, enzyme), the better expression level usually refers to the higher expression level, in a specific specific case, better expression The level may be a lower expression level, as this may require a functional analog to be a naturally occurring sequence in the metabolic pathway of the host cell, ie, a wild-type function similar to a T or a modified sequence, ie, a non-wild type A functional analog. A codon-optimized sequence encoding a specific peptide, usually a wild-type sequence designed to achieve the desired level of expression (10). In particular, preferred functional analogs are Interested in having a host (called its function) A nucleotide sequence of a similar, identical or higher expression level of a nucleotide sequence of the analog. The sequence-likeness or similarity is defined herein as between two or more polymorphic sequences or between two or more nucleic acid sequences. , after sequence alignment, usually, sequence- or similarity compares the entire sequence, but can also only compare the sequence of the portion of the alignment of 201217536. In this technique, depending on the situation, ' ' "Consistency" or "similarity" also means the degree of sequence correlation between a polypeptide sequence or a nucleic acid sequence as determined by alignment between sequences. The preferred method for determining identity or similarity is designed to provide maximum between test sequences. The preferred computer program for determining the homogeneity and similarity between two sequences in the context of the present invention includes BLASTP and BLASTN (Altschul, SF et al., J. Mol. Biol. 1990, 215). , 403-410, publicly available from NCBI and other sources BLAST Manual, Altschul, S„ et al., NCBI NLM NIH Bethesda, MD 20894). When using BLASTP, the preferred inter-parameters for polypeptide sequence alignment Open 1〇〇, interval extension 0.5, Blosum 62 matrix. When using BLASTN, the preferred parameters for nucleic acid sequence alignment are 1间隔.〇, interval extension〇5, DNA full matrix (DNA unit matrix) According to the invention, a biocatalyst is used, i.e., at least one of the reaction steps in the process is catalyzed by a biomaterial or a biological source, such as an organism or a biomolecule derived therefrom. A special biocatalyst containing a variety of enzymes or a variety of enzymes. In a specific example, use _ or a plurality of enzymes isolated from the natural environment (separated from organisms in which enzymes have been produced), for example, solutions, emulsions, dispersions, colds; The suspension) 'dissolves the product or is fixed to the support. In a specific embodiment, one or more enzymes form part of a living organism (such as a living whole cell). Enzymes can perform catalytic functions in cells. It is also possible that the enzyme can be secreted into the medium in which the cells are present. 11 201217536 Living cells can be growing cells, resting or dormant cells (eg, stalks) or cells in quiescent phase. It is also possible to use an enzyme that is part of a disproportionated cell (ie, a substrate that allows the enzyme's pure or enzyme substrate to be permeable). The biocatalyst used in the process of the present invention can in principle be any organism' or derived from any of the manufactured ribs. The organism can be a eukaryote or a prokaryote. In particular, organisms may be selected from animals (including humans), plants, bacteria, archaea, yeasts, and fungi. In a specific embodiment, the biocatalyst is derived from an animal, particularly a portion thereof such as liver, pancreas, brain, kidney, heart or other organs. Animals: Specially selected from the group of mammals, more particularly from the following groups: rabbit, murine, porcine, and bovine. Suitable plants include, inter alia, plants selected from the group consisting of Asplenium; Cucurbitaceae, especially Curcurbita, which is a Chinese pumpkin (Curcurbita m〇schata) (pumpkin). Or Cucumis; Mercurialis, such as the perennial mountain age (Mercurialis perennis), Hydnocarpus (Hydnocarpus); and the genus Ceratonia. Suitable bacteria can be selected in particular from the group consisting of Vibrio, Pseudomonas, Bacillus, Corynebacterium, Brevibacterium, Enterococcus, Streptococcus, Klebsiella, Lactococcus, Lactobacillus, Clostridium, Eich Escherichia, Thermus, Mycobacterium 12 201217536 (Mycobacterium), Zymomonas, Proteus, Agrobacterium, Ground spores Geobacillus, Acinetobacter, Ralstonia, Rhodobacter, Paracoccus, Novosphingobium, and sub-scientific cells Nitrosomonas, Legionella, Neisseria, Rhodopseudomonas, Staphylococcus, Thermostat (Thermot) Oga), Deinococcus and Salmonella. Suitable archaea can be specifically selected from the group of methanogens. More specifically, suitable archaea can be selected from the following groups: Archaeoglobus, Aeropyrum, Halobacterium, Methanosarcina, and A. Methanococcus, Thermoplasma, Pyrobaculum, Methanocaldococcus, Methanobacterium, Methanosphaera, decane fire Methanopyrus and Methanobrevibacter. Suitable fungi can be selected in particular from the following groups: Rhizopus, Neurospora, Penicillium, and Aspergillus. Suitable yeasts are particularly selected from the group consisting of Candida, Hansenula, Kluyveromyces, and Saccharomyces. 13 201217536 It is clear to those skilled in the art that in the process according to the invention, naturally occurring biocatalysts (wild-type) or naturally occurring biocatalysts can be used with suitable mutants. Naturally occurring biocatalytic properties can be improved by biotechnology known to those skilled in the art, such as molecular evolution or rational design. A large variant of the wild-type biocatalyst can be modified to function as a biocatalyst or can be produced by, for example, mutational techniques known to those skilled in the art, such as mutations, point mutations, directed evolution, genetic recombination, and the like. It is produced by encoding DNA of an organism of a biocatalyst element such as an enzyme. In particular, the DNA may be modified such that it encodes an enzyme different from at least the amino acid enzyme of the wild (tetracycline), such that it has a wild residue ratio, the encoding of which contains _ or a plurality of amino acid substitutions, deletions and/or insertions. An enzyme, or the sequence that binds the mutant to two or more parent enzymes or by affecting the expression of such modified dna in a suitable (host) cell. The latter can be achieved by methods known to those skilled in the art, such as codon optimization or codon pair optimization, as based on the method described in WO 2008/000632. Mutant biocatalysts may have improved properties associated with one or more of the following phases: selectivity to matrix, activity, stability, solvent tolerance, pH profile, temperature profile, matrix profile, sensitivity to inhibition Use of sex, cofactors, and matrix affinity. In addition, we can screen for mutants with increased levels of interest for proteins (enzymes), improved resistance to proteases (which catalyze the breakdown of proteins), or any other protein (enzyme) that affects the final Factors, mutants with improved properties can be identified by administering a suitable high throughput | selection bite 201217536 method known to those skilled in the art. When referring to a biocatalyst of a particular source, in particular an enzyme, a recombinant biocatalyst derived from a first organism, but produced in a (genetically modified) second organism, specifically an enzyme, expressly means from the first organism Biocatalysts, especially enzymes. Particularly in the case where AKP is employed as an additional product, such as 5-FVA, AAP, hexamethylenediamine or 6_ACA, the host cell line can naturally convert AKP to this product or at least catalyze at least one necessary reaction. The organism is considered to be advantageous. For example, E. coli has aminotransferase activity, whereby E. coli can catalyze the formation of AAp (see below) or convert 5-FVA (if the cell also contains a suitable decarboxylase, it can form in the cell). The following) becomes 6-ACA. In one embodiment, the host cell line comprises an organism having the following: an amino adipic acid pathway (also known as Aaa) or a moiety thereof (such as lower eukaryotic cells: capable of catalyzing the synthesis of lysine; Fungi, yeast, Euglena; biocatalysts of certain bacteria 'such as Thermus, Abnormal genus; archaea; or biocatalysts that contain nitrogen through nitrogenase. If the organism contains a gene encoding an AKA or AKP-based enzyme, thus seriously affecting the production of AKP, the gene is preferably rejected or the expression of the gene is preferably inhibited. In a preferred embodiment, the host cell line is an organism that has a high AAA pathway flux, such as Penicillium, Ustilag0 Inaydis, or an lysine-producing agent. Organized organism. High-throughput is defined as, under selected production conditions, in each organism, 15 201217536 100% provides the ratio of lysine to the cell for protein synthesis: to less than 50%, more preferably at least 50% Even better, at least, in the preferred embodiment, the host cell line can produce a high level of high citric acid organism, which can be a naturally occurring or heterologous organism. This - the organism can be obtained by expressing the glucosinolate synthase required for the formation of the cofactor in the nitrogenase or its homologue. In a specific example, the host cell comprises a nucleic acid sequence derived from a portion thereof, such as liver, sputum, liver, kidney, heart or other source nucleic acid.哕 k ^ ^ ^ ^ ^ ^ 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别 特别The nucleic acid sequence is suitable for: the main cell of the wound contains a heterologous substance derived from the plant: the fern of the genus Fern, the plant of the genus of the genus, the genus of the genus, especially the genus Cucurbita, ie the Chinese pumpkin or cucumber. Genus; cross ^ % two melons (pumpkins) Brassicaceae, special county (Arabidopsis). ^. 衧 (1) 疋 耳 芥 挺 挺 挺 挺 挺 (A. thaliana); ; genus; genus; MUM. born in /, the system 'the host cell contains a nucleic acid sequence derived. Suitable * heterologous fine halogen can be specifically selected from the following groups: Pseudomonas, rod馘H, m genera, orchid, coryneform bacterium, Brevibacterium, intestinal chain (four), put _W_ycetales), Klebsiella, genus, genus Clostridium, eu , Klebsiella, & limbs M ah, genus, genus, Anabaena, Microcystis, Synech cystis, Rhizopus Genus 201217536 (Rhizobium), Bradyrhiz 〇bium, Thermus, Mycobacterium, Zymomonas, Deformation Genus, Agrobacterium, Bacillus subtilis, Acinetobacter, Az〇t〇bacter, Ralstonia, Rhodobacter, Paracoccus, Neosporum, Nitrosamine Phytophthora, Legionella, Neisseria, Rhodopseus, Staphylococcus, Abnormal genus, and Salmonella. In one embodiment, the host cell contains a different origin from archaea Source nucleic acid sequence. Suitable archaea can be selected from the following groups: genus Guillaz, genus Pyrococcus, genus Halobacterium, octatripus, genus genus, pyrogen, heat Thermococcus, Firerodococcus, Methanospirillum, Pyrococcus, Sulfolobus, Hydococcus, A. sphaeroides, A. A bacterium of the genus Brevibacterium, a genus of the genus Methane, and a genus of the genus Methanococcus. In one embodiment, the host cell comprises a heterologous nucleic acid sequence derived from a fungus. Suitable fungi are particularly selected from the group consisting of: Rhizopus, Phanerochaete, naked Emericella, Ustilago, Lactobacillus, Penicillium, Cephalosporium, Paecilomyces, Trichophytum, and Verticillium. In one embodiment, the host cell comprises a heterologous nucleic acid sequence derived from a yeast. Suitable yeasts are particularly selected from the following fresh tanks: Candida, Hansenula, Kluyveromyces , Yarrowia, Schizosaccharomyces, Pichia, Yarrowia, and Saccharomyces 17 201217536 (Saccharomyces) 〇 for those familiar with the art It is clear that in the method according to the invention, it is suitable to use a naturally occurring biocatalyst element (such as an enzyme) to express an (wild-type) biocatalyst or to use a naturally occurring biocatalyst element. A mutant of activity. The properties of naturally occurring biocatalyst motifs can be improved by biotechnology known to those skilled in the art, for example via molecular evolution or rational design. The mutant of the wild type biocatalyst motif can be produced by, for example, modifying the coding DNA of an organism capable of producing a biocatalyst element (such as an enzyme) using a mutation technique known to those skilled in the art. These include random mutations, site-directed mutagenesis, directed evolution, and genetic recombination. In particular, DNA can be modified to encode an enzyme different from at least one amino acid of the wild-type enzyme, thus compared to the wild type. Encoding an enzyme comprising one or more amino acid substitutions, deletions and/or insertions; or allowing the mutant to bind to a sequence of two or more parent enzymes or to express the modified DN A in a suitable (host) cell. The latter can be achieved by methods known to those skilled in the art, such as deteriorating optimization or codon pair optimization, as based on the method described in WO 2008/000632. According to the invention, the AKP system is made from AKG. AKG can in principle be obtained in any way. In particular, AKG can be obtained via biocatalytic means to provide a suitable carbon source for the conversion of the heterologous biocatalyst to AKG (e.g., fermentation via a carbon source). In an advantageous method, AKG is prepared using a whole cell bioconverting carbon source to form AKG. The carbon source may specifically comprise at least one compound 18 201217536 selected from the group consisting of: -ols, polyols, carboxylic acids, carbon dioxide, fatty acids, glycerols, including any of these compounds mixture. Suitable ones of the 70 alcohols include methanol and ethanol. Suitable polyols include glycerin and carbohydrates. Suitable fatty acids or glycerides may be provided in particular as an edible oil, preferably a plant source. Carbohydrates are particularly useful because carbohydrates are generally available in large quantities from sources of bioregeneration, such as agricultural products, preferably agricultural waste. Preferably, the carbohydrates used are selected from the group consisting of glucose, fructose, sucrose, lactose, sugars, starch, cellulose, and hemicellulose. Particularly preferred are glucose, sugar-containing sugars, and polysaccharides containing glucose. In one embodiment of the invention, AKG is converted to AKA using a biocatalyst for the conversion of AKG to ΑΚA, the biocatalyst being derived in part from the AAA pathway for the biosynthesis of lysine. This conversion may involve a single or several reaction steps' such steps may be catalyzed by one or more biocatalysts. The biocatalyst or a portion thereof for catalyzing the conversion of AKG to AKA may be homologous or heterologous. In particular, biocatalysts that form part of the AAA pathway for the synthesis of amino acids can be found in organisms selected from the group consisting of yeasts, fungi, archaea, and bacteria, particularly from the following groups: Penicillium, cephalosporins Genus, Paecilomyces, Trichophyton, Trichoderma, Pembrassis, Microsporum, Saccharomyces, Schizosaccharomyces, Saccharomyces, Candida, Kluyveromyces, Yeah R. cerevisiae, Pichia, Hansenula, Thermus, Abnormal genus, Pyrococcus, Sulfolobus, Pyrococcus, Methanococcus, M. mazei, methane Genus, genus M. genus, genus Methane, genus Brevibacterium, 曱19 201217536 genus of the genus Streptomyces and Methanothermobacter. Suitable biocatalysts can be found in organisms capable of producing high citric acid, such as biocatalysts of nitrogenase complexes in nitrogen-fixing bacteria such as the following: cyanobacteria (eg, Anabaena, Microcystis) , Synechococcus), Rhizobiales (eg, Rhizobium, Bradyrhizobium), Proteobacteria (eg, Pseudomonas, Azotobacter, Cray) Burdock) and actinobacteria (eg, Frankia). Thus, if a biocatalyst or a portion thereof based on a host cell naturally comprising an AAA pathway for the synthesis of lysine is used, the system may be homologous. In a preferred embodiment of the invention, a biocatalyst capable of producing a high AKA yield is required. The biocatalyst or portion thereof comprising the AAA pathway for the synthesis of lysine can be modified by methods known in the art, such as mutation/screening or metabolic engineering. A high level of AKA can be produced by increasing the activity of the enzyme involved in its formation and/or reducing the activity involved in its conversion to an enzyme such as aminoaldipic acid. Enzymes involved in the formation of AKA include high citrate synthase (Ec 2.3.3.14), southern aconitase (EC 4.2.1.36), and high isocitrate dehydrogenase (EC 1 · 1.1.87). The activity of this enzyme in primary cells can be increased by methods known in the art, such as (over)expression of genes encoding individual enzymes and/or functional homologs, and the use of substrates, products or other compounds to slow down inhibition or use Molecular evolution or rational design 'improved catalytic properties of enzymes. The preferred method for conducting evolutionary evolution can be based on W〇 2〇〇3/〇丨〇丨8 3 . When it is not desired to convert the produced AKA to amino adipic acid (eight eighty-eight) _ 20 201217536 It may be the other step in the route of amino acid synthesis. Preferably, the heterologous biocatalyst has a low Enzyme activity which does not catalyze this conversion, in particular an aminotransferase, such as an aminoadipate aminotransferase (EC 2.6.1.39), or has a low or no dehydrogenation of the amino acid capable of catalyzing this conversion Enzyme activity. Thus, if the host cell providing the biocatalyst contains a gene encoding the enzyme, the gene is preferably inactive, knocked or the expression of the gene is attenuated. When this step is necessary in the 8.8 pathway from the production of the amine acid, the AKA is converted to AAAA by supplying the desired amount of lysine to facilitate growth and maintaining a limited, minimal activity, but not capable of high level. The host cell line is advantageous. In particular, if Penicillum chrysogenum is the host, the amine transferase may have the sequence of sequence number: 45 or a homolog thereof. Deactivation of genes encoding unwanted activities can be accomplished in a number of ways. One method is temporary, using an anti-message molecule or an RNAi molecule (e.g., according to Kamath et al. 2003. Nature 421:231-237). Another method uses an adjustable starter line that can be turned off, like a four-part, (eg, according to Park and hhhauser, 2005,

Eukaryot. Cell. 4:1328-1342). Yet another method is the administration of a chemical inhibitor or protein inhibitor or physical inhibitor (e.g., according to > ^ ^ 2〇〇3 Nat Bmtech (1) Muscle (4)). A better method is to remove the entire gene or part thereof that encodes the desired activity. In order to obtain this - mutant, the most advanced methods can be applied, such as the technique of single exchange recombination or double homologous recombination. For this, it is necessary to (10) mount the integrated (four) vector in the chromosome of the host cell at the predetermined target (IV). In a preferred embodiment of the invention, the 21 201217536 integrated selection vector comprises a DNA fragment homologous to a DNA sequence in a predetermined target site in the genome of the host cell for directing integration of the selection vector into the vector The scheduled location. To facilitate targeted integration, the selection vector is preferably linearized prior to transformation of the host cell. Preferably, linearization is performed to facilitate at least one of the vectors, but preferably each end is flanked by a sequence homologous to the target. The length of the homologous sequence on either side of the target address is preferably at least 0.1 kb, even preferably at least 〇2 kb, more preferably at least 0.5 kb, even more preferably at least 1 kb, optimally at least 2 kt^ The final length most suitable for the experiment depends on the organism, the sequence of the target, and the length. Targeted integration of the nucleic acid construct into the genome of the host cell by homologous recombination, i.e., integration at a predetermined target, is preferably increased by increasing the homologous recombination ability of the host cell. The phenotype of the cell preferably involves a defect 1^8 or 1^3 gene as described in ~〇 05/95624. 〇 05/95624 discloses a preferred method for obtaining filamentous fungal cells, comprising increasing the effectiveness of target integration by preventing non-homologous random integration of DNA fragments into the genome. The vector system can be a single vector or plastid or two or more vectors or plastids which together contain the entire DNA of the genomic form to be introduced into the host cell. Fungal cells can be transformed by protoplast formation, protoplast transformation, and cell wall regeneration. A procedure suitable for transformation of a fungal host cell is described in EP 238023 and Yelton et al. (1984. Proc. Nat. Acad. Sci. USA 81: 1470-1474). A procedure suitable for the transformation of filamentous fungal host cells using Agrobacterium tumefaciens is described in de Groot 22 201217536 MJ et al. (1998. Nat. Biotechnol. 16:839-842. Erratum in: Nat. Biotechnol. 1998. 16:1074). Other methods, such as the electroporation described in relation to Neurospora crassa, can also be applied. The co-transformed fungal cells are transfected with the gene of interest, along with the selectable marker. This can be physically linked to the gene of interest (i.e., on the plastid) or on separate fragments. After transfection, the transformant in which the selectable marker gene is present is screened, and then the integration at the preferred predetermined gene body address is analyzed. A selectable marker is a product that provides resistance to antibiotics or viruses, resistance to heavy metals, prototrophy to auxotrophs, and the like. Selectable markers that may be used include, but are not limited to, 'amdS (acetamidase), argB (ornosine formazan transferase), bar (glyphosate acetyltransferase), hygB (hygromycin acid transferase) ), niaD (nitrate reductase), pyrG (whey _5, _ acid dehydration S#), sC or sutB (adenosyl transferase), trpc (aminobenzoic acid synthase), ble ( The phleomycin resistance protein) and its equivalent. The most preferred state is to provide a DNA molecule comprising a first DNA fragment comprising a sequence of DNA homologously homologous to the sequence of the chromosomal DNA flanking the target sequence on its 5 and 3 sides. The desired substitution sequence (ie, the selectable marker gene). A cell in which the target sequence in the chromosomal DNA is replaced by a desirably substituted sequence can be screened using a selectable marker in which the first DNA fragment is present. To increase the relative frequency of screening for the correct mutant microbial strain, cocoa operably linked a second DNA fragment to the fragment described above (ie, 5 of the target address, side + selectable marker gene + target address 3 , the side) HDNA# segment comprises an expression cassette, the expression cassette comprising a selection marker encoding a eukaryotic cell and a regulatory group of a functional group 23 201217536; The second selection marker is fine and the lack of cells that are replaced by the desired substitution sequence. If the sequence of the sequence in the sequence is heterologous to the amino acid system of the amino acid synthesis, then the preferred v=t leaver will contain the derivative _ adipic acid converted to an amine group. Second, the disability does not cause. The term 'enzymes', Newt's tearing--峨= leaven= base, thereby catalyzing the special-sex transformation. The conversion may involve two or more known or unknown intermediate reactions, and the clock G_^AKA or AKA is converted to AKP. This system can occur in cells or be isolated from cells. Aminotransferases are known to have a wide range of matrices. It may be desirable to reduce the activity of one or more of the enzymes present in the host cell, thus reducing the activity of AKA to AAA, while maintaining the relative catalytic function of the biosynthesis of other amino acids or cellular components. It is also preferred to avoid any other host cell which would cause the aka to convert to an undesirable by-product enzyme activity. The technology for the preparation of AKP from AKG is based on the synthetic pathway of fflc! The principle of C! elongation is known to exist in the decane-producing archaea, which is part of the synthesis of coenzyme B and the biosynthesis. Coenzyme B is considered to be a basic substance in the formation of methane in these organisms, and an important intermediate in the synthesis of α-ketosuberic acid coenzyme. Thus, in the formation of archaea, the α-ketoglutaric acid is converted to 1 ketoadipate, and then converted to 01·ketopimelic acid by continuously adding an fluorenylene group after several reaction steps. And the final (X-ketosuberic acid (see also Figure 1): a. α-keto acid with long Cn + acetyl group-c〇A~^ high η citric acid + 24 201217536

CoA-SH (steps 1, 5 and 9 in Figure 1), b• high n citric acid <——^ high aconitic acid (catalyzed by high n-citrate dehydrogenase (steps in Figure 1) 2, 6 and 1〇), C·H. aconitate – isoheight n_citric acid (steps 3, 7 and 11 in Figure 1), d'high η-isocitric acid + NADP+ — with long Cn +1 a-keto acid + NADPH + H + + C02 (steps 4, 8 and 12 in Figure 1), wherein η is selected in 1-4. This repeated reaction sequence is in the methanogen methanogen The description of cocci and Methanocaldococcus jannashii has been described. Similar non-iterative reactions involve the extension of other alpha-ketocarboxylic acid Cls in other metabolic pathways such as grass mash in the oxidized citric acid cycle. Conversion of acetic acid to α-ketoglutaric acid, conversion of ex-isovalerate to isohexanoic acid in the isopropylmalic acid pathway portion of leucine, and α-ketone in the AAA pathway for the formation of lysine Conversion of glutaric acid to monoketoadipate, conversion of pyruvate to alpha ketobutyrate and conversion of maleic acid to pyruvate in the acetone 1 pathway for the production of isoleucine. The land is defined as “Cis long.” In the description and characterization of J. jejuni, many genes involved in Q-prolongation and enzymes have been described, which show that these enzymes and the coding genes are related to each other (IV) and The money body towel is similar to the enzymes involved in the prolongation of the enzymes and the like, and the subset of the enzymes of the keto-succinic acid is further extended by the α-ketoadipate and the α-keto pimelic acid. The biochemical properties have been described and are referred to as "eight gossips". Some genes encoding these enzymes have been identified in the genome sequence of J. jejuni 25 201217536, and others have been suggested. The preparation of aka or cockroach can be carried out on the scale of the long-term (four) red industry, so that the A- or ΑΚΡ ' can be effectively prepared as a special compound by encoding a nucleic acid sequence involving a prolonged enzyme system and a suitable host cell. Or an intermediate of a commercial product such as hexamethylenediamine, adipic acid or caprolactam. As indicated above, at least one of the Aks enzyme AksD, AksE and AksF is derived from M. variabilis or its work. In particular, it is possible to use - or a plurality of calves (4) selected from the following groups, and to catalyze the enzyme according to the present invention (: AksD, AksE, AksF, Vis or other) AksA): Cyclohexanes, Helminthosporium, M. thermophilus, M. mazei, C. thermophilus, M. genus, decane genus and Brevibacterium genus. More special Alternatively, one or more enzymes derived from decane-producing bacteria selected from the group consisting of Methanothermobacter thermoautotropicum, Methanococcus maripaludis, and S. sphaeroides can be used. (Methanosphaera stadtmanae), Methanopyrus kandleri, Methanosarcina thermophilus, Methanococcus vannielii, Methanospirillum hungatei, thermophilic mane Methanosaeta thermophila, Methanosarcina acetivorans, and Helminthosporium. In addition, an enzyme suitable for catalyzing the Ci extension of AKG and/or AKA can be found in an organism, for example, the organism comprises an enzyme system that catalyzes the synthesis of lysine by the amino adipic acid pathway or its 26 201217536 moiety, or It is a homologue of a part of other metabolites, such as a high citrate synthase involved in nitrogen fixation. In particular, organisms selected from yeasts and fungi, such as Penicillium, cephalosporium, sputum, genus, genus, genus, genus, genus, genus, genus, genus Yarrowia, Hansenula, Schizosaccharomyces, Saccharomyces, Candida, Kluyveromyces, especially Penicillium chrysogenum, Penicillium notatum, Paecilomyces Carneus), Paecilomyces persinicus, Cephalosporium acremonium, Aspergillus niger, Emericella nidulans, Aspergillus oryzae, Ustilago Maydis), Schizosaccharomyces pombe, Saccharomyces cerevisiae, Yarrowia lipolytica (Yarrowia 11卩〇1>^0珏), Hansenula polymorpha (1^1186111113) 111〇 113), Candida albicans, Candida maltosa, and Kluyveromyces lactis; bacteria, such as solid Species, Pseudomonas, Klebsiella, Deinococcus, Thermophilus, especially Azotobacter vinelandii, Pseudomonas stutzerii, Krebs Klebsiella pneumoniae, Deinococcus radiourans 'Deinococcus geothermalis ' ^ Thermus thermophilus; and archaea such as Pyrococcus, Sulfolobus, Pyrococcus, Cyclone , Methane genus, genus M. genus, decane genus, genus Helicobacter, genus Brevibacterium, 27 201217536 M. mazei and genus Thermobacillus, especially Pyrococcus Horikoshii), Sulfolobus solfataricus, TTiermococcws, Helminthosporium, Helminthosporium variabilis, Stefanella carbendazim, J. cerevisiae, S. cerevisiae, decane thermophilic Bacteria, thermophilic decane octacocci, Hemhel's spirulina, thermophilic melon, decane acetyle and tropophilic methanogens. The yeast, fungus, bacteria, nucleus or other organisms may in particular provide a high citrate synthase capable of catalyzing the "reaction" of AKG prolongation into guanidine and, optionally, prolongation into the APK. In addition, a biocatalyst suitable for catalyzing the reaction step of preparing AKP can be found in the genus Aspergillus or the genus Pteridium, in particular, Asplenium septentrionale or Hydnocarpus anthelminthica, which is natural under natural conditions. Can produce AKP. Further, specific examples of AksA, AksD, AksE, and AksF enzymes which can be used are listed in the following table, and homologs thereof can also be used. Step Enzyme Name Organism Gene Protein 1 AksA J. japonicus MJ0503 NP-247479 Thermophilic Autotrophic Methanococcus ΔΗ MTH1630 NP-276742 Seaweed Methaneococcus S2 MMP0153 NP_987273 Seaweed M. coli C5 MmarC5_1522 YP_001098033 Sea Descendae C7 MmarC7_1153 YP—001330370 Sodium sterol sphagnum DSM 3091 Msp_0199 YP.447259 曱 嗜 thermophilic bacteria AV19 MK1209 NP_614492 Helminthosporin SB Mevan_1158 YP_001323668 Klebsiella pneumoniae nifV P05345 Brown nitrogen-fixing bacteria nifV P05342 Pseudomonas stutzeri nifV ABP79047 N. sphaeroides Nankai 3 Maeo_0994 YP_001325184 28 201217536 Step Enzyme Name Organism Gene Protein 2,3 AksD M. japonicum MJ1003 NP_ 247997 Thermophilic Autotrophic Bacillus ΔΗ MTH1386 NP_ 276502 Seaweed M. cerevisiae S2 Mmpl480 NP_ 988600 Seaweed Cyclohexane C5 MmarC5 0098 YP. 001096630 M. cerevisiae C7 MmarC7_0724 YP- 001329942 M. sphaeroides DSM 3091 Msp_1486 YP. 448499 Methane thermophilic bacteria AV19 MK1440 NP_ .614723 Wanshi Cocci SB Mevan—0789 YP. .001323307 Hydox cyanobacteria Nankai3 Maeo_0311 YP. .001324511 M. mazei MA3085* NP_ .617978* Heinz Helicobacter pylori JF-1 Mhun-1800* YP. _503240* Thermophilic 鬃Trichophyton PT Mthe_0788* YP. .843217* M. sphaeroides DSM 3091 Msp_1100* YP. .448126* Reference to base and protein can be found at www.ncbi.nlm.nih.gov/ The gene/protein marked with * can be obtained in the 3rd of 2010, the other part: can be obtained in 2〇〇8月4年15曰) Step Enzyme Name Organism Gene Protein 2,3 AksE Jane Methane Coccus MJ1271 NP_248267 Thermophilic methanogen ΔΗ MTH1387 NP_276503 M. meliloti S2 MMP0381 NP_987501 Methane cocci C5 MmarC5_1257 YP_001097769 M. coli C7 MmarC7 - 1379 YP_001330593 M. cerevisiae DSM 3091 Msp_1485 YP448498 曱 嗜 thermophilic AV19 MK0781 NP_614065 Methanococcus SB Mevan_1368 YP_001323877 Hydrangea genus Nankai 3 Maeo-0652 YP_001324848 Methane acetate eight Cocci MA3751* NP_618624* Hemophilus snails JF-1 Mhun_1799* YP—503239* M. sphaeroides DSM 3091 Msp_0374* YP_447420* __ Thermophilic sputum PT Mthe_0853* YP_843282* 4 AksF M. japonica MJ1596 NP_248605 Thermophilic autotrophic methanogen ΔΗ MTH184 NP-275327 Helminococcus sulphate S2 MMP0880 NP988000 Seaweed M. coli C5 MmarC5_0688 YP001097214 29 201217536 Organism Helminococcus C7 Strain of Steroids DSM 3091 Methane Thermophilic AV19 Wansane Cocci SB chromobacter bacterium Nankai 3 M. octacocci Hemellella sphaeroides JF-1 Sputum snails DSM 3091 Thermophilic sputum PT gene protein MmarC7—0128 γρ_001329349 Msp-0674 YP-447715 MK0782 ΝΡ_614066 Mevan_0040 ΥΡ_001322567 Maeo_1484 ΥΡ_001325672 MA3748* ΝΡ_618621* Mhun_1797* ΥΡ 503237* Msp_0674氺ΥΡ—447715* Mthe_0855* ΥΡ_843284* S tm The cause and protein reference is available at www.ncbi.nlm.nih.g〇v/:ftSU ·The list of listed people right * 夕 闵 / protein: can be in the 3rd of February 2010 To other parts: may be obtained at 2008 + 15 + 4 March said).

The NifV enzyme or a functional analogue thereof may specifically be a NifV enzyme derived from the genus Azotobacter, more particularly a brown nitrogen-fixing bacterium, or a functional analogue thereof. Selectively include NifV enzymes from Klebsiella, particularly Klebsiella pneumoniae, and Pseudomonas, particularly Pseudomonas stutzeri, and functional analogs thereof. In a particularly preferred embodiment, the NifV enzyme or functional analog comprises an enzyme according to the sequence identification number: 2 or a functional analog thereof. The AksD enzyme or a homolog thereof, the AksE enzyme or a homolog thereof or the AksF enzyme or a homolog thereof may be specifically derived from an organism selected from the group consisting of: a genus of genus, a decane heat Bacillus, Methanococcus, M. oxysporum, M. fungus, Brevibacterium brevis, Streptomyces genus, Methane spirulina, A. genus, and Mycobacterium genus or homologs thereof 'But the condition is that at least one is from M. variabilis. The AksD and the AksE are preferably used in the form of a heterodimer in which AksD and AksE are derived from the same organism or are functional analogs of AksD and AksE from the same organism (especially one from In the specific example of the same species of the genus Artemisinus, it has reached a good result of 30 201217536. In a particular embodiment, the AksD enzyme or a homolog thereof or the AksE or a homolog thereof is derived from an organism selected from the group consisting of M. variabilis, particularly N. cinerea Nankai. More particularly, M. variabilis, Nankai3, M. vannamei; or homologs of AksD and AksE, respectively, for each of these organisms. Preferably, AksD and Aks are used in an equivalent molar position, in particular a molar ratio of 0.8:1 to 1.2:1, more particularly 0 9 : 丄:j. In a preferred embodiment, the AksD enzyme or a homolog thereof or the homologue thereof is derived from an organism selected from the group consisting of variegated methane spheres, particularly variegated methanococcus Nankai. More particularly variegated methanococcus

Nankai 3\ or its homologue. In a specific embodiment, the AksD enzyme or a homolog thereof comprises an enzyme according to the sequence identification number: 34 or a functional analog thereof. In a specific embodiment, the AksE enzyme or a homolog thereof is an enzyme comprising a sequence according to the sequence identification number: 31 or a functional analog thereof. If an octopus $ enzyme or a functional analog thereof is used, it is preferably derived from the genus cyclamate Nankai, more particularly from the genus Methanococcus Nankai 3 Spitting enzyme or its functional analogue. In a particularly preferred embodiment, the AksF or functional analog is an enzyme comprising a sequence according to the sequence identification number: 43 or a functional analog thereof. Among the methods in which the AksD, 5 Xuan AksE, and the AksF are each independently derived from the following groups, good results have been achieved: a sputum enzyme from the genus Artemisia and a functional analog of the Aks enzyme of the genus Artemisia. In particular, in 31 201217536 wherein AksD'AksE and AksF are selected from the following groups, high yields (products obtained by AKP or conversion of AKP) have been obtained: Aks enzymes derived from chromobacter bacterium and A functional analog of the Aks enzyme of chromobacter. Another AksF derived from the genus Ceramococcus, which achieves the best results, is AksF from the seaweed M. coli. The AKP obtained according to the present invention can be used as an intermediate compound for the preparation of other compounds such as 6-AC A or another compound mentioned above. The conversion action is in principle carried out in a manner known per se, such as the method of the aforementioned technique cited above. In particular, the invention further relates to a process for the preparation of 5-FVA, AAP or 6-ACA from AKP obtained according to the invention. In one embodiment, the carboxyl group of the AKP is removed, thereby forming 5-FVA, and if desired, the 5-FVA can be converted to 6-ACA. In another embodiment, the AKP is converted to AAP and, if desired, converted to 6-ACA.

The method for preparing 5-FVA, AAP or 6-ACA from AKP can be achieved according to the method described in WO 2009/113855, relating to the preparation of 5-FVA, AAP or 6-ACA, in particular examples, for such The scope of the claims for the preparation of any of the compounds, as well as the decarboxylase and aminotransferases identified in the sequence listing, including homologs thereof, are incorporated herein by reference. If desired, the 6-ACA obtained according to the present invention can be cyclized to form caprolactam as described in US-A 6,194,572. In other embodiments, the AKP is used to prepare alpha-ketosuberic acid (AKS) by using a biocatalyst having a prolonged catalytic activity to subject the 32 201217536 AKP to a C! extended treatment. Enzymes having AKPiC! prolonged catalytic activity may each independently be derived from an organism selected from the group of A. sinensis. Preferably, one or more of the enzymes are selected from the group consisting of: An alkaloid, a genus vaginococcus, a decane genus, a thermophilic genus, a vaginal genus, a decane genus, and a bacterium of the genus bacillus. In a preferred embodiment, the AKS system Produced in a biocatalytical manner using a biocatalyst comprising: - an AksA enzyme having high (η) citrate activity or a homolog thereof (eg, Nifv); - at least one selected from the group consisting of Enzyme: AksD enzyme with high n-aconitase activity, AksE enzyme with high aconitase activity, homologue of the AksD enzyme, and homolog of the AksE enzyme, preferably AksD enzyme or homolog And AksE enzymes or homologs; and -- have high The AksF enzyme of n-isocitrate dehydrogenase or a homolog thereof. These enzymes can be specifically selected from the respective enzymes listed in WO 2009/113855, among which these enzymes, in particular Tables 1A and 1B This is incorporated herein by reference. The same concept of converting AKP to 6-ACA as described herein can be used, i.e., using one or more decarboxylase enzymes that are capable of catalyzing the reaction steps of the methods of the invention, The biocatalyst of the group of aminotransferases and amino acid dehydrogenases further converts the formed α-ketosuberic acid into 7-aminoheptanoic acid. Optionally, one or more of the subsequent reactions The step can be carried out by a chemical reaction method. The 7-amino heptanoic acid obtained in this method can be cyclized to form the corresponding C7-endoamine (also known as 2-azetidinone or oxime-amino group). Nitrogen 33 201217536 Heterocyclic octane and/or direct polymerization or permeation through the C7_amine for the production of nylon-7 or its copolymer. If desired, the product obtained according to the process of the invention can be isolated from biocatalysis Suitable separation methods are generally known in the art. Further, in the context of the present invention, the reaction conditions of any biocatalytic step may depend on the known conditions for the biocatalyst (especially the enzyme), the materials disclosed herein, and optionally some conventional experiments. In principle, the choice of the pH of the reaction medium is limited, as long as the biocatalyst is active under § pH conditions. Basic, neutral or acidic conditions may be used, depending on the biocatalyst and other factors. The method comprises the use of a microorganism, such as an enzyme for expressing a method of catalyzing the invention, wherein the pH is selected to be the pH at which the microorganism is capable of performing its intended function. In particular, at 25 C, essentially the case of an aqueous system Next, the pH can be selected within a range of 4 pH units below neutral pH and 2 pH units greater than neutral pH, ie between pH 3 and pH 9. If the water is the only solvent or main solvent (based on the total liquid, > 5 wt%, especially > 9 wt%) ', where a small amount of alcohol or other solvent (such as carbon source) can be dissolved ( Based on the total liquid, < 50% by weight, especially < 90% by weight, at which the microorganism can remain active, the system is considered aqueous. Particularly in the case of using yeasts and/or fungi, acidic conditions based on an aqueous system at 25 ° C intrinsically are preferred, and particularly pH may be in the range of pH 3 to pH 8. If desired, the pH can be adjusted using acid and/or assay or buffered with a suitable combination of acid and base. 34 201217536 In an advantageous embodiment, the method of the invention comprises a fermentation process. The term fermentation as used herein is broadly understood and is common in the art, and thus means the use of cell cultures of cells of microorganisms or larger organisms to convert or modify the material to be a useful product for humans. Here, the conditions need not be anaerobic. In principle, the choice of incubation conditions is broadly limited as long as the biocatalyst exhibits sufficient activity and/or growth. This includes aerobic, micro-oxygen, gas-limited and anaerobic conditions. The anaerobic conditions herein are defined as the absence of any oxygen or substantially oxygen-free conditions by which the biocatalyst 'especially microorganisms are consumed, usually corresponding to an oxygen consumption of less than 5 mmol/lh', especially if the oxygen consumption is lower than 2 5 mmol/lh or less than 1 mmol/lh. The aerobic condition is one in which oxygen sufficient for unrestricted growth is dissolved in the medium, and flb is sufficient to support an oxygen consumption rate of at least 1 〇mm〇yi h, more preferably more than 20 mmol/lh, and even more preferably more than 5 〇. On mm〇1/1 and optimally above 100 mmol/lh. The oxygen-limited condition is defined as the condition in which the oxygen consumption is limited by the conversion of oxygen from gas to liquid. The lower limit of the oxygen-limited condition is determined by the upper limit of the anaerobic condition, which is usually at least! Wei and especially at least 2 5 Na. Move or to v 5 mmol/l.h. The upper limit of the oxygen-limited condition is determined by the lower limit of aerobic conditions, that is, lower than the survey, less than 5 (), and less than 2, or less than 10 mmol/l.h. When the law is in progress, in particular, the conditions are aerobic, anaerobic or limited (iv), depending on the amount and composition of the incoming gas under its conditions, the actual mixing/mass conversion characteristics of the equipment used, and the microorganisms used. Type and microbial density. In principle, the temperature used is not critical, as long as the biocatalyst specifically enzymes exhibit a large amount of activity. In general, the temperature is at least ,, especially at least 15t, more particularly at least underarm. The maximum temperature desired depends on the biocatalyst. Generally, this maximum temperature is known in the art, for example, if commercially available biocatalysts are shown in the product data sheet, or in accordance with general general knowledge and the materials disclosed herein are determined in a conventional manner. The temperature is usually 9 〇. (: or lower, preferably 7 〇. (: or lower, in particular 5 〇 ° C or lower 'more special art or lower. In particular, if the biocatalytic reaction is carried out outside the host organism, A reaction medium comprising a high concentration of organic solvent (e.g., more than 5% or more than 90% by weight) can be used. If an enzyme is used, it retains sufficient activity in the medium. In an advantageous method, whole cells are used. Bioconverting 6 ACA matrix or forming 6-ACA intermediates (such as AKP or AAp) to prepare 6-ACA, the method comprising using one or more biocatalysts (usually one or more) that will produce catalytic bioconversion The microorganism of the enzyme, such as one or more biocatalysts selected from the group consisting of a biocatalyst capable of catalyzing the conversion of AKp to AAP and a biocatalyst capable of catalyzing the conversion of AAp to 6_ACA. In a preferred embodiment, the microorganism is capable of Producing a decarboxylase and/or at least one enzyme selected from the group consisting of an amino acid dehydrogenase and an aminotransferase capable of catalyzing the reaction steps described above. A carbon source, which can be used as The substrate of the microorganism used in the present invention may have at least one compound selected from the group consisting of monohydric alcohols, polyhydric alcohols, carboxylic acids, carbon dioxide, fatty acids, glycerides, including these compounds. Mixtures of any one. Suitable monohydric alcohols include methanol and ethanol. Suitable polyols include glycerol and carbohydrates. Suitable fatty acids or glycerides may be provided in particular in the form of edible oils, preferably plant sources. In particular, carbohydrates may be used, as carbohydrates are generally available in large quantities from sources of biological regeneration, such as agricultural products, preferably agricultural waste materials. Preferably, carbohydrates selected from the group consisting of glucose, fructose, sucrose, lactose are used. , saccharides, starches, celluloses and hemicelluloses. Particularly preferred are glucose, oligosaccharides containing glucose, and polysaccharides comprising glucose. Cells, particularly recombinant cells, comprise one or more reactions for catalyzing the process of the invention. Step biocatalyst (usually one or more enzymes) 'Can be constructed using techniques known per se from the technology itself. For example, if one or more biocatalysts are to be produced in a recombinant cell (which can be a heterologous system) then this technique can be used to provide a vector (such as a recombinant vector) And comprising one or more genes encoding one or more of the biocatalysts. One or more of the genes may be used, or each of the vectors may comprise one or more regulatory elements, such as one or more A promoter, which is operatively linked to a gene encoding a biocatalyst. The term "operably linked" as used herein means that a polynucleotide element (or coding sequence or nucleic acid sequence) is linked in a functional relationship. When the sequence is placed in a functional relationship with another nucleic acid sequence, the nuclear k sequence is known to be ligated. For example, if the promoter or enhancer transcribes the transcription of the coding sequence, then Operablely connected. The term "promoter," as used herein, means a nucleic acid fragment whose function is to control the transcription of one or more genes, which is located upstream in the direction of transcription relative to the transcriptional start position of the gene, and the structural recognition occurs. The binding site of the dependent RNA polymerase, the location of transcription initiation, and any other DNA sequence, including, but not limited to, transcription factor binding sites, repressors, and activator protein binding sites, as well as anyone else familiar with the art. A nucleotide sequence that acts directly or indirectly to modulate the amount of transcription produced by a promoter. A "constitutive" promoter is a promoter that is active under most environmental and developmental conditions. An "inducible" promoter is a A promoter that is active under environmental or developmental regulation. The term "homologous, when used to refer to a specified (recombinant) nucleic acid or polypeptide molecule and the relationship between a given organism or host cell, is interpreted to mean essentially the nucleic acid Or the polypeptide molecule is produced by the same type of host cell or organism, preferably the same variety or strain. A nucleic acid sequence that can be used to achieve expression of an enzyme (especially an aminotransferase, an amino acid dehydrogenase, a decarboxylase, an Aks enzyme or another enzyme as described above) encoded in the method of the invention The promoter may be native to a nucleic acid sequence encoding an enzyme to be expressed, or may be heterologous to the nucleic acid sequence (intervention sequence), wherein the promoter is operably linked to the nucleic acid sequence. Preferably, the promoter is homologous, i.e., endogenous to the host cell. If using a heterologous promoter (nucleus of enzymes of interest in coding)

In the case of a column, the heterologous promoter is preferably capable of producing a higher constant level of the transcription product comprising the coding sequence than the promoter originally produced in the coding sequence (or capable of producing more per unit time) Transcriptional molecule, ie, mRNAA 38 201217536 sub). In this case, suitable starters include both synthetic and inducible natural promoters, as well as genetically engineered promoters, which are well known to those skilled in the art. A strong constitutive promoter is a kind of relative to a native host cell that causes the initiation of mRNAs in the form of a sputum frequency. Examples of this strong, sputum and shaped promoter in gram-positive microorganisms include SP01-26, SPOl -15, veg, pyc (propionate carboxylase promoter) and amyE. Examples of inducible promoters in gram-positive microorganisms include jp TG-inducible Pspac promoter, xylose-inducible PxylA promoter. Examples of 'constitutive and inducible promoters in negative-negative microorganisms include, but are not limited to, tac, tet, trp-tet, lpp, lac, lpp-lac 'laclq, T7, T5, T3, gd, trc, ara ( PBAD), SP6, λ-Ρκ, and LP1. Promoters for (filamentous) fungal cells are known in the art and can be, for example, glucose-6-phosphate dehydrogenase gpdA promoter, protease promoter Such as pepA, pepB, pepC; glucoamylase glaA promoter, amylase amyA, amyB promoter; catalase catR4catA promoter; glucose oxidase goxC promoter, β-galactosidase iacA promoter, α-glucose Glycosidase aglA promoter, translation Long factor ratio promoter, polyxylase promoters such as xlnA, xlnB, xlnC, xlnD; cellulase promoters such as eglA, eglB, cbhA; transcriptionally regulated promoters such as areA, creA, xlnR, pacc , prtT; or another promoter, and it can be found on the NCBI website (http://www.ncbi.nlm.nih.gov/entrez/). The term "heterologous" is used when referring to nucleic acids (DNA). Or RNA) or protein, meaning a nucleic acid or protein that does not naturally occur as part of its existence 2012 20121536 organism, cell, genome or DNA or RNA sequence, or in its discovery in nature Found in different cells or genomic or DNA or RNA sequences. A heterologous nucleic acid or protein is endogenous to a cell to which it is introduced, but is obtained from other cells or produced synthetically or recombinantly. In general, although not required, this nucleic acid encodes a protein that is not normally produced in cells that are transcribed or expressed by δ-Xuan DNA. Similarly, exogenous RNA encodes a protein f that is normally not expressed in cells (in which 5 wai exogenous RNA is present). Heterologous nucleic acids and proteins are also referred to as foreign nucleic acids or proteins f. Any nucleic acid or protein that is recognized by a person skilled in the art as being heterologous or foreign to the cell to which it is expressed is encompassed by the term heterologous nucleic acid or protein. - The method according to the invention can be carried out in a host organism of Xinlai. The host organism is in particular a recombinant or heterologous cell. Accordingly, the present invention further relates to a heterologous cell comprising one or more heterologous nucleic acid sequences encoding a serotonin, ', 豸 or a plurality of heterologous enzymes as claimed in the patent scope: The definition of the term "and the optional - or a variety of enzymes have the patent scope of the s, U, 13 towel" "" The nucleic acid sequence may comprise - or a plurality of bat analogs as shown in Table 1 of the exemplified, provided that the sequence is the enzyme of the lion's yeast group: a heterogeneous fine from the variegated bacterium Blister Ht!, AksF# and its functional analogues. The nucleic acid sequence of the group of 40 201217536 sequences represented by any of the following: sequence identification number: 1, 5, 8, 15, 20, 23 '32, 35, 36 and functional analogs thereof . In a specific example wherein AKP is converted to an additional product, the cell advantageously comprises one or more enzyme activities that catalyze the conversion of AKP to the additional product (either directly or as an intermediate). In particular, the host cell may further comprise an aminotransferase or an amino acid dehydrogenase and a decarboxylase, which together have the catalytic activity to form 6-ACA. Suitable enzymes and coding genes are described in particular in this example and in WO 2009/113855. The invention will be exemplified by the following examples. The selection of the sample gene was searched from the database for the small subunit of Nankai 3 high aconitase (AksE, Maeo_0652, [SEQ ID NO: 31]) and the high aconitase unit (AksD, Maeo__0311, [SEQ ID NO: 34] and high isocitrate dehydrogenase (AksF, Maeo_1484, [SEQ ID NO: 43]); its small unit from Acetobacter SB high aconitase (AksE, Mevan_1368, [ Sequence identification number: 40]), high aconitase large unit (AksD, Mevan_0789, [SEQ ID NO: 37], high isocitrate dehydrogenase (AksF, Mevan_0040, [SEQ ID NO: 19)) Homolog; its subunit of M. aureus S2 high aconitase (AksE, MMP0381, [SEQ ID NO: 25]), large aconitase unit (AksD, MMP1480, [SEQ ID NO: 28] a homologue of high-sweet hexahydrodehydrogenase (AksF, MMP0880 '[SEQ ID NO: 22]); it is a small subunit of Hessian Helicobacter pylori JF-1 high aconitase (AksE, 41 201217536

Mhun_1800, [sequence identification number: 13]), high aconitase large unit (AksD, Mhun_1799, [SEQ ID NO: 10]), high isocitrate dehydrogenase (AksF, Mhun_1797, [SEQ ID NO: 16 )])) homologue; brown nitrogen-fixing bacteria high citrate synthase NifV [SEQ ID NO: 2]), from the genus Vibrio fluvialis JS17 aminotransferase protein [SEQ ID NO: 7] and the protein sequence of Lactococcus lactis branched chain 0C-keto acid decarboxylated scale KdcA [SEQ ID NO: 4]. All genes, except for the brown nitrogen-fixing bacteria high citrate synthase nifV (SEQ ID NO: 1), were codon-optimized using the method described in WO 2008/000632 (Table 13) and synthesized. Method of manufacturing constructs (Geneart, Regensburg, Germany). In the optimization procedure, avoid the restriction endonuclease site of the internal restriction endonuclease, and introduce a common restriction endonuclease cleavage site from the beginning to the end of the soil to allow sub-selection in the expression vector. . According to the manufacturer's instructions, using Phusion DNA polymerase, using the primer pair AT-Vfl_for_Ec (AAATTT GGTACC GCTAGGAGGAATTAACCATG) + AT-Vfl-rev_Ec (AAATTT ACTAGTAAGCTGGGTTTACGCGACTTC), the codon-optimized amine transfer from Vibrio phoenix JS17 The gene (SEQ ID NO: 8) was subjected to PCR amplification. According to the manufacturer's instructions, using Phusion DNA polymerase, using the primer pair Kdc_forJEc (AAATTT ACTAGT GGCTAGGAGGAATTACATATG) and Kdc_rev_Ec (AAATTT AAGCTT ATTACTTGTTCTGCTCCGCAAAC), the Ritter's from the ct-keto acid decarboxylase KdcA encoding the L. lactis Lactococcus lactis (Cactus Lactococcus lactis) codon optimized mitigation 42 201217536 basal enzyme gene (SEQ ID NO: 5), for amplification. The aminotransferase fragment was digested with KpnI/Spel, and the decarboxylase fragment was digested with Spel/Hindlll. The two fragments were ligated into KpnI/Hindm-digested pBBR_lac to obtain pAKP-96. For the subunits (AksE), high aconitase (AksD), high aconitase (AksD), and high-sweet lemons from M. variabilis, M. vannamei, M. sylvestris or P. aureus. The gene for acid dehydrogenase (AksF) was optimized for codon pairing of E. coli (using the method described in W008000632; Table 13). The sequences of the codon-optimized genes are shown in the sequence identification numbers: 5, 8, 9, 12, 15, 20, 23, 26, 29, 32, 35, 36, 39 and 42. The construct was made synthetically (Geneart, Regensburg, Germany) containing the optimized gene and the wild-type nifv gene (SEQ ID NO: 1), and the genes in each construct can also be seen in Table 1. In this optimization procedure, avoid the restriction endonuclease of the internal restriction endonuclease' and introduce the restriction endonuclease site of the common restriction enzyme at the beginning to the end to allow sub-selection in the vector. . Also, upstream of AksD, the tac promoter sequence from pMS470 was added. Each 〇RF has a common ribosome binding position and a leader sequence' to drive transcription and translocation in E. coli. The AksA/AksF gene cassette synthesized by Ndel/Xbal and the AksD/AksE gene cassette synthesized by Xbal/Hindlll were used. A fragment containing the Aks gene was inserted into the Ndel/Hindlll cleavage site of pMS470 to obtain various vectors. These plastids and plastids ρΑΚΡ9ό, containing the aminotransferase gene (AT) from Vibrio fuliginea and the decarboxylation gene (DC) from Lactococcus lactis, were transformed into BL21* , the strains listed in Table 1 were obtained. 43 201217536 Table 1: Sequence identification number of genes present in various E. coli strains UQ m »η vn in νη ν〇m 00 00 〇〇00 00 〇〇οο 00 Progress: 甥cn CS cn (N Huan; f CO CN Cn 〇\ cn 04 CO (NS 骧 骧 ι θιί Os CO vn cn vo m cn W?\ Department: f 匕缂J^l —Η 't-η i H 韬Μ 韬ε Η θ 资 S 佑 佑Λ柒=车® cW 酴涸'^条^03⁄4 θί® 涸< B-dgj \i{堀婚戒: 资=a ^c ¢-3⁄4 堀味味1 w涸画资<aD key涸ι|Β 越〇« S-洄 ββ条ε1 '堀回赍«3盘雄=3⁄4^ 洄 资 _ ^=3⁄4 te-+® ββ胬: Φ® s-cy B5涠 hard ((7)味1>洄S-画资<e3<a3 遨 遨 洄払 洄払 洄払 ¢ =-=3⁄4 β洄W (7)昧|? mg 堀¢ 堀¢ ⁄ 堀¢ ? d d d a a a a a a a a a a a a a a a '资^«iV g洄So <93$ V 堀 资 “ 陕 陕 陕 陕 陕 陕 陕 陕 陕 陕 陕 陕 陕 陕 陕 陕 陕 陕 陕 陕 IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS IS洄寸% sister〇 00 sister 〇ίο & sister inch 2 < (D ίο δ CN rn \〇(谱硪隶^=υα <谱飨讳砩鍩=IV) 44 201217536 Expression of proteins in Enterobacter and production of metabolites Cultures eAKP429, eAKP489, eAKP491, eAKP470, eAKP471, eAKP472, eAKP473, and eAKP474 (shown in the table were grown overnight in tubes with 10 ml of 2*TY medium. The 200 medium was transferred to a shake flask with 20 ml of Magic medium (Invitrogen), and the bottle was incubated on a rotary shaker at 3 ° C and 120 rpm for 16 hours. Collected by centrifugation from 2 〇 ml The cells from the culture medium were then resuspended in 4 ml of Magic medium on a 24-well plate and then incubated on a rotary shaker at 30 ° C and 200 rpm. 24 hours and '120 hours later' Samples were taken and the cells were separated from the supernatant by centrifugation. Samples were stored at -20 ° C for analysis. Analytical methods for determination of AKP, 6-ACA and AAP using Waters HSS T3 column 1.8 μπι, 100 mm*2.1 Mm, using the gradient elution method indicated in Table 2, separates AKP, 6-ACA, and AAP. Eluens A consists of LC/MS grade water containing 0.1% formic acid and Eluens B consists of acetonitrile containing 0.1% citric acid. The flow rate was 0.25 ml/min and the column temperature was kept constant at 40 °C. Table 2: Gradient elution schedule for separation of AKP, 6-ACA and AAP Time (minutes) 0 5.0 5.5 10 10.5 15 %A 100 85 20 20 100 100 %B 0 15 80 80 0 0

The electrospray used in the Waters micromass Quattro micro API is either positive or negative ionization mode, depending on the compound to be analyzed, using multiple reaction monitoring (MRM). The ion source temperature was maintained at 130 ° C, while the solvent volatilization temperature was 350 ° C and the flow rate was 500 L / hr. 45 201217536 For the technique, the proton-degrading molecules are broken into pieces by HM4 eV, resulting in fragments such as H2〇, C〇 and special. For 6, ACA and AAP, the protonated molecules were broken into pieces by 13 eV to produce specific fragments due to the loss of HiO, NH3 and C0. For the determination of the concentration of ’, the synthetically prepared compound is subjected to calibration of the calibration curve for individual ions. This is used to calculate the concentration in the sample. The sample was appropriately diluted (25 times) to overcome the inhibitory effect as well as the matrix effect. Analysis of supernatant and cell extracts The supernatant was diluted 25-fold with water prior to UPLC-MS/MS analysis. The results are shown in Table 3, and it is clearly shown that the levels of 6-ACA and AAP in the strains eAKP671 and eAKP673 are significantly higher than those of the strains 6 8.1 gt; 67 〇 and eAKP674, respectively, showing miscellaneous The efficacy of sputum bacillus aksFi is better than that of homologs from M. vannamei and M. cerevisiae. It is also clear from this table that the level of 6-ACA, AAP and AKP in strain eAKP491 is significantly higher than that of eAKP674, showing that the efficacy of M. aureus aksD/aksE is better than that from sea bream. Homolog. It is postulated that the conversion of AKP to AAP is catalyzed by a native aminotransferase present in E. coli. 46 201217536 Table 3: Yield of 6-ACA, AAP and AKP in Magic medium Partially after 6 hours of 6-ACA [mg/1] AAP after 120 hours [mg/1] AKP after 24 hours [mg/1 ] B1-21 (blank) supernatant nd nd nd eAKP-429 (reference) supernatant 5 π 2 eAKP489 (reference) supernatant 10 24 nd eAKP674 (reference) supernatant 10 11 nd eAKP670 (reference) Ϊ́ί青液 20 r 24 nd eAKP491 supernatant 116 388 80 eAKP671 supernatant 36 100 3 eAKP672 supernatant 164 403 200 eAKP673* supernatant 22 50 nd* *no 检测 detected in the medium » should pay attention to 'cell The internal position of the 泫 泫 ΑΑΡ ΑΑΡ ΑΑΡ ΑΑΡ ΑΑΡ ΑΑΡ ΑΑΡ ΑΑΡ ΑΑΡ ΑΑΡ ΑΑΡ ΑΑΡ 6 6 6 6 6 6 6 6 6 6 6 6 6 ; ; ; ; ; e e e e e e e e e e e e e e e e e e e e e e Compared to eAKP674 I: a simple description of the diagram:! Figure 1: OC-ketoglutaric acid is converted to Ot-ketoadipate, followed by continuous addition of methylene _ after several reaction steps, conversion (4) pimelic acid and the final (X-ketosuberic acid. [Main component symbol description 1 (none) 47 201217536 List <110> DSM IP Assets B.V. <120> Method for preparing a-ketopimelic acid by Cl-prolongation

<130> 27845-WO-PCT <150> EP10176270.6 <151> 2010-09-10 <160> 49 <170> Patentln version 3.3 <210> 1 <211>

<212> DNA <21 3> Azotobacter vinelandii <220><221> CDS <222> (1)..(1155) <400> 1 atg get age gtg ate ate Gac gac act acc ctg cgt gac ggt gaa cag 48

Met Ala Ser Val lie lie Asp Asp Thr Thr Leu Arg Asp Gly Glu Gin 15 10 15 agt gcc ggg gtc gcc ttc aat gcc gac gag ag ate get ate gee ege 96

Ser Ala Gly Val Ala Phe Asn Ala Asp Glu Lys lie Ala Me Ala Arg 20 25 30 geg etc gcc gaa ctg ggc gtg ccg gag ttg gag ate ggc att ccc age 144

Ala Leu Ala Glu Leu Gly Val Pro Glu Leu Glu lie Gly lie Pro Ser 35 40 45 atg ggc gag gaa gag ege gag gtg atg cac gcc ate gcc ggt etc ggc 192

Met Gly Glu Glu Glu Arg Glu Val Met His Ala lie Ala Gly Leu Gly 50 55 60 ctg teg tet ege ctg ctg gcc tgg tgc egg eta tgc gac gtc gat etc 240 Leu Ser Ser Arg Leu Leu Ala Trp Cys Arg Leu Cys Asp Val Asp Leu 65 70 75 80 geg geg geg ege tee acc ggg gtg acc atg gtc gac ett teg ctg ccg 288 Ala Ala Ala Arg Ser Thr Gly Val Thr Met Val Asp Leu Ser Leu Pro 85 90 95 gtc tee gac ctg atg ctg cac cac Aag etc aat ege gat ege gac tgg 336 Val Ser Asp Leu Met Leu His His Lys Leu Asn Arg Asp Arg Asp Trp 100 105 110 gcc ttg ege gaa gtg gcc agg ctg gtc ggc gaa geg ege atg gcc ggg 384

Ala Leu Arg Glu Val Ala Arg Leu Val Gly Glu Ala Arg Met Ala Gly 115 120 125 etc gag gtg tgc ctg ggc tgc gag gac gcc teg egg geg gat ctg gag 432 Leu Glu Val Cys Leu Gly Cys Glu Asp Ala Ser Arg Ala Asp Leu Glu 130 135 140 ttc gtc gtg cag gtg ggc gaa gtg geg cag gcc gcc ggc gcc cgt egg 480

Phe Val Val Gin Val Gly Glu Val Ala Gin Ala Ala Gly Ala Arg Arg 145 150 155 160 ctg ege ttc gcc gac acc gtc ggg gtc atg gag ccc ttc ggc atg etc 528 Leu Arg Phe Ala Asp Thr Val Gly Val Met Glu Pro Phe Gly Met Leu 165 170 175 gac ege ttc cgt ttc etc age egg ege ctg gac atg gag ctg gaa gtg 576 Asp Arg Phe Arg Phe Leu Ser Arg Arg Leu Asp Met Glu Leu Glu Val 180 185 190 cac gcc cac gat gat ttc ggg ctg Gcc aeg gcc aac acc ctg gcc geg 624 1 201217536

His Ala His Asp Asp Phe Gly Leu Ala Thr Ala Asn Thr Leu Ala Ala 195 200 205 gtg atg ggc ggg gcg act cat ate aac acc aeg gtc aac ggg etc ggc 672

Val Met Gly Gly Ala Thr His lie Asn Thr Thr Val Asn Gly Leu Gly 210 215 220 gag cgt gcc ggc aac gcc gcg ctg gaa gag tgc gtg ctg gcg etc aag 720

Glu Arg Ala Gly Asn Ala Ala Leu Glu Glu Cys Val Leu Ala Leu Lys 225 230 235 240 aac etc cac ggt ate gac acc ggt ate gat acc ege ggc ate ccg gcc 768

Asn Leu His Gly lie Asp Thr Gly lie Asp Thr Arg Gly lie Pro Ala 245 250 255 ate tee gcg ctg gtc gag egg gcc teg ggg ege cag gtg gcc tgg cag 816 lie Ser Ala Leu Val Glu Arg Ala Ser Gly Arg Gin Val Ala Trp Gin 260 265 270 aag age gtg gtc ggc gcc ggg gtg ttc act cac gag gcc ggt ate cac 864

Lys Ser Val Val Gly Ala Gly Val Phe Thr His Glu Ala Gly lie His 275 280 285 gtc gac gga ctg etc aag cat egg ege aac tac gag ggg ctg aat ccc 912

Val Asp Gly Leu Leu Lys His Arg Arg Asn Tyr Glu Gly Leu Asn Pro 290 295 300 gac gaa etc ggt ege age cac agt ctg gtg ctg ggc aag cat tee ggg 960

Asp Glu Leu Gly Arg Ser His Ser Leu Val Leu Gly Lys His Ser Gly 305 310 315 320 gcg cac atg gtg ege aac aeg tac ege gat ctg ggt ate gag ctg gcg 1008

Ala His Met Val Arg Asn Thr Tyr Arg Asp Leu Gly lie Glu Leu Ala 325 330 335 gac tgg cag age caa gcg ctg etc ggc ege ate cgt gcc ttc tee acc 1056

Asp Trp Gin Ser Gin Ala Leu Leu Gly Arg lie Arg Ala Phe Ser Thr 340 345 350 agg acc aag ege age ccg cag cct gcc gag ctg cag gat ttc tat egg 1104

Arg Thr Lys Arg Ser Pro Gin Pro Ala Glu Leu Gin Asp Phe Tyr Arg 355 360 365 cag ttg tgc gag caa ggc aat ccc gaa ctg gcc gca gga gga atg gca 1152 Gin Leu Cys Glu Gin Gly Asn Pro Glu Leu Ala Ala Gly Gly Met Ala 370 375 380 tga 1155 <210> 2 <211> 384 <212> PRT <213> Azotobacter vinelandii <400> 2

Met Ala Ser Val Me lie Asp Asp Thr Thr Leu Arg Asp Gly Glu Gin 15 10 15

Ser Ala Gly Val Ala Phe Asn Ala Asp Glu Lys Me Ala lie Ala Arg 20 25 30

Ala Leu Ala Glu Leu Gly Val Pro Glu Leu Glu lie Gly lie Pro Ser 35 40 45

Met Gly Glu Glu Glu Arg Glu Val Met His Ala lie Ala Gly Leu Gly 50 55 60

Leu Ser Ser Arg Leu Leu Ala Trp Cys Arg Leu Cys Asp Val Asp Leu 65 70 75 80 2 201217536

Ala Ala Ala Arg Ser Thr Gly Val Thr Met Val Asp Leu Ser Leu Pro 85 90 95

Val Ser Asp Leu Met Leu His His Lys Leu Asn Arg Asp Arg Asp Trp 100 105 110

Ala Leu Arg Glu Val Ala Arg Leu Val Gly Glu Ala Arg Met Ala Gly 115 120 125

Leu Glu Val Cys Leu Gly Cys Glu Asp Ala Ser Arg Ala Asp Leu Glu 130 135 140

Phe Val Val Gin Val Gly Glu Val Ala Gin Ala Ala Gly Ala Arg Arg 145 150 155 160

Leu Arg Phe Ala Asp Thr Val Gly Val Met Glu Pro Phe Gly Met Leu 165 170 175

Asp Arg Phe Arg Phe Leu Ser Arg Arg Leu Asp Met Glu Leu Glu Val 180 185 190

His Ala His Asp Asp Phe Gly Leu Ala Thr Ala Asn Thr Leu Ala Ala 195 200 205

Val Met Gly Gly Ala Thr His lie Asn Thr Thr Val Asn Gly Leu Gly 210 215 220

Glu Arg Ala Gly Asn Ala Ala Leu Glu Glu Cys Val Leu Ala Leu Lys 225 230 235 240

Asn Leu His Gly Me Asp Thr Gly lie Asp Thr Arg Gly lie Pro Ala 245 250 255 lie Ser Ala Leu Val Glu Arg Ala Ser Gly Arg Gin Val Ala Trp Gin 260 265 270

Lys Ser Val Val Gly Ala Gly Val Phe Thr His Glu Ala Gly lie His 275 280 285

Val Asp Gly Leu Leu Lys His Arg Arg Asn Tyr Glu Gly Leu Asn Pro 290 295 300

Asp Glu Leu Gly Arg Ser His Ser Leu Val Leu Gly Lys His Ser Gly 305 310 315 320

Ala His Met Val Arg Asn Thr Tyr Arg Asp Leu Gly lie Glu Leu Ala 325 330 335

Asp Trp Gin Ser Gin Ala Leu Leu Gly Arg lie Arg Ala Phe Ser Thr 340 345 350

Arg Thr Lys Arg Ser Pro Gin Pro Ala Glu Leu Gin Asp Phe Tyr Arg 355 360 365

Gin Leu Cys Glu Gin Gly Asn Pro Glu Leu Ala Ala Gly Gly Met Ala 3 201217536 370 375 380 <210> 3 <211> 1644

<212> DNA <213> Lactococcus lactis <220><221> CDS <222> (1)..(1644) <400> 3 _atg tat aca gta gga Gat tac ctg tta gac cga tta cac gag ttg gga 48

Met Tvr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly 1 5 10 15 att gaa gaa att ttt gga gtt cct ggt gac tat aac tta caa ttt tta 96 lie Glu Glu lie Phe Gly Val Pro Gly Asp Tyr Asn Leu Gin Phe Leu 20 25 30 gat caa att att tea ege gaa gat atg aaa tgg att gga aat get aat 144 Asp Gin lie lie Ser Arg Glu Asp Met Lys Trp lie Gly Asn Ala Asn 35 40 45 gaa tta aat get tet tat atg get Gat ggt tat get cgt act aaa aaa 192 Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys 50 55 60 get gcc gca ttt etc acc aca ttt gga gtc ggc gaa ttg agt geg ate 240 Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala lie 65 70 75 80 aat gga ctg gca gga agt tat gcc gaa aat tta cca gta gta gaa att 288 Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu lie 85 90 95 gtt ggt tea cca act tea aaa gta caa aat gac gga aaa ttt gtc cat 336

Val Gly Ser Pro Thr Ser Lys Val Gin Asn Asp Gly Lys Phe Val His 100 105 110 cat aca eta gca gat ggt gat ttt aaa cac ttt atg ag atg cat gaa 384 His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu 115 120 125 cct gtt aca gca geg egg act tta ctg aca gca gaa aat gcc aca tat 432 Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Tyr 130 135 140 gaa att gac cga gta ett tet caa tta Eta aaa gaa aga aaa cca gtc 480 Glu lie Asp Arg Val Leu Ser Gin Leu Leu Lys Glu Arg Lys Pro Val 145 150 155 160 tat att aac tta cca gtc gat gtt get gca gca aaa gca gag aag cct 528 Tyr lie Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro 165 170 175 gca tta tet tta gaa aaa gaa age tet aca aca aat aca act gaa caa 576 Ala Leu Ser Leu Glu Lys Glu Ser Ser Thr Thr Asn Thr Thr Glu Gin 180 185 190 Gtg att ttg agt aag att gaa gaa agt ttg aaa aat gcc caa aaa cca 624 Val lie Leu Ser Lys lie Glu Glu Ser Leu Lys Asn Ala Gin Lys Pro 195 200 205 gta gtg att gca gga cac gaa gta att agt ttt ggt tta gaaAaa aeg 672 Val Val Me Ala Gly His Glu Val lie Ser Phe Gly Leu Glu Lys Thr 210 215 220 gta act cag ttt gtt tea gaa aca aaa eta ccg att aeg aca eta aat 720 Val Thr Gin Phe Val Ser Glu Thr Lys Leu Pro Lie Thr Thr Leu Asn 225 230 235 240 ttt ggt aaa agt get gtt gat gaa tet ttg ccc tea ttt tta gga ata 768 4 201217536

Phe Gly Lys Ser Ala Val Asp Glu Ser Leu Pro Ser Phe Leu Gly lie 245 250 255 tat aac ggg aaa ctt tea gaa ate agt ett aaa aat ttt gtg gag tcc 816 Tyr Asn Gly Lys Leu Ser Glu lie Ser Leu Lys Asn Phe Val Glu Ser 260 265 270 gca gac ttt ate eta atg ctt gga gtg aag ctt aeg gac tcc tea aca 864 Ala Asp Phe lie Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr 275 280 285 ggt gca ttc aca cat cat tta gat gaa Aat aaa atg att tea eta aac 912

Gly Ala Phe Thr His His Leu Asp Glu Asn Lys Met lie Ser Leu Asn 290 295 300 ata gat gaa gga ata att ttc aat aaa gtg gta gaa gat ttt gat ttt 960 lie Asp Glu Gly He lie Phe Asn Lys Val Val Glu Asp Phe Asp Phe 305 310 315 320 aga gca gtg gtt tet tet tta tea gaa tta aaa gga ata gaa tat gaa 1008 Arg Ala Val Val Ser Ser Leu Ser Glu Leu Lys Gly lie Glu Tyr Glu 325 330 335 gga caa tat att gat aag caa tat Gaa gaa ttt att cca tea agt get 1056 Gly Gin Tyr lie Asp Lys Gin Tyr Glu Glu Phe Me Pro Ser Ser Ala 340 345 350 ccc tta tea caa gac cgt eta tgg cag gca gtt gaa agt ttg act caa 1104 Pro Leu Ser Gin Asp Arg Leu Trp Gin Ala Val Glu Ser Leu Thr Gin * 355 360 365 age aat gaa aca ate gtt get gaa caa gga acc tea ttt ttt gga get 1152 • Ser Asn Glu Thr lie Val Ala Glu Gin Gly Thr Ser Phe Phe Gly Ala 370 375 380 tea aca att ttc tta aaa tea aat agt cgt ttt att gga caa cct tta 1200 Ser Thr lie Phe Leu Lys Ser Asn Ser Arg Phe lie Gly Gin Pro Leu 385 390 395 400 tgg ggt tet att gga tat act ttt cca geg get Tt gga age caa att 1248 Trp Gly Ser lie Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gin lie 405 410 415 geg gat aaa gag age aga cac ctt tta ttt att ggt gat ggt tea ctt 1296 Ala Asp Lys Glu Ser Arg His Leu Leu Phe lie Gly Asp Gly Ser Leu 420 425 430 caa ctt acc gta caa gaa tta gga eta tea ate aga gaa aaa etc aat 1344 Gin Leu Thr Val Gin Glu Leu Gly Leu Ser lie Arg Glu Lys Leu Asn 435 440 445 cca att tgt Ttt ate ata aat aat gat ggt tat aca gtt gaa aga gaa 1392 Pro He Cys Phe lie lie Asn Asn Asp Gly Tyr Thr Val Glu Arg Glu 450 455 460 ate cac gga cct act caa agt tat aac gac att cca atg tgg aat tac 1440 Lie His Gly Pro Thr Gin Ser Tyr Asn Asp lie Pro Met Trp Asn Tyr 465 470 475 480 teg aaa tta cca gaa aca ttt gga gca aca gaa gat cgt gta gta tea 1488 Ser Lys Leu Pro Glu Thr Phe Gly Ala Thr Glu Asp Arg Val Val Ser 485 490 495 aaa att gtt aga aca gag aat gaa ttt gtg tet gtc atg aaa gaa gcc 1536 Lys lie Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala 500 505 510 caa gca gat gtc aat aga a Tg tat tgg ata gaa eta gtt ttg gaa aaa 1584 Gin Ala Asp Val Asn Arg Met Tyr Trp lie Glu Leu Val Leu Glu Lys 515 520 525 gaa gat geg cca aaa tta ctg aaa aaa atg ggt aaa tta ttt get gag 1632 Glu Asp Ala Pro Lys Leu Leu Lys Lys Met Gly Lys Leu Phe Ala Glu 530 535 540 5 201217536 1644 caa aat aaa tag Gin Asn Lys 545 <210> 4 <211> 547

<212> PRT <213> Lactococcus lactis <400> 4

Met Tvr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly 1 5 10 15 lie Glu Glu lie Phe Gly Val Pro Gly Asp Tyr Asn Leu Gin Phe Leu 20 25 30

Asp Gin lie lie Ser Arg Glu Asp Met Lys Trp lie Gly Asn Ala Asn 35 40 45

Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys 50 55 60

Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala lie 65 70 75 80

Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu lie 85 90 95

Val Gly Ser Pro Thr Ser Lys Val Gin Asn Asp Gly Lys Phe Val His 100 105 110

His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu 115 120 125

Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Tyr 130 135 140

Glu lie Asp Arg Val Leu Ser Gin Leu Leu Lys Glu Arg Lys Pro Val 145 150 155 160

Tyr He Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro 165 170 175

Ala Leu Ser Leu Glu Lys Glu Ser Ser Thr Thr Asn Thr Thr Glu Gin 180 185 190

Val Me Leu Ser Lys lie Glu Glu Ser Leu Lys Asn Ala Gin Lys Pro 195 200 205

Val Val lie Ala Gly His Glu Val lie Ser Phe Gly Leu Glu Lys Thr 210 215 220

Val Thr Gin Phe Val Ser Glu Thr Lys Leu Pro lie Thr Thr Leu Asn 225 230 235 240

Phe Gly Lys Ser Ala Val Asp Glu Ser Leu Pro Ser Phe Leu Gly lie 245 250 255 6 201217536

Tyr Asn Gly Lys Leu Ser Glu lie Ser Leu Lys Asn Phe Val Glu Ser 260 265 270

Ala Asp Phe lie Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr 275 280 285

Gly Ala Phe Thr His His Leu Asp Glu Asn Lys Met lie Ser Leu Asn 290 295 300

Me Asp Glu. Gly lie lie Phe Asn Lys Val Val Glu Asp Phe Asp Phe 305 310 315 320

Arg Ala Val Val Ser Ser Leu Ser Glu Leu Lys Gly lie Glu Tyr Glu 325 330 335

Gly Gin Tyr lie Asp Lys Gin Tyr Glu Glu Phe lie Pro Ser Ser Ala 340 345 350

Pro Leu Ser Gin Asp Arg Leu Trp Gin Ala Val Glu Ser Leu Thr Gin 355 360 365

Ser Asn Glu Thr lie Val Ala Glu Gin Gly Thr Ser Phe Phe Gly Ala 370 375 380

Ser Thr lie Phe Leu Lys Ser Asn Ser Arg Phe lie Gly Gin Pro Leu 385 390 395 400

Trp Gly Ser lie Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gin lie 405 410 415

Ala Asp Lys Glu Ser Arg His Leu Leu Phe lie Gly Asp Gly Ser Leu 420 425 430

Gin Leu Thr Val Gin Glu Leu Gly Leu Ser lie Arg Glu Lys Leu Asn 435 440 445

Pro lie Cys Phe lie lie Asn Asn Asp Gly Tyr Thr Val Glu Arg Glu 450 455 460 lie His Gly Pro Thr Gin Ser Tyr Asn Asp lie Pro Met Trp Asn Tyr 465 470 475 480

Ser Lys Leu Pro Glu Thr Phe Gly Ala Thr Glu Asp Arg Val Val Ser 485 490 495

Lys lie Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala 500 505 510

Gin Ala Asp Val Asn Arg Met Tyr Trp lie Glu Leu Val Leu Glu Lys 515 520 525

Glu Asp Ala Pro Lys Leu Leu Lys Lys Met Gly Lys Leu Phe Ala Glu 530 535 540

Gin Asn Lys 545 7 201217536 <210> 5 <211> 1644 <212> DNA <213> Synthetic <220><223> Lactococcus lactis branched chain α-keto acid decarboxylase KdcA codon-optimized gene < 400 > 5 atgtatactg ttggtgatta tctgctggac cgtctgcatg aactgggcat tgaagaaatc 60 ttcggtgtcc caggcgacta caacctgcag ttcctggacc agatcatctc ccgcgaagat 120 atgaaatgga tcggtaacgc aaacgagctg aacgcgtctt atatggctga tggttatgct 180 cgcaccaaaa aggctgcggc ctttctgacc acctttggtg tgggcgagct gagcgcgatc 240 aacggcctgg caggttccta cgctgagaac ctgccggtag tagaaatcgt tggttccccg 300 acctctaagg ttcagaacga cggcaaattc gtacatcaca ccctggcgga cggcgatttt 360 aagcacttta tgaaaatgca cgaaccggtc accgccgctc gcactctgct gaccgcggaa 420 aacgcaacgt acgagatcga tcgtgtactg tcccagctgc tgaaagaacg taaaccggtg 480 tatatcaatc tgccggttga tgtcgctgcg gccaaagcag agaaaccggc actgtccctg 540 gagaaggaga gctccactac taacaccacc gaacaggtta tcctgtccaa aattgaagaa 600 tctctgaaaa acgcacagaa accggtggtt atcgcaggtc acgaggttat ctccttcg gc 660 ctggagaaaa ctgttactca attcgtctct gaaacgaaac tgccgatcac gaccctgaac 720 tttggcaagt ccgcagttga cgaatctctg ccttctttcc tgggcattta caacggcaaa 780 ctgtccgaga tctccctgaa acgaagagtt tattccgtct tctgcaccgc gaacttcgta gaatccgctg actttatcct gatgctgggt 840 gtgaaactga ccgactcctc taccggtgcg ttcacgcacc atctggatga aaacaaaatg 900 atcagcctga acatcgacga gggtatcatc ttcaacaagg tagttgaaga tttcgacttc 960 cgtgctgttg tcagcagcct gtccgagctg aaaggcattg agtacgaggg tcaatacatc 1020 gataaacagt tgagccagga ccgcctgtgg 1080 caggcagttg agtccctgac gcagtccaac gaaactatcg tagcggaaca aggtacctct 1140 ttcttcggtg cttctaccat ctttctgaag tccaactctc gctttatcgg tcagccgctg 1200 tggggttcta tcggttacac gttcccggct gcgctgggta gccagatcgc tgataaagag 1260 tctcgtcatc tgctgttcat cggtgatggt tccctgcagc tgactgtaca ggaactgggt 1320 ctgtctatcc gtgaaaaact gaacccgatt tgttttatca tcaataacga tggctacact 1380 gttgagcgtg aaattcatgg tccgactcag tcttacaacg atattccgat gtggaactac 1440 tctaaactgc cggaaacctt cggtgcaact gaggatcgcg tcgtgagcaa gattgtgcgt 1500 Actg Agaacg agttcgtatc tgttatgaaa gaggcgcagg cagatgtgaa ccgcatgtac 1560 tggatcgaac tggttctgga aaaagaggat gcaccgaaac tgctgaagaa aatgggtaaa 1620 ctgtttgcgg agcagaacaa gtaa 1644 <210> 6 <211> 1362

<212> DNA <213> Vibrio fluvialis 8 201217536 <220><221> CDS <222> (1)..(1362) <400> 6 atg aac aaa ccg caa Age tgg gaa gee egg gee gag acc tat teg etc 48

Met Asn Lys Pro Gin Ser Trp Glu Ala Arg Ala Glu Thr Tyr Ser Leu 15 10 15 tat ggt ttc acc gac atg cct teg ctg cat cag ege ggc aeg gtc gtc 96

Tyr Gly Phe Thr Asp Met Pro Ser Leu His Gin Arg Gly Thr Val Val 20 25 30 gtg acc cat ggc gag gga ccc tat ate gtc gat gtg aat ggc egg cgt 144

Val Thr His Gly Glu Gly Pro Tyr lie Val Asp Val Asn Gly Arg Arg 35 40 45 tat ctg gac gee aac teg ggc ctg tgg aac atg gtc geg ggc ttt gac 192

Tyr Leu Asp Ala Asn Ser Gly Leu Trp Asn Met Val Ala Gly Phe Asp 50 55 60 cac aag ggg ctg ate gac gee gee aag gee caa tac gag cgt ttt ccc 240 His Lys Gly Leu lie Asp Ala Ala Lys Ala Gin Tyr Glu Arg Phe Pro 65 70 75 80 ggt tat cac gee ttt ttc ggc ege atg tee gat cag aeg gta atg ctg 288 Gly Tyr His Ala Phe Phe Gly Arg Met Ser Asp Gin Thr Val Met Leu 85 90 95 • teg gaa aag ctg gtc gag gtg Teg ccc ttt gat teg ggc egg gtg ttc 336 Ser Glu Lys Leu Val Glu Val Ser Pro Phe Asp Ser Gly Arg Val Phe 100 105 110 * tat aca aac teg ggg tee gag geg aat gac acc atg gtc aag atg eta 384 Tyr Thr Asn Ser Gly Ser Glu Ala Asn Asp Thr Met Val Lys Met Leu 115 120 125 tgg ttc ctg cat gca gee gag ggc aaa ccg caa aag ege aag ate ctg 432

Trp Phe Leu His Ala Ala Glu Gly Lys Pro Gin Lys Arg Lys lie Leu 130 135 140 acc ege tgg aac gee tat cac ggc gtg acc gee gtt teg gee age atg 480

Thr Arg Trp Asn Ala Tyr His Gly Val Thr Ala Val Ser Ala Ser Met 145 150 155 160 acc ggc aag ccc tat aat teg gtc ttt ggc ctg ccg ctg ccg ggc ttt 528 Thr Gly Lys Pro Tyr Asn Ser Val Phe Gly Leu Pro Leu Pro Gly Phe 165 170 175 gtg cat ctg acc tgc ccg cat tac tgg ege tat ggc gaa gag ggc gaa 576 Val His Leu Thr Cys Pro His Tyr Trp Arg Tyr Gly Glu Glu Gly Glu 180 185 190 acc gaa gag cag ttc gtc gee ege Etc gege ege gag ctg gag gaa aeg 624 Thr Glu Glu Gin Phe Val Ala Arg Leu Ala Arg Glu Leu Glu Glu Thr 195 200 205 ate cag ege gag ggc gee gac acc ate gee ggt ttc ttt gee gaa ccg 672 lie Gin Arg Glu Gly Ala Asp Thr lie Ala Gly Phe Phe Ala Glu Pro 210 215 220 gtg atg ggc geg ggc ggc gtg att ccc ccg gee aag ggc tat ttc cag 720

Val Met Gly Ala Gly Gly Val lie Pro Pro Ala Lys Gly Tyr Phe Gin 225 230 235 240 geg ate ctg cca ate ctg ege aaa tat gac ate ccg gtc ate teg gac 768

Ala lie Leu Pro lie Leu Arg Lys Tyr Asp lie Pro Val lie Ser Asp 245 250 255 gag gtg ate tgc ggt ttc gga ege acc ggt aac acc tgg ggc tgc gtg 816 Glu Val lie Cys Gly Phe Gly Arg Thr Gly Asn Thr Trp Gly Cys Val 260 265 270 acc tat gac ttt aca ccc gat gca ate ate teg tee aag aat ett aca 864 Thr Tyr Asp Phe Thr Pro Asp Ala lie lie Ser Ser Lys Asn Leu Thr 9 201217536 275 280 285 gcg ggc ttt ttc ccc atg ggg Gcg gtg ate ett ggc ccg gaa ett tee 912

Ala Gly Phe Phe Pro Met Gly Ala Val lie Leu Gly Pro Glu Leu Ser 290 295 300 aaa egg ctg gaa acc gca ate gag gcg ate gag gaa ttc ccc cat ggc 960

Lys Arg Leu Glu Thr Ala lie Glu Ala lie Glu Glu Phe Pro His Gly 305 310 315 320 ttt acc gee teg ggc cat ccg gtc ggc tgt get att gcg ctg aaa gca 1008 Phe Thr Ala Ser Gly His Pro Val Gly Cys Ala lie Ala Leu Lys Ala 325 330 335 ate gac gtg gtg atg aat gaa ggg ctg get gag aac gtc ege ege ett 1056 lie Asp Val Val Met Asn Glu Gly Leu Ala Glu Asn Val Arg Arg Leu 340 345 350 gee ccc cgt ttc gag gaa agg ctg Aaa cat ate gee gag ege ccg aac 1104 Ala Pro Arg Phe Glu Glu Arg Leu Lys His lie Ala Glu Arg Pro Asn 355 360 365 ate ggt gaa tat ege ggc ate ggc ttc atg tgg gcg ctg gag get gtc 1152 lie Gly Glu Tyr Arg Gly lie Gly Phe Met Trp Ala Leu Glu Ala Val 370 375 380 aag gac aag gca age aag aeg ccg ttc gac ggc aac ctg teg gtc age 1200 Lys Asp Lys Ala Ser Lys Thr Pro Phe Asp Gly Asn Leu Ser Val Ser 385 390 395 400 gag cgt ate gee aat acc tgc acc gat ctg ggg ctg att tgc egg ccg 1248 Glu Arg lie Ala Asn Thr Cys Thr Asp Leu Gly Leu Me Cys Arg Pro 405 410 415 ett ggt cag tee gtc gtc ett tgt ccg ccc ttt ate Ctg acc gag gcg 1296 Leu Gly Gin Ser Val Val Leu Cys Pro Pro Phe lie Leu Thr Glu Ala 420 425 430 cag atg gat gag atg ttc gat aaa etc gaa aaa gee ett gat aag gtc 1344 Gin Met Asp Glu Met Phe Asp Lys Leu Glu Lys Ala Leu Asp Lys Val 435 440 445 ttt gee gag gtt gee tga 1362

Phe Ala Glu Val Ala 450 <210> 7 <211> 453

<212> PRT <213> Vibrio fluvialis <400> 7

Met Asn Lys Pro Gin Ser Trp Glu Ala Arg Ala Glu Thr Tyr Ser Leu 15 10 15

Tyr Gly Phe Thr Asp Met Pro Ser Leu His Gin Arg Gly Thr Val Val 20 25 30

Val Thr His Gly Glu Gly Pro Tyr Me Val Asp Val Asn Gly Arg Arg 35 40 45

Tyr Leu Asp Ala Asn Ser Gly Leu Trp Asn Met Val Ala Gly Phe Asp 50 55 60

His Lys Gly Leu lie Asp Ala Ala Lys Ala Gin Tyr Glu Arg Phe Pro 65 70 75 80

Gly Tyr His Ala Phe Phe Gly Arg Met Ser Asp Gin Thr Val Met Leu 10 201217536 85 90 95

Ser Glu Lys Leu Val Glu Val Ser Pro Phe Asp Ser Gly Arg Val Phe 100 105 110

Tyr Thr Asn Ser Gly Ser Glu Ala Asn Asp Thr Met Val Lys Met Leu 115 120 125

Trp Phe Leu His Ala Ala Glu Gly Lys Pro Gin Lys Arg Lys lie Leu 130 135 140

Thr Arg Trp Asn Ala Tyr His Gly Val Thr Ala Val Ser Ala Ser Met 145 150 155 160

Thr Gly Lys Pro Tyr Asn Ser Val Phe Gly Leu Pro Leu Pro Gly Phe 165 170 175

Val His Leu Thr Cys Pro His Tyr Trp Arg Tyr Gly Glu Glu Gly Glu 180 185 190

Thr Glu Glu Gin Phe Val Ala Arg Leu Ala Arg Glu Leu Glu Glu Thr 195 200 205 lie Gin Arg Glu Gly Ala Asp Thr lie Ala Gly Phe Phe Ala Glu Pro 210 215 220

Val Met Gly Ala Gly Gly Val Me Pro Pro Ala Lys Gly Tyr Phe Gin 225 230 235 240

Ala lie Leu Pro lie Leu Arg Lys Tyr Asp lie Pro Val lie Ser Asp 245 250 255

Glu Val lie Cys Gly Phe Gly Arg Thr Gly Asn Thr Trp Gly Cys Val 260 265 270

Thr Tyr Asp Phe Thr Pro Asp Ala lie lie Ser Ser Lys Asn Leu Thr 275 280 285

Ala Gly Phe Phe Pro Met Gly Ala Val lie Leu Gly Pro Glu Leu Ser 290 295 300

Lys Arg Leu Glu Thr Ala lie Glu Ala lie Glu Glu Phe Pro His Gly 305 310 315 320

Phe Thr Ala Ser Gly His Pro Val Gly Cys Ala lie Ala Leu Lys Ala 325 330 335 lie Asp Val Val Met Asn Glu Gly Leu Ala Glu Asn Val Arg Arg Leu 340 345 350

Ala Pro Arg Phe Glu Glu Arg Leu Lys His lie Ala Glu Arg Pro Asn 355 360 365 lie Gly Glu Tyr Arg GJy lie Gly Phe Met Trp Ala Leu Glu Ala Val 370 375 380 11 201217536

Lys Asp Lys Ala Ser Lys Thr Pro Phe Asp Gly Asn Leu Ser Val Ser 385 390 395 400

Glu Arg lie Ala Asn Thr Cys Thr Asp Leu Gly Leu lie Cys Arg Pro 405 410 415

Leu Gly Gin Ser Val Val Leu Cys Pro Pro Phe Me Leu Thr Glu Ala 420 425 430

Gin Met Asp Glu Met Phe Asp Lys Leu Glu Lys Ala Leu Asp Lys Val 435 440 445

Phe Ala Glu Val Ala 450 <210> 8 <211> 1362 <212> DNA <213> Synthetic <220><223> Vibrio fluvialis JS17 ω-aminotransferase codon-optimized gene < 400 > 8 atgaataaac cacagtcttg ggaagctcgt gctgaaacct atagcctgta cggctttacc 60 gatatgccgt ctctgcacca gcgtggtact gtagtggtaa cgcacggtga gggcccgtac 120 atcgtggacg ttaatggccg ccgttacctg gatgcaaaca gcggcctgtg gaacatggtt 180 gcgggcttcg accacaaagg cctgatcgat gccgcaaaag cgcagtacga acgcttcccg 240 ggttatcacg cgttctttgg ccgtatgagc gaccagactg tgatgctgag cgaaaaactg 300 gttgaagtgt ccccgttcga tagcggtcgt gtcttttaca ctaactctgg cagcgaggct 360 aacgatacca tggttaagat gctgtggttc ctgcacgcag cggaaggcaa acctcagaaa 420 cgtaaaattc tgacccgttg gaacgcttat cacggtgtga ctgctgtttc cgcatctatg 480 accggtaaac cgtataacag cgtgttcggt ctgccgctgc ctggcttcgt gcatctgacc 540 tgcccgcact actggcgtta tggtgaggaa ggcgaaactg aggaacagtt cgtggcgcgt 600 ctggctcgtg aactggaaga aaccattcaa cgcgaaggtg cagatactat cgcgggcttc 660 tttgcggagc ctgtt atggg tgccggcggt gtgattccgc cggcgaaggg ctatttccag 720 gcaatcctgc cgatcctgcg caagtacgac attccggtta tttctgacga agtgatctgc 780 ggcttcggcc gcaccggtaa cacctggggc tgcgtgacgt atgacttcac tccggacgca 840 atcattagct ctaaaaacct gactgcgggt ttcttcccta tgggcgccgt aatcctgggc 900 ccagaactgt ctaagcgcct ggaaaccgcc atcgaggcaa tcgaagagtt cccgcacggt 960 ttcactgcta gcggccatcc ggtaggctgc gcaatcgcgc tgaaggcgat cgatgttgtc 1020 atgaacgagg gcctggcgga aaacgtgcgc cgcctggcgc cgcgttttga agaacgtctg 1080 aaacacattg ctgagcgccc gaacattggc gaatatcgcg gcatcggttt catgtgggcc 1140 ctggaagcag ttaaagataa agctagcaag accccgttcg acggcaacct gtccgtgagc 1200 gaacgtatcg ctaatacctg tacggacctg ggtctgatct gccgtccgct gggtcagtcc 1260 gtagttctgt gcccaccatt tatcctgacc gaagcgcaga tggatgaaat gttcgataaa 1320 ctggagaaag ctctggataa agtgttcgct gaagtcgcgt aa 1362 12 201217536 < 210 > 9

<211> 1212 <212> DNA <213> Methanospirillum hungatei <220>

<221> CDS <222> (1)..(1212) <400> 9 atg gtt act ctg tct gag aag ate ctg ggt gca ccg gca ggc act tac 48

Met Val Thr Leu Ser Glu Lys Me Leu Gly Ala Pro Ala Gly Thr Tyr 15 10 15 ate gac cgt cac ate gac ege gca ttc tgc cac gac ggt act ggt att 96 lie Asp Arg His Me Asp Arg Ala Phe Cys His Asp Gly Thr Gly lie 20 25 30 cag geg aag ate ate tac gac geg atg ggc gca ccg ggt ate get aac 144 Gin Ala Lys lie lie Tyr Asp Ala Met Gly Ala Pro Gly lie Ala Asn 35 40 45 ccg gac tee gtt tac ate ate tac gac Cac att get ccg get aac aac 192

Pro Asp Ser Val Tyr lie lie Tyr Asp His lie Ala Pro Ala Asn Asn 50 55 60 tct cag act gca gaa ctg cag get gaa ctg cgt act ctg geg cgt gaa 240 Ser Gin Thr Ala Glu Leu Gin Ala Glu Leu Arg Thr Leu Ala Arg Glu 65 70 75 80 tgc ggt gtt cac ttc tgg gat ate ggt tct ggt ate tgc cac cag gta 288 Cys Gly Val His Phe Trp Asp lie Gly Ser Gly lie Cys His Gin Val 85 90 95 atg get gaa ggt cag gtt get ccg Ggt gaa gtt gtt ate ggt get gac 336 Met Ala Glu Gly Gin Val Ala Pro Gly Glu Val Val lie Gly Ala Asp 100 105 110 tct cac tee tgc act ctg ggt geg ctg ggt gca ttc get acc ggt gtt 384 Ser His Ser Cys Thr Leu Gly Ala Leu Gly Ala Phe Ala Thr Gly Val 115 120 125 ggt gca tct gac atg get ggt ate tgg gtt tct ggt gaa acc tgg ctg 432 Gly Ala Ser Asp Met Ala Gly lie Trp Val Ser Gly Glu Thr Trp Leu 130 135 140 Ege gtt ccg gac tee ate ggt ate cac ctg tct ggt tct ctg aag cag 480

Arg Val Pro Asp Ser lie Gly lie His Leu Ser Gly Ser Leu Lys Gin 145 150 155 160 ggc gtt gag tgg aaa gac gtt geg ctg act tac gtt get ege ctg ggt 528 Gly Val Glu Trp Lys Asp Val Ala Leu Thr Tyr Val Ala Arg Leu Gly 165 170 175 atg gac ggt gca act tac get geg ctg gaa ttc ate ggt gaa tee act 576 Met Asp Gly Ala Thr Tyr Ala Ala Leu Glu Phe lie Gly Glu Ser Thr 180 185 190 ccg tct gta ccg atg gaa ggt cgt Ctg act ctg tgc aac atg get gtt 624 Pro Ser Val Pro Met Glu Gly Arg Leu Thr Leu Cys Asn Met Ala Val 195 200 205 gaa gca ggc geg aaa acc ggt ctg ttc tac get gac aaa gaa act gaa 672 Glu Ala Gly Ala Lys Thr Gly Leu Phe Tyr Ala Asp Lys Glu Thr Glu 210 215 220 cgt tac ctg get gaa tac tee gta cca tgc ccg atg caa gtt ctg gaa 720 Arg Tyr Leu Ala Glu Tyr Ser Val Pro Cys Pro Met Gin Val Leu Glu 225 230 235 240 aac cca gac tac gtt cag gac tgc tac ctg gat ctg get gac ate gaa 768 Asn Pro Asp Tyr Val Gin Asp Cys Tyr Leu Asp Leu Ala Asp Me Glu 245 250 255 13 201217536 ccg gtt tgc gca gta ccg cac cgc gtt gac Acc gta cag ccg gtt ccg 816 Pro Val Cys Ala Val Pro His Arg Val Asp Thr Val Gin Pro Val Pro 260 265 270 gca ctg gcg ggt act cac ctg gat cag gtt ttc ate ggt act tgc acc 864 Ala Leu Ala Gly Thr His Leu Asp Gin Val Phe He Gly Thr Cys Thr 275 280 285 aac ggt cgt ttc gaa gat ctg get cgc get gcg cgt ate ctg aaa ggt 912 Asn Gly Arg Phe Glu Asp Leu Ala Arg Ala Ala Arg lie Leu Lys Gly 290 295 300 cgt cgc Gtt aaa gtt cgt act ate gtt gtt ccg gca tet gaa cgt gac 960

Arg Arg Val Lys Val Arg Thr lie Val Val Pro Ala Ser Glu Arg Asp 305 310 315 320 ttc ctg aaa gca ate ctg tet ggt gtt get get gac ctg gta cag get 1008 Phe Leu Lys Ala lie Leu Ser Gly Val Ala Ala Asp Leu Val Gin Ala 325 330 335 ggc tgc acc ate ggt ccg ccg ggt tgc ggt ccg tgc ctg ggt gcg cac 1056 Gly Cys Thr lie Gly Pro Pro Gly Cys Gly Pro Cys Leu Gly Ala His 340 345 350 atg ggc gtt ctg ggt gaa ggt gaa Gtt gcg ctg tet act gca aac cgt 1104 Met Gly Val Leu Gly Glu Gly Glu Val Ala Leu Ser Thr Ala Asn Arg 355 360 365 aac ttc aaa aac cgt atg ggc gta ggt get tet tac tac ctg tgc tet 1152 Asn Phe Lys Asn Arg Met Gly Val Gly Ala Ser Tyr Tyr Leu Cys Ser 370 375 380 ccg tet act get get gca tet get ate tac ggt gaa ate act gac ccg 1200

Pro Ser Thr Ala Ala Ala Ser Ala lie Tyr Gly Glu lie Thr Asp Pro 385 390 395 400 1212 cgt gaa gtc gtt Arg Glu Val Val <210> 10 <211> 404

<212> PRT <213> Methanospirillum hungatei <400> 10

Met Val Thr Leu Ser Glu Lys lie Leu Gly Ala Pro Ala Gly Thr Tyr 15 10 15

Me Asp Arg His lie Asp Arg Ala Phe Cys His Asp Gly Thr Gly lie 20 25 30

Gin Ala Lys lie Me Tyr Asp Ala Met Gly Ala Pro Gly lie Ala Asn 35 40 45

Pro Asp Ser Val Tyr lie lie Tyr Asp His Me Ala Pro Ala Asn Asn 50 55 60

Ser Gin Thr Ala Glu Leu Gin Ala Glu Leu Arg Thr Leu Ala Arg Glu 65 70 75 80

Cys Gly Val His Phe Trp Asp lie Gly Ser Gly lie Cys His Gin Val 85 90 95

Met Ala Glu Gly Gin Val Ala Pro Gly Glu Val Val lie Gly Ala Asp 100 105 110 14 160 201217536

Ser His Ser Cys Thr Leu Gly Ala Leu Gly Ala Phe Ala Thr Gly Val 115 120 125

Gly Ala Ser Asp Met Ala Gly lie Trp Val Ser Gly Glu Thr Trp Leu 130 135 140

Arg Val Pro Asp Ser lie Gly lie His Leu Ser Gly Ser Leu Lys Gin 145 150 155

Gly Val Glu Trp Lys Asp Val Ala Leu Thr Tyr Val Ala Arg Leu Gly 165 170 175

Met Asp Gly Ala Thr Tyr Ala Ala Leu Glu Phe lie Gly Glu Ser Thr 180 185 190

Pro Ser Val Pro Met Glu Gly Arg Leu Thr Leu Cys Asn Met Ala Val 195 200 205

Glu Ala Gly Ala Lys Thr Gly Leu Phe Tyr Ala Asp Lys Glu Thr Glu 210 215 220 240

Arg Tyr Leu Ala Glu Tyr Ser Val Pro Cys Pro Met Gin Val Leu Glu 225 230 235

Asn Pro Asp Tyr Val Gin Asp Cys Tyr Leu Asp Leu Ala Asp lie Glu 245 250 255

Pro Val Cys Ala Val Pro His Arg Val Asp Thr Val Gin Pro Val Pro 260 265 270

Ala Leu Ala Gly Thr His Leu Asp Gin Val Phe lie Gly Thr Cys Thr 275 280 285

Asn Gly Arg Phe Glu Asp Leu Ala Arg Ala Ala Arg Me Leu Lys Gly 290 295 300 320

Arg Arg Val Lys Val Arg Thr lie Val Val Pro Ala Ser Glu Arg Asp 305 310 315

Phe Leu Lys Ala lie Leu Ser Gly Val Ala Ala Asp Leu Vai Gin Ala 325 330 335

Gly Cys Thr Me Gly Pro Pro Gly Cys Gly Pro Cys Leu Gly Ala His 340 345 350

Met Gly Val Leu Gly Glu Gly Glu Val Ala Leu Ser Thr Ala Asn Arg 355 360 365

Asn Phe Lys Asn Arg Met Gly Val Gly Ala Ser Tyr Tyr Leu Cys Ser 370 375 380

Pro Ser Thr Ala Ala Ala Ser Ala lie Tyr Gly Glu lie Thr Asp Pro 385 390 395

Arg Glu Val Val 15 400 201217536 <210> 11 <211> 1215

≪ 212 > DNA < 213 > Heinz Yue burning Spirillum (Methanospirillum hungatei) < 400 > 11 atggtgacat tatcggagaa gattctaggt gccccggccg gcacgtatat tgatcgacat 60 attgaccggg cattctgcca tgacgggacc gggattcagg caaagataat ctatgatgca 120 atgggggctc cgggtattgc aaatccggat tctgtctaca ttatttatga tcatattgct 1 80 ccggcgaaca actcccagac tgcagaactc caggcagagc tccggaccct tgccagagag 240 tgcggggtgc atttctggga tatcggctct ggtatatgtc atcaggtgat ggcagaaggg 300 caggtggcac caggggaggt tgtcatcgga gctgattctc attcatgcac actcggtgct 360 ctcggggcgt ttgcaaccgg cgtcggggca agtgacatgg caggtatctg ggtgtctggt 420 gagacctggc tgagggttcc tgattcaatc ggcattcatc tctccggatc cttaaagcaa 480 ggcgttgagt ggaaggatgt tgcgctgacc tatgtggcac ggctcgggat ggacggagca 540 acctatgcag ccctggagtt cattggtgaa tccactccgt cggttcccat ggaaggacga 600 ctgacattat gcaatatggc ggttgaggcc ggggcaaaga ccgggctctt ttatgcagac 660 aaggagacag agcgatatct cgcagagtat tctgttccct gtccgatgca ggttttggaa 720 aacccggact atgtgcagga ctgctatctt gatctcgcag atattgagcc ggtatgtgcg 780 gttcctcacc gggtggatac tgtccaaccg gttccggccc ttgcaggtac ccatcttgat 840 caggtcttta tcgggacctg tacgaacggc cggtttgaag atctcgcacg tgctgccagg 900 attctgaaag gacgccgggt aaaagtcaga accattgttg ttccggoatc agagcgtgat 960 ttcctcaagg ctattttgtc aggggttgct gctgacctcg tgcaggcagg atgtaccatc 1020 ggaccgcccg gctgtggtcc ctgccttggt gcccatatgg gtgttctggg tgagggtgaa 1080 gtagcccttt caaccgcaaa ccggaacttt aagaaccgga tgggtgtggg ggcttcgtat 1140 tatctctgtt caccctccac tgctgcagca agtgccatat atggtgagat tactgatcca 1200 agggaggttg Tatga 1215 <210> 12 <211> 486

<212> DNA <213> Methanospirillum hungatei <220><221> CDS <222> (1)..(486) <400> 12 atg act gcg ctg aaa ggt Tct ggt ccg get gtt tgc ate ggt gaa gat 48

Met Thr Ala Leu Lys Gly Ser Gly Pro Ala Val Cys lie Gly Glu Asp 15 10 15 ate gac act gac ctg gtt ate get ggt cgt tat ctg cgt act aaa gac 96 lie Asp Thr Asp Leu Val lie Ala Gly Arg Tyr Leu Arg Thr Lys Asp 20 25 30 tgg tct ttc tgg gca cag cac gta ttc gaa gat ctg gac ccg tcc ctg 144 Trp Ser Phe Trp Ala Gin His Val Phe Glu Asp Leu Asp Pro Ser Leu 35 40 45 16 201217536 gca gaa cgt ctg aaa ggc gca Gta ctg gtt get ggt aag aac atg ggc 192

Ala Glu Arg Leu Lys Gly Ala Val Leu Val Ala Gly Lys Asn Met Gly 50 55 60 tgc ggt tet tet ege gaa cag get gca cgt geg ctg cac gaa get ggc 240

Cys Gly Ser Ser Arg Glu Gin Ala Ala Arg Ala Leu His Glu Ala Gly 65 70 75 80 gtt ctg geg gtt ate get ccg tet ttc get cgt ate ttc ttc cgt aac 288

Val Leu Ala Val lie Ala Pro Ser Phe Ala Arg lie Phe Phe Arg Asn 85 90 95 tgc ate aac gtt ggt ctg ccg ctg ctg gaa tgc gac ctg act ggc tgc 336 Cys Me Asn Val Gly Leu Pro Leu Leu Glu Cys Asp Leu Thr Gly Cys 100 105 110 act gac ggt atg ate act ttc gac tgc act gaa ggc tgg gtt gaa 384 Thr Asp Gly Met lie lie Thr Phe Asp Cys Thr Glu Gly Trp Val Glu 115 120 125 gtt gac ggt act ege tac ctg ttc cgt Ccg ctg tet ccg cgt atg cag 432 Val Asp Gly Thr Arg Tyr Leu Phe Arg Pro Leu Ser Pro Arg Met Gin 130 135 140 gaa ate ctg tet acc ggt ggt ctg att gaa tac tgg aag ege cgt aaa 480 Glu lie Leu Ser Thr Gly Gly Leu lie Glu Tyr Trp Lys Arg Arg Lys 145 150 155 160 gag ege 486 Glu Arg <210> 13

<211> 162 <212> PRT <213> Methanospirillum hungatei <400> 13

Met Thr Ala Leu Lys Gly Ser Gly Pro Ala Val Cys lie Gly Glu Asp 15 10 15 lie Asp Thr Asp Leu Val lie Ala Gly Arg Tyr Leu Arg Thr Lys Asp 20 25 30

Trp Ser Phe Trp Ala Gin His Val Phe Glu Asp Leu Asp Pro Ser Leu 35 40 45

Ala Glu Arg Leu Lys Gly Ala Val Leu Val Ala Gly Lys Asn Met Gly 50 55 60

Cys Gly Ser Ser Arg Glu Gin Ala Ala Arg Ala Leu His Glu Ala Gly 65 70 75 80

Val Leu Ala Val He Ala Pro Ser Phe Ala Arg lie Phe Phe Arg Asn 85 90 95

Cys lie Asn Val Gly Leu Pro Leu Leu Glu Cys Asp Leu Thr Gly Cys 100 105 110

Thr Asp Gly Met lie Me Thr Phe Asp Cys Thr Glu Gly Trp Val Glu 115 120 125

Val Asp Gly Thr Arg Tyr Leu Phe Arg Pro Leu Ser Pro Arg Met Gin 130 135 140 17 201217536

Glu lie Leu Ser Thr Gly Gly Leu lie Glu Tyr Trp Lys Arg Arg Lys 145 150 155 160

Glu Arg <210> 14 <211> 489

(Methanospirillum hungatei) Heinz Yue pit end bacteria <; < 212 > DNA < 213 & gt 400 > 14 atgactgctc tcaaaggctc cggccctgca gtctgtatcg gagaggatat cgatacggat 60 ctggtgattg ccggacgata cctgagaaca aaagactgga gtttttgggc acagcatgtg 120 tttgaggatc ttgatccttc tcttgccgaa agactgaaag gagcagtgct tgtcgccgga 180 aagaacatgg gttgcgggtc ttcacgggaa caggcggccc gggctctgca tgaggcagga 240 gttcttgctg tcatcgcccc ttcgtttgcc agaatttttt tccggaactg catcaatgtc 300 gggcttccgt tactggaatg tgatctgacc ggatgcaccg atggcatgat catcactttt 360 gattgcactg aagggtgggt ggaggtggat gggacgcggt atctcttccg gcccctctct 420 ccacggatgc aggagattct cagcaccggc ggtctgattg agtactggaa acggagaaaa 480 gagcgatga 489 < 210 > 15 < 211 > 987

<212> DNA <213> Methanospirillum hungatei <220><221> CDS <222> (1)..(987) <400> 15 atg aag cgc gtt gtt gtt Get ccg ggc gac ggt ate ggt ccg gaa gtt 48

Met Lys Arg Val Val Val Ala Pro Gly Asp Gly lie Gly Pro Glu Val 15 10 15 ate ccg tet gca ctg gaa gtt ctg cgc ttc ttc cac ccg gaa tgg gaa 96

He Pro Ser Ala Leu Glu Val Leu Arg Phe Phe His Pro Glu Trp Glu 20 25 30 tac ate ccg gtt tac ctg ggt tac gaa tgc tgg aaa cgt act ggc gac 144 Tyr lie Pro Val Tyr Leu Gly Tyr Glu Cys Trp Lys Arg Thr Gly Asp 35 40 45 gca ctg tet cag cgt act ctg gaa act ctg aag aaa get gac ctg ate 192 Ala Leu Ser Gin Arg Thr Leu Glu Thr Leu Lys Lys Ala Asp Leu lie 50 55 60 ctg ttc ggt get ate acc act ccg cca Gac ccg aaa tac cac tet gtt 240 Leu Phe Gly Ala lie Thr Thr Pro Pro Asp Pro Lys Tyr His Ser Val 65 70 75 80 gtt ctg cgt ate cgt aaa gag ctg gat ctg tac get aac etc cgt ccg 288

Val Leu Arg lie Arg Lys Glu Leu Asp Leu Tyr Ala Asn Leu Arg Pro 85 90 95 gta ttc ggt gaa ggc ttc gac ate ctg ate gtt cgt gaa aac act gaa 336 Val Phe Gly Glu Gly Phe Asp lie Leu lie Val Arg Glu Asn Thr Glu 100 105 110 ggt ctg tac tcc ggt ate gag tgg cag gaa aaa gac cgc get tgc act 384 Gly Leu Tyr Ser Gly lie Glu Trp Gin Glu Lys Asp Arg Ala Cys Thr 18 201217536 115 120 125 ctg cgc gtt gtt tct gaa gcg Ggt tct cgc cgt ate get ege ttc get Leu Arg Val Val Ser Glu Ala Gly Ser Arg Arg lie Ala Arg Phe Ala 130 135 140 432 tgc ggt tgc gcg aag cgt cgt cgt cgt cac ctg act ate ggt aac aaa 480 Cys Gly Cys Ala Lys Arg Arg Arg Arg His Leu Thr lie Gly Asn Lys 145. 150 155 160 get aac gtt ctg aaa tct gac tcc tac ttc ctg gat ate tgc atg gaa 528 Ala Asn Val Leu Lys Ser Asp Ser Tyr Phe Leu Asp lie Cys Met Glu 165 170 175 gaa gca gaa aaa get ggt ate tcc ate gac aag aaa tac ate gac tct Glu Ala Glu Lys Ala Gly Me Ser lie Asp Lys Lys Tyr lie Asp Ser 180 185 190 ctg gta ctg gac gta gct ctg cag cac cca ggt cgt tac Ga c gtt ate gtt Leu Val Leu Asp Val Leu Gin His Pro Gly Arg Tyr Asp Val lie Val 195 200 205 576 624 act acc aac ate ttc ggt gac ate ctg tct gac gca gca gca ttc ctg Thr Thr Asn lie Phe Gly Asp lie Leu Ser Asp Ala Ala Ala Phe Leu 210 215 220 672 gaa ggt ggt ctg ggt atg ctg ccg tct get aac ate ggt cgt cac cag 720 Glu Gly Gly Leu Gly Met Leu Pro Ser Ala Asn lie Gly Arg His Gin 225 230 235 240 gca ctg Ttc gaa ccg gtt cac ggt tct gcg ccg gat ate get ggt aaa Ala Leu Phe Glu Pro Val His Gly Ser Ala Pro Asp lie Ala Gly Lys 245 250 255 768 ggt ctg get aac ccg ate get gca ate cgc tgc gta tct ctg ctg ctg Gly Leu Ala Asn Pro lie Ala Ala lie Arg Cys Val Ser Leu Leu Leu 260 265 270 816 aaa tac gtt ggc gag aag ccg tct gcg att gaa gtt gaa aaa gcg att Lys Tyr Val Gly Glu Lys Pro Ser Ala lie Glu Val Glu Lys Ala lie 275 280 285 864 cag aaa act ate get gac ggt ate aaa act ccg gat ctg ggt ggt act Gin Lys Thr lie Ala Asp Gly lie Lys Thr Pro Asp Leu Gly Gly Thr 290 295 300 912 gcg acc act gaa gaa gtt ggt cgt Gc g gta ctg tct cac ctg get tct 960 Ala Thr Thr Glu Glu Val Gly Arg Ala Val Leu Ser His Leu Ala Ser 305 310 315 320 tcc aag aaa gca gaa ggt ccg gac etc Ser Lys Lys Ala Glu Gly Pro Asp Leu 325 987 &gt >>> 0 12 3 1111 2222 < VV < 16 329 PRT Methanospirillum hungatei <400> 16 Met Lys Arg Val Val Val Ala Pro Gly Asp Gly lie Gly Pro Glu Val 15 10 15 lie Pro Pro A A A A A A A A A A A A A A A A A A A A A A A A A Leu Lys Lys Ala Asp Leu lie19

201217536 50 55 60

Leu Phe Gly Ala He Thr Thr Pro Pro Asp Pro Lys Tyr His Ser Val 65 70 75 80

Val Leu Arg lie Arg Lys Glu Leu Asp Leu Tyr Ala Asn Leu Arg Pro 85 90 95

Val Phe Gly Glu Gly Phe Asp lie Leu lie Val Arg Glu Asn Thr Glu 100 105 110

Gly Leu Tyr Ser Gly lie Glu Trp Gin Glu Lys Asp Arg Ala Cys Thr 115 120 125

Leu Arg Val Val Ser Glu Ala Gly Ser Arg Arg lie Ala Arg Phe Ala 130 135 140

Cys Gly Cys Ala Lys Arg Arg Arg Arg His Leu Thr lie Gly Asn Lys 145 150 155 160

Ala Asn Val Leu Lys Ser Asp Ser Tyr Phe Leu Asp lie Cys Met Glu 165 170 175

Glu Ala Glu Lys Ala Gly lie Ser lie Asp Lys Lys Tyr lie Asp Ser 180 185 190

Leu Val Leu Asp Val Leu Gin His Pro Gly Arg Tyr Asp Val lie Val 195 200 205

Thr Thr Asn lie Phe Gly Asp lie Leu Ser Asp Ala Ala Ala Phe Leu 210 215 220

Glu Gly Gly Leu Gly Met Leu Pro Ser Ala Asn lie Gly Arg His Gin 225 230 235 240

Ala Leu Phe Glu Pro Val His Gly Ser Ala Pro Asp lie Ala Gly Lys 245 250 255

Gly Leu Ala Asn Pro lie Ala Ala Me Arg Cys Val Ser Leu Leu Leu 260 265 270

Lys Tyr Val Gly Glu Lys Pro Ser Ala lie Glu Val Glu Lys Ala lie 275 280 285

Gin Lys Thr lie Ala Asp Gly lie Lys Thr Pro Asp Leu Gly Gly Thr 290 295 300

Ala Thr Thr Glu Glu Val Gly Arg Ala Val Leu Ser His Leu Ala Ser 305 310 315 320

Ser Lys Lys Ala Glu Gly Pro Asp Leu 325 <210> 17

≪ 211 > 990 < 212 > DNA < 213 > Heinz A Hyun spiro g (Methanospirillum hungatei) 20 201217536 < 400 > 17 atgaagcggg ttgttgtggc tcccggtgat ggtatcggac ctgaagtaat accttctgca 60 cttgaggtgc ttcggttctt tcatcctgag tgggagtata ttccggtata tttggggtat 120 gagtgctgga agagaaccgg agatgcattg tcacaaagga cacttgaaac gctcaaaaag 180 gcggatctaa tcctgtttgg tgcgattaca acacctcctg atccgaagta tcacagtgtg 240 gtgctacgga ttcgaaagga actggatctc tatgcaaatc tccgcccggt attcggagaa 300 gggtttgata ttttgatcgt gcgggagaat accgaggggc tctattcagg tatcgaatgg 360 caggagaagg atcgtgcctg taccctccgt gttgtcagtg aagcaggatc gcgtcggatt 420 gccagatttg cttgtggctg tgccaagcgg agacgaagac atctgacaat cggcaataag 480 gcaaatgtcc tgaagtctga ctcttatttc cttgatatct gcatggagga ggctgaaaag 540 gcaggaatat ccatagataa aaagtatatc gactcactgg ttcttgacgt cctgcagcac 600 Ccaggccggt atgatgtcat tgtgacgacg aacatctttg gggacatcct ttcagatgcg 660 gctgcatttc tggaaggggg ccttgggatg cttcccagcg caaatattgg acggcatcag 720 gcactcttcg aaccagttca tggcagtgcc cctgatattg ccgggaaggg tcttgcaaat 780 cccatcgcag ccatcagatg tgtatccctg cttcttaagt atgtcggaga gaagcccagt 840 gctattgaag tggaaaaggc gattcaaaag accatcgccg acgggataaa gactcctgat 900 - ctcggaggta ctgcaacaac tgaggaagtg ggacgggcag tcctatcaca tcttgcatca 960 tcaaaaaagg cagagggtcc ggacctctga 990 < 210 > 18 < 211 > 1014

<212> DNA <213> Methanococcus vannielii

222 o get 222 4t91e v vv va MJ c' ghro ctT1 3 e taM aal c V 9ts 9tc t tcMe as a Ύ a L 3 o 4) apr5 vCF o cet tgM 》: a Γ CD(1)18tatTy >>>> 93 0 12 o 9( s

aG 93⁄4 9le u丨 a ^ aG ggsp atA 8 4 5 1

CP

a Θ «L ahr crh aT aalu gaG

9 6 as 3au 3 I 9g Ictro aG cpr tgal20galetae 9V 11 a M tca, atryr35ser gvatT 3tcs 3 J t* u 3 J a313 ^ o gGaaG gG 5 as 9e ay aaLymphggG ctAI 9ls atHi ca CAI c/ lysp c A catM gaHis30crgtgrA OH WA c5e liAsns aG?aglCA anapa ^ cAsgtttys?act autc gAI aeutgucar/! ttaILagGIaTh Hva5 gyraaln agr92yTtcG agUAiIGI40gatrlle acTh5 0.5 6 9 44

Cabt!^rg85c e tcGcgAta=o a no tgphtatTacASl Huca3ro u eccpcaA attcrlleLaagLystatgTyr cae5atjplteu tcs6 a A CL

Ct/a<0pr a VoicrFi taer7 tsegcrg gs3gls5'ggA r0 pr ct i e ayl cttLatT c Θ t Γ taHctTh

gaaThrlGInttgAS actp7r5°gcaArg9Lycs Lys!9L0euapahae ar0uhr aapcgT » at soAu

40802 6 2 ^ e ysASPsph UL aaLeagLetttUA 3 Ittlut e aGlaL

G 21 201217536 gtc ata ata egg gaa aat act gag tgt ett tac gta aaa agg gag tat 384

Val lie lie Arg Glu Asn Thr Glu Cys Leu Tyr Val Lys Arg Glu Tyr 115 120 125 tat gac gaa ata aac gaa gta gca att gee gaa aga ata att tea aaa 432

Tyr Asp Glu lie Asn Glu Val Ala lie Ala Glu Arg lie lie Ser Lys 130 135 140 aag gga age gaa aga ata Sta aaa ttt gca ttt gaa tat gca agg tta 480

Lys Gly Ser Glu Arg lie lie Lys Phe Ala Phe Glu Tyr Ala Arg Leu 145 150 155 160 aat aat ega aaa aaa gtg tet tgc ata cac aaa geg aat gta tta aga 528 Asn Asn Arg Lys Lys Val Ser Cys lie His Lys Ala Asn Val Leu Arg 165 170 175 gta act gac gga tta ttt ttg gaa att ttc gaa aaa ata get aaa ett 576

Val Thr Asp Gly Leu Phe Leu Glu lie Phe Glu Lys lie Ala Lys Leu 180 185 190 tat gaa aac ttt ggt ata teg age aat gat tac tta ata gat gca aca 624 Tyr Glu Asn Phe Gly Me Ser Ser Asn Asp Tyr Leu lie Asp Ala Thr 195 200 205 gca atg tac ett att aaa aat cca tat atg ttt gat gta atg gtt aca 672

Ala Met Tyr Leu Me Lys Asn Pro Tyr Met Phe Asp Val Met Val Thr 210 215 220 aca aac ett ttt gga gat att tta tet gat gag gcc gca gga ett att 720 Thr Asn Leu Phe Gly Asp Me Leu Ser Asp Glu Ala Ala Gly Leu lie 225 230 235 240 999 ggt ett gga atg teg cct tet gca aat att ggg gat aat tta gga 768 Gly Gly Leu Gly Met Ser Pro Ser Ala Asn lie Gly Asp Asn Leu Gly 245 250 255 tta ttt gag cct gtt cat ggt tea Gcc cca gat att get gga aaa gga 816

Leu Phe Glu Pro Val His Gly Ser Ala Pro Asp lie Ala Gly Lys Gly 260 265 270 ata tet aat ccg att geg aca att tta agt get tea atg atg ett gac 864 lie Ser Asn Pro lie Ala Thr lie Leu Ser Ala Ser Met Met Leu Asp 275 280 285 cat tta aaa atg aat aaa aag geg gaa att ata aga aat gca gtt aaa 912 His Leu Lys Met Asn Lys Lys Ala Glu lie lie Arg Asn Ala Val Lys 290 295 300 aaa aeg ata aat aat ggt tat ttg aca Ccc gat ett ggt gga age ctg 960 Lys Thr lie Asn Asn Gly Tyr Leu Thr Pro Asp Leu Gly Gly Ser Leu 305 310 315 320 aaa act tcc gaa gtt gta aat aaa gtt ata gaa ttt att egg gat gaa 1008 Lys Thr Ser Glu Val Val Asn Lys Val lie Glu Phe lie Arg Asp Glu 325 330 335 1014 ate taa lie <210> 19 <211> 337

<212> PRT <213> Methanococcus vannielii <400> 19

Met Gly Tyr Met Pro Lys lie Cys Val lie Thr Gly Asp Gly Me Gly 15 10 15

Lys Glu Val Val Pro Glu Thr Leu Arg Val Leu Asn Glu Val His Asp 20 25 30 22 201217536

Phe Glu Tyr lie Glu Ala His Ala Gly Tyr Glu Cys Phe Lys Arg Cys 35 40 45

Gly Glu Ser Me Pro Glu Ser Thr lie Gin Thr Ala Lys Asn Ser Asp 50 55 60

Ser Me Leu Phe Gly Ser Val Thr Thr Pro Lys Pro Thr Glu Leu Lys 65 70 75 80

Asn Lys Pro Tyr Arg Ser Pro lie Leu Thr Leu Arg Gin Glu Leu Asp 85 90 95

Leu Tyr Ala Asn lie Arg Pro Thr Tyr Asn Phe Lys Asp Leu Asp Phe 100 105 110

Val lie lie Arg Glu Asn Thr Glu Cys Leu Tyr Val Lys Arg Glu Tyr 115 120 125

Tyr Asp Glu lie Asn Glu Val Ala lie Ala Glu Arg lie lie Ser Lys 130 135 140

Lys Gly Ser Glu Arg lie lie Lys Phe Ala Phe Glu Tyr Ala Arg Leu 145 150 155 160

Asn Asn Arg Lys Lys Val Ser Cys lie His Lys Ala Asn Val Leu Arg 165 170 175

Val Thr Asp Gly Leu Phe Leu Glu lie Phe Glu Lys lie Ala Lys Leu 180 185 190

Tyr Glu Asn Phe Gly lie Ser Ser Asn Asp Tyr Leu lie Asp Ala Thr 195 200 205

Ala Met Tyr Leu lie Lys Asn Pro Tyr Met Phe Asp Val Met Val Thr 210 215 220

Thr Asn Leu Phe Gly Asp lie Leu Ser Asp Glu Ala Ala Gly Leu lie 225 230 235 240

Gly Gly Leu Gly Met Ser Pro Ser Ala Asn lie Gly Asp Asn Leu Gly 245 250 255

Leu Phe Glu Pro Val His Gly Ser Ala Pro Asp lie Ala Gly Lys Gly 260 265 270 lie Ser Asn Pro lie Ala Thr Me Leu Ser Ala Ser Met Met Leu Asp 275 280 285

His Leu Lys Met Asn Lys Lys Ala Glu Me lie Arg Asn Ala Val Lys 290 295 300

Lys Thr lie Asn Asn Gly Tyr Leu Thr Pro Asp Leu Gly Gly Ser Leu 305 310 315 320

Lys Thr Ser Glu Val Val Asn Lys Val lie Glu Phe lie Arg Asp Glu 23 201217536 335 325 lie <210> 20 <211> 1011 <212> DNA <213> Synthetic <220><223> Codon pair optimization gene, Mevan_0040 <400> 20 330

atgggttaca tgccgaaaat ctgcgttatc actggcgacg gtatcggtaa agaagttgtt 60 ccggaaactc tgcgcgtact gaacgaagtt cacgacttcg aatacatcga agcacacgcg 120 ggttacgagt gcttcaagcg ctgcggtgaa tccatcccgg aatccactat tcagactgcg 180 aaaaactctg actccatcct gttcggttct gttaccactc cgaaaccaac tgaactgaaa 240 aacaagccgt accgctctcc gattctgact ctgcgtcagg aactggatct gtacgctaac 300 atccgtccga cttacaactt caaagacctg gacttcgtta tcatccgtga aaacactgaa 360 tgcctgtacg ttaagcgtga atactacgac gaaatcaacg aagttgctat cgctgaacgt 420 atcatctcca agaaaggttc tgaacgtatc atcaaattcg ctttcgaata cgcacgtctg 480 aacaaccgta agaaagtttc ctgcatccac aaagctaacg tactgcgcgt aactgacggt 540 ctgttcctgg aaatcttcga gaagatcgcg aaactgtacg aaaacttcgg tatctcttct 600 aacgactacc tgatcgacgc aactgcaatg tacctgatca aaaacccgta catgttcgac 660 gtaatggtta ccactaacct gttcggtgac atcctgtctg acgaagctgc tggtctgatc 720 ggtggtctgg gtatgtctcc gtctgctaac atcggtgaca acctgggtct gttcgaaccg 780 gttcacggtt ctgcaccgga tatcgctggt aaaggtatct ccaacccgat cgcgactatc 840 ctgtctgcgt ctatgatgct ggatcacctg aaaatgaaca agaaagcaga aatcatccgt 900 aacgctgtta agaaaactat caacaacggt tacctgactc cggacctggg tggttctctg 960 aaaacttctg aagttgttaa caaagttatc gaattcatcc gcgacgagat t 1011 < 210 > 21 < 211 > 1020 < 212 > DNA < 213 > sea marsh Yue: ¾ lactis (Methanococcus maripaludis) < 220 ><221> CDS <222> (1)..(1020) <400> 21 atg aga aac act ccc aaa att tgt gtt ate aat ggt gac ggt att gga 48

Met Arg Asn Thr Pro Lys lie Cys Val lie Asn Gly Asp Gly lie Gly 15 10 15 aac gaa gta gtt cct gaa aeg gtg ega gtt tta aat gaa ett ggt gac 96

Asn Glu Val Val Pro Glu Thr Val Arg Val Leu Asn Glu Leu Gly Asp 20 25 30 ttc gaa ttc att cat gee cat gca ggt tac gaa tgt ttt aaa aga tgt 144 Phe Glu Phe Me His Ala His Ala Gly Tyr Glu Cys Phe Lys Arg Cys 35 40 45 ggc gat geg ata cca gaa aac aca att gaa att gca aaa gaa tet gat 192 24 201217536

Gly Asp Ala lie Pro Glu Asn Thr lie Glu lie Ala Lys Glu Ser Asp 50 55 60 tgt att tta ttt gga tea gtt acc act cca aaa ccg act gaa tta aaa 240

Cys lie Leu Phe Gly Ser Val Thr Thr Pro Lys Pro Thr Glu Leu Lys 65 70 75 80 aat aaa tea tat aga agt cca ata tta act tta aga aaa gaa ett gac 288 Asn Lys Ser Tyr Arg Ser Pro Me Leu Thr Leu Arg Lys Glu Leu Asp 85 90 95 ett tat gca aat att agg cca act tat aac ttt gat aat ett gat ttt 336 Leu Tyr Ala Asn lie Arg Pro Thr Tyr Asn Phe Asp Asn Leu Asp Phe 100 105 110 gtt ata att ega gaa aat act gaa Gga etc tat gta aaa aaa gaa tat 384 Val lie lie Arg Glu Asn Thr Glu Gly Leu Tyr Val Lys Lys Glu Tyr 115 120 125 tac gac gaa aaa aac gaa gtt gca att get gag ega ata att tea aaa 432

Tyr Asp Glu Lys Asn Glu Val Ala lie Ala Glu Arg lie lie Ser Lys 130 135 140 ttt gga agt tet aga att gta aaa ttt get ttt gat tat geg gtt caa 480

Phe Gly Ser Ser Arg lie Val Lys Phe Ala Phe Asp Tyr Ala Val Gin 145 150 155 160 aat aac aga aaa aaa gta tcc tgc ata cat aaa gca aac gta tta egg 528

Asn Asn Arg Lys Lys Val Ser Cys lie His Lys Ala Asn Val Leu Arg Stomach 165 170 175 gtt act gac gga tta ttt tta gaa gtt ttc gaa gaa atg tet aaa cat 576 - Val Thr Asp Gly Leu Phe Leu Glu Val Phe Glu Glu Met Ser Lys His 180 185 190 tac gaa aaa tta gga ata aag tet gat gac tac eta att gac geg aca 624 Tyr Glu Lys Leu Gly Me Lys Ser Asp Asp Tyr Leu lie Asp Ala Thr 195 200 205 gca atg tat ttg att aga aac Ccg caa atg ttt gat gta ttg gtt aca 672 Ala Met Tyr Leu Me Arg Asn Pro Gin Met Phe Asp Val Leu Val Thr 210 215 220 aca aat ett ttt gga gat att tta tet gat gaa get gca gga ett att 720

Thr Asn Leu Phe Gly Asp lie Leu Ser Asp Glu Ala Ala Gly Leu lie 225 230 235 240 ggc gga ett gga atg tet cct tea gca aac att ggt gat aaa aac gga 768

Gly Gly Leu Gly Met Ser Pro Ser Ala Asn Me Gly Asp Lys Asn Gly 245 250 255 tta ttt gag cca gtt cat gga tet gca cca gac att get gga aaa gga 816

Leu Phe Glu Pro Val His Gly Ser Ala Pro Asp Me Ala Gly Lys Gly 260 265 270 att tea aac ccg att gca aca ata ttg agt get gca atg atg ett gac 864 lie Ser Asn Pro lie Ala Thr lie Leu Ser Ala Ala Met Met Leu Asp 275 280 285 cat tta aaa atg aat aaa gaa gcc gaa tac att aga aaa geg gtt aaa 912 His Leu Lys Met Asn Lys Glu Ala Glu Tyr Me Arg Lys Ala Val Lys 290 295 300 aaa aeg gtt gaa tgt aaa tat tta act Cct gat ett ggg gga aac tta 960 Lys Thr Val Glu Cys Lys Tyr Leu Thr Pro Asp Leu Gly Gly Asn Leu 305 310 315 320 aaa act ttt gaa gtt aeg gaa aaa ate att gaa tcc ata agg tet cag 1008 Lys Thr Phe Glu Val Thr Glu Lys lie lie Glu Ser lie Arg Ser Gin 325 330 335 atg att cag tga 1020

Met lie Gin 25 201217536 <210> 22 <211> 339

<212> PRT <213> Methanococcus maripaludis <400> 22

Met Arg Asn Thr Pro Lys lie Cys Val lie A$n Gly Asp Gly lie Gly 15 10 15

Asn Glu Val Val Pro Glu Thr Val Arg Val Leu Asn Glu Leu Gly Asp 20 25 30

Phe Glu Phe lie His Ala His Ala Gly Tyr Glu Cys Phe Lys Arg Cys 35 40 45

Gly Asp Ala lie Pro Glu Asn Thr lie Glu lie Ala Lys Glu Ser Asp 50 55 60

Cys lie Leu Phe Gly Ser Val Thr Thr Pro Lys Pro Thr Glu Leu Lys 65 70 75 80

Asn Lys Ser Tyr Arg Ser Pro lie Leu Thr Leu Arg Lys Glu Leu Asp 85 90 95

Leu Tyr Ala Asn lie Arg Pro Thr Tyr Asn Phe Asp Asn Leu Asp Phe 100 105 110

Val lie lie Arg Glu Asn Thr Glu Gly Leu Tyr Val Lys Lys Glu Tyr 115 120 125

Tyr Asp Glu Lys Asn Glu Val Ala lie Ala Glu Arg lie lie Ser Lys 130 135 140

Phe Gly Ser Ser Arg lie Val Lys Phe Ala Phe Asp Tyr Ala Val Gin 145 150 155 160

Asn Asn Arg Lys Lys Val Ser Cys lie His Lys Ala Asn Val Leu Arg 165 170 175

Val Thr Asp Gly Leu Phe Leu Glu Val Phe Glu Glu Met Ser Lys His 180 185 190

Tyr Glu Lys Leu Gly lie Lys Ser Asp Asp Tyr Leu lie Asp Ala Thr 195 200 205

Ala Met Tyr Leu lie Arg Asn Pro Gin Met Phe Asp Val Leu Val Thr 210 215 220

Thr Asn Leu Phe Gly Asp lie Leu Ser Asp Glu Ala Ala Gly Leu lie 225 230 235 240

Gly Gly Leu Gly Met Ser Pro Ser Ala Asn lie Gly Asp Lys Asn Gly 245 250 255

Leu Phe Glu Pro Val His Gly Ser Ala Pro Asp lie Ala Gly Lys Gly 260 265 270 26 201217536 lie Ser Asn Pro lie Ala Thr lie Leu Ser Ala Ala Met Met Leu Asp 275 280 285

His Leu Lys Met Asn Lys Glu Ala Glu Tyr lie Arg Lys Ala Val Lys 290 295 300

Lys Thr Val Glu Cys Lys Tyr Leu Thr Pro Asp Leu Gly Gly Asn Leu 305 310 315 320

Lys Thr Phe Glu Val Thr Glu Lys lie lie Glu Ser lie Arg Ser Gin 325 330 335

Met lie Gin <210> 23 <211> 1017 <212> DNA <213> Synthetic <220><223> Codon pair optimization gene, MMP0880 <400> 23 atgcgtaaca ctccgaaaat ctgcgttatc aacggtgacg gtatcggtaa cgaagttgtt 60 ccggaaaccg ttcgcgtact gaacgaactg ggtgacttcg aattcatcca cgcgcacgct 120 ggttacgaat gcttcaagcg ctgcggtgac gctatcccgg aaaacaccat cgaaatcgct 180 aaagagtctg actgcatcct gttcggttct gtaactactc cgaaaccaac tgaactgaaa 240 aacaagtctt accgotctcc gattctgact ctgcgtaaag agctggatct gtacgctaac 300 atccgtccga cttacaactt cgacaacctg gatttcgtta tcatccgtga aaacactgaa 360 ggtctgtacg ttaagaaaga atactacgac gagaaaaacg aagttgctat cgctgaacgt 420 atcatctcca agttcggttc ttctcgcatc gttaaattcg cattcgacta cgcagtacag 480 aacaaccgta agaaagtttc ctgcatccac aaagcgaacg ttctgcgcgt aactgacggt 540 ctgttcctgg aagttttcga agaaatgtcc aagcactacg aaaaactggg tatcaaatct 600 gacgactacc tgatcgacgc aactgcgatg tacctgatcc gtaacccgca gatgttcgac 660 gttctggtta ctaccaacct gttcggtgac atcctgtctg acgaagcagc tggtctgatt 720 ggtggtctgg gtatgtctcc gtctgctaac atcggtgaca aaaacggtct gttcgaaccg 780 gttcacggtt ctgcaccgga tatcgctggt aaaggtatct ccaacccgat cgcgactatc 840 ctgtctgctg caatgatgct ggatcacctg aaaatgaaca aagaagctga atacatccgt 900 aaagcggtta agaaaaccgt tgaatgcaaa tacctgactc cggacctggg tggtaacctg 960 aaaactttcg aagttactga aaagatcatc gaatccatcc gttctcagat gattcaa 1017 < 210 > 24 < 211 > 486

<212> DNA <213> Methanococcus maripaludis <220><221> CDS <222> (1)..(486) 27 201217536 <400> 24 atg aaa ata act Ggt aag gtg cac tta ttt ggg gat gac ate gat act 48

Met Lys lie Thr Gly Lys Val His Leu Phe Gly Asp Asp lie Asp Thr 15 10 15 gat geg ata att ccc gga get tat tta aaa aeg act gat gaa tat gag 96

Asp Ala lie lie Pro Gly Ala Tyr Leu Lys Thr Thr Asp Glu Tyr Glu 20 25 30 ett gca teg cac tgt atg gca gga att gac gaa aat ttt cca gaa agg 144

Leu Ala Ser His Cys Met Ala Gly lie Asp Glu Asn Phe Pro Glu Arg 35 40 45 gtc gaa gat ggt gac ttt tta gtt gca ggt gaa aat ttt gga tgc gga 192

Val Glu Asp Gly Asp Phe Leu Val Ala Gly Glu Asn Phe Gly Cys Gly 50 55 60 agt tea agg gaa cag gcc cca att gcc ata aaa tac tgc gga ate aag 240

Ser Ser Arg Glu Gin Ala Pro lie Ala lie Lys Tyr Cys Gly He Lys 65 70 75 80 gca ata att gtt gag agt ttt gca agg ata ttt tac aga aat tgc ata 288

Ala lie lie Val Glu Ser Phe Ala Arg Me Phe Tyr Arg Asn Cys lie 85 90 95 aat tta gga gta ttt cca att gaa tgc aag gga ata tea aaa cac gtc 336 Asn Leu Gly Val Phe Pro lie Glu Cys Lys Gly lie Ser Lys His Val 100 105 110 aaa gat ggg gat gta ata gaa tta gat ett gaa gaa aaa aaa gtt ate 384 Lys Asp Gly Asp Val lie Glu Leu Asp Leu Glu Glu Lys Lys Val lie 115 120 125 tta aaa gac aeg gtt ett gac tgc aat Ett ccg aca ggg act gca aaa 432

Leu Lys Asp Thr Val Leu Asp Cys Asn Leu Pro Thr Gly Thr Ala Lys 130 135 140 gat ata atg gat gaa ggc ggg ett ata aat tac gca aag aaa caa aaa 480

Asp He Met Asp Glu Gly Gly Leu Me Asn Tyr Ala Lys Lys Gin Lys 145 150 155 160 486 aat taa Asn <210> 25

<211> 161 <212> PRT <213> Methanococcus maripaludis <400> 25

Met Lys lie Thr Gly Lys Val His Leu Phe Gly Asp Asp Me Asp Thr 15 10 15

Asp Ala lie lie Pro Gly Ala Tyr Leu Lys Thr Thr Asp Glu Tyr Glu 20 25 30

Leu Ala Ser His Cys Met Ala Gly Me Asp Glu Asn Phe Pro Glu Arg 35 40 45

Val Glu Asp Gly Asp Phe Leu Val Ala Gly Glu Asn Phe Gly Cys Gly 50 55 60

Ser Ser Arg Glu Gin Ala Pro lie Ala lie Lys Tyr Cys Gly lie Lys 65 70 75 80

Ala lie lie Val Glu Ser Phe Ala Arg lie Phe Tyr Arg Asn Cys lie 85 90 95 28 201217536

Asn Leu Gly Val Phe Pro Me Glu Cys Lys Gly Me Ser Lys His Val 100 105 110

Lys Asp Gly Asp Val lie Glu Leu Asp Leu Glu Glu Lys Lys Val lie 115 120 125

Leu Lys Asp Thr Val Leu Asp Cys Asn Leu Pro Thr Gly Thr Ala Lys 130 135 140

Asp lie Met Asp Glu Gly Gly Leu lie Asn Tyr Ala Lys Lys Gin Lys 145 150 155 160

Asn <210> 26 <211> 483 <212> DNA <213> Synthetic <220><223> Codon pair optimization gene, MMP0381 <400> 26 atgaagatca ccggtaaagt tcacctgttc ggtgacgaca tcgacactga cgctatcatt 60 ccgggtgctt acctgaaaac cactgacgaa tacgaactgg cttctcactg catggcgggt 120 atcgacgaaa acttcccgga acgcgttgaa gatggcgact tcctggttgc tggcgaaaac 180 ttcggttgcg gttcttcccg tgaacaggca ccgattgcta tcaaatactg cggtatcaaa 240 gcaatcatcg ttgaatcctt cgcacgtatc ttctaccgta actgcatcaa cctgggcgta 300 ttcccgatcg aatgcaaagg tatctccaag cacgttaaag acggtgacgt tatcgaactg 360 gatctggaag agaagaaagt tatcctgaaa gacaccgtac tggactgcaa cctcccgact 420 ggtactgcga aagatatcat ggacgaaggt ggtctgatca actacgctaa gaagcagaaa 480 aac 483 <210> 27 <211> 1257

<212> DNA <213> Methanococcus maripaludis <220><221> CDS <222> (1)..(1257) <400> 27 atg aca ctt get gag aaa ate Att tea aaa aat gtt gga aaa aat gtt 48

Met Thr Leu Ala Glu Lys lie lie Ser Lys Asn Val Gly Lys Asn Val 1 5 10 15 tac gcc aaa gac age gtc gaa ata age gta gat att gca atg aca cat 96

Tyr Ala Lys Asp Ser Val Glu lie Ser Val Asp lie Ala Met Thr His 20 25 30 gac ggg acc acc ccg ctt aeg gta aaa gcc ttt gag cag att tea gat 144 Asp Gly Thr Thr Pro Leu Thr Val Lys Ala Phe Glu Gin lie Ser Asp 35 40 45 aaa gta tgg gat aat gaa aag ata gtc att att ttt gac cac aat ate 192 Lys Val Trp Asp Asn Glu Lys lie Val lie lie Phe Asp His Asn lie 29 201217536 50 55 60 cct gca aac acg tea aaa get Gca aat atg cag gtt ata aeg aga gaa 240 Pro Ala Asn Thr Ser Lys Ala Ala Asn Met Gin Val lie Thr Arg Glu 65 70 75 80 ttc ata aaa aag cag ggg att aaa aat tac tac etc gat ggc gaa gga 288 Phe lie Lys Lys Gin Gly ly Lys Asn Tyr Tyr Leu Asp Gly Glu Gly 85 90 95 ata tgc cat caa gtt eta cct gaa aag ggc cat gta aaa cca aac atg 336 lie Cys His Gin Val Leu Pro Glu Lys Gly His Val Lys Pro Asn Met 100 105 110 ata att geg gga get gac age cac aca tgt act cat ggg gee ttt gga 384 lie lie Ala Gly Ala Asp Ser His Thr Cys Thr His Gly Ala Phe Gly 115 120 125 gca ttt get aca ggt ttt ggt get aca gac atg ggt Tac gtc tat Gca 432 Ala Phe Ala Thr Gly Phe Gly Ala Thr Asp Met Gly Tyr Val Tyr Ala 130 135 140 aca gga aaa acc tgg ett aga gtt cct gaa act ate ege gta aat gta 480

Thr Gly Lys Thr Trp Leu Arg Val Pro Glu Thr lie Arg Val Asn Val 145 150 155 160 act gga gaa aat gaa aat att tet gga aaa gac att att tta aaa act 528 Thr Gly Glu Asn Glu Asn lie Ser Gly Lys Asp lie lie Leu Lys Thr 165 170 175 tgt aag gaa gtt gga aga cgt ggg get acg tac atg tet tta gaa tac 576

Cys Lys Glu Val Gly Arg Arg Gly Ala Thr Tyr Met Ser Leu Glu Tyr 180 185 190 ggt gga aat gca gtc cac aat ett tea atg gat gaa aga atg gtt ctg 624

Gly Gly Asn Ala Val His Asn Leu Ser Met Asp Glu Arg Met Val Leu 195 200 205 tea aac atg get att gaa atg ggc gga aaa gca gat att ate gaa get 672 Ser Asn Met Ala lie Glu Met Gly Gly Lys Ala Gly lie lie Glu Ala 210 215 220 gat gat act aca tat aga tat ett gaa aat gca gga gtt teg ege gaa 720

Asp Asp Thr Thr Tyr Arg Tyr Leu Glu Asn Ala Gly Val Ser Arg Glu 225 230 235 240 gaa att ett gaa ttg aaa aaa aat aaa ata aca gtt gat gaa tee gaa 768 Glu lie Leu Glu Leu Lys Lys Asn Lys lie Thr Val Asp Glu Ser Glu 245 250 255 gaa gac tac tac aaa aca att gaa ttt gac ata acc ggt atg gaa gaa 816 Glu Asp Tyr Tyr Lys Thr lie Glu Phe Asp lie Thr Gly Met Glu Glu 260 265 270 cag gtt gca tgc cct cac cac cct Gat aac gta aaa gga gtt tea gaa 864

Gin Val Ala Cys Pro His His Pro Asp Asn Val Lys Gly Val Ser Glu 275 280 285 gtt gaa gga aca gaa tta aac cag gta ttc ate ggt tea tgc aca aac 912 Val Glu Gly Thr Glu Leu Asn Gin Val Phe lie Gly Ser Cys Thr Asn 290 295 300 gga aga tta aac gac tta aga att get gca aaa tat ttg aaa gga aaa 960

Gly Arg Leu Asn Asp Leu Arg lie Ala Ala Lys Tyr Leu Lys Gly Lys 305 310 315 320 aaa gtt aat gaa aac aca aga tta att gta ate cct gca tea aag tea 1008 Lys Val Asn Glu Asn Thr Arg Leu lie Val lie Pro Ala Ser Lys Ser 325 330 335 ata ttt aaa gaa gee eta aat gaa gga tta att gat ate ttt gta gat 1056 lie Phe Lys Glu Ala Leu Asn Glu Gly Leu lie Asp lie Phe Val Asp 340 345 350 tec gga gca tta ata tgt acc cct Gga tgc gga cca tgt ett gga gee 1104 30 201217536

Ser Gly Ala Leu He Cys Thr Pro Gly Cys Giy Pro Cys Leu Gly Ala 355 360 365 cat cag ggg gtt tta ggt gat gga gaa gta tgc ctt get aca act aac 1152 His Gin Gly Val Leu Gly Asp Gly Glu Val Cys Leu Ala Thr Thr Asn 370 375 380 egg aac ttt aaa gga aga atg gga aac aeg aac gca caa gtt tac etc 1200 Arg Asn Phe Lys Gly Arg Met Gly Asn Thr Asn Ala Gin Val Tyr Leu 385 390 395 400 tet tet cca aaa ata get gca aaa Tet geg gtt aaa ggc tac att aca 1248 Ser Ser Pro Lys He Ala Ala Lys Ser Ala Val Lys Gly Tyr lie Thr 405 410 415 1257 aat gaa taa Asn Glu <210> 28 <211>

<212> PRT <213> Methanococcus maripaludis <400> 28

Met Thr Leu Ala Glu Lys lie lie Ser Lys Asn Val Gly Lys Asn Val 15 10 15

Tyr Ala Lys Asp Ser Val Glu lie Ser Val Asp lie Ala Met Thr His 20 25 30

Asp Gly Thr Thr Pro Leu Thr Val Lys Ala Phe Glu Gin lie Ser Asp 35 40 45

Lys Val Trp Asp Asn Glu Lys lie Val lie lie Phe Asp His Asn lie 50 55 60

Pro Ala Asn Thr Ser Lys Ala Ala Asn Met Gin Val lie Thr Arg Glu 65 70 75 80

Phe lie Lys Lys Gin Gly ly Lys Asn Tyr Tyr Leu Asp Gly Glu Gly 85 90 95 lie Cys His Gin Val Leu Pro Glu Lys Gly His Val Lys Pro Asn Met 100 105 110 lie lie Ala Gly Ala Asp Ser His Thr Cys Thr His Gly Ala Phe Gly 115 120 125

Ala Phe Ala Thr Gly Phe Gly Ala Thr Asp Met Gly Tyr Val Tyr Ala 130 135 140

Thr Gly Lys Thr Trp Leu Arg Val Pro Glu Thr lie Arg Val Asn Val 145 150 155 160

Thr Gly Glu Asn Glu Asn lie Ser Gly Lys Asp lie lie Leu Lys Thr 165 170 175

Cys Lys Glu Val Gly Arg Arg Gly Ala Thr Tyr Met Ser Leu Glu Tyr 180 185 190 31 201217536

Gly Gly Asn Ala Val His Asn Leu Ser Met Asp Glu Arg Met Val Leu 195 200 205

Ser Asn Met Ala lie Glu Met Gly Gly Lys Ala Gly lie lie Glu Ala 210 215 220

Asp Asp Thr Thr Tyr Arg Tyr Leu Glu Asn Ala Gly Val Ser Arg Glu 225 230 235 240

Glu lie Leu Glu Leu Lys Lys Asn Lys lie Thr Val Asp Glu Ser Glu 245 250 255

Glu Asp Tyr Tyr Lys Thr lie Glu Phe Asp tie Thr Gly Met Glu Glu .260 265 270

Gin Val Ala Cys Pro His His Pro Asp Asn Val Lys Gly Val Ser Glu 275 280 285

Val Glu Gly Thr Glu Leu Asn Gin Val Phe Me Gly Ser Cys Thr Asn 290 295 300

Gly Arg Leu Asn Asp Leu Arg lie Ala Ala Lys Tyr Leu Lys Gly Lys 305 310 315 320

Lys Val Asn Glu Asn Thr Arg Leu lie Val lie Pro Ala Ser Lys Ser 325 330 335 lie Phe Lys Glu Ala Leu Asn Glu Gly Leu lie Asp lie Phe Val Asp 340 345 350

Ser Gly Ala Leu Me Cys Thr Pro Gly Cys Gly Pro Cys Leu Gly Ala 355 360 365

His Gin Gly Val Leu Gly Asp Gly Glu Val Cys Leu Ala Thr Thr Asn 370 375 380

Arg Asn Phe Lys Gly Arg Met Gly Asn Thr Asn Ala Gin Val Tyr Leu 385 390 395 400

Ser Ser Pro Lys lie Ala Ala Lys Ser Ala Val Lys Gly Tyr lie Thr 405 410 415

Asn Glu <210> 29 <211> 1254 <212> DNA <213> Synthetic <220><223> Codon pair optimization gene, MMP1480 <400> 29 atgactctgg ctgagaagat catctccaaa aacgttggta aaaacgttta cgcgaaagac 60 tccgttgaaa tctccgttga catcgcgatg actcacgacg gtactactcc gctgaccgtt 120 aaagcgttcg aacagatctc tgacaaagta tgggataacg agaagatcgt tatcatcttc 180 32 201217536 gaccacaaca tcccggctaa cacctctaaa gctgctaaca tgcaagttat cactcgtgaa 240 ttcatcaaga agcagggtat caaaaactac tacctggatg gtgaaggtat ctgccaccag 300 gtactgccgg aaaaaggtca cgttaagccg aacatgatca tcgctggcgc agactctcac 360 acttgcactc acggtgcatt cggtgcattc gctaccggtt tcggtgcaac tgacatgggt 420 tacgtttacg caactggtaa aacctggctg cgcgtaccgg aaaccattcg cgttaacgta 480 actggcgaaa acgaaaacat ctccggtaaa gacatcatcc tgaaaacttg caaagaagtt 540 ggtcgtcgcg gtgcaactta catgtctctg gaatacggtg gtaacgctgt tcacaacctg 600 tctatggacg aacgtatggt tctgtctaac atggctatcg aaatgggtgg taaagctggt 660 atcatcgaag ctgacgacac cacttaccgc tacctggaaa acgctggcg t ttcccgtgaa 720 gaaatcctgg aactgaagaa aaacaagatc accgttgacg aatctgaaga agattactac 780 aaaactattg aattcgacat caccggtatg gaagaacagg ttgcttgccc acaccacccg 840 gacaacgtta aaggcgtttc tgaagttgaa ggtactgaac tgaaccaggt attcatcggt 900 tcctgcacca acggtcgtct gaacgatctg cgtattgctg cgaaatacct gaaaggtaag 960 aaagttaacg aaaacacccg tctgatcgtt atcccggcat ctaaatctat cttcaaagaa 1020 gcgctgaacg aaggtctgat cgacatcttc gttgactccg gtgcactgat ctgcactccg 1080 ggttgcggtc cgtgcctggg tgcacaccag ggcgttctgg gtgacggtga Agtttgcctg 1140 gcaaccacta accgtaactt caaaggtcgt atgggtaaca ccaacgctca ggtttacctg 1200 tcctctccga agatcgctgc gaagtctgcg gtaaaaggtt acatcactaa tgag 1254 <210> 30 <211> 498

<212> DNA <213> Methanococcus aeolicus <220><221> CDS <222> (1)..(498) <400> 30 atg ata ata aaa gga aat Att cat tta ttt ggt gat gat att gat acc 48

Met lie lie Lys Gly Asn lie His Leu Phe Gly Asp Asp lie Asp Thr 15 10 15 gat gcc ata att ccc ggg gcc tac ctt aaa aca aca gac cca aag gag 96

Asp Ala lie lie Pro Gly Ala Tyr Leu Lys Thr Thr Asp Pro Lys Glu 20 25 30 ttg gca tct cat tgc atg get gga att gat gaa aaa ttt tea aca ag 144 Leu Ala Ser His Cys Met Ala Gly lie Asp Glu Lys Phe Ser Thr Lys 35 40 45 gta aaa gac ggc gat ata att gtt gca ggt gaa aat ttt ggc tgt gga 192

Val Lys Asp Gly Asp lie lie Val Ala Gly Glu Asn Phe Gly Cys Gly 50 55 60 agt agt agg gaa cag gca cca ata tcc ata aaa cac acc gga ata aag 240 Ser Ser Arg Glu Gin Ala Pro lie Ser lie Lys His Thr Gly Lie Lys 65 70 75 80 gca gta gtt get gaa agt ttt gca egg ata ttt tat aga aat tgt att 288 Ala Val Val Ala Glu Ser Phe Ala Arg lie Phe Tyr Arg Asn Cys lie 85 90 95 aat ata gga tta ata cct ata act Tgc gaa gga ata aat gaa caa ate 336

Asn lie Gly Leu lie Pro Me Thr Cys Glu Gly Me Asn Glu Gin Me 100 105 110 33 498 498201217536 caa aac eta aaa gat ggc gac aca ata gaa att gat ttg caa aat gaa 384

Gin Asn Leu Lys Asp Gly Asp Thr lie Glu lie Asp Leu Gin Asn Glu 115 120 125 aca ata aaa ata aat tet atg atg tta aat tgt gga get ccc aaa ggg 432

Thr lie Lys lie Asn Ser Met Met Leu Asn Cys Gly Ala Pro Lys Gly 130 135 140 ata gaa aaa gaa att tta gat get ggt gga tta gta caa tat aca aaa 480 lie Glu Lys Glu lie Leu Asp Ala Gly Gly Leu Val Gin Tyr Thr Lys 145 150 155 160 aat aag tta aaa aaa taa Asn Lys Leu Lys Lys 165 <210> 31 <211> 165

<212> PRT <213> Methanococcus aeolicus <400>

Met lie lie Lys Gly Asn lie His Leu Phe Gly Asp Asp lie Asp Thr 15 10 15

Asp Ala lie lie Pro Gly Ala Tyr Leu Lys Thr Thr Asp Pro Lys Glu 20 25 30

Leu Ala Ser His Cys Met Ala Gly Me Asp Glu Lys Phe Ser Thr Lys 35 40 45

Val Lys Asp Gly Asp lie lie Val Ala Gly Glu Asn Phe Gly Cys Gly 50 55 60

Ser Ser Arg Glu Gin Ala Pro lie Ser lie Lys His Thr Gly lie Lys 65 70 75 80

Ala Val Val Ala Glu Ser Phe Ala Arg lie Phe Tyr Arg Asn Cys lie 85 90 95

Asn lie Gly Leu He Pro lie Thr Cys Glu Gly lie Asn Glu Gin lie 100 105 110

Gin Asn Leu Lys Asp Gly Asp Thr lie Glu lie Asp Leu Gin Asn Glu 115 120 125

Thr lie Lys lie Asn Ser Met Met Leu Asn Cys Gly Ala Pro Lys Giy 130 135 140 lie Glu Lys Glu lie Leu Asp Ala Gly Gly Leu Val Gin Tyr Thr Lys 145 150 155 160

Asn Lys Leu Lys Lys 165 <210> 32 <211> 495 <212> DNA <213> Synthetic 34 <220> 201217536 <223> Codon pair optimization gene, Maeo_0652 <400> atgatcatca aaggtaacat ccacctgttc ggtgacgaca tcgacactga cgctatcatc 60 ccaggtgctt acctgaaaac cactgacccg aaagagctgg catctcactg catggcgggt 120 atcgacgaaa aattctctac caaagttaaa gacggtgaca tcatcgttgc tggcgaaaac 180 ttcggttgcg gttcttcccg tgaacaggca ccgatctcca tcaagcacac cggtatcaaa 240 goggttgttg ctgaatcctt cgctcgcatt ttctaccgta actgcatcaa catcggtctg 300 atcccgatca cctgtgaagg tatcaacgaa cagattcaga acctgaaaga cggtgacacc 360 atcgaaatcg atctgcagaa cgaaaccatc aagatcaact ccatgatgct gaactgcggt 420 gcaccgaaag Gtatcgaaaa agaaatcctg gatgctggcg gtctggtaca gtacaccaag 480 aacaagctga agaaa 495 <210> 33

<211> 1266 <212> DNA <213> Methanococcus aeolicus <220><221> CDS <222> (1)..(1266) <400> 33 atg Aca ttg gca gag gaa ata tta tea aaa aaa gta gga aaa aaa gta Met Thr Leu Ala Glu Glu lie Leu Ser Lys Lys Val Gly Lys Lys Val 15 10 15 aaa gca gga gat gtt gta gaa ata gat ata gat tta gca atg act cat Lys Ala Gly Asp Val Val Glu lie Asp lie Asp Leu Ala Met Thr His 20 25 30 gat gga aca aca cca tta tet gca aag gca ttt aaa cag ata acc gat Asp Gly Thr Thr Pro Leu Ser Ala Lys Ala Phe Lys Gin lie Thr Asp 35 40 45 aag gta tgg gac aat aaa aaa ata gtc ata gta ttt gac cat aat gtc Lys Val Trp Asp Asn Lys Lys lie Val lie Val Phe Asp His Asn Val 50 55 60 cca gca aat aca tta aaa gcc gca aat atg caa Aaa att aca ega gaa Pro Ala Asn Thr Leu Lys Ala Ala Asn Met Gin Lys lie Thr Arg Glu 65 70 75 ttt ata aaa gaa caa aat ata ata aat cat tat ttg gat ggt gaa ggc Phe lie Lys Glu Gin Asn He lie Asn His Tyr Leu Asp Gly Glu Gly 85 90 95 gta tgc cat caa gtg et a cct gaa aac gga cat ata caa cca aac atg Val Cys His Gin Val Leu Pro Glu Asn Gly His lie Gin Pro Asn Met 100 105 110 gtt ata get ggt gga gat agt cac aca tgc acc tat ggg gca ttt ggg Val lie Ala Gly Gly Asp Ser His Thr Cys Thr Tyr Gly Ala Phe Gly 115 120 125 gca ttt gca aca gga ttt ggg get acc gac atg ggg aat ata tat gca Ala Phe Ala Thr Gly Phe Gly Ala Thr Asp Met Gly Asn lie Tyr Ala 130 135 140 Aca gga aaa act tgg tta aaa gtt cca aaa acc ata aga ata aat gtt Thr Gly Lys Thr Trp Leu Lys Val Pro Lys Thr lie Arg lie Asn Val 145 150 155 aat gga gaa aat gat aaa att act gga aaa gat att att tta aaa Att Asn Gly Glu Asn Asp Lys Me Thr Gly Lys Asp Me lie Leu Lys lie 48 96 144 192 240 80 288 336 384 432 480 160 528 35 201217536 165 170 175 tgt aaa gaa gtt gga cga agt gga get act tac atg gca ett gaa Tac 576

Cys Lys Glu Val Gly Arg Ser Gly Ala Thr Tyr Met Ala Leu Glu Tyr 180 185 190 99c 999 9aa 9ca ata aaa aaa tta agt atg gac gaa aga atg gtt tta 624

Gly Gly Glu Ala lie Lys Lys Leu Ser Met Asp Glu Arg Met Val Leu 195 200 205 age aat atg get ate gaa atg ggc gga aaa gtt ggg ett ate gaa gee 672 Ser Asn Met Ala lie Glu Met Gly Gly Lys Val Gly Leu Me Glu Ala 210 215 220 gat gaa acc aca tat aat tac ett aga aat gta gga att agt gaa gaa 720 Asp Glu Thr Thr Tyr Asn Tyr Leu Arg Asn Val Gly lie Ser Glu Glu 225 230 235 240 aaa ata tta gaa ttg aaa aaa aat Caa ata acc att gat gag aac aat 768

Lys lie Leu Glu Leu Lys Lys Asn Gin lie Thr lie Asp Glu Asn Asn 245 250 255 ata gat aat gat aat tat tat aaa att ata aat ata gat att aca gac 816 lie Asp Asn Asp Asn Tyr Tyr Lys lie lie Asn lie Asp lie Thr Asp 260 265 270 atg gag gag caa gtg gca tgc cct cac cat ccc gat aat gtt aaa aat 864

Met Glu Glu Gin Val Ala Cys Pro His His Pro Asp Asn Val Lys Asn 275 280 285 att teg gaa gta aaa gga get ccc ata aat cag gtg ttc ata ggt tea 912

Me Ser Glu Val Lys Gly Ala Pro lie Asn Gin Val Phe lie Gly Ser 290 295 300 tgc aca aat ggt agg ttg aac gat tta aga ata gcc tea aaa tat tta 960

Cys Thr Asn Gly Arg Leu Asn Asp Leu Arg He Ala Ser Lys Tyr Leu 305 310 315 320 aaa gga aaa aag gtt cat aat gat gtt aga tta ata gta ata cct get 1008 Lys Gly Lys Lys Val His Asn Asp Val Arg Leu Me Val Lie Pro Ala 325 330 335 tea aaa tea ata ttt aaa cag gca tta aaa gaa gga tta att gat att 1056 Ser Lys Ser He Phe Lys Gin Ala Leu Lys Glu Gly Leu lie Asp lie 340 345 350 ttt gta gat get gga get tta att Tgc acc ccc gga tgc ggt cct tgt 1104 Phe Val Asp Ala Gly Ala Leu lie Cys Thr Pro Gly Cys Gly Pro Cys 355 360 365 ttg ggg gcc cac caa gga gtt tta gga gat ggt gaa gtt tgt tta gcc 1152 Leu Gly Ala His Gin Gly Val Leu Gly Asp Gly Glu Val Cys Leu Ala 370 375 380 acc aca aat aga aat ttc aaa gga aga atg gga aat aeg aca geg gaa 1200 Thr Thr Asn Arg Asn Phe Lys Gly Arg Met Gly Asn Thr Thr Ala Glu 385 390 395 400 ata tat tta tcc tcc ccc get att gcc gca aaa agt gca att aaa gga 1248 lie Tyr Leu Ser Ser Pro Ala lie Ala Ala Lys Ser Ala lie Lys Gly 405 410 415 tat ate aca aat gaa taa 1266

Tyr lie Thr Asn Glu 420 <210> 34 <211> 421

<212> PRT <213> Methanococcus aeolicus <400> 34

Met Thr Leu Ala Glu Glu lie Leu Ser Lys Lys Val Gly Lys Lys Val 36 201217536 1 5 10 15

Lys Ala Gly Asp Val Val Glu lie Asp lie Asp Leu Ala Met Thr His 20 25 30

Asp Gly Thr Thr Pro Leu Ser Ala Lys Ala Phe Lys Gin lie Thr Asp 35 40 45

Lys Val Trp Asp Asn Lys Lys lie Val lie Val Phe Asp His Asn Val 50 55 60

Pro Ala Asn Thr Leu Lys Ala Ala Asn Met Gin Lys lie Thr Arg Glu 65 70 75 80

Phe lie Lys Glu Gin Asn lie lie Asn His Tyr Leu Asp Gly Glu Gly 85 90 95

Val Cys His Gin Val Leu Pro Glu Asn Gly His lie Gin Pro Asn Met 100 105 110

Val lie Ala Gly Gly Asp Ser His Thr Cys Thr Tyr Gly Ala Phe Gly 115 120 125

Ala Phe Ala Thr Gly Phe Gly Ala Thr Asp Met Gly Asn lie Tyr Ala 130 135 140

Thr Gly Lys Thr Trp Leu Lys Val Pro Lys Thr Me Arg lie Asn Val 145 150 155 160

Asn Gly Glu Asn Asp Lys lie Thr Gly Lys Asp lie lie Leu Lys lie 165 170 175

Cys Lys Glu Val Gly Arg Ser Gly Ala Thr Tyr Met Ala Leu Glu Tyr 180 185 190

Gly Gly Glu Ala lie Lys Lys Leu Ser Met Asp Glu Arg Met Val Leu 195 200 205

Ser Asn Met Ala lie Glu Met Gly Gly Lys Val Gly Leu lie Glu Ala 210 215 220

Asp Glu Thr Thr Tyr Asn Tyr Leu Arg Asn Val Gly lie Ser Glu Glu 225 230 235 240

Lys lie Leu Glu Leu Lys Lys Asn Gin lie Thr lie Asp Glu Asn Asn 245 250 255 lie Asp Asn Asp Asn Tyr Tyr Lys lie lie Asn lie Asp lie Thr Asp 260 265 270

Met Glu Glu Gin Val Ala Cys Pro His His Pro Asp Asn Val Lys Asn 275 280 285

Me Ser Glu Val Lys Gly Ala Pro lie Asn Gin Val Phe lie Gly Ser 290 295 300 37 201217536

Cys Thr Asn Gly Arg Leu Asn Asp Leu Arg lie Ala Ser Lys Tyr Leu 305 310 315 320

Lys Gly Lys Lys Val His Asn Asp Val Arg Leu lie Val lie Pro Ala 325 330 335

Ser Lys Ser lie Phe Lys Gin Ala Leu Lys Glu Gly Leu lie Asp lie 340 345 350

Phe Val Asp Ala Gly Ala Leu lie Cys Thr Pro Gly Cys Gly Pro Cys 355 360 365

Leu Gly Ala His Gin Gly Val Leu Gly Asp Gly Glu Val Cys Leu Ala 370 375 380

Thr Thr Asn Arg Asn Phe Lys Gly Arg Met Gly Asn Thr Thr Ala Glu 385 390 395 400 lie Tyr Leu Ser Ser Pro Ala lie Ala Ala Lys Ser Ala He Lys Gly 405 410 415

Tyr Me Thr Asn Glu 420 <210> 35 <211> 1263 <212> DNA <213> Synthetic <220><223> Codon pair optimization gene, Maeo_0311 <400> 35 atgactctgg ctgaagaaat cctgtccaag aaagttggta agaaagttaa agcgggtgac 60 gttgttgaaa tcgatatcga cctggcgatg actcacgacg gtactactcc gctgtctgcg 120 aaagcattca agcagatcac tgacaaagta tgggataaca agaaaatcgt tatcgttttc 180 gaccacaacg ttccggctaa caccctgaaa gctgctaaca tgcagaagat cactcgcgaa 240 ttcatcaaag agcagaacat catcaaccac tacctggacg gtgaaggtgt ttgccaccag 300 gtactgccgg aaaacggtca cattcagccg aacatggtta tcgctggcgg cgattctcac 360 acctgtactt acggcgcatt cggtgcgttc gctactggct tcggtgcaac tgacatgggt 420 aacatctacg caactggtaa aacctggctg aaagttccga aaactattcg tatcaacgtt 480 aacggtgaaa acgacaagat caccggtaaa gacatcatcc tgaaaatctg caaagaagtt 540 ggtcgttctg gtgcaactta catggcgctg gaatacggtg gtgaagcaat caagaaactg 600 tctatggacg aacgtatggt tctgtctaao atggctatcg aaatgggtgg taaagttggt 660 ctgatcgaag ctgacgaaac cacttacaac tatctgcgta acgttggtat t tctgaagag 720 aagatcctgg aactgaagaa aaaccagatc actatcgacg aaaacaacat cgacaacgac 780 aactactaca aaatcatcaa catcgacatc actgacatgg aagaacaggt tgcttgcccg 840 caccacccgg ataacgttaa aaacatctct gaagttaaag gcgcaccaat caaccaggta 900 ttcatcggtt cctgcaccaa cggtcgcctg aacgatctgc gcattgcttc taaatacctg 960 aaaggtaaga aagttcacaa cgacgtacgt ctgatcgtta tcccggcttc caagtctatc 1020 38 201217536 ttcaagcagg cgctgaaaga aggtctgatc gacatcttcg ttgacgctgg cgcgctgatc 1080 tgcactccgg gttgcggtcc gtgcctgggt gcacaccagg Gcgtactggg tgacggtgaa 1140 gtttgcctgg caactaccaa ccgtaacttc aaaggtcgta tgggtaacac cactgctgaa 1200 atctacctgt cctctccggc aatcgctgct aaatctgcta tcaaaggtta catcactaac 1260 gag 1263 <210> 36 <211> 1254

<212> DNA <213> Methanococcus vannielii <220><221> CDS <222> (1)..(1254) <400> 36 atg act ctg get gaa get Ate ctg tee aag aaa ctg ggt aaa aac gtt 48

Met Thr Leu Ala Glu Ala lie Leu Ser Lys Lys Leu Gly Lys Asn Val 15 10 15 tac get aaa gac tee gtt gaa ate gac gtt gat ctg gca atg act cac 96

Tyr Ala Lys Asp Ser Val Glu lie Asp Val Asp Leu Ala Met Thr His 20 25 30 gac ggt act act ccg ctg acc gtt aaa geg ttc gaa gag ate tet gac 144

Asp Gly Thr Thr Pro Leu Thr Val Lys Ala Phe Glu Glu lie Ser Asp 35 40 45 ege gta ttc gac aac aag aag ate gtt ate gtt ttc gac cac aac ate 192 Arg Val Phe Asp Asn Lys Lys lie Val lie Val Phe Asp His Asn lie 50 55 60 ccg get aac acc tet aaa geg gca aac atg cag ate ate act ege gac 240

Pro Ala Asn Thr Ser Lys Ala Ala Asn Met Gin lie lie Thr Arg Asp 65 70 75 80 ttc ate aag aag cac gac ate aaa aac tac tac ctg gat ggt gaa ggt 288

Phe Me Lys Lys His Asp lie Lys Asn Tyr Tyr Leu Asp Gly Glu Gly 85 90 95 ate tgc cac cag att ctg ccg gaa aaa ggt cac gtt aag ccg aac atg 336 lie Cys His Gin Me Leu Pro Glu Lys Gly His Val Lys Pro Asn Met 100 105 110 gtt ate gtt ggt get gac tet cac act tgc act cac ggt geg ttc ggt 384 Val lie Val Gly Ala Asp Ser His Thr Cys Thr His Gly Ala Phe Gly 115 120 125 gca ttc gca act ggc ttc ggt get tet Gac atg ggt tac gtt tac gca 432 Ala Phe Ala Thr Gly Phe Gly Ala Ser Asp Met Gly Tyr Val Tyr Ala 130 135 140 act ggt aaa acc tgg ttc ege gta ccg gaa acc ate ege gtt aac gta 480

Thr Gly Lys Thr Trp Phe Arg Val Pro Glu Thr lie Arg Val Asn Val 145 150 155 160 act ggt aaa aac gaa aac ate tee ggt aaa gat ate gtt ctg aaa act 528 Thr Gly Lys Asn Glu Asn lie Ser Gly Lys Asp lie Val Leu Lys Thr 165 170 175 tgc aaa gaa gtt ggt cgt tet ggt gca act tac atg geg ctg gaa tac 576 Cys Lys Glu Val Gly Arg Ser Gly Ala Thr Tyr Met Ala Leu Glu Tyr 180 185 190 ggt ggt tet get gtt aaa geg ctg Aac atg gac gaa cgt atg gta ctg 624 Gly Gly Ser Ala Val Lys Ala Leu Asn Met Asp Glu Arg Met Val Leu 195 200 205 tgc aac atg get ate gaa atg ggt ggt aaa gtt ggt ctg att gaa get 672 39 201217536

Cys Asn Met Ala lie Glu Met Gly Gly Lys Val Gly Leu lie Glu Ala 210 215 220 gac cac acc act tac gac tac ctg aaa aac get ggc gta tet aac cag 720 Asp His Thr Thr Tyr Asp Tyr Leu Lys Asn Ala Gly Val Ser Asn Gin 225 230 235 240 gaa ate get gaa ctg cag cgt aac aag ate tee ate act gaa aac gaa 768

Glu lie Ala Glu Leu Gin Arg Asn Lys lie Ser lie Thr Glu Asn Glu 245 250 255 gaa act tac ttc aaa acc gtt gag ttc gac ate act gac atg gaa gaa 816 Glu Thr Tyr Phe Lys Thr Val Glu Phe Asp lie Thr Asp Met Glu Glu 260 265 270 cag gtt get tgc ccg cac cac ccg gat aac gtt aaa ggt ate tet gaa 864 Gin Val Ala Cys Pro His His Pro Asp Asn Val Lys Gly lie Ser Glu 275 280 285 gtt ctg ggt act ccg ate gac cag att Ttc ate ggt tee tgc acc aac 912

Val Leu Gly Thr Pro lie Asp Gin lie Phe lie Gly Ser Cys Thr Asn 290 295 300 ggt cac ate ggc gat ctg cgt ate get geg aag att ctg aaa ggt aag 960

Gly His lie Gly Asp Leu Arg lie Ala Ala Lys Me Leu Lys Gly Lys 305 310 315 320 tet ate aac aaa aac acc cgt ctg ate gtt ate ccg get tet aaa tet 1008 Ser lie Asn Lys Asn Thr Arg Leu Me Val lie Pro Ala Ser Lys Ser 325 330 335 ate ctg aag cag geg ctg aac gaa ggt ctg ate gac ate ttc gtt gac 1056 lie Leu Lys Gin Ala Leu Asn Glu Gly Leu lie Asp lie Phe Val Asp 340 345 350 ttc ggt geg ctg ate tgc gca cca Ggt tgc ggt ccg tgc ctg ggt gca 1104 Phe Gly Ala Leu lie Cys Ala Pro Gly Cys Gly Pro Cys Leu Gly Ala 355 360 365 cac gaa ggc gta ctg ggt gac ggt gaa gtt tgc ctg gca act acc aac 1152 His Glu Gly Val Leu Gly Asp Gly Glu Val Cys Leu Ala Thr Thr Asn 370 375 380 cgt aac ttc aaa ggt cgt atg ggt aac ate aac tet gaa gtt tac ctg 1200 Arg Asn Phe Lys Gly Arg Met Gly Asn lie Asn Ser Glu Val Tyr Leu 385 390 395 400 tee tet ccg gca ate get get aaa tet get ate aaa ggt cac ate act 1248 Ser Ser Pro Ala lie Ala Ala Lys Ser Ala lie Lys Gly His lie Thr 405 410 415 1254 aac gag Asn Glu <210> 37 <211&gt ; 418

<212> PRT <213> Methanococcus vannielii <400> 37

Met Thr Leu Ala Glu Ala lie Leu Ser Lys Lys Leu Gly Lys Asn Val 15 10 15

Tyr Ala Lys Asp Ser Val Glu Me Asp Val Asp Leu Ala Met Thr His 20 25 30

Asp Gly Thr Thr Pro Leu Thr Val Lys Ala Phe Glu Glu lie Ser Asp 35 40 45 40 201217536

Arg Val Phe Asp Asn Lys Lys lie Val lie Val Phe Asp His Asn lie 50 55 60

Pro Ala Asn Thr Ser Lys Ala Ala Asn Met Gin lie lie Thr Arg Asp 65 70 75 80

Phe lie Lys Lys His Asp lie Lys Asn Tyr Tyr Leu Asp Gly Glu Gly 85 90 95 lie Cys His Gin lie Leu Pro Glu Lys Gly His Val Lys Pro Asn Met 100 105 110

Val lie Val Gly Ala Asp Ser His Thr Cys Thr His Gly Ala Phe Gly 115 120 125

Ala Phe Ala Thr Gly Phe Gly Ala Ser Asp Met Gly Tyr Val Tyr Ala 130 135 140

Thr Gly Lys Thr Trp Phe Arg Val Pro Glu Thr He Arg Val Asn Val 145 150 155 160

Thr Gly Lys Asn Glu Asn lie Ser Gly Lys Asp lie Val Leu Lys Thr 165 170 175

Cys Lys Glu Val Gly Arg Ser Gly Ala Thr Tyr Met Ala Leu Glu Tyr 180 185 190

Gly Gly Ser Ala Val Lys Ala Leu Asn Met Asp Glu Arg Met Val Leu 195 200 205

Cys Asn Met Ala lie Glu Met Gly Gly Lys Val Gly Leu lie Glu Ala 210 215 220

Asp His Thr Thr Tyr Asp Tyr Leu Lys Asn Ala Gly Val Ser Asn Gin 225 230 235 240

Glu lie Ala Glu Leu Gin Arg Asn Lys lie Ser lie Thr Glu Asn Glu 245 250 255

Glu Thr Tyr Phe Lys Thr Val Glu Phe Asp lie Thr Asp Met Glu Glu 260 265 270

Gin Val Ala Cys Pro His His Pro Asp Asn Val Lys Gly lie Ser Glu 275 280 285

Val Leu Gly Thr Pro lie Asp Gin lie Phe lie Gly Ser Cys Thr Asn 290 295 300

Gly His lie Gly Asp Leu Arg lie Ala Ala Lys lie Leu Lys Gly Lys 305 310 315 320

Ser lie Asn Lys Asn Thr Arg Leu lie Val lie Pro Ala Ser Lys Ser 325 330 335 lie Leu Lys Gin Ala Leu Asn Glu Gly Leu lie Asp lie Phe Val Asp 340 345 350 41 201217536

Phe Gly Ala Leu lie Cys Ala Pro Gly Cys Gly Pro Cys Leu Gly Ala 355 360 365

His Glu Gly Val Leu Gly Asp Gly Glu Val Cys Leu Ala Thr Thr Asn 370 375 380

Arg Asn Phe Lys Gly Arg Met Gly Asn lie Asn Ser Glu Val Tyr Leu 385 390 395 400

Ser Ser Pro Ala lie Ala Ala Lys Ser Ala lie Lys Gly His lie Thr 405 410 415

Asn Glu <210> 38 <211> 1257

≪ 212 > DNA < 213 > Wan's for methane bacteria (Methanococcus vannielii) < 400 > 38 atgacacttg ctgaagcaat tctttcaaaa aaacttggaa aaaatgtata tgctaaagat 60 agcgttgaaa tagacgtcga ccttgcaatg acccatgatg gaactacgcc attgactgta 120 aaagctttcg aagaaatttc agacagggtt tttgataata aa.aaaatagt aatagttttt 180 gaccataata ttccagcaaa tacgtcaaaa gcagcaaata tgcagattat aacaagagac 240 ttcattaaaa aacacgacat taaaaactac tatcttgatg gagaaggaat atgtcatcaa 300 atacttcctg aaaaaggcca tgtaaagcca aacatggtaa tcgttggtgc agatagccat 360 acctgtaccc atggggcatt tggggctttt gcaacgggtt ttggtgcaag cgacatgggt 420 tacgtttatg ctactggaaa aacatggttt agagttcctg aaacaatacg ggtgaatgtt 480 actggtaaaa acgaaaatat ttccggaaag gacattgttt taaaaacctg taaagaagtt 540 ggaagaagtg gtgcaacata tatggcattg gaatacggag gaagtgctgt aaaagcccta 600 aacatggatg aaagaatggt tttatgcaat atggcaattg aaatgggcgg Aaaagttgga 660 ttaattgaag cagaccatac aacttacgat taccttaaaa atgcaggcgt ttccaatcaa 720 gaaatagccg aattacaaag aaacaaaatt tcaattactg aaaatgaaga aacatacttt 780 a aaactgttg aatttgatat aactgacatg gaagaacaag ttgcatgccc acatcatccc 840 gataatgtaa aaggtatttc tgaggtttta ggtactccta ttgaccaaat atttatcggt 900 tcttgtacaa atgggcatat aggcgacctt agaattgctg caaaaatttt aaaaggaaaa 960 tccataaata aaaatacaag gcttatagta attcctgcat ctaaatcgat acttaaacag 1020 gccctaaatg aaggattaat tgatattttt gtggattttg gtgcattaat ctgtgctcca 1080 ggatgcggcc cttgccttgg cgcacatgaa ggggtacttg gcgatggtga agtatgtctt 1140 gcaactacaa accgcaactt taaaggaaga atgggaaaca ttaattcaga ggtatattta 1200 tcttctccag Caattgctgc aaaaagtgca attaaagggc atattacaaa cgaataa 1257 <210> 39 <211> 483

<212> DNA <213> Methanococcus vannielii 42 201217536 <220><221> CDS <222> (1)..(483) <400> 39 atg aag ctg aaa Ggt aaa gcg cac gta ttc tct gac gac gtt gat act 48

Met Lys Leu Lys Gly Lys Ala His Val Phe Ser Asp Asp Va! Asp Thr 15 10 15 gac gca ate att ccg ggt get tat ctg cgt act act gac gtt tac gaa 96

Asp Ala lie lie Pro Gly Ala Tyr Leu Arg Thr Thr Asp Val Tyr Glu 20 25 30 ctg gca tct cac tgc atg get ggt ate gac gaa aac ttc ccg aag aaa 144

Leu Ala Ser His Cys Met Ala Gly lie Asp Glu Asn Phe Pro Lys Lys 35 40 45 gtt aac ctg ggt gac ttc ate gtt get ggc gaa aac ttc ggt tgc ggt 192 Val Asn Leu Gly Asp Phe lie Val Ala Gly Glu Asn Phe Gly Cys Gly 50 55 60 tct tcc cgt gaa cag gca ccg ate tcc ate aaa tac ctg ggt ate tee 240

Ser Ser Arg Glu Gin Ala Pro lie Ser lie Lys Tyr Leu Gly lie Ser 65 70 75 80 gca ate ate get gaa tcc ttc get ege att ttc tac cgt aac tcc ate 288 Ala lie lie Ala Glu Ser Phe Ala Arg lie Phe Tyr Arg Asn Ser lie 85 90 95 aac ctg ggt gtt ate ccg ate gaa tgc aaa aac ate tcc aag cac gtt 336

Asn Leu Gly Val lie Pro lie Glu Cys Lys Asn lie Ser Lys His Val 100 105 110 aaa act ggc gac ctg ate gaa ctg gat ctg gaa aac aag aaa ate ate 384 Lys Thr Gly Asp Leu lie Glu Leu Asp Leu Glu Asn Lys Lys Lie lie 115 120 125 ctg aaa gac ate gtt ctg gaa tgc acc gta ccg act ggt aaa gcg aaa 432 Leu Lys Asp Me Val Leu Glu Cys Thr Val Pro Thr Gly Lys Ala Lys 130 135 140 gag ate ate gac ctg ggt ggt ctg ate Aac tac get aaa gcg cag atg 480

Glu lie Me Asp Leu Gly Gly Leu Me Asn Tyr Ala Lys Ala Gin Met 145 ggt Gly 150 155 160 483 <210><211><212><213><400> 40 161

PRT Methanococcus vannielii 40

Met Lys Leu Lys Gly Lys Ala His Val Phe Ser Asp Asp Val Asp Thr 15 10 15

Asp Ala lie lie Pro Gly Ala Tyr Leu Arg Thr Thr Asp Val Tyr Glu 20 25 30

Leu Ala Ser His Cys Met Ala Gly lie Asp Glu Asn Phe Pro Lys Lys 35 40 45

Val Asn Leu Gly Asp Phe lie Val Ala Gly Glu Asn Phe Gly Cys Gly 50 55 60

Ser Ser Arg Glu Gin Ala Pro lie Ser lie Lys Tyr Leu Gly He Ser 43 201217536 65 70 75 80

Ala lie lie Ala Glu Ser Phe Ala Arg lie Phe Tyr Arg Asn Ser lie 85 90 95

Asn Leu Gly Val lie Pro lie Glu Cys Lys Asn lie Ser Lys His Val 100 105 110

Lys Thr Gly Asp Leu lie Glu Leu Asp Leu Glu Asn Lys Lys lie lie 115 120 125

Leu Lys Asp lie Val Leu Glu Cys Thr Val Pro Thr Gly Lys Ala Lys 130 135 140

Glu lie lie Asp Leu Gly Gly Leu Me Asn Tyr Ala Lys Ala Gin Met 145 150 155 160

Gly <210> 41 <211> 486

60 ccaggagcat atctaagaac tactgatgtt tatgaacttg catcgcactg tatggcgggg 120 attgatgaga attttcctaa aaaagtaaat ttgggggatt ttattgttgc aggtgaaaat 180 tttggctgtg gaagttcaag ggaacaggct ccaatttcga taaaatatct tggaataagt 41 atgaaattaa aaggcaaagc acacgtattt tcagatgatg tcgataccga tgctataatt; < 212 > DNA < 213 > Wan's A Hyun lactis (Methanococcus vannielii) < 400 & gt 240 gcaataattg cggaaagttt tgcaagaatt ttttatcgaa attctataaa cttaggtgta 300 attccaattg aatgcaaaaa catttcaaaa cacgttaaaa caggggattt aatagaatta 360 gaccttgaaa acaaaaaaat cattttaaaa gacattgttt tagaatgcac ggttccaact 420 ggaaaggcaa aagaaataat tgatttaggc gggcttataa attatgcaaa agcgcaaatg 480 ggctaa 486 < 210 > 42 < 211 > 1029

<212> DNA <213> variegated genus; Methanococcus aeolicus <220><221> CDS <222> (1)..(1029) <400> 42 atg aag ate ccg aaa Ate tgc gtt ate gaa ggt gac ggt ate ggt aaa 48

Met Lys lie Pro Lys lie Cys Val Me Glu Gly Asp Gly lie Gly Lys 15 10 15 gaa gtt ate cca gaa acc gtt ege att ctg aaa gaa ate ggt gac ttc 96

Glu Val lie Pro Glu Thr Val Arg lie Leu Lys Glu lie Gly Asp Phe 20 25 30 gaa ttc ate tac gaa cac get ggt tac gaa tgc ttc aag ege tgc ggt 144 Glu Phe lie Tyr Glu His Ala Gly Tyr Glu Cys Phe Lys Arg Cys Gly 35 40 45 44 201217536 gac get ate ccg gag aaa act ctg aaa act geg aaa gag tgc gac get 192

Asp Ala lie Pro Glu Lys Thr Leu Lys Thr Ala Lys Glu Cys Asp Ala 50 55 60 ate ctg ttc ggt geg gta tet act ccg aaa ctg gac gaa act gaa cgt 240 lie Leu Phe Gly Ala Val Ser Thr Pro Lys Leu Asp Glu Thr Glu Arg 65 70 75 80 aag ccg tac aaa tet ccg att ctg act ctg cgt aaa gaa ctg gat ctg 288 Lys Pro Tyr Lys Ser Pro lie Leu Thr Leu Arg Lys Glu Leu Asp Leu 85 90 95 tac get aac gtt cgt ccg ate cac Aaa ctg gat aac tet gac tee tee 336 Tyr Ala Asn Val Arg Pro lie His Lys Leu Asp Asn Ser Asp Ser Ser 100 105 110 aac aac ate gac ttc ate ate ate cgt gaa aac act gaa ggt ctg tac 384

Asn Asn lie Asp Phe lie lie lie Arg Glu Asn Thr Glu Gly Leu Tyr 115 120 125 tee ggt gtt gaa tac tac gac gaa gaa aaa gaa ctg gca ate tet gaa 432 Ser Gly Val Glu Tyr Tyr Asp Glu Glu Lys Glu Leu Ala lie Ser Glu 130 135 140 cgt cac ate tee aag aaa ggt tee aag ege ate ate aaa ttc gca ttc 480

Arg His Me Ser Lys Lys Gly Ser Lys Arg lie lie Lys Phe Ala Phe 145 150 155 160 gaa tac get gtt aag cac cac cgt aag aaa gtt tee tgc ate cac aag 528 _ Glu Tyr Ala Val Lys His His Arg Lys Lys Val Ser Cys lie His Lys . 165 170 175 " tet aac ate ctg cgt ate act gac ggt ctg ttc ctg aac ate ttc aac 576 * Ser Asn He Leu Arg lie Thr Asp Gly Leu Phe Leu Asn lie Phe Asn 180 185 190 gaa ttc aaa Gaa aaa tac aaa aac gaa tac aac ate gaa ggt aac gac 624

Glu Phe Lys Glu Lys Tyr Lys Asn Glu Tyr Asn lie Glu Gly Asn Asp 195 200 205 tac ctg gtt gac gca act geg atg tac ate ctg aaa tet ccg cag atg 672 Tyr Leu Val Asp Ala Thr Ala Met Tyr lie Leu Lys Ser Pro Gin Met 210 215 220 ttc gac gtt ate gtt act acc aac ctg ttc ggt gac att ctg tet gac 720 Phe Asp Val lie Val Thr Thr Asn Leu Phe Gly Asp lie Leu Ser Asp 225 230 235 240 gaa geg tet ggt ctg ctg ggt ggt Ctg ggt ctg geg ccg tet get aac 768 Glu Ala Ser Gly Leu Leu Gly Gly Leu Gly Leu Ala Pro Ser Ala Asn 245 250 255 ate ggt gac aac tac ggt ctg ttc gaa ccg gtt cac ggt tet gca ccg 816 lie Gly Asp Asn Tyr Gly Leu Phe Glu Pro Val His Gly Ser Ala Pro 260 265 270 gat ate get ggt aaa ggc gtt get aac ccg ate get gca gta ctg tet 864 Asp lie Ala Gly Lys Gly Val Ala Asn Pro lie Ala Ala Val Leu Ser 275 280 285 Get tet atg atg ctg tac tac ctg gat atg aaa gag aag tet ege ctg 912 Ala Ser Met Met Leu Tyr Tyr Leu Asp Met Lys Glu Lys Ser Arg Leu 290 295 300 ctg aaa gac get gtt aaa cag gta ctg gca cac aaa gac ateAct ccg 960

u a la la la la la la la 305 305 Lys lie lie 325 330 335 gaa gaa ctg cgt aag ate teg Glu Glu Leu Arg Lys lie Ser 340 45 1029 201217536 <210> 43 <211> 343

<212> PRT <213> Methanococcus aeolicus <400> 43

Met Lys lie Pro Lys lie Cys Val lie Glu Gly Asp Gly Me Gly Lys 15 10 15

Glu Val lie Pro Glu Thr Val Arg lie Leu Lys Glu lie Gly Asp Phe 20 25 30

Glu Phe lie Tyr Glu His Ala Gly Tyr Glu Cys Phe Lys Arg Cys Gly 35 40 45

Asp Ala lie Pro Glu Lys Thr Leu Lys Thr Ala Lys Glu Cys Asp Ala 50 55 60 lie Leu Phe Gly Ala Val Ser Thr Pro Lys Leu Asp Glu Thr Glu Arg 65 70 75 80

Lys Pro Tyr Lys Ser Pro lie Leu Thr Leu Arg Lys Glu Leu Asp Leu 85 90 95

Tyr Ala Asn Val Arg Pro lie His Lys Leu Asp Asn Ser Asp Ser Ser 100 105 110

Asn Asn Me Asp Phe lie lie lie Arg Glu Asn Thr Glu Gly Leu Tyr 115 120 125

Ser Gly Val Glu Tyr Tyr Asp Glu Glu Lys Glu Leu Ala lie Ser Glu 130 135 140

Arg His lie Ser Lys Lys Gly Ser Lys Arg lie lie Lys Phe Ala Phe 145 150 155 160

Glu Tyr Ala Val Lys His His Arg Lys Lys Val Ser Cys lie His Lys 165 170 175

Ser Asn lie Leu Arg lie Thr Asp Gly Leu Phe Leu Asn lie Phe Asn 180 185 190

Glu Phe Lys Glu Lys Tyr Lys Asn Glu Tyr Asn lie Glu Gly Asn Asp 195 200 205

Tyr Leu Val Asp Ala Thr Ala Met Tyr lie Leu Lys Ser Pro Gin Met 210 215 220

Phe Asp Val lie Val Thr Thr Asn Leu Phe Gly Asp lie Leu Ser Asp 225 230 235 240

Glu Ala Ser Gly Leu Leu Gly Gly Leu Gly Leu Ala Pro Ser Ala Asn 245 250 255 lie Gly Asp Asn Tyr Gly Leu Phe Glu Pro Val His Gly Ser Ala Pro 260 265 270 46 201217536

Asp lie Ala Gly Lys Gly Val Ala Asn Pro lie Ala Ala Val Leu Ser 275 280 285

Ala Ser Met Met Leu Tyr Tyr Leu Asp Met Lys Glu Lys Ser Arg Leu 290 295 300

Leu Lys Asp Ala Val Lys Gin Val Leu Ala His Lys Asp lie Thr Pro 305 310 315 320

Asp Leu Gly Giy Asn Leu Lys Thr Lys Glu Val Ser Asp Lys lie lie 325 330 335

Glu Glu Leu Arg Lys lie Ser 340 <210> 44 <211> 1032

<212> DNA <213> Methanococcus aeolicus <220><221> CDS <222> (1)..(1032) <400> 44 ttg aaa ata cct aaa ata Tgt gtg ata gaa ggg gac ggc ata gga aaa 48

Leu Lys lie Pro Lys lie Cys Val lie Glu Gly Asp Gly Me Gly Lys 15 10 15 gaa gta ata cct gaa aca gtc cgc ata tta aaa gaa ata ggg gac ttt 96

Glu Val Me Pro Glu Thr Val Arg lie Leu Lys Glu lie Gly Asp Phe 20 25 30 gaa ttc ata tat gaa cat gcg gga tat gaa tgt ttt aaa egg tgc ggt 144 Glu Phe lie Tyr Glu His Ala Gly Tyr Glu Cys Phe Lys Arg Cys Gly 35 40 45 gat gca ata ccc gaa aaa aca tta aaa act gca aaa gaa tgc gat gcc 192

Asp Ala lie Pro Glu Lys Thr Leu Lys Thr Ala Lys Glu Cys Asp Ala 50 55 60 ata tta ttt ggt gca gtt age acc cct aaa tta gat gaa aeg gag ega 240 lie Leu Phe Gly Ala Val Ser Thr Pro Lys Leu Asp Glu Thr Glu Arg 65 70 75 80 aaa cca tat aaa age ccc ata tta aca ett aga aaa gaa tta gac eta 288 Lys Pro Tyr Lys Ser Pro Me Leu Thr Leu Arg Lys Glu Leu Asp Leu 85 90 95 tat gca aat gta aga cca ata cat Aaa tta gat aat tcc gat agt tea 336 Tyr Ala Asn Val Arg Pro Me His Lys Leu Asp Asn Ser Asp Ser Ser 100 105 110 384 432 480 160 aat aat ata gat ttc ata ata att ega gaa aac aca gaa gga eta tat Asn Asn Lie Asp Phe lie lie lie Arg Glu Asn Thr Glu Gly Leu Tyr 115 120 125 tet ggt gtg gaa tat tat gac gaa gaa aaa gag ttg gca ata teg gaa Ser Gly Val Glu Tyr Tyr Asp Glu Glu Lys Glu Leu Ala lie Ser Glu 130 135 140 agg cat ata tet aaa aaa gga age aaa aga att att aaa ttt gca ttt Arg His lie Ser Lys Lys Gly Ser Lys Arg lie Me Lys Phe Ala Phe 145 150 155 gaa tat get gtg aaa cat cac aga aaa aaa gta tcc tgt Ate cat aaa G Lu Tyr Ala Val Lys His His Arg Lys Ly Ser Vals Cys lie His Lys 528 47 201217536 165 170 175 tea aat att tta aga att aeg gac ggt ett ttt tta aac ata ttc aat 576 Ser Asn lie Leu Arg Me Thr Asp Gly Leu Phe Leu Asn Me Phe Asn 180 185 190 gaa ttt aaa gaa aaa tat aaa aat gaa tac aat ata gaa gga aac gat 624

Glu Phe Lys Glu Lys Tyr Lys Asn GIu Tyr Asn lie Glu Gly Asn Asp 195 200 205 tat tta gta gat get aeg gca atg tat att tta aaa age cca caa atg 672 Tyr Leu Val Asp Ala Thr Ala Met Tyr lie Leu Lys Ser Pro Gin Met 210 215 220 ttc gat gta att gta act aca aat tta ttt ggt gac ata tta tcc gat 720 Phe Asp Val lie Val Thr Thr Asn Leu Phe Gly Asp lie Leu Ser Asp 225 230 235 240 gaa gca teg gga tta ttg gga ggt Tta ggc ttg get cct tea gca aat 768 Glu Ala Ser Gly Leu Leu Gly Gly Leu Gly Leu Ala Pro Ser Ala Asn 245 250 255 att ggg gat aat tat gga tta ttt gag cct gtg cat ggt tcc gcc cca 816 lie Gly Asp Asn Tyr Gly Leu Phe Glu Pro Val His Gly Ser Ala Pro 260 265 270 gac ata get gga aaa ggt gtt gca aat ccg ata get geg gtt ett agt 864

Asp lie Ala Gly Lys Gly Val Ala Asn Pro lie Ala Ala Val Leu Ser 275 280 285 get teg atg atg eta tat tac eta gat atg aag gag aaa agt agg eta 912 Ala Ser Met Met Leu Tyr Tyr Leu Asp Met Lys Glu Lys Ser Arg Leu 290 295 300 tta aaa gat gcc gta aaa cag gtg ttg gcc cat aaa gat ata act cct 960 Leu Lys Asp Ala Val Lys Gin Val Leu Ala His Lys Asp lie Thr Pro 305 310 315 320 gat tta ggg ggc aat tta aaa aca Aag gaa gta age gat aaa att att 1008 Asp Leu Gly Gly Asn Leu Lys Thr Lys Glu Val Ser Asp Lys lie lie 325 330 335 gaa gaa tta egg aaa ata tcc taa 1032

Glu Glu Leu Arg Lys lie Ser 340 <210> 45 <211> 343

<212> PRT <213> Methanococcus aeolicus <400> 45

Leu Lys lie Pro Lys lie Cys Val lie Glu Gly Asp Gly lie Gly Lys 15 10 15

Glu Val lie Pro Glu Thr Val Arg lie Leu Lys Glu lie Gly Asp Phe 20 25 30

Glu Phe lie Tyr Glu His Ala Gly Tyr Glu Cys Phe Lys Arg Cys Gly 35 40 45

Asp Ala lie Pro Glu Lys Thr Leu Lys Thr Ala Lys Glu Cys Asp Ala 50 55 60 lie Leu Phe Gly Ala Val Ser Thr Pro Lys Leu Asp Glu Thr Glu Arg 65 70 75 80

Lys Pro Tyr Lys Ser Pro lie Leu Thr Leu Arg Lys Glu Leu Asp Leu 48 201217536 85 90 95

Tyr Ala Asn Val Arg Pro lie His Lys Leu Asp Asn Ser Asp Ser Ser 100 105 110

Asn Asn lie Asp Phe lie lie lie Arg Glu Asn Thr Glu Gly Leu Tyr 115 120 125

Ser Gly Val Glu Tyr Tyr Asp Glu Glu Lys Glu Leu Ala lie Ser Glu 130 135 140

Arg His lie Ser Lys Lys Gly Ser Lys Arg lie lie Lys Phe Ala Phe 145 150 155 160

Glu Tyr Ala Val Lys His His Arg Lys Lys Val Ser Cys lie His Lys 165 170 175

Ser Asn He Leu Arg lie Thr Asp Gly Leu Phe Leu Asn lie Phe Asn 180 185 190

Glu Phe Lys Glu Lys Tyr Lys Asn Glu Tyr Asn lie Glu Gly Asn Asp 195 200 205

Tyr Leu Val Asp Ala Thr Ala Met Tyr lie Leu Lys Ser Pro Gin Met 210 215 220

Phe Asp Val Me Val Thr Thr Asn Leu Phe Gly Asp lie Leu Ser Asp 225 230 235 240

Glu Ala Ser Gly Leu Leu Gly Gly Leu Gly Leu Ala Pro Ser Ala Asn 245 250 255 lie Gly Asp Asn Tyr Gly Leu Phe Glu Pro Val His Gly Ser Ala Pro 260 265 270

Asp lie Ala Gly Lys Gly Val Ala Asn Pro lie Ala Ala Val Leu Ser 275 280 285

Ala Ser Met Met Leu Tyr Tyr Leu Asp Met Lys Glu Lys Ser Arg Leu 290 295 300

Leu Lys Asp Ala Val Lys Gin Val Leu Ala His Lys Asp lie Thr Pro 305 310 315 320

Asp Leu Gly Gly Asn Leu Lys Thr Lys Glu Val Ser Asp Lys Me lie 325 330 335

Glu Glu Leu Arg Lys lie Ser 340 <210> 46 <211> 32 <212> DNA <213> Synthetic <220><223> Introduction 49 201217536 <400> 46 aaatttggta ccgctaggag gaattaacca tg &lt ;210> 47 <211> 33 <212> DNA <213> Synthetic <220><223> Introduction <400> 47 aaatttacta gtaagctggg tttacgcgac ttc <210> 48 <211> 33 <212> DNA <213> Synthetic <220><223> Introduction <400> 48 aaatttacta gtggctagga ggaattacat atg <210> 49 <211> 35 <212> DNA <213> Synthetic <220><223> primer <400> 49 aaatttaagc ttattacttg ttctgctccg caaac

Claims (1)

201217536 VII. Patent Application Range·· 1. A method for preparing α-keto pimelic acid, which comprises converting alpha ketoglutarate into adipic acid and converting α-ketoadipate into heart ketone The acid' wherein at least one of the conversions is carried out using a heterologous biocatalyst that catalyzes at least one of the conversions, wherein the heterologous biocatalyst comprises: - an AksD enzyme having high η aconitase activity or It has homologues of high aconitase activity, _AksE enzyme with n-aconitase activity or homologue thereof with high n-aconitase activity, _ 咼η-isocitrate dehydrogenase An active AksF enzyme or a homolog thereof having 咼η-aconitase activity, wherein the genus is selected from the AksD enzyme, the AksE enzyme, and the AksF enzyme, and any homologue thereof The enzymes of the group are derived from the genus Streptomyces faecalis (Attendance (7) (10) (4) ______________________________________________________________________________________________________________________________________________________________________________________________________________________________ Lion enzyme, the enzyme and the yeast And the enzymes of the group of homologues of any of these are from the snail color of the snails, especially from the variegated simmering snails a kai3, and the enzymes or their functions are similar. I. The method of claim 1 or 2, wherein the fine enzyme is from M. oxysporum or M. vanillus (fine _ a stupid, and the AksD enzyme or its functional analog and (9) Wherein the 201217536 AkSE enzyme is an AksE enzyme or a functional analog thereof derived from M. variabilis or M. vanillus. 4. The method of claim 3, wherein the gossip 1) enzyme is selected from An AksD enzyme or a functional analog thereof derived from M. variabilis, and wherein the AksE enzyme is selected from AksE enzyme derived from M. variabilis or a functional analog thereof. 5. U.S. Patent Application No. U4 The method of any one of the above, wherein the <> trace enzyme is a statin or a functional analog thereof from the genus S. sphaeroides. 6. The method of any one of claims (1), wherein Biocatalysts contain Nif with high (n) citrate activity v enzyme or another enzyme or a homolog thereof having high (n) citrate activity. 7. The method of claim 6, wherein the biocatalyst comprises a NifV enzyme having high (10) lemon activity, From the group consisting of Nifv enzymes derived from brown nitrogen-fixing bacteria ((6)-W oil secrets) and their functional analogues. 8. As for the method of claim 1 to 7 of the scope of the patent, cc- shouting a diacid produced by a biocatalytic process from a carbon source, especially from a carbohydrate. 9. The method of claim 1, wherein the biocatalyst comprises: - at least - lion fV enzyme, Select from the sequence identification number: the group consisting of the enzyme and its functional analogues; - at least - the enzyme, selected from the sequence identification number: 37, the AksD enzyme and its functional analogues Group 201217536 - at least one AksE enzyme selected from the group consisting of AksE enzymes represented by sequence identification number: 31 and functional analogs thereof; - or at least one AksF enzyme selected from sequence identification Number: 43 indicates the AksF A group of enzymes and their functional analogues. 10. The method of claim 9, wherein the biocatalyst comprises at least one of the NifV enzymes, at least one of the AksD enzymes, at least one of the AksE enzymes, and at least one of the AksF enzymes. A method for producing 6-aminocaproic acid, which comprises: - preparing α-ketopimelic acid by the method of any one of claims 1 to 10, or removing the α-ketone a carboxyl group of pimelic acid, thereby forming 5-methylvaleric acid, and then converting the 5-valeric acid to 6-aminocaproic acid; or the method comprises any one of claims 1-7 The method of preparing α-keto pimelic acid, converting the α-keto pimelic acid to α-aminopimelic acid, and then converting α-aminopimelic acid to 6-aminocaproic acid. A method for producing α-ketosuberic acid, which comprises preparing α-ketopimelic acid according to the method of any one of claims 1 to 10, using a catalytic activity having a prolonged activity of Cr The biocatalyst is subjected to treatment with a prolonged Cr. 13. The method of claim 12, wherein the enzyme has Cr to prolong the catalytic activity of OC-ketopimelate, the enzymes are each independently derived from a methanogenic archaea. Group of organisms, 201217536 are preferably selected from the group consisting of Methanococcus, Methanocaldococcus, Methanosarcina, and heat of sputum. Methanothermobacter, Methanosphaera, Methanopyrus, and A:: Methanobrevibacter. A method for producing 7-aminoheptanoic acid, which comprises converting α-ketosuberic acid obtained by the method of claim 12 or 13 of the patent application. 15. The method of any one of claims 1 to 14, wherein the method is carried out under fermentation conditions. 16. A heterologous cell comprising one or more heterologous nucleic acid sequences encoding one or more heterologous enzymes having at least one reaction step in the preparation of alpha-ketopimelic acid from alpha-ketoglutaric acid Catalytical activity, wherein the one or more heterologous enzymes are as defined in any one of claims 1-10, and the cell optionally comprises one or more nucleic acid sequences encoded in, for example, the patent application A catalytically active enzyme in the reaction step of any of items 11-14. 17. The heterologous cell of claim 15 which comprises at least one nucleic acid sequence represented by any one of sequence identification numbers: 1, 5, 8, 23, 32, 35, 36, 39, 42 and A functional analog of any one. 18. Use of a heterologous cell as claimed in claim 16 or 17 for the preparation of the following: caprolactam, 6-aminocaproic acid, alpha-keto pimelic acid, adipic acid or hexamethylenediamine.