TW200925165A - A composition to enhance wound healing - Google Patents

Abstract

The present invention provides comprehensive compositions for treating the problems associated with skin wound healing and wrinkle reducing via the incorporation of: (i) human Stem Cell Factor (hSCF) to induce the proliferation and migration of epithelium stem cells for wound healing; (ii) human Insulin Growth Factor (hIGF-1) to stimulate collagen secretion from fibroblast for wrinkle reducing. The compositions comprising at least one of (i) and/or (ii) are administered on skin through the topical delivery systems, including penetration enhancers and suitable carrier bases. The better effect on wound healing and wrinkle reducing is to combine the two growth factors of hSCF and hIGF-1.

Description

200925165 IX. Description of the Invention: [Technical Field] The present invention relates to a composition for promoting wound healing, in particular, a human stem cell growth factor (hSCF) and a human growth factor (human growth factor). The composition for promoting wound healing is embedded by the micro-lipid embedding technique. [Prior Art] The epidermis is the human body's first-line immune defense line--the loss of the silk skin is extremely susceptible to foreign® microbial infection, and burns, Radiation therapy, diabetes and other patients are in this threat for a long time, so many people are currently working on how to promote wound healing; however, most of the drugs currently used for treatment are killing, antibiotics, corticosteroids, etc. There are disadvantages for wound healing, and the wound healing rate is poor. Therefore, the current research direction has been to stimulate cell regeneration by artificial application, cell therapy or administration of cytokines to achieve rapid reconstruction of dermal and epidermal tissues. Giving cytokines is a better way because cytokines regulate immune responses The important mechanism of self-repair; and the self-repair of the skin requires a lot of cells © hormones, to hide on different cells, to complete - (d) complex repair actions. The main function of growth factors is to stimulate the proliferation of fibroblasts, microvessels, epidermal cells In the process of wound healing, fibroblasts are the main cells for repairing tissues, so the cytokines that stimulate the proliferation of fibroblasts are relatively important. It has been pointed out that in the complex process of skin wound healing, there are platelet growth. Platelet-derived growth factor (PDGF), transforming growth factor-β (TGF-β), fibroblast growth factor (FGF), epidermal growth factor (EPF) , 姨 素 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 2009 It has guiding and regulating effects to promote wound healing [1, 2, 3]. ❹

Loot et al [4] use epidermal growth factor (EGF), immunogenic fibroblast growth factor (IV) c f-Mast gro_ factor, bFGF), ternal growth factor (κημ), platelet derived growth factor (PDGF) Born money? 'Multiple urinary, occupational, non-diabetic ulcerated fibroblasts, a series of in vitro tests, the results show: (bFGF + coffee (1), (PDGF IGF1) (bFGF + PDGF) can significantly stimulate the fiber The growth of the mother cells is the highest, and the proliferation of the mother cells is stimulated by (PDGF + IGF-1), and the pdgfwgw has a synergistic effect. The above-mentioned and the skin care are used for the growth of the traits. Factors, which have been commonly used as silkworm growth factor (EGF), immunogenic fibroblast growth factor (bFGF), insulin-like growth factor (IGF1), and platelet-derived growth factor (IV), Life tube endothelial growth factor 〇 / ugly) and so on. It is known that stem cell fact〇r (SCF) is a tyrosme kmase receptor (Hgand), which, when combined with c_Kit receptor, induces signal transduction of some cells, including mast cells (_t eeU), mad stem cells (hem qing _ cell), germ cells (germ ceU), and melanocytes (melan〇cyte) [5,6,7 8], especially stem cell growth factor (SCF) can stimulate stem cells Migration to the area of the crane, and the proliferation effect sigh 1 (), „ i; 2, 13]. Although stem cell growth factor (SCF) has the side of the stem cell proliferation, but in the current study, 'there has not been reported dry The fascination (S) has the ability to promote skin wound healing. Therefore, the inventor of this case, in view of the potential of stem cell growth factor (SCF) in the application of cell proliferation, is the innovation and innovation of 亟思, and has worked hard for many years. After the research, the composition of the wound healing is finally successfully developed. [Invention] The object of the present invention is to provide a composition for promoting wound healing, which comprises the growth factor of stem cells. The compound composition of SCF promotes the healing of skin wounds and diminishes the formation of wrinkles. The second object of the present invention is to provide a composition for promoting wound healing that is easily absorbed by the human epidermis. /w microlipid embedding method, the compound composition containing stem cell growth factor (SCF) can be wrapped into a micron-sized emulsion to promote skin penetration and absorption. To achieve the above object, the inventor of the present invention has The biologically active human stem cell growth factor (hSCF) acts as a component of a composition for promoting skin wound healing to stimulate skin epithelial stem cell migration and proliferation, thereby promoting wound healing; in addition, the inventor of the present invention uses biologically active Human Insulin Gr〇wth 〇Fact〇rl (hIGF-1) is used in combination with the aforementioned human stem cell growth factor (hsCF), which can stimulate fibroblast regeneration and human hematopoietic growth factor (hIGF-Ι). Secretion of collagen, which smoothes wrinkles; therefore 'containing human stem cell growth factor (hSCF) and human insulin The composition of the growth factor, such as the card, can not only promote skin wound healing, but also reduce skin wrinkles and scars. The human stem cell growth factor (hSCF) and human insulin growth factor (hIGF-Ι) used in the present invention are Gene transfer method and genetic engineering technology; DNA sequence encoding human stem cell growth factor (hSCF) (as shown in SEQDD No: 1), and DNA sequence encoding human insulin growth 200925165 factor (hIGF-1) (eg SEQ) Π) No··3)) was separately selected into the expression vector system, and the vector containing the DNA sequences encoding the above two growth factors (hSCF and hIGF-Ι) was separately transferred into the expression host and induced. The protein was post-extracted to obtain human stem cell growth factor (hSCF) (whose protein sequence is shown as SEQ ID No: 2) and human tamsin growth factor (hIGF-Ι), respectively (the protein sequence is shown as sEQID No: 4). ). The expression vector system includes, but is not limited to, a pET vector system and a pGEX vector system, etc.; in the preferred embodiment, the secret vector is pET24a; the expression host includes, but is not limited to, E. coli ("7"), In a preferred embodiment, the performance host is a large intestine rod _ co / 〇 AL2 plant codon plus 〇 the present invention provides a composition for promoting wound healing, mainly comprising human stem cell growth factor (hSCF) and human insulin growth factor. Active substances; however, these two growth factors belong to the protein 'very easy to lose activity at room temperature, if it is sold in commercial form at room temperature', it is bound to be embedded in special materials to stabilize human stem cell growth factor (10) CF) And the activity of human insulin growth factor-1 (hIGF-Ι). The present invention embeds human stem cell growth factor (10) (7) and human insulin growth factor 1 (hIGF-Ι) into a micro-nano-sized particle (particle diameter of about 1 〇·6 gu 9 ) in a micro-monthly material. In addition to being able to stably maintain the above two growth factors (10) π and) at the room temperature, the water-soluble protein is embedded in the micro-lipid material, and the periphery of the liposome

Water 14 彳 helps to contain water-soluble colloids, so the embedding composition is also in the form of an emulsion and helps to spread on the skin, and the above two growth factors (hSCF and hIGF-Ι) are embedded in microscopic Nano-sized particles also help to penetrate into the dermal layer of the skin, accelerating the absorption of epidermal cells in 200925165. The micro-lipid material used in the invention includes an emulsifier and an oil phase liquid; the emulsifier includes Tween 20, Tween 80, and Triton X-100, PG, PG-400, etc.; the oil phase liquid includes phospholipid, egg Phospholipids (lethicin), cholesterol (cholesterol), sisal oil, mineral oil. Human water cell growth factor (hSCF) and water in oil in water 'w/o/w Human insulin growth factor (hIGF-1) is embedded to form micronanoparticles. In addition, the liposome embedding can be further mixed with a water-soluble colloid to increase the stability of the liposome embedding; the water-soluble colloid includes: PolyEthylene Glyec^PECMOCO, ethylene glycol , Tween20, Sanxianjiao, transparent adhesive, etc. The composition for promoting wound healing provided by the present invention comprises: a human stem cell growth factor (hSCF) having an amine as shown in SEQ ID No: 2. a base acid sequence; a human tamsin growth factor (MGF-1) having an amino acid sequence as shown in SEQ ID No: 4; an emulsifier' and an oil phase liquid; the emulsifier and the oil phase liquid The system embeds the human stem cell growth factor (hSCF) and the human simian growth factor (hIGF-Ι) into a liposome embedding. The composition provided by the present invention may also be accompanied by an infiltrating device (eg : Ultrasonic introducer or microcurrent device, etc. 'to accelerate the penetration of the compound composition containing stem cell growth factor (SCF) into the hair follicle site of the dermis layer. [Embodiment] Example 1 Expression of human stem cell growth factor (hSCF) and Purified human stem cell growth The gene of the factor (hSCF) is localized on the S1 locus (SI locus) of human 12th chromosome 12q22-12q24. Human stem cell growth factor (hSCF) has a soluble protein (4) uble fo can insoluble transmembrane protein (Wmembrane). f - two forms, the difference between the two forms of human stem cell growth factor (hSCF) is whether there is a proteolytic cleavage site, and both forms of human stem cell growth factor (hSCF) have biological impurities; The base of the protease cleavage position (IV) is located on the human stem cell growth factor (hSCF) gene, the sixth exon (exon6), and the full length of the protein after the translation of the gene containing the sixth exon is translated. Has 248 amino acids, after cleavage of the carboxyl-terminal amino acid by protease, 'remaining soluble human stem cell growth factor (IV) Uble hSCF with a total length of 165 amino acids; relative, insoluble The transmembrane protein human transmembrane growth factor (transmembrane hSCF) does not have this sixth exon, and its gene is translated to obtain a protein with a total length of 220 amino acids. The composition for promoting wound healing provided by the present invention comprises a soluble human stem cell growth factor (soluble hSCF)' cDNA sequence encoding soluble human stem cell growth factor (s〇luble hsCF) as shown in SEQ ID No: 1, which The full-length cDNA of 495 base pairs (bp) encodes a protein sequence as shown in SEQnDN〇: 2, which has 165 amino acids. This is soluble human stem cell growth factor (soluble hSCF). 1. Construction of human stem cell growth factor (hSCF) gene extraction of human placenta total RNA (total RNA) and reverse transcription polymerase chain reaction (RT-PCR) to synthesize human placental cDNA ' The cDNA is used as a template to perform cloning and amplification of the soluble human stem cell growth factor (s〇iuble hSCF) gene by a polymerase chain reaction (PCR). The sequence of soluble human stem cell growth factor specificity primer 200925165 (soluble hSCF specificity primers) is as follows: Forward primer (containing I restriction enzyme digestion site): 5f cgggatccatgaagaagacacaaacttggattc 3f (SEQ ID No: 5)

BamH I reverse primer (containing _Λ%ο I restriction enzyme cleavage position): 5, ccgstcgagaaccacacaatcactagtttcag 3f (SEQ ID No: 6)

The Xhol PCR reaction conditions were: 94. (: After 2 minutes of reaction, 94 ° C for 1 minute, 55 ° C for 45 seconds, 72 ° C for 45 seconds, a total of 30 cycles, and finally reacted at 72 ° C for 5 minutes to carry out the extension reaction (elongation); The product was analyzed by electrophoresis on 1.5% agarose gel, stained with ethidium bromide (EtBr), and exposed to ultraviolet light. The results are shown in Figure 1. PCR amplification The length of the product is about 5 bp. Then the PCR product and the pET24a vector are double-digested (and the restriction enzymes are digested separately), and the digested PCR product and the pET24a vector are purified and ligated ( Ligation) to select the pCR product into the pET24a vector to form the pET24a-SCF plastid, and transfer the pET24a-SCF plastid into the host cell E. coli (5·co/OBI^i- In codonplus, the PCR product sequence for large-scale proliferation and sequencing confirmation is correct, and the DNA sequence thereof is shown in SEQ ID No: 1. 2. The expression and purification of human stem cell growth factor (hSCF) protein E. coli containing pET24a-SCF plastid (f.co/z.) A^-codon plus a single colony, incubated with 5 ml of LB liquid medium containing 35 pg/ml kanamycin at 37 °c overnight; take the above 5 ml overnight culture to 5 〇 0 ml 11 200925165 In LB liquid medium containing kanamycin, continue to shake culture at 37 ° C for about 3 hours ' until the absorbance of the culture solution 〇 D reaches 0.54, then add 〇 5 _ isopropyl-D - Isopropyithi〇galactoside (IPTG) was further cultured for 6 hours to induce human stem cell growth factor (hSCF) (the amino acid sequence thereof is shown as SEqIDN〇: 2). After sputum, the culture was centrifuged. The supernatant was removed, the centrifuged cell pellet was recovered, and the cell pellet was resuspended in 50 ml of a buffer solution containing 〇〇pg/mi lysozyme (iyS〇zyme), ρΗ7·5, PBS). Block, and place the suspension in 4. (: 30 under 30 minutes, divide the cells with 'Valley, then treat the cell solution with supersonic sonication on ice, and ultrasonically oscillate for 1.5 seconds each time. A total of 15 times, there is a 1 second pause between each shock, and then the suspension is 10,00 Remove the supernatant by centrifugation at 0g for 1 minute; wash buffer with 5 〇 ml 1 χ IB (2〇 _

Tns-HCl, pH 7.5, 10 mM EDTA, 1% Triton Χ-1Ό0) Resuspend the precipitate, centrifuge the suspension at 10,000 for 10 minutes, remove the supernatant, repeat the above steps of resuspension and centrifugation.

3 times; then, resuspend the sediment in 25 ml of 8 M urea buffer solution containing 20 mM Tris-HC Bu 0.5 M NaCl, pH 7.8, which contains the inclusion body of pET24a_SCF © codon Plus expressing protein (inclusion) The suspension was placed at 4 ° C overnight to dissolve the inclusion body, and then the suspension was centrifuged at 15,000 g for 30 minutes, and then the supernatant fraction was collected. 'The supernatant contained pET24a-SCF / BL21 codon plus expressed protein; the supernatant was applied to a His-Bind resin column, followed by an elution buffer (elute buffer, 8 M urea, 20 mM Tris_HCl, 0·5) M NaCl, 0.25 M imidazole,

PH 7.8) Rinse the purified protein out of the column and use 9 times volume of rapid refolding buffer (2.5 M urea, 20 mM Tris-HCl, 0.01 mM EDTA, 2 mM 12 200925165 GSH, 0 · 2 mM GSSG, 0.02% sodium azide, 0.2 M arginine, pH 8.5) Dilute the purified protein 'after 48 hours at room temperature'. The purified protein solution was concentrated 10-fold by thin membrane ultrafiltration and at 4 Dialysis was carried out at a concentration of 1,000 ml of a refolding buffer (20 mM Tris-HCl, 0.01 mM EDTA) containing a urea reduction gradient (2 to 〇M). Next, the protein status was examined by 15% SDS-PAGE. As shown in Fig. 2, the purified human stem cell growth factor (hSCF) protein size was about 21 kDa; then Western blot was used to determine protein specificity. (protein specificity), first, transfer the protein to a nylon membrane (Hybond-P, Amersham, HK) and fill it with (1 X PBS + 3 % fat-free milk powder + 0. 〇 5 % Tween 20 ) Blocking the vacancies on the nylon membrane, and then using the mouse anti-human SCF monodcme antibody '1.5 pg/m b diluted 1000 times as the primary antibody (primary secret) Human goat stem cell growth factor (hSCF) was detected and detected by using goat anti-mouse IgG antibody (alka丨ine phospatase-conjugated goat anti-mouse IgG, diluted 15000 times) as a secondary antibody. Fluorescence signals, the results of Western ink collapse method are shown in Figure 3; from the results of Figure 3 ® confirmed that the purified protein obtained in this example is indeed soluble human stem cell growth factor (soluble hSCF). 3. Analysis of human stem cell growth factor (hSCF) protein activity The purified human stem cell growth factor (hSCF) protein was added to a different concentration of 2, 5, 10, 20 ng/ml in phosphate buffer (PBSy > Each well (weu) contains 1 μμ1 human leukemia cell line TF-1 (1 X l〇4 cells/mi) in a microtiter plate, each well is added 1 μΐ different concentrations of human stem cells Growth factor (hSCF); this cell 13 200925165 strain was washed 3 times with phosphate buffered saline (PBS) in advance, and contained 10% fetal bovine serum (Fetal Calf Serum, FCS) and 0.08 ng/ml interleukin-3 ( Interleukin-3, IL-3) RPMI 1640 liquid medium was resuspended; the TF-1 cell line supplemented with human stem cell growth factor (hSCF) was cultured at 37 ° C, 5% C〇2 for 48 hours. Add 10 μΐ AlamarblueT' to each well in the microtiter plate and continue to culture for 4 hours. 'AlamarblueTM is a reagent for testing live cell metabolism'. It can be transformed from the original non-fluorescent indigo blue to have a firefly after interacting with living cells. Light pink 'connector' to 53〇~560 nm Excitation wavelength and 590 nm divergence wave emission wavelength were used to detect the amount of fluorescence, thereby quantitatively measuring the effect of human stem cell growth factor (hSCF) on the growth activity of TF-1 cell line; the results are shown in Figure 4. The higher the concentration of human stem cell growth factor (hSCF), the more the amount of fluorescent light detected, that is, the more stimulating the growth of π" cell lines, and the concentration reaches 10 ng/ml or more, and the effect of stimulating the growth of TIM cell lines is gradually increasing. Example 2 Expression and Purification of Human Insulin Growth Factor-1 (hIGF-Ι) 1. Construction of Human Insulin Growth Factor-1 (hlGF-1) Gene © Using Human Placenta cDNA as Template and Polymerase The chain reaction (pCR) carries out the selection and amplification of the human tensin-1 growth factor-l (hlGF-1) gene, and the sequence of human insulin growth factor-specific specific primers (hIGF-1 specificity primers) is shown as follows. Primer (containing restriction enzyme cleavage position): (SEQIDNo: 7) 5r cqggatccggaccggagacgctctgr.g 3,

BamH I reverse primer (containing guanidine I restriction enzyme cleavage position): (SEQlDNo: 8) 5f ccqctcqaqagctgacttCTacaggctl-ga 3,

Xho I 14 200925165 The PCR reaction conditions were: 94. (: After 2 minutes of reaction, it was subjected to 94 ° C for 40 seconds, 55 ° C for 45 seconds, 72. (: 45 seconds, a total of 30 cycles 'final reaction at 72 ° for 5 minutes to carry out the extension reaction; pcR amplification product was 1 - 5 Analysis by % agarose gel electrophoresis, stained with ethidium bromide (EtBr), and exposed to ultraviolet light. The results are shown in Figure 5. The length of the product amplified by PCR is MO bp. Next, the PCR products are respectively The pET24a vector was subjected to double digestion (and the • ❺ 纲 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ Body, and pET24a_IGIM f turned (four) colony side to send host cell E. coli (five. knife-codonplus, for large-scale proliferation, and sequencing confirmed the proliferation of PCR product sequence is correct, its DNA sequence is SEQ 1〇N〇 The protein sequence encoded by :3 is shown as SEQ ID No: 4, and there are 70 amino acids, which is human tamsin growth factor-1 (hlGF-1). 2. Human insulin growth factor _ i(hiGF-l) protein expression and purification Ο will be transfused to contain PET24 A-IGF-l plastid E. coli (£· co/j·) melon W-codon plus single colony, such as LB liquid medium containing % μ§/ιη1 kanamycin at 37〇c The lower shock culture was cultured overnight; the above 5 ml of the overnight culture solution was taken to 5 〇〇 - kan liquid containing kanamycin, and the culture was further shaken at 37 ° C for about 3 hours until the absorbance of the culture solution 〇 〇55. After reaching ο』-〗, add 〇5 _isopropyl-D-thiogalactose (iptg) for 6 hours to induce human insulin growth factor ^ (hIGF-1) (the amino acid sequence thereof) As shown in SEQ!DN〇: 4) After 6 hours, the culture solution was centrifuged to remove the supernatant, and the centrifuged cell pellet was recovered, and 15 200925165 was 50 ml of phosphoric acid containing loo μ§/ιη1 lysozyme. Resuspend the cell pellet in buffer (PBS) and place the suspension in 4. (: 30 minutes to dissolve the cells, then ultrasonically oscillate the cell solution on ice, ultrasonic wave oscillate each time 1.5 A total of 15 times, there is a second interval between each shock, then the suspension is centrifuged for 10 minutes at 10° The supernatant was resuspended in 5 〇 ml 1 清洗 wash buffer (20 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1% Triton®-100) and the suspension was centrifuged at 10,000 g. After a minute, the supernatant was removed, and the above steps of resuspension and centrifugation were repeated 3 times; then, the precipitate was resuspended in 25 ml of a urea buffer solution containing 20 mMTris-HCl, 0.5 Μ ® NaCl, pH 7.8, and the precipitate was resuspended. The inclusion body of pET24a-IGF-l/BL21codonplus expressing protein was contained therein; the suspension was placed at 4. (: The solution was solubilized overnight, and then the suspension was centrifuged at 15,000 g for 3 minutes, and then the supernatant fraction containing the protein expressed by pET24a-IGF-1/BL21 codon plus was collected. Adding the sage supernatant to the His_Bind resin column, followed by

Flow wash buffer (8 M urea, 20 mM Tris-HCl, 0.5 M NaCl, 0.25 M imidazole, pH

7.8) Flush the purified protein out of the column 'with 9 times the volume of the rapid refolding buffer solution (2 5 MA. urea, 20 mM Tris-HCl, 0.01 mM EDTA, 2 mM GSH, 0.2 mM GSSG, 0.02%) Sodium azide, 0·2 M arginine, pH 8.5) The purified protein was diluted and allowed to stand at room temperature for 48 hours. The purified protein solution was concentrated 10-fold by ultrafiltration of the membrane and i was obtained at 4 ° C. The 〇mi was dialyzed against a urea reduction gradient (2 to 0 M) in a refolding buffer (2 mM Tris-HCl, 0.01 mM EDTA). Then 'to 15. /. The protein state was examined by SDS-PAGE. As a result, as shown in Fig. 6, the purified human insulin growth factor-1 (hIGF-1) protein was about 75 kDa. 16 200925165 3. Analysis of protein activity of human keratin growth factor The above purified human tamsin growth factor 丨 (called protein was diluted with acid buffer (PBS) to 2, 5, 10, 20 ng / ml After different concentrations, a microtiter plate containing 1 μl of mouse fibroblast cell line 3Τ3 (1×1 〇4 cells/ml) was added to each well, and 1 μΐ of different concentrations of human islands were added to each well. Growth factor 丨 h (hIGF1); the 3T3 cell line was washed 3 times with linalic acid buffer (PBS) beforehand and resuspended in the culture medium containing % fetal bovine serum (A DMEM (four) medium; will be added to human Tengdao The growth factor called Xinhua 3T3 cell line was cultured for 48 hours in a C37 C, 5% C〇2 environment, and then further cultured for 4 hours by adding 1 μμΐ AlamarblueTM to each well of the microtiter plate; Fluorescence was detected by the excitation wavelength of 53〇~56〇nm and the wavelength of the lungs of 59〇, so as to quantitatively measure the effect of human insulin growth factor_丨(hIGF_^ on the growth activity of 3T3 cell line; the results are shown in Figure 7 The higher the concentration of island growth factor (hIGF-Ι) The more the amount of fluorescence detected, the more stimulated the growth of 313 cell line. Example 3 Human stem cell growth factor (hSCF) and human insulin growth factor q φ (hIGF-1) are embedded in human stem cell growth factor ( hSCF) (36.5 pg/ml, dissolved in Tris-Buffer) 1〇ml and human temsin growth factor (hIGF_1} (10 μ§/ιη1, dissolved in Tris_Buffer) 1〇ml, add 0.5~ at 4 °C 2 grams of Tween 80, 0·5~2 grams of Triton X-100, 0.5-0.5-2 grams of glucose and other emulsifiers, 'slowly add an equal volume of oil phase liquid, containing 80~90% phospholipid, 5- 10% printing fat (lehicin), 5~10% cholesterol (cholesterol), etc., stirred uniformly at 4 °c with a MKKMO'ooorpm high-pressure homogenizer, about 10~20 minutes, immediately forming micro-lipid micro-nano particles ( w/o/w), the final total volume is mixed with water-soluble colloid in a ratio of 2:3 (Package 17 200925165 includes PolyEthylene Glycol (PEG-400), Ethylene Glycol, Tween 2〇, III Celery, etc.), stirred at 4 ° C for 20 minutes at 2,500~3,000 rpm homogenizer; the purpose of adding water-soluble colloid is to increase the fat Body stability, the water-soluble protein in the liposome can remain active for 2 to 3 years at room temperature; human stem cell growth factor (hsCF) and human temsin growth factor-1 (hIGF) in the final chyle composition -Ι) concentrations of 7.5 pg/ml and 2 pg/mi, respectively. Example 4 Mouse Skin Wound Healing Test Mice Skin Wound Healing Test There were 2 groups of experimental groups and 1 group of blank control groups, each group containing 4 8 week old Balbc mice. Each mouse was sterilized. The scalpel cut a 0.5 X 0.5 cm2 wound on the back of the mouse after shaving, and then observed the skin wound of the mouse with a microscope, and captured and recorded the wound image, and calculated the wound area of the third day in the soft body; mouse skin The test design for the wound healing test was as follows: Test group 1: 100 μΐ emulsion containing 7.5 pg/ml hSCF; Test group 2: 100 μΐ emulsion containing 7.5 pg/ml hSCF + 2 pg/ml hIGF-1; blank control Group: 100 μM emulsions containing no growth factor emulsion β blank control mice were coated with a growth factor-free emulsion after wound formation; mice of test group 1 were prepared as described in Example 3 after wound formation. The emulsion containing 7.5 pg/ml hSCF was applied to the skin wound of mice at 10:00 am, and each mouse was applied with 1 μM emulsion for 3 days; the mice of the test group 2 were caused by the wound. 1 hour, with the above The emulsion prepared in Example 3 containing 7.5 pg/ml hSCF+ 2 pg/ml hIGF-1 was applied to the skin wound of mice at 10:00 am, and each mouse was applied with 100 μM emulsion for 3 times. After the test was carried out for 3 weeks, 24 hours after the third application of the emulsion (referred to as the third 曰) 'microscopic observation of the skin wound of the mouse, 18 200925165 and the wound image was taken and recorded' and calculated on the 3rd day of the software Wound area. The microscope used in this embodiment is connected to a charge coupled device (CCD) to capture the image of the mouse skin wound, and after capturing the image, the image is transmitted to a computer for image processing and wound area calculation and statistics. The software used for image processing and wound area calculation is Northern Eclipse image SyStem; while the statistics are analyzed by the software sigmaStat program (2002), the Duncan's multivariate field test (by a single variant analysis of anova) (Duncan, s New Multiple Range

Test, DMRT) is calculated. The image of a small-weather skin wound is shown in Figure 8. Figure 8A is the image of the skin lesion σ just caused by the mouse at the beginning of the experiment. After the treatment of the mice in U County for 3 days, the skin of the skin is damaged. Fig. 8C is the image of the skin wound after the treatment of the mice in the test group 2 for 3 days. Figure 8D is the image of the skin wound after the treatment for 3 days from the control group. It can be seen from the figure that The skin area of the mouse treated with the composition for promoting wound healing after 3 days of treatment (as shown in Fig. 8-8, Fig. 8 (:)) is significantly smaller than that of the mouse skin treated without the composition for promoting wound healing of the present invention. (As shown in heart D) It is small. The image processing software calculates the skin wound area of the day and the third day to convert the wound healing rate, which is calculated as follows: The skin wound area of the day 1〇 〇 〇 〇曰 skin wound area wound healing rate (%) Guang Gu ancient + eight 曰 skin wound area ” - knife analysis of the wound healing rate of each group of mice, the community wants heart, year, year. As shown in Figure 9 and Table 1, the wound healing rate of the blank control fish rats was about 42%. ^ The wound healing rate of the mice in the test group was about 77.99%. The test group 2 small _ injury read rate was about • 99/〇 and compared with the blank control group, the wound healing rate of the test group 200925165 test group 2 was significantly different (ρ<〇. Table 1 Results of the mouse skin wound healing test group mouse number blank control group 32.17 test group 1 91.45 Test group 2 86.73 11 —_111 48.49 43.54 72.00 75.72 74·6〇79.50

IV 43.87 72.78 80.47 42.02 77.99 80.99

实施 Example 5 Human skin test The human skin is mixed with the above-mentioned emulsion containing 7_5hsCF+ 2MGIM. The data of the test sample is as shown in Table 2, and the test sites of each test object are recorded before the record, as shown in Figure 10. The A, C, and E arrows are shown. Table 2 Data of human skin test subjects Tester Gender Age ❹ Tester 1 Male Tester 2 Female Tester 3 Female 42 63 40 Test site Deep wrinkles at the end of the eye Deep wrinkles at the end of the eye Abdominal stretch marks

Before the test's test I Fig. 10A Fig. 10B Fig. 10C Fig. 10D Fig. 10E Fig. 10F The top emulsion prepared in the above Example 3 containing 7_5 gg/ml hSCF+ 2 pg/ml hIGF-l was partially applied to Each test subject's test site 'smear 2 times a day' 2 smear once, after continuous application of sputum, photographs the test site of each test object, as shown in the arrow at the b, D, F arrows; , B and circle C, E> It can be seen that after 30 days of using the composition for promoting wound healing provided by the present invention, the wrinkles of the face can be diluted; and 'from the perspective of Yuan 10 can also be seen from 200925165 The composition for promoting wound healing provided by the invention can also dilute the symptoms of the abdomen skin (for example, the nipple pattern). The composition for promoting wound healing provided by the present invention has the following advantages when compared with other conventional techniques: 1. The present invention proves for the first time that stem cell growth factor (SCF) has the ability to promote skin wound healing' and the membrane island When the growth factor d (hjGFd) is used in combination, it has the effect of reducing the wrinkles. φ 2. The present invention uses gene transfer and genetic engineering techniques to produce biologically active stem cell growth factor (SCF) and temsin growth factor _ 丨 (1ιΙ(}ΙΜ), which were confirmed by cell strain test. Growth factors are biologically active and promote cell growth. 3. The present invention utilizes basal colloidal embedding to allow stem cell growth factor (SCF) and insulin-like growth factor-1 (hIGF-Ι) to be stored at room temperature, and It retains its biological activity; and after embedding, the particle size is micro-nano grade (particle diameter up to 10-6~10-9m), which is in the form of emulsion, which is not only easy to apply but also helps the skin to absorb and penetrate. The composition of the present invention can not only directly, but also cooperate with the ultrasonic wave or micro-current transfer system to directly deliver the composition of the present invention to the dermis layer and accelerate the absorption of the skin. The above detailed description is feasible for one of the present inventions. The specific embodiments of the present invention are not intended to limit the scope of the invention, and the equivalents of the embodiments of the present invention should be included in the scope of the patents of the present invention. In summary, this case is not only innovative in the composition of the composition, but also can improve the above-mentioned multiple functions compared with the conventional articles. It should fully meet the statutory invention patent requirements of novelty and progressiveness, and love to apply according to law. This invention patent application, invented the invention, to the sense of virtue. 21 200925165 [Simplified schematic] Figure 1 is soluble human stem cell growth factor (soluble hSCF) after polymerase chain reaction (PCR) amplification, 1.5% After agarose gel electrophoresis analysis and staining with ethidium bromide (EtBr), the results were observed under ultraviolet light. Figure 2 shows the protein state by Coomassie blue staining after SDS-PAGE electrophoresis; Transgenic Escherichia coli with pET24a-SCF plastids see 2/-codonplus, 6 hours after induction by IPTG, crude protein extract of all cells; Lane 2: Transgenic Escherichia coli 5L27 with 24 PET24a-SCF plastid -codon plus, crude protein extract of insoluble fraction in cell lysate after 6 hours of induction by IPTG; lane 3: purified human stem cells after purification Long factor (s〇iublehsCF) protein. Figure 3 shows the results of Western blotting analysis of soluble human stem cell growth factor (s〇luWe hSCF) protein; lane 1: Transgenic Escherichia coli with pET24a-SCF plastid 5ZJ/- Codonphis, crude protein extract of all cells after 6 hours of induction by IPTG; lane 2: Escherichia coli with pET24a_SCF plastid was found to be knife-codon plus, 6 hours after induction by IPTG, fine cell lysate_ 1) Insoluble fracti〇n protein crude extract; Lane 3, purified soluble human stem cell growth factor (s〇hiblehSCF) protein. Figure 4 shows the effect of soluble human stem cell growth factor (s〇luble hSCF#^ 丨 丨 cell line growth activity. Figure 5 shows human primordial growth factor-1 (hIGF-Ι) polymerase chain reaction (PCR) amplification After the 'analysis of 1.5% agarose gel' and stained with ethidium bromide (EtBr), the results were observed under ultraviolet light. 22 200925165 Figure 6 is stained with coomassie biue after SDS-PAGE electrophoresis. Check the protein status; Lane 1: Transgenic E. coli with pET24a-IGF-1 plastids see 2; _c〇d〇nplus, 6 hours after induction with IpTG, crude protein extract of all cells; The crude protein extract of the insoluble fracti〇n in the cell lysate after 6 hours of induction by IPTG was transfected with E. coli plus pET24a-IGF-1 plastid; Lane 3: purified human growth factor (hiGF-Ι) protein. Figure 7 shows the effect of human insulin growth factor-1 (hIGF-Ι) on the growth activity of 3T3 cell line. II Figure 8 is mouse skin Wound healing test image record; Figure VIII A: Mouse at the beginning of the trial The image of the skin wound just caused; Figure 8B: The image of the skin wound after the test group 1 mice were treated for 3 days; Figure 8C: The image of the skin wound after the test group 2 mice were treated for 3 days; Fig. 8D: Image of skin wounds after 3 days of treatment in blank control mice. Figure 9 is a graph showing the wound healing rate of each group of mice in the skin wound healing test, indicating * with the blank control group The comparison is statistically significant (p < 0 05). Figure 10 is the human skin test image record; Figure 10 A, C, E is divided into the test site of the tester 1, 2, Ο 3; Figure 10 B, D and F are the test sites of the tester 2 and 3 after the application of the emulsion containing 7.5 pg/ml hSCF+2 pg/ml hIGF-1 prepared in the third embodiment. [Main component symbol description] None [Reference] Literature] 1. Tamnx, I., Kikuchi, T. 1990. Insulin-like factor (IGF-1), insulin, &nd epidennal growth factor (EGF) are survival factors for density-inhibited, quiescent Balb/c-3T3 Murine fibroblast J. Cell Physiol. 143(3): 494-500. 23 200925165 2. Frankel, SK, BM Moats-Staats, CD Cool, MW Wynes, AD Stiles, DW Riches. 2005. Human insulin-like growth factor-IA expression on transgenic mice promotes adenomatous hyperplasia but not pulmonary fibrosis. Am. J. Physiol. Lung Cll Mol. 288(5): L805-812. 3. Greenhalgh, DG 1996. The role of growth factors in wound healing. J. Trauma. 41: 159-167.

4. Loot, MA, Kenter, SB? Au, FL, Van Galen, WJ, Middelkoop, E., Bos, JD, Mekkes, JR 2002. Fibroblasts derived from chronic biological ulcers differ in the response to stimulation with EGF, IGF- 1, bFGF, and PDGF-AB compared to controls. Eur. J. Cell Biol. 81(3): 153-160. 5. Jiang, X., O. Gurel, EA Mendiaz, GW Steams, CL Clogston, HS Lu TD Osslund, RS Syed, KE Langley, WA Hendrickson. 2000. Structure of the active core of human stem cell factor and analysis of binding to its receptor kit. EMBO J. 19:3192-3203. 6. Nishimura, EK5 SA Jordan, H. Oshima, H. Yoshida, M. Noriyama, IJ Jackson, Y Barrandon, Y. Miyachi, SI Nishikawa. 2002. Dominant role of the niche in melanocyte stem-cell fate determination. Nature 416: 854-860. Mager, M.? R. Pause, N. Farjo, S. Muller-Rover, EMJ Peters, K. Foitzik, DJ Tobin. 2004. Limitations of human occipital scalp hair follicle oi^an culture for studying the effects of minoxidil as a hair growth en Hancer. Exp. Dermatol. 13:635-642. 8. Mol3 CD? KB Lim, V. Sridhar, H. Zou,, EYT Chien,, BC Sang, J. Nowakowski, DB Kassel,, CN Cronin, D.E McRee. 2003. Structure of a okit product complex reveals the basis for kinase transactivation. J. Biol. Chem. 278:31461-31464. 9. Broudy, VC (1997) Stem cell factor and hematopoiesis. Blood 90:1345-1364 10. Botchkareva, NV, M. Khlgatian, BJ Longley, VA Botchkarev, BA Gilchrest, 2001. SCF/c-KIT signaling is required for cyclic regeneration of the hair pigmentation unit. FASEB J. 15(3): 645-658 11· Jiang, X·, O. Gurel, E. A. Mendiaz, G. W. Steams, C. L. Clogston, H. S_ Lu, T. D. Osslund, RS Syed, KE Langley, WA Hendrickson. 2000. Structure of the active core of human 24 200925165 stem cell factor and analysis of binding to its receptor kit. EMBO J. 19:3192-3203. 12. Peters, EMJ? M. Maurer, VA Botchkarev, K. deM. Jensen , P. Welker, GA Scott, R. Paus. 2003. Kit is expressed by Epithelial cells in vivo. J. Invest. Dermatol. 121:976-984. 13. Zhang, Z., R. Zhang, A. Joachimiak, J. Schlessinger, XP Kong. 2000. Crystal structure of human stem cell factor: Implication For stem cell factor receptor dimerization and activation. Proc. Natl. Acad. Sci. USA 97:7732-7737.

25

Claims (1)

200925165 X. Patent application scope: 1. A composition for promoting wound healing, comprising: a human stem cell growth factor (hSCF) emulsifier, and an oil phase liquid; the emulsifier and the oil phase liquid system The human stem cell growth factor is embedded into a liposome-embedded material. 2. The composition for promoting wound healing according to claim 1, wherein the human stem cell growth factor has the sequence of SEQ ID No: 2. 3_ The composition for promoting wound healing according to claim 1, wherein the emulsifier comprises 栝· Tween 20, Tween 80, Triton X-100, and polyethylene glycol (jp〇iyethylene giyC〇i) , peg) and PEG-400. The composition for promoting wound healing according to the above aspect of the invention, wherein the oil phase liquid comprises: phospholipid, lecithin, cholesterol (cholesterol), sesame oil, mineral oil. 5. The composition for promoting wound healing according to claim 1, wherein the emulsifier and the oil phase liquid system are water in oil in water (w/o/w). In the method, a human stem cell growth factor is embedded to form a liposome-embedded material having micron nanoparticles. The composition for promoting wound healing according to claim 1, wherein the liposome-embedded material is mixed with a water-soluble colloid to increase the stability of the liposome-encapsulated material. 7. The composition for promoting wound healing according to claim 6, wherein the water-soluble colloid comprises: PolyEthylene Glycol (PEG-400), ethylene glycol, Tween 20, Sanxian Glue, transparent glue, etc. 8. A composition that promotes wound healing and reduces skin wrinkles and scars, including: a human stem cell 26 200925165 human stem cell factor (hSCF), a human insulin growth factor (human Insulin Growth Factor-1, hIGF-1), an emulsifier, and an oil phase liquid; the emulsifier and the oil phase liquid system embed the human stem cell growth factor and the human tamsin growth factor into a liposome-embedded material. 9. The composition of claim 8, wherein the human stem cell growth factor has the sequence of SEQ ID No: 2. 10. The composition of claim 8, which promotes wound healing and reduces skin wrinkles and scars, wherein the human insulin growth factor has the sequence of SEQ ID No: 4. 11. The composition for promoting wound healing and reducing skin wrinkles and scars according to claim 8, wherein the emulsifier comprises: Tween 20, Tween 80, Triton X-100, polyethylene glycol (polyethylene glycol, PEG) and PEG-400, etc. 12. The composition for promoting wound healing and reducing skin wrinkles and scars as described in claim 8 wherein the oil phase liquid comprises: ph〇sph〇lipid, lecithin, cholesterol ( Cholesterol, naphtha, mineral oil. © 13· A composition for promoting wound healing and reducing skin wrinkles and scars as described in claim 8 wherein the emulsifier and oil phase liquid system is water-in-oil and water-in-water (water in 〇丨1 water) The 'w/o/w method' embeds human stem cell growth factor (hSCF) and human insulin growth factor (hIGF-1) into a liposome-embedded material with micro-nanoparticles. 14. The composition for promoting wound healing and reducing skin wrinkles and scars as described in claim 8, wherein the liposome-embedded body is mixed with a water-soluble colloid to increase the stability of the liposome-encapsulated material. Sex. The composition for promoting wound healing and reducing skin wrinkles and scars according to claim 14, wherein the water-soluble colloid comprises: polyethylene glycol glycerin, ethylene glycol, Tween 20, and triterpenoid , transparent plastic, etc. 28