TW201122110A - Vectors, methods, systems and kits for protein purification - Google Patents

Abstract

Disclosed herein are autocleaved peptide linkers for producing purified proteins. The autocleaved peptide linkers are inserted between a chitin binding protein (CBP) and a target protein to form a fusion protein. Upon expression of the fusion protein, it is allowed to pass a chitin matrix so that the CBP portion of the fusion protein may be bound with the chitin matrix, the peptide linker then undergoes autocleavage in a buffer solution at a pH value of about 5.5-7.5 to release the target protein. The chitin matrix may be regenerated with another buffer solution at a pH value of about 3-4, that is, to release the bound CBP and returns to its unbond form. The chitin matrix may be reused for at least 6 times without losing activity.

Description

201122110 VI. Description of the invention: [Technical field to which the invention pertains] The present invention relates to a self-cleavable peptide (linker-linker) and a peptide-binding protein (chitin-binding) Protein, CBP) on Purified Proteins [Prior Art] Protein purification generally involves multiple operations related to column chromatography, such as ion exchange, hydrophobic interactions, and gel filtration. The best way to purify a protein is to achieve affinity separation by affinity with a gel with a specific functional group. Such column chromatography with specific functional groups includes, for example, a nickel column layer. Analysis, cytosolic modification of the column chromatography, maltose modification of the gel column chromatography or other and so on. However, there are still many defects in the protein column chromatography method that is currently prevalent in Y. For example, 'the fusion protein is usually obtained, so the protease will be used to remove the unwanted fusion site, or A gel that combines viable affinity but is expensive. In view of the above, there is a need in the related art to provide an improved method and/or system that can be used to produce purified white matter without the need for protease treatment. The improved method and/or system itself (4) is economical and can be sacrificed without sacrificing In the case of the function of the target protein itself, it is used to mass produce the target protein. SUMMARY OF THE INVENTION 201122110 The present invention herein provides a self-cleavable peptide linker for use of the peptide linker in purifying a protein. In particular, the present invention = a vector design for expressing a fusion protein comprising a chitin-binding protein (CBP) and a target protein, and a self-cleavable one of the white matter of the present invention. The peptide linker is ligated such that the fusion protein expressed by the vector passes through a chitin matrix) and the above-described peptide fragment which is cleavable from i is at a pH of about 5 without the use of a protease. The 5 to 75 buffer dissolves in self-cleavage, allowing the target protein to be released from the fusion protein. Therefore, the present invention # is often suitable for use in related applications for purification of a desired protein, including in diagnostic, research, and industrial applications. Accordingly, a first aspect of the invention provides a vector comprising: a promoter; a first-multicore (iv) operably linked to the promoter and encoding to produce a chitin-binding protein (CBP); a second polynucleotide operably linked to the first polynucleotide and encoding to produce a linker which is a - peptide and has an amino acid sequence selected from the group consisting of: , SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, and the peptide is capable of self-cleavage without the use of a protease: and a third polynucleotide, which is operatively associated with the second Multi-core thieves are connected and can encode a target protein. A second aspect of the invention provides a method for producing a target protein, the method comprising the steps of: (8) transfecting a host cell with a vector such that the host cell exhibits a fusion protein, wherein the vector comprises: a promoter , 201122110 a first polynucleotide operably linked to the promoter and encoding to produce a chitin binding protein (CBP); a second polynucleotide operably associated with the A polynucleotide is ligated and can be encoded to produce a linker which is a peptide and has an amino acid sequence selected from the group consisting of: sequence number: sequence number: 2. sequence number: 3 or sequence number: 4' And the peptide can self-cleavage without the use of a protease: and φ-di-polynucleotide, which is operably linked to the second polynuclear acid and can encode a target protein. (b Cleaving the primary cell to produce a crude extract of the fusion protein, wherein the crude extract has a pH of at least greater than 8; (c) passing the crude extract through a chitin matrix; (d) Buffer to infiltrate and clear The chitin matrix, without the use of a protease and transmitted through the self-breaking linker peptide eluted ^ manner the target protein, wherein the second - Calls buffer having a first pH value range of about 5.5 to 7.5 in. / In some embodiments, the method further comprises the step (4), after the step (c) and before the step (d): (cl) washing the chitin matrix with a), the second buffer The liquid has a second pH between the three flushes. In the case of about 3 to 4%, the soft step-pj:1 value is about 6 to. In an example, the first pH is about 6.0. Between the other. The second pH is about 3.6. ^ In the example, the third aspect of the invention provides a system for producing the target protein 201122110. The system comprises: a vector for expressing a fusion protein, comprising: a promoter, a first polynucleotide operably linked to the promoter and encoding to produce a chitin binding protein (CBp) );

a second polynucleotide operably linked to the first polynucleotide and encoding to produce a linker which is a peptide and has an amino acid sequence selected from the group consisting of: · 丨, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, and the peptide is capable of self-cleavage without the use of a protease: and a second polynucleotide operatively associated with the The second polynucleic acid is linked and can encode a target protein; a host cell for expressing the fusion protein encoded by the vector; and a chitin matrix which can utilize the following protein, the method Including: a method for purifying the (a) transfection of the host cell with the vector; (b) lysing the host cell to produce a crude extract of the fusion protein, wherein the crude extract has a pH of at least greater than 8; (c) passing the crude extract through a chitin matrix; (d) infiltrating and washing the chitin matrix with a first buffer, washing by means of no protease and the linker peptide self-cleavage Out of the target protein Wherein the first buffer has a first pH value of about 5.5 to 7.5 range; ^ 201122110 chitin group substance thereof with ^ 1. A fourth aspect of the invention is to provide a buffer for the purification of a target protein by a buffer solution having a P H value of between about 3 and about 4. The kit includes: a dragon as described above; a host cell which can be used to express the fusion protein encoded by the vector; a chitin matrix for 9 human proteins; a buffer solution for H = white matter elutes from the chitin matrix and the pH of the buffer solution is between about 6 and about 7; and instructions for how to use the kit, ^ in the form of CD, VCD or DVD . In certain embodiments: the :: the matrix comprises the low-cost chitin source - squid cartilage: One or more embodiments of the invention are described in detail below. After reading the detailed description and the request, you will get a better understanding of the features and advantages. The following description and accompanying drawings are provided to illustrate the invention, and the scope of the invention is not limited to the embodiments. [Embodiment] In order to make the description of the present invention more detailed and complete, the embodiments and specific embodiments of the present invention will be described below with reference to the accompanying drawings; on the other hand, well-known elements and steps are not described. In the embodiments, the principles and spirit of the embodiments of the present invention are not to be obscured or unnecessarily limited. Details of the methods and systems for purifying the target protein using a reusable and inexpensive chitin matrix will be described below. In order to achieve this goal, a drug containing a recombinant protein (ie, a fusion protein) containing a chitin-binding protein is provided.

The matrix can be regenerated by washing with a suitable buffer and can be reused for at least 6 times to lose activity, thus also allowing the method of the present invention to bind to chitin-binding &amp; The protein is more competitive with a self-closing skill. The first aspect of the present invention provides a φ, body which can express a fusion protein. The carrier comprises: a promoter; a first polynucleic acid; Is operably linked to the promoter and encoding to produce a chitin binding protein (CBP); a second polynucleotide operably linked to the first polynucleotide and encoding to produce a A linker which is a peptide and has an amino acid sequence selected from the group consisting of SEQ ID NO: 丨, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, and the peptide can be used without protease Self-cleavage in the case of: and a third polynucleotide operably linked to the second polynucleotide and encoding to produce a target protein. • The fusion protein herein refers to a a recombinant protein expressed, and the recombinant protein comprises, in order from the N-terminus to the C-terminus: CBP, a self-cleavable linker peptide of the present invention, and a target protein. The construction of the DNA expression vector is Those skilled in the art are well-known in the art, or can refer to the description in the embodiments herein. In order to produce a performance vector, the specific gene design is firstly based on the general introduction design principle or using the existing primer design tool on the market. Appropriate bow scorpion. In order to use this kind of primer design tool to generate multiple pairs of appropriate primers, it is better to select primer pairs with high adhesion efficiency based on primers and secondary structures such as target nucleic acids. Then, the designed pair of bows is amplified by a polymerase chain reaction (PCR) to obtain the desired nucleotide sequence, and then the acid sequence is transferred into the transfer vector. For example, pREST A, and by this, transfect host cells, such as E. coli cells, so that the eggs can be in the host cells. A large number of performances. In this field, there is a general technicalist who should be able to implement the present invention by using a suitable promoter, host cell, etc., without undue experimentation. 'Polynucleotide refers to a nucleic acid molecule comprising, a regulatory element' such that when this polynucleotide is introduced into a host, it is capable of directing the mechanism within the host cell to produce The translation product produced by the gene. In this context, the term "operably linked to" refers to the coding sequence of a multi-peptide and the way in which the translation and transcription control sequences are linked. It is such that when appropriate = and (eg, a transcriptional activator protein) binds to the regulatory sequences, the peptide can be expressed. The self-cleavable peptide linker of the present invention has an amino acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, or it has a repeat (EAAAK) The amino acid sequence of n, wherein η is 2, 3, 4 or 5. Any of the above peptide linkers can self-cleavage in a buffer solution having a pH of between about 5.5 and 7.5, thereby releasing the 'protein from the fusion protein. In one example, the peptide linker can self-cleavage in a buffer solution having a pH between about 6 and 7. In another example, the peptide linker can self-cleavage in a buffer solution having a ρη value of about ό. 201122110 The term "target protein" as used herein refers to a molecule of interest that includes a prokaryotic or a true envelope that can be expressed by a vector in a transformed host cell. Suitable target proteins include, but are not limited to, chitosanase, chitinase, disrupted to produce -beta-1,3-glucanase (laminaripentose-producing- β-Ι, 3-g|Uc LPHase), hydrolase, transferase, lyase, isomerase, thiolase such as arsenic 6, an enzyme such as an enzyme or ligase; a storage protein such as ovalbumin Endogenous transfer proteins such as blood globulin; structural proteins such as actin, cytoplasm; =, collagen, elastin, alpha•corner f protein, glycoprotein = egg; f such as antigen or antigenicity Decision-making = egg: an immunoglobulin for the preparation of vaccines; such as prothrombin and fibrinogens: hormones and interferons that bind to antigens and neutralize antibodies or immunoglobulins: Island, "prime, white blood cell growth - in the case of the 'this protein' is a chitosanase. In =. The target protein is a few Dingzhe a is a case of 'white matter is LPHase every. In another - In the examples, the chain of the egg of the target egg refers to any type of energy and CBP. Examples of the combined β-chitin matrix include, but are not limited to, chitin μ,. έ In an example, the chitin matrix is isolated from a low-cost protocartilage. Ρ • Chitin, the price is about US dollars compared to the production of cartilage ° and ... chitin is the amount of β-chitin preparation. Can ::: to f more acid or alkali treatment, so can be reduced Discard the chitin matrix to make beads, glue, tubing, thin 201122110 membrane, sponge, sputum, n, coating form or other suitable t-surface that can bind to CBP to isolate or purify the target protein or In a test test, it is analyzed whether the presence of the target protein exists. In the example, the chitin matrix is formed into a column form. "Buy master cell" refers to a protein which can express the target, CBP and/or cells of fusion protein f, and which include expression systems known in prokaryotic or eukaryotic systems, including bacteria, yeast g, insects, invertebrates, = mammalian cells including human cells. In one example, this = cell is a large intestine (four) cell. This transformed Escherichia coli cell is cultured and screened by various methods, for example, using nutrients and/or antibiotics. In a second aspect of the invention, a method for producing a purified purine protein is provided. The method comprises the steps of: mastering the vector of the present invention to transfect a host cell such that the host cell exhibits a fusion protein; and lysing the host cell to produce a crude extract of the fusion protein, wherein the crude extract The pH of the substance is at least greater than 8; (c) the crude extract is infiltrated with a first buffer by a chitin matrix, and the chitin matrix is immersed, and the egg is self-enzymed and Linking the subordinate to the target protein, wherein the first-pound value of the first-stage B+ elution has a value of between about 1.1 and 7.5 to construct the cell via the foregoing steps, for example, a resistance of 4 days. &amp; </ RTI> <RTIgt; </ RTI> <RTIgt; </ RTI> <RTIgt; </ RTI> <RTIgt; </ RTI> <RTIgt; Then, the crude extract containing the expressed fusion protein is cultured by a conventional technique, for example, mechanically or chemically destroying the cell membrane, and then the extract of the two-m fusion protein collected by centrifugation is characterized by its pH; Two / for 8. In the example, the extract is passed through a chitin matrix, for example, P_chitin prepared from the squid cartilage, and the CBP portion of the fusion protein is bound to the chitin-based group f to form a complex Things. Two = the self-fragmented linker between the protein of the invoice and the pH range of the second: In another example, self-breaking occurs at a pH range of six. approximately

^ In some embodiments, the method further comprises the step (4), which is performed after the step (4) and before the step (d): (el) washing the chitin matrix with TD =, the second buffer has a medium The first positive value of the first -= S. 5。 In this example, the second PH value is about 3.6. In certain embodiments, the first pH is between about 6 and 7. In another example, according to the second aspect of the present invention, a method for generating a == system includes: a carrier for expressing a fusion protein according to the above embodiment, Characterizing the host cell of the fusion protein encoded by the vector 13 201122110; and a chitin matrix, which is disclosed to purify the target protein; wherein the chitin, the matrix can be - pH about 3 to The buffer solution between 4 is regenerated. The term "regeneration" as used herein refers to washing a chitin matrix with a solution having a suitable pH, such as a buffer solution having a pH between about 3 and 4, and washing out the bound CBP protein. Revert to the state when it was not previously combined. In certain embodiments, the chitin matrix is inactive 6 times, e.g., 2, 3, 4, 5 or 6 times. • A fourth aspect of the invention provides a kit for purifying a target protein. The kit includes: a vector as described above; a host cell which can be used to express the fusion protein encoded by the vector; and a combination for binding the fusion. a chitin matrix of protein; a buffer solution for eluting the target protein from the chitin matrix, and the pH of the buffer solution is between about 6 and about 7; and Instructions for using this set can be in the form of a CD, VCD or DVD. In certain embodiments, the chitin matrix comprises beta-chitin from a low-cost chitin source, squid cartilage g. The disclosure is illustrated by the following specific examples, and the invention is not limited to the specific embodiments disclosed. Example 1 Materials and Methods 1.1 Transgenic chitin-binding protein (CBP) The CBP gene was amplified by PCR using S. marcescens gene DNA as a template. Based on the cbp gene of Serratia marcescens (stored 14 201122110, numbered AAU88202 and purchased from Food Industry Research Institute, Hsinchu 'Taiwan' product number ATCC 990), primer 1 and primer 2 were designed respectively. Detailed sequence of all primers). The PCR amplification reaction was carried out with Vent DNA polymerase for a total of 25 cycles, and each cycle condition was denaturation: 94. (:, 30 seconds; bonding: 58. (:, 30 seconds; extension: 72 ° C, 4 minutes. Insert the amplified Pcr fragment into the claw / e I in the pRESTA and the 0 I cutting position, construct pREST/CBP. 1.2 Construction of CBP fusion protein expression vector The method of constructing a expression vector containing a linker and a CBP fusion protein of a type I gene enzyme (genenase I) recognition position involves the following several steps. PCR primer 3 and primer 4 remove the #心1 position in pREST/CBP by position-directed mutagenesis, and the resulting expression vector is called de-I-pREST/CBP. In the second step, after the CBP gene Inserting the cleavage site of the type I gene enzyme and removing the termination code, primers 5 and 6 were designed for this purpose, and were used to phosphorylate T4 polynucleotide kinase before use in the Pcr reaction. The sequence amplified by PCR was self-ligated into pREST/CBP-G. Next, various linkers were introduced (the sequences of all the linkers are listed in Table 2). When amino acid sequence is to be added to pREST/CBP-G For the linker (EAAAKM SEQ ID NO: 4), the primer can be used in the reverse PCR amplification reaction. Sub 7 and 8. Similar to the second step, phosphorylation of primers 7 and 8 was also carried out in advance so that the amplified DNA fragments could be ligated into pREST/CBP-V5G. In a similar manner, primers 9, 1 were used, respectively. 〇, primers 9, 11 and primers 9, 12 construct a expression vector containing (EAAAKM SEQ ID NO: 1), (eaAAK) 3 (SEQ ID NO: 2), and (EAAAK) 4 (SEQ ID NO: 3). A vector containing no proteolytic site of the type I gene enzyme can be constructed by introducing the primers 15 201122110 13 and 14, and the constructed vector is called PREST/CBP-V5. Next, the vector without the CBP is constructed by using the primers 15 and 16. In order to evaluate the function of this system, the β-1,3-glucanase (LPHase) gene derived from 汾mizie« sy s was inserted into the A/c/el/B of the PREST/CBP-V5G vector, respectively. The R丨 position, the chitinase gene derived from cere (10) was inserted into the A/ofe Ι/Λ/co I position of the preST/CBP-V5G vector, and the chitin derived from the chocho-cho/(10) as (10) The glycanase gene was inserted into the A/cfe 丨/H/n丨丨丨 position of the PREST/CBP-V5G vector, and φ was transformed into E. coli cells for expression. Next, β- The three types of fusion proteins were purified by the chitin column, including CBP-V5G-LPHase, CBP-V5G-chitinase and CBP-V5G-chitosanase. 201122110 Table 1 Introduction sequence number 1 5,- GGAATTCCATATGAACAAAACTTCCCGTACC-3, 2 5,-CCGCTCGAGCTCTTATTTGCTCAGGTTGAC-3, 3 5-GGAGATATAGGGATGAACAAA AC-3' 4 5'- GTTTTGTTCATCCCTATATCTCC-3' 5 5,-CCGGGTGCGGCACACTACCATATGGAGCTCG AGATCTGCAGCTGGTAC-3, 6 S'-GATCCAACCACGTTTAGCTTTGCTCAGGTTGA CGTCGATC -3, 7 5,- CTGCTAAAGAAGCTGCTGCTAAAGAAGCTGCT GCTAAACCGGGTGCGGCACACTAC-3 '8 5'-CAGCTTCTTTAGCAGCAGCTTCTTTAGCAGCA GCTTCTTTGCTCAGGTTGACGTC-3, 9 5'-GAAGCTGCTGCTAAAGAAGCTGCTGCTAAACC GGGTGCGGCACACTACCATATG-3' 10 5, -TTTGCTCAGGTTGACGTCCATCGC-3 '11 5, -TTTAGCAGCAGCTTCTTTGCTCAGGTTGACGT C-3' 12 S'-TTTAGCAGCAGCTTCTTTAGCAGCAGCTTCTT TGCTCAGGTGACGTC-3, 13 5,-GTAGTGTGCCGCACCCGGCATATGTTTAGCAG CAGCTTC-3, 14 5,-GGAATTCCATATG TACAATTTGCCAAAC-3, 15 5'-GCGATCGACGTCAACCTGCTCGAGGAAGCTG CTGCT-3' 16 S'-CGATTCGACATACTCGAGAGCATTCGCCTGTT GCGA-3' SEQ ID NO: 5 6 7 8 91011 121314151617181920 17 201122110 Table 2 peptide linker of CBP fusion protein

Linker Amino acid sequence SEQ ID NO. (EAAAK) n n = 2, 3,4, 5 1 (EAAAK)z 1 EAAAKEAAAK 2 (EAAAK)3 2 EAAAKEAAAKEAAAK 3 (EAAAK)4 3 EAAAKEAAAKEAAAKEAAAK 4 (EAAAK)g 4 EAAAKEAAAKEAAAKEAAAKEAAAK

1.3 Preparation of β-chitin matrix • The squid cartilage is used to make a β-chitin matrix and a column containing the matrix. The squid cartilage was soaked in NaOH (3%, 1 liter) and heated to 100 ° (: about 3 hours. Then, the squid cartilage was washed with water and residual NaOH was removed. The squid cartilage was further soaked in HC1 ( 6M, 1 liter) and kept at a temperature of about 25 ° C for about 12 hours. After washing several times with water, adjust the pH to more than 6. The cartilage is homogenized and sieved to obtain a diameter of about 0.3 to 0.6 mm. The β-chitin matrix corresponds to a mesh size of about 30-50 mesh. The β-chitin matrix is stored at 4 ° C. 1.4 Purification of CBP and fusion protein 18 201122110 Escherichia coli BL21 (DE3) Host cells to express proteins. Single plant pREST/CBP was seeded in LB medium (5 ml) containing ampicillin (ο ι/ml) and incubated at 37 ° C for 12 hours. The culture was transferred to a conical flask containing LB (1 gram/ml), IPTG in LB medium (1 liter), and incubated at 37 ° C for 1 hour. The medium was 7000 g at 4 Centrifuge at °C for about 1 minute. Resuspend the collected cells in acid-filled steel buffer solution. 1〇 ml, 20 mM 'pH 7.0), followed by sonication disrupt the cells by centrifugation to remove cell debris, supernatant of Example 1.3 β- chitin matrix full engagement (100

Milliliter, Tris 50 mM, sulphate, pH 8.0, 5% (v/w), β-chitin with a diameter of 0.3-0.6 mm) and incubated overnight at 4 °C. The resulting mixture was filled into a column of 2.5 cm x 60 cm (inside diameter) and washed with 250 ml of a buffer solution (Tris 50 mM, 1 M sulfuric acid, pH 8.0) (which is a volume of β_ chitin solid 10 Double) to remove any unbound protein fraction. CBP was eluted with 50 ml of acetate buffer (20 mM, pH 3.6) (flow rate 2 ml/min). The eluate was collected once every 5 ml, and all CBP fusion proteins were purified according to the above general methods, including CBP-V5G-LPHase, CBP-V5G, chitinase and CBp_V5G_CNS (ie, 'CBP-free recombination Butylase). The corresponding polysaccharide was used as a substrate for the reaction of the enzyme, followed by SDS-PAGE to separate the activity of the purified protein. The protein recovery ratio and the effect of purification were calculated based on the enzyme activity and the amount of protein obtained. Purification of the above CBP-free recombinant chitinase according to the method disclosed in the literature (ie, 1.5 protein quantification according to the BCA-1 kit provided by the supplier (BCA1 kit, 201122110)

• The accompanying protocol in Sigma-Aldrich, St Louis, MO) quantifies the protein produced by the bCA method. 1.6 Measuring Enzyme Activity LPHase, chitinase and CBP-free recombinant chitinase (CNS) were measured with β-1,3-glucan, chitin gel and chitosan as substrates. Enzyme activity. Enzyme activity was estimated by assessing the sugar content of the reducing end by the dinitrosalicylic acid method. 0.3 ml of the polysaccharide was mixed with the enzyme (1%) and 3 ml of the enzyme, and incubated at 37 ° C for 4 hours, 0.6 ml of diφ nitrosalicylic acid was added, and the mixture was boiled for about 15 minutes. Cool and centrifuge to remove the precipitate. The addition product of the obtained reducing sugar was analyzed by a spectrometer at 540 nm. 1.7 Electrospray mass-spectrometric (ESI-MS) analysis uses a quadrupole time-of-flight mass spectrometer to record mass spectra and scans the range of mass-to-mass ratios of 500-3000 u for protein analysis. 2 seconds and each scan is spaced apart from each other by 1 second. φ 2. Results

2.1 Transferring from Serratia marcescens, performance and separation of CBP by affinity column chromatography According to the chitin-binding protein gene of Serratia marcescens, two kinds of nucleosides were designed for PCR amplification. A pair of primers for increasing the reaction. A chromosomal DNA of Serratia marcescens was used as a template to amplify a DNA fragment (〇 6 kb) and sequenced to confirm that it was CBP. Sequence analysis revealed that the amplified CBP gene comprises: • an open reading frame of about 594 test pairs, which encodes a sequence of about 197 amino acids in length, of which about 27 amino acids are signal peptides. Then will 201122110

The entire complete CBP gene was transferred into the pREST A plastid. The resulting plastid was used to transform E. coli (DE3) to express the desired protein. Next, the soluble recombinant protein expressed is purified from the β-chitin matrix. In order to understand the degree of affinity binding between CBP and chitin, the crude extract of the recombinant protein was mixed with an appropriate amount of chitin matrix and then filled into a column, first washed with brine (50 mM NaCl), followed by ρη Various buffers with values between 4 and 8 wash out the target protein. 'These buffers include Na〇AC (5〇mM, pH 4-8), phosphate buffer (50mM, pH 6-7) and Tris_HC1 (5〇mM). , pH 7-8). Next, the eluted protein was analyzed by SDS-PAGE. The results show that when the pH is less than 7, the target protein can be eluted from the β-chitin matrix. After SDS-PAGE analysis, it was found that the obtained recombinant protein had homogeneity (&gt;90%) (Fig. 1, left panel). The molecular weight estimate is approximately ~20 kDa. ESI-MS analysis was used to provide a more accurate molecular weight with a molecular weight of 18785 Da (Fig. 1, right panel), which is approximately the same as the predicted molecular weight when no signal peptide is present. Construct other performance vectors based on pREST A. The carrier construction method is shown in Fig. 2. First, the amplified cbp gene was inserted into the X/zo I cleavage site. Further, the position of I in the resulting vector is removed, and de-Ndel/pREST/CBP can be constructed, and various peptide linkers and type I gene enzyme cleavage position sequences (PGAAHY) can be inserted after the cbp gene. Next, the Ndel position sequence is inserted after the type I gene cleavage site to facilitate subsequent insertion of the target protein gene. The resulting vector can be used to insert various genes. To test the efficacy of this vector, a chitosanase (CNS) gene was inserted and tested. The fusion egg 21 201122110 • The possibility of S solution by the type 1 gene enzyme and the chitosan of the fusion protein were recorded as key factors for evaluating various linker peptides shown in Table 2. The linker with the sequence of (EAAAK) 5 (SEQ ID NO: 4) or with the sequence of GTGGEGPGGGGPGEGGTGGTGGEGPGG or (ggggs) 5 in the tested linker (this article does not provide the latter _ _ _ off data) will show obvious Chitinase activity. In addition, all of the above three fusion proteins can be separated from the stellate matrix column and released by chitinase (about 25 kDa) after treatment with the type I gene enzyme (data not shown) showing these connections The sub-peptide does not interfere with the structure of these proteins and the specific protease cleavage site in the fusion protein remains in a position accessible by the protease. It is known that the (EAAAK) 5 (SEQ ID NO: 4) sequence can form a helical structure and can be purified by chitin column chromatography to obtain better yields and better purity than the other two fusion proteins. . Therefore, this study selected this linker peptide for subsequent studies' and the vector that can express this peptide is called φ PREST/CBP-V5G. In order to confirm the function of this vector, two other proteins were selected for testing 'chitinase from Cactus cereus> and chitinase from Aspergillus niger, and E. coli overexpressed these two proteins. . The expressed fusion protein containing CBP, a linker peptide and the above protein is a soluble protein and can be purified through the above chitin matrix column. Due to the unique role of chitin matrix and chitin-binding protein (CBP), this method can be used to construct a diversity system, and through this system, the affinity recombination method can be used to purify the recombination. protein. The system of the present invention provides a simple, rapid way to purify the fusion protein in large quantities. The system of the present invention can increase the purification yield of the fusion protein containing LPHase by about 27% and increase the purity by 53 times relative to the fusion protein containing LPHase, chitinase and chitosanase; as for the chitin The purified yield of the enzyme fusion protein can be increased by about 29%, and the purity is increased by about 30 times; the purified yield of the fusion protein containing the chitosan xylanase can be increased by about 58%, and the purity is increased by about 137 times. SDS-PAGE analysis showed that the system of the invention achieved a highly uniform protein (Fig. 3). The fusion protein is then proteolytically cleaved with a type I gene enzyme to release the recombinant protein from the butyl group bound to the fusion protein. Due to the presence of the Ndel position, it is expected that the histamine residue will be contained in the N• end of the recombinant protein treated with the type I gene enzyme. • 2.2 Control (EAAAK) 5 Linker Acid-Dependent Self-Fracture Process The inventors of the present application discovered that the EAAAK 5 linker (SEQ ID NO: 4) was self-cleavable when it was studied how to elute the recombinant protein. The affinity binding of CBP to β-chitin is related to pH. When pH is &lt; 7, CBP will not bind to chitin. In a pre-study, when CBP-V5G-CNS was incubated with phosphate buffer (pH 6~7, 25, 1212 hours), it can be obtained without the type I gene enzyme treatment. Fusion Eggs • White releases a considerable amount of CNS. Initially inferred that this unexpected result can be 23 201122110 can come from a small amount of contaminated protease, in order to test this possibility, with a solution of about pH 3.6 from the chitin column The CBP-V5G-CNS was purified to maintain the recombinant protein in a state in which it was still a fusion protein. Then, the fusion protein was heated at 1 Torr under a pH of 3.6 for about 1 minute. The solution in the resulting sample was replaced with a solution of about 4.2-8.0 and stored at 25 ° C for about 12 hours. SDS-PAGE analysis (Fig. 4) showed that the fusion protein retained its self-fragmentation properties, and this self-fracture The phenomenon only φ will appear in the range of pH about 6~7. 2·3 Analysis of self-fragmentation of fusion proteins with various EAAAK linkers In order to understand this self-breaking phenomenon, different repetitions are introduced into the fusion protein. (EAAAK) n linker Where η is equal to 2, 3, 4 or 5 (sequence number: sequence 1 to 4, respectively). Place all of these fusion proteins in phosphate buffer (1 mM, pH • 7.0) containing NaCl (300 mM) It was incubated for about 12 hours. In this case, the phenomenon of self-breaking was found to be incomplete. As shown in Figure 5, SDS-PAGE analysis showed that all fusion proteins showed a systematic protein band pattern. Close to the 20 kDa protein band It may be the result of cleavage from the (EAAAK) n linkers with different repeat orders. For example, after partial self-breaking, the fusion protein CBP-V2G-CNS showed four distinct protein bands (Fig. 5, Section 2), estimated molecular weights of 45, 26, 20, and 19 kDa, respectively, equivalent to intact fusion protein, PGYAAHY-CNS (CNS fusion protein with type I gene 24 201122110 enzyme recognition position), cbp -(eaaak)2 and CBP-(EAAAK). Similarly, for CBP-V3G-CNS, the five protein bands appearing 'from large molecular weight to small molecular weight, representing the complete fusion protein, respectively, linked to PG YAAHY CNS, CBP-(EAAAK)3, CBP-(EAA AK) 2 and CBP-(EAAAK). Other fusion proteins with longer linkers also exhibit the same self-fracture pattern. The inventors further cleave the peptide sequence or CBP φ at the position of the type I gene enzyme in the fusion protein. Sequence removal and testing of the self-fragmentation properties of this fusion protein. The results show that the (EAAAK)5 linker of the present invention is still at pH 6.0 when there is no CBP or type I gene enzyme recognition site peptide in the fusion protein. Has the ability to break self. Next, the self-breaking characteristics of the above-mentioned EAAAK linkers having different repetition times were confirmed by ESI/MS analysis (Fig. 6). The calculated molecular weights of CBP-(EAAAK)5, CBP-(EAAAK)4, CBP-(EAAAK)3, ΦCBP-(EAAAK)2, CBP^EAAAKh are 20996, 20526, 20056, 19586 and 19115 kDa, respectively. As for PGAAHY-CNS, the molecular weight is 24,430 kDa. As shown in Figure 6, the mass/charge (m/z) signal in each spectrum is quite correlated with the predicted CBP-(EAAAK)n portion and PGAAHY-CNS. For the CBP/CNS fusion protein, it is most efficient to cut the EAAAK unit from the nearest CNS, because the entire reaction was analyzed by ESI/MS and no EAAAK unit was found to be connected to the CNS. The EAAAK unit will continue. From 25 201122110, CBP-(EAAAK)n partially cleaves, and after each cleavage, an .EAAAK peptide (molecular weight of about 470 Da) is released. At the same time, this cleavage does not require any protease assistance, in other words. 'Do not use any protease to achieve self-breaking. 2.4 Purification of the protein by the CBP protein purification system of the present invention First, the carrier containing CBP, the ΕΑΑΛΚ unit peptide linker of the present invention, and the U&gt;Hase of the Serratia marcescens is constructed in the above manner; or CBP is contained. The carrier of the EAAAK unit peptide linker of the present invention and the chitosanase of the genus Aspergillus. The two vectors were separately transfected into E. coli hosts to synthesize a fusion protein containing LBPase of CBP-(EAAAK)5_Serratia marcescens and a few containing CBP-(EAAAK)5-S. A fusion protein of a butanase. Next, a column packed with β-chitin is prepared in the above manner, and then the separated fusion protein is loaded into the column, and then the column is washed with a buffer solution of pH 6.0, thereby purifying the target. The protein is shown in Figure 7. From the results of Figures 7A and 7B, it was confirmed that the CBP protein purification system of the present invention can be easily separated without using a protease by self-cleavage of a linker inserted between CBP and a target protein. The target protein. Other Embodiments 26 201122110 • Any of the features mentioned in the above specification may be freely combined, and each feature may be replaced by other identical, equivalent or similar means, and therefore, unless otherwise specified, each is indicated herein. Features are only examples of similar features. From the above description, those skilled in the art can understand and confirm the contents of the present invention and make various appropriate modifications and retouchings without departing from the spirit and scope of the present invention. The scope defined in the patent application is subject to change. BRIEF DESCRIPTION OF THE DRAWINGS In order to make the above and other objects, features, advantages and embodiments of the present invention more obvious, the description of the drawings is as follows: Figure 1 is an SDS-PAGE result and MS analysis of CBP. Results, (A) lane 1, protein marker, lane 2, purified CBP; (B) mass spectrometry analysis of recombinant CBP; Figure 2 shows the procedure for constructing the pREST/CBP-V5G vector, where V5G represents 5 EAAAK repeat units and peptides of type I φ due to enzymatic cleavage position; Figure 3 is the results of SDS-PAGE of the purified three fusion proteins, which respectively contain the LPHase gene derived from sputum, Chitinase gene derived from (10)cere (10) and chitin poly-enzyme gene derived from Apergz·//(10)/ww/ga plus: lane 1, protein marker; lane 2, CBP-V5G-LPHase crude extract protein Lane 3, CBP-V5G-LPHase purified protein; lane 4, CBP-V5G-chitinase* crude extract protein (molecular weight 65 kDa); lane 5, CBP-V5G-chitinase purified protein ( Molecular weight 58 kDa); lane 6 'CBP-V5G-CNS crude extract egg 27 201122110 , white ; lane 7 , CBP-V5G-CNS purified protein (molecular weight 45 kDa); Figure 4 shows the results of self-cleavage of the linker of CBP-V5G-CNS fusion protein under various pH solutions by SDS-PAGE: lane 1, protein marker; lane 2, Tris, pH 8.0; lane 3, Tris, pH 7.5; lane 4, phosphate buffer, pH 7.0; lane 5, phosphate buffer, pH 6.0; lane 6, NaOAc, pH 5.1; lane 7, NaOAc 'pH 4.2. It should be noted that in lane 5, the upper protein band and the lower protein band are presumed to be CNS and CBP, respectively, and the protein band at 45 kDa is a complete fusion protein; ^ Figure 5 is a self-breaking of the linker by SDS-PAGE. As a result, the fusion protein was cultured in a phosphate buffer (pH 6.0, 16 ° C) to obtain a result of only partial self-fragmentation; lane 1, protein marker; lane 2, CBP-V2G-CNS; Lane 3, CBP-V3G-CNS; Lane 4, CBP-V4G-CNS; Lane 5, CBP-V5G-CNS; Lane 6, CBP-V5-CNS (without type I gene enzyme cleavage position sequence Protein 7; V5G-CNS (protein without CBP); Figure 6 is the ESI-MS analysis of the fusion protein after self-breaking, which is analyzed by SDS-PAGE from Figure 4. The obtained samples were subjected to mass spectrometry analysis, (A) CBP-V2G-CNS; (B) CBP-V3G-CNS; (C) CBP-V4G-CNS; (D) CBP-V5G-CNS; (E) CBP-V5-CNS; (F) V5G-CNS; wherein the molecular weight of EAA AK peptide is 470 kDa by mass spectrometry; Figure 7A is a SDS-PAGE analysis of the CBP system of the invention for purification of recombinant Serratia The effect of LPHase, in which, the first channel, the protein marker; the second channel 'coarse fusion protein; the third lane, the CBP-V5G-LPHase fusion protein purified by β-chitin; the fourth lane, the junction 28 201122110 LPHase-labeled protein released after cleavage; and Figure 7B is an SDS-PAGE analysis of the effect of the CBP system of the present invention for purifying the recombinant chitinase of the genus Aspergillus, wherein, the first protein Marker; Lane 2, crude fusion protein; Lane 3, CBP-V5G-chitosanase fusion protein purified by β-chitin; Lane 4, chitosan released after linker break Glycogen-labeled protein. [Main component symbol description]

29 201122110 NP-8412-TW-C_sequence 1isting.WorkFile Organization Applicant

Street : 1001 University Road City : fflf State : Taiwan Country : R. 0. C. PostalCode : PhoneNumber : FaxNumber : EmailAddress : &lt;110&gt; OrganizationName : National Chiao Tung University

Application Project &lt;120&gt; Title : Carrier, Method, System and Set for Purifying Protein &lt;130&gt; AppFileReference : &lt;140&gt; CurrentAppNumber : &lt;141&gt; CurrentFi1ingDate : _-_-_ Sequence

&lt;213&gt; OrganismName : unknown &lt;400&gt; PreSequenceString : EAAAKEAAAK &lt;212&gt; Type : PRT &lt;211&gt; Length : 10 SequenceName : SEQ ID NO 1 SequenceDescription : Sequence 10 &lt;213&gt; OrganismName : unknown &lt;400&gt; PreSequenceString : EAAAKEAAAK EAAAK &lt;212&gt; Type : PRT &lt;211&gt; Length : 15 SequenceName : SEQ ID NO 2 SequenceDescription : Sequence 15 &lt;213&gt; OrganismName : unknown &lt;400&gt; PreSequenceString : EAAAKEAAAK EAAAKEAAAK &lt;212〉 Type : PRT &lt ;211&gt; Length : 20 SequenceName : SEQ ID NO 3 SequenceDescription : Sequence 20

&lt;213&gt; OrganismName : unknown &lt;400&gt; PreSequenceString : EAAAKEAAAK EAAAKEAAAK EAAAK &lt;212〉 Type : PRT &lt;211&gt; Length : 25 SequenceName : SEQ ID NO 4 SequenceDescription : Sequence 25 &lt;213&gt; OrganismName : S. marcescens &lt ;400&gt; PreSequenceString : ggaattccat atgaacaaaa cttcccgtac c &lt;212&gt; Type : DNA &lt;211&gt; Length : 31 SequenceName : SEQ ID NO 5 SequenceDescription ; Sequence 31 &lt;213&gt; OrganismName : S. marcescens &lt;400&gt; PreSequenceString : ccgctcgagc tcttatttgc Tcaggttgac &lt;212&gt; Type : DNA Page 1 of 30 201122110 NP-8412-TW-C_sequence 1isting.WorkFile &lt;211&gt; Length : 30

SequenceName : SEQ ID NO 6 SequenceDe s c r i p t i on :

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : ggagatatag ggatgaacaa aac 23 &lt;212&gt; Type : DNA &lt;211&gt; Length : 23

SequenceName : SEQ ID NO 7 SequenceDescription :

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : gttttgttca tccctatatc tcc 23 &lt;212〉 Type : DNA &lt;211&gt; Length : 23

SequenceName : SEQ ID NO 8 SequenceDescription ;

Sequence

&lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : ccgggtgcgg cacactacca tatggagctc gagatctgca gctggtac 48 &lt;212〉 Type : DNA &lt;211&gt; Length : 48

SequenceName : SEQ ID NO 9 SequenceDescription :

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : gatccaacca cgtttagctt tgctcaggtt gacgtcgatc 40 &lt;212〉 Type : DNA &lt;211&gt; Length : 40

SequenceName : SEQ ID NO 10 SequenceDescription :

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : ctgctaaaga agctgctgct aaagaagctg ctgctaaacc gggtgcggca cactac 56 &lt;212〉 Type : DNA &lt;211&gt; Length : 56

SequenceName : SEQ ID NO 11 SequenceDescription :

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : cagcttcttt agcagcagct tctttagcag cagcttcttt gctcaggttg acgtc 55 &lt;212&gt; Type : DNA &lt;211&gt; Length : 55

SequenceName : SEQ ID NO 12 SequenceDescription :

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : gaagctgctg ctaaagaagc tgctgctaaa ccgggtgcgg cacactacca tatg 54 &lt;212〉 Type : DNA &lt;211&gt; Length : 54

SequenceName : SEQ ID NO 13 Page 2 201122110 NP-8412-TW-C_sequence 1isting.WorkFile

SequenceDescription ;

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : tttgctcagg ttgacgtcca tcgc 24 &lt;212&gt; Type : DNA &lt;211&gt; Length : 24

SequenceName : SEQ ID NO 14 SequenceDescription :

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : tttagcagca gcttctttgc tcaggttgac gtc 33 &lt;212〉 Type : DNA &lt;211&gt; Length : 33

SequenceName : SEQ ID NO 15 SequenceDescription :

Sequence

&lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : tttagcagca gcttctttag cagcagcttc tttgctcagg tgacgtc 47 &lt;212&gt; Type : DNA &lt;211〉 Length : 47

SequenceName : SEQ ID NO 16 SequenceDescription :

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : gtagtgtgcc gcacccggca tatgtttagc agcagcttc 39 &lt;212&gt; Type : DNA &lt;211&gt; Length : 39

SequenceName : SEQ ID NO 17 SequenceDescription :

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : ggaattccat atgtacaatt tgccaaac 28 &lt;212&gt; Type : DNA &lt;211&gt; Length : 28

SequenceName : SEQ ID NO 18 SequenceDescription :

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : gcgatcgacg tcaacctgct cgaggaagct gctgct 36 &lt;212&gt; Type : DNA &lt;211&gt; Length : 36

SequenceName : SEQ ID NO 19 SequenceDescription :

Sequence &lt;213&gt; OrganismName : artificial DNA &lt;400&gt; PreSequenceString : cgattcgaca tactcgagag cattcgcctg ttgcga 36 &lt;212&gt; Type : DNA &lt;211&gt; Length : 36

SequenceName : SEQ ID NO 20 SequenceDescription ; Page 3

Claims (1)

201122110 VII. Patent Application Range: 1. A vector for producing a fusion protein, comprising: a promoter; a first polynucleotide operably linked to the promoter and encoding to generate a few a binding protein (CBP); a second polynucleotide operably linked to the first polynucleotide and encoding to produce a linker which is a peptide and has a Amino acid sequence: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, and the peptide can self-cleavage without the use of protease: and a third polynucleotide, An operably linked to the second polynucleotide and encoding to produce a target protein. 2. The vector according to claim 1, wherein the target protein is an enzyme, a storage protein, a transfer protein, a structural protein, an immunoglobulin, a blood protein, a binding protein, a hormone, a synthetic protein or a peptide. 3. The vector according to claim 2, wherein the enzyme is chitinase, chitosanase or disrupted to produce pentosan-β-1,3-glucanase (laminaripentose-producing-P) -1,3-glucanase, LPHase) ° 201122110 4* A method for producing a target protein, including · (4) ❹ request item! The vector is used to transfect a cell, such that the primary cell expresses the fusion protein; 0&gt;) cleaves the host cell to produce one of the fusion proteins and the sp., wherein the crude extract has a pH of at least greater than 8; Extracting (c) the crude product is infiltrated with a chitin matrix and (4) with a -buffer buffer and washing the protein without pure use of the protease and the linker self-cleavage Wherein the first buffer solution is between 5.5 and 7.5. There is a PH value, which is about 5. The square according to claim 4, the soil $ a person μ (four) is after the step (4) and the step (:) two more two contains the step (4)) 'this step flush 2 base # 'The second buffer has a -first pH value of between about 3 and 4. 3.6 The method of claim 5, wherein the second pH is between about 7 and about 7. The method of claim 4, wherein the first pH value is about 6 201122110 and the pH value is about 6, 8. The method of claim 7 wherein the first 9 is as claimed in claim 4 The method wherein the host cell comprises E. coli cells. H). The method of claim 4, wherein the chitin matrix comprises chitin. U. The method of claim 1 wherein 'the chitin is made of squid cartilage. η. - a vector for producing a purified target protein: a carrier as claimed in claim 1; - a host cell 'for expressing a white matter produced by the carrier; and a singular The substrate can be purified by using the method as described in claim 4; wherein the chitin matrix can be regenerated from about 3 to about buffer solution. The method of claim 12, wherein the host cell comprises an E. coli cell. 14. A kit for purifying a target protein comprising: the vector of claim 1; - a host cell, the silk exhibiting a fusion egg produced by the vector; a white matter; a chitin matrix for The fusion protein binds to a buffer solution having a pH between about 5.5 and about 75 for eluting the target protein from the chitin matrix; and instructions for using the kit. 15. The kit of claim 14 wherein the host cell comprises an E. coli cell. 16. The kit of claim 14 wherein the buffer solution is a phosphate buffer. 17. The kit of claim 14, wherein the chitin matrix comprises beta-chitin. The kit of claim 17, wherein the beta-chitin is made of squid cartilage.