KR20100111899A - Novel kgf2-fn10 fusion protein and its use for promoting skin regeneration - Google Patents

Abstract

PURPOSE: A novel KGF2-FN10 fusion protein is provided to ensure kerationocyte differentiation and mitogenic activation and to use for cosmetic product and drug. CONSTITUTION: A KGF2-FN10 fusion protein has keratinocyte growth factor 2(KGF2) and fibronectin type 10 III domain(FN10). The KGF 2 has an amino acid sequence of sequence number 1. The FN10 has an amino acid sequence of sequence number 2. The fusion protein has an amino acid sequence of sequence number 4. A polynucleotide encoding the fusion protein has a base sequence of sequence number 3. A composition for proliferating keratinocytes and promoting differentiation of keratinocytes contains KGF2-FN10 fusion protein as an active ingredient. A composition for promoting skin regeneration contains KGF2-FN10 fusion protein as an active ingredient.

Description

Novel KGF2-FN10 fusion protein and its use for promoting skin regeneration}

The present invention relates to the use of a novel fusion protein, and more particularly to a novel KGF2-FN10 fusion protein in which keratinocyte growth factor 2 (KGF2) and fibronectin's tenth type III domain (FN10) are bound. And its use for promoting keratinocyte proliferation and differentiation and ultimately for promoting skin regeneration using the same.

Keratinite growth factor 2 (KGF2) was first isolated from rat embryo cDNA by homologous-based polymerase chain reactions and is a member of the fibroblast growth factor (FGF) superfamily [Emoto, H. et al. Structure and expression of human fibroblast growth factor-10. J Biol Chem 1997, 272: 23191-2319. KGF2 is mainly synthesized in mesenchymal cells, and predominantly acts on epithelial cells in a paracrine manner [Beer, H. D. et al. Mouse fibroblast growth factor 10: cDNA cloning, protein characterization, and regulation of mRNA expression. Oncogene 1997, 15: 2211-2212. KGF2-mediated mesenchymal cell-epithelial interactions have been shown to play epithelial regeneration during wound healing and to play an important role in the basic work of normal skin structure during development [Soler, P. M. et al. In vivo characterization of keratinocyte growth factor-2 as a potential wound healing agent. Wound Repair Regen 1999, 7: 172-17.

Growth factor-induced proliferation and differentiation require cells to attach to extracellular matrix (ECM) components [Ingham, K. C. et al. Interaction of heparin with fibronectin and isolated fibronectin domains. Biochem J 1990, 272: 605-61. Fibronectin (FN) is a major ECM component used by many cell types as an adhesion substrate [Ruoslahti, E. Fibronectin and its receptors. Annu Rev Biochem 1988, 57: 375-41]. In normal skin, fibronectin is present in dermal-epidermal junctions and increases in skin tissue upon wound healing [Stenman, S. and Vaheri, A. Distribution of a major connective tissue protein, fibronectin, in normal human tissues. J Exp Med 1978, 147: 1054-106. Fibronectin has a molecular structure with homologous repeat modules consisting of 40-90 amino acids [Ruoslahti, E. Fibronectin and its receptors. Annu Rev Biochem 1988, 57: 375-41]. Tenth type III domains of fibronectin (FN10) include Arg-Gly-Asp (RGD), a major cell-adhesion domain of fibronectin and is recognized by members of integrins [Choung, P. H. et al. Synergistic activity of fibronectin and fibroblast growth factor receptors on neuronal adhesion and neurite extension through extracellular signal-regulated kinase pathway. Biochem Biophys Res Commun 2002, 295: 898-90].

We designed a novel KGF2 fusion protein (KGF2-FN10) comprising FN1 for cell adhesion function and examined the effect of the protein on cell adhesion, proliferation and differentiation in primary human keratinocytes. By demonstrating, this invention was completed.

Therefore, the main object of the present invention is to provide a novel KGF2-FN10 fusion protein in which keratinocyte growth factor 2 (KGF2) and fibronectin's tenth type III domain (FN10) are bound.

Another object of the present invention to provide a polynucleotide encoding the KGF2-FN10 fusion protein of the present invention and a recombinant vector comprising the same.

Another object of the present invention to provide a host cell transformed with the recombinant vector of the present invention and a method for producing KGF2-FN10 fusion protein using the same.

Another object of the present invention is to provide a keratinocyte proliferation and differentiation promoting use of the KGF2-FN10 fusion protein of the present invention and ultimately to promote skin regeneration using the same.

According to one aspect of the invention, the present invention provides KGF2-FN10 fusion protein, characterized in that keratinocyte growth factor 2 (KGF2) and fibronectin's tenth type III domain (FN10) are bound.

In the present invention, the keratinocyte growth factor 2 (KGF2) is also known as FGF10 as a member of the fibroblast growth factor (FGF) family, the protein is mitogenic activity of epidermal cells that are keratinized It is known to function as a major factor in the wound healing process [Emoto H et al. (1997). "Structure and expression of human fibroblast growth factor-10.". J. Biol. Chem. 272 (37): 23191-4. The keratinocyte growth factor 2 (KGF2) of the present invention may have any amino acid sequence of a protein known as KGF2 or FGF10 in NCBI (www.ncbi.nlm.nih.gov) or a variant known to function equivalent thereto, It is preferably characterized by having the amino acid sequence of human KGF2 protein (NM_004465), most preferably the amino acid sequence of SEQ ID NO: 1.

In the present invention, the fibronectin is a type of extracellular matrix (ECM) protein having a broad binding specificity to integrins, which are cell surface receptors. Fibronectin is known to be involved in many important functions such as wound healing, cell adhesion, blood clotting, cell differentiation and migration [Dean DC et al. (1987). "Cloning and analysis of the promotor region of the human fibronectin gene". Proc. Natl. Acad. Sci. U.S.A. 84 (7): 1876-1880. The main part of the sequence of fibronectin consists of repeats of three type domains, which are called types I, II, and III [Skorstengaard K et al. (1986). "Complete primary structure of bovine plasma fibronectin". Eur. J. Biochem. 161 (2): 441-453]. The tenth fibronectin type III domain (FN10) used in the present invention is a small autonomous domain of fibronectin having an RGD sequence directly involved in integrin binding. The FN10 domain of the present invention may have any amino acid sequence of a domain known as FN10 in the NCBI (www.ncbi.nlm.nih.gov) or a variant known to function equivalent thereto, but preferably the human FN10 domain ( AAD00019), and most preferably having the amino acid sequence of SEQ ID NO: 2.

In the present invention, the KGF2-FN10 fusion protein may have an amino acid sequence of any fusion protein to which KGF2 and FN10 are bound, preferably 5-10 amino acid residues for linkage between the protein between KGF2 and FN10. It may include a linker having, and most preferably characterized by having the amino acid sequence of SEQ ID NO: 4.

According to another aspect of the invention, the present invention provides a polynucleotide encoding KGF2-FN10 fusion protein to which keratinocyte growth factor 2 (KGF2) and fibronectin's tenth type III domain (FN10) are bound. do.

In the present invention, the polynucleotide may have any base sequence capable of encoding the KGF2-FN10 fusion protein, but preferably the base sequence encoding the KGF2-FN10 fusion protein having the amino acid sequence of SEQ ID NO: 4, Most preferably, it has a nucleotide sequence of SEQ ID NO: 3.

According to another aspect of the invention, the invention provides a recombinant vector comprising a polynucleotide having a nucleotide sequence encoding the KGF2-FN10 fusion protein.

In the present invention, the recombinant vector may be any recombinant vector in which the KGF2-FN10 fusion protein coding polynucleotide is inserted into a vector, but preferably includes a promoter capable of expressing in prokaryotic or eukaryotic cells. The recombinant vector may be inserted into a vector, and more preferably, it is a pBAD / HisA-KGF2-FN10 recombinant vector having a cleavage map of FIG. 1B.

According to another aspect of the present invention, the present invention provides a host cell transformed with a recombinant vector comprising a KGF2-FN10 fusion protein coding polynucleotide according to the present invention.

In the present invention, the host cell may be prokaryotic or eukaryotic, depending on the type of recombinant vector, but is preferably Escherichia coli .

According to another aspect of the present invention, the present invention comprises the steps of culturing a host cell transformed with a recombinant vector comprising a KGF2-FN10 fusion protein coding polynucleotide according to the present invention; Expressing KGF2-FN10 fusion protein to which keratinocyte growth factor 2 (KGF2) and fibronectin's tenth type III domain (FN10) are bound; And it provides a method for producing a KGF2-FN10 fusion protein comprising the step of separating the KGF2-FN10 fusion protein.

According to another aspect of the present invention, the present invention provides a composition for promoting cell proliferation and differentiation of keratinocytes containing the KGF2-FN10 fusion protein according to the present invention as an active ingredient. In Example 4 of the present invention, the cell proliferation promoting effect of keratinocytes was experimentally proved, and in Example 5, the differentiation promoting effect of keratinocytes was experimentally demonstrated. Human cytokeratin K10 used in Example 5 is widely known as keratinocyte differentiation markers [Berge U et al. Kinetin-induced differentiation of normal human keratinocytes undergoing aging in vitro. Ann N Y Acad Sci. 2006 May; 1067: 332-6.

According to another aspect of the present invention, the present invention provides a composition for promoting skin regeneration comprising the KGF2-FN10 fusion protein according to the present invention as an active ingredient.

In the present invention, the composition for promoting skin regeneration is characterized in that it is used as a cosmetic for cosmetic improvement or wound treatment.

When the KGF2-FN10 fusion protein of the present invention is used as a medicament for wound treatment, it may be prepared by a known method in the pharmaceutical field, and may be mixed with itself or a pharmaceutically acceptable carrier, excipient, diluent, etc. It may be prepared and used in the form of a tablet, capsule, or injection. They can also be administered orally or parenterally. Preferably, the fusion protein of the present invention may be prepared in the form of a dressing or ointment for wound treatment when used as a medicament.

The dosage for administering the KGF2-FN10 fusion protein according to the present invention as an active ingredient may be appropriately selected according to the age, sex, condition and symptoms of the disease of the patient, and preferably, once a day when applied with a dressing or ointment. It can be administered as 0.1-100 mg of the fusion protein.

Hereinafter, the present invention will be described in more detail.

The present invention provides novel KGF2-FN10 fusion proteins. Wherein KGF2 comprises a polypeptide having an amino acid sequence represented by SEQ ID NO: 1 and a functional equivalent of the polypeptide, and FN10 includes a polypeptide having an amino acid sequence represented by SEQ ID NO: 2 and a functional equivalent of the polypeptide do. The term "functional equivalent" means that at least 80%, more preferably 90% or more of the amino acid sequence has sequence homology as a result of the addition, substitution, or deletion of an amino acid, substantially with the KGF2 protein or FN10 domain of the present invention. Refers to a polypeptide exhibiting homogeneous physiological activity. Methods of exchanging amino acids of proteins without significantly altering their physiological activity are known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). In some cases, the UDG protein may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, or the like.

The present invention also provides a polynucleotide encoding the KGF2-FN10 fusion protein. The polynucleotide may be a single chain or a double chain having a nucleotide sequence, and may be DNA or RNA. The polynucleotides can be isolated in nature or prepared by chemical synthesis (Engels and Uhlmann, Angew Chem Int Ed Engl. 37: 73-127, 1988). However, it can be preferably isolated from humans by methods such as PCR. Preferably the polynucleotide sequence has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 4, more preferably has a nucleotide sequence of SEQ ID NO: 3.

The polynucleotide encoding the KGF2-FN10 fusion protein according to the present invention can be inserted into a suitable expression vector to transform the host cell. The term "expression vector" refers to a plasmid, virus or other medium into which a polynucleotide sequence encoding KGF2-FN10 fusion protein can be inserted or introduced. The polynucleotide sequence according to the present invention may be operably linked to an expression control sequence, wherein the operably linked gene sequence and the expression control sequence are one expression vector containing a selection marker and a replication origin together. It may be included within. “Operably linked” can be genes and expression control sequences linked in such a way as to enable gene expression when the appropriate molecule is bound to the expression control sequences. The "expression control sequence" refers to a DNA sequence that controls the expression of a polynucleotide sequence operably linked in a particular host cell. Such regulatory sequences include promoters for carrying out transcription, any operator sequence for regulating transcription, sequences encoding suitable mRNA ribosomal binding sites, and sequences that control termination of transcription and translation. Examples of the plasmids include E. coli-derived plasmids (pBR322, pBR325, pUC118 and pUC119, pET-22b (+)), Bacillus subtilis-derived plasmids (pUB110 and pTP5) and yeast-derived plasmids (YEp13, YEp24 and YCp50). The virus may be an animal virus such as a retrovirus, adenovirus or vaccinia virus, or an insect virus such as a baculovirus. A vector suitable for introducing a polynucleotide according to the present invention into a host cell can be used, and preferably a vector designed to facilitate protein expression induction and isolation of the expressed protein.

Recombinant vectors comprising the polynucleotides of the present invention can be introduced into host cells using methods known in the art. The method of introducing the recombinant vector according to the present invention into a host cell may include, but is not limited to, calcium chloride (CaCl 2) and heat shock, particle gun bombardment, and silicon carbide whister. Silicon carbide whiskers, sonication, electroporation, and precipitation with polyethylenglycol (PEG).

Accordingly, the present invention provides host cells transformed with the recombinant vector of the present invention. The host cell is preferably a bacterium, for example E. coli.

The present invention also provides a method for producing the KGF2-FN10 fusion protein of the present invention comprising the step of culturing the transformed bacteria. The method comprises culturing under appropriate media and conditions such that the polynucleotide encoding the KGF2-FN10 fusion protein of the invention is expressed in the transformed host cell. Methods for culturing the transformed cells to express the recombinant protein are known in the art, and for example, seeded in a suitable medium in which the transformed cells can be grown and seeded, and then seeded in the culture medium. And expression of the protein by incubation in suitable conditions. Thereafter, the isolation and purification of the KGF2-FN10 fusion protein of the present invention, the expression of which is induced in the transformed cells can be carried out through various separation and purification methods known in the art, for example, lysing the cells. The lysate is then centrifuged to form salts (ammonium sulfate precipitation and sodium phosphate precipitation), solvent precipitation (protein fraction precipitation with acetone, ethanol, etc.), dialysis, gel filtration, ion exchange chromatography, reverse phase column chromatography and prochining. Techniques such as chemical chromatography can be applied alone or in combination to produce the KGF2-FN10 fusion protein of the present invention. See, Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, cold Spring Habor, NY. (1982); Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press (1989); Deutscher, M., Guide to Protein Purification Methods Enzymology, vol. 182. Academic Press. Inc., San Diego, CA (1990)].

Growth factor-induced proliferation and differentiation often requires cell attachment to extracellular matrix proteins such as fibronectin. The present invention is the result of studying the effect of keratinocyte growth factor 2 (KGF2) fused to fibronectin on the extracellular matrix protein on the KGF2 activity according to protein manipulation. The fusion protein (KGF2-FN10) expressed in Escherichia coli according to an embodiment of the present invention exhibited significantly elevated mitogenic activity of KGF2 in human keratinocytes. In addition, KGF2-FN10 fusion proteins showed significantly increased keratinocyte differentiation activity compared to the original KGF2.

Cell adhesion to extracellular matrix such as fibronectin induces many intracellular signal transductions, including increased FAK autophosphorylation and activation of ERK-type MAP kinase. Such integrin-mediated signal transduction suggests that other mitogenic signal transduction pathways are involved to coordinate cell proliferation and differentiation. In previous studies, we found that fibronectin-mediated signaling is amplified with signals generated from FGFRs via the ERK-type MAP kinase pathway. Although detailed mechanisms regarding the association of KGF2-FN10 with enhanced biological activity in elevated human keratinocytes should be identified, the amplified effects of KGF2 and fibronectin are believed to play an important role in the potential activity of KGF2-FN10.

KGF-2 enhances skin wound treatment and re-epidermalization. In the racket model of scar formation, KGF-2 is most effective in treating wounds and leaves no apparent scars compared to other growth factors, including KGF-1 and TGF-β. In addition, fibronectin enhances keratinocyte attachment and migration in the treatment of wounds.

In the present invention, we have successfully produced fusion proteins that retain the activity of both original KGF2 and fibronectin. These fusion proteins exhibited significantly enhanced mitogenic activity of KGF2 in human keratinocytes. In addition, KGF2-FN10 fusion proteins showed significantly increased keratinocyte differentiation activity compared to the original KGF2. Therefore, current in vitro experiments show that KGF2-FN10 fusion proteins have some advantages over the original KGF2 and could potentially provide new strategies for the potential therapeutic effects of KGF2.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only intended to illustrate the invention, so the scope of the invention is not to be construed as limited by these examples.

Example 1 Construction of Expression Plasmids and Purification

PCR primers were designed to recognize tenth type III domain of human fibronectin (FN10) as follows: FN10 upstream primers, 5'-CTCGAGCAACAATCAACAGTTTC-3, FN10 downstream primers, 5'-CTCGAGTGGTTTGTCAATTTC-3. PCR was performed using Human cDNA library (Invitrogen) as a template, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl 2, 100 μg ml ^-1 gelatin, 0.2 mM dNTPs, 1.25 units Taq polymerase (iNtRON), 50 each. The reaction was carried out in 30 μl reaction containing pmol upstream and downstream primers. The thermocycling parameters used in the PCR were as follows: annealing 1 min at 55 ° C .; Extension 2 min at 72 ° C .; Denaturation 1 min at 94 ° C. After 30 cycles, PCR-amplified cDNA products were digested with PstI. After digestion, the PCR products were subjected to the vector pBAD-HisA2 cloned with the cDNA of KGF2 (see FIG. 1A; Jang, JH Stimulation of human hair growth by the recombinant human keratinocyte growth factor-2 (KGF-2). Biotechnol Lett 2005, 27: 749-75] was in-frame ligated to finally produce the recombinant vector pBAD-HisA-KGF2-FN10 (see FIG. 1B). KGF2-FN10 fusion proteins containing poly-His tags were expressed by transforming E. coli strain BL21 (DE3) according to the manufacturer's protocol (Invitrogen) and purified using Ni2 + affinity column under denaturing conditions. 2 is a photograph confirming the expression of purified recombinant KGF2-FN10 fusion protein by SDS-PAGE. Recombinant KGF2-FN10 was shown as a fusion protein labeled with histidine (His6) and purified using a Ni-NTA column. Diluted material was subjected to SDS-PAGE under reduced conditions and visualized by Coomassie Blue staining. Protein was subjected to 10% (w / v) SDS-polyacrylamide gel electrophoresis. Molecular mass markers are represented by kDa.

Example 2: Cell Culture

Experiments were performed using primary human keratinocytes (Invitrogen). These cells were cultured in Keratinocyte-SFM according to the manufacturing protocol (Invitrogen). Cells were incubated at 37 ° C. in humid air containing 5% CO 2. The medium was changed 3 times a week and the cultures were separated by treatment of cells with 0.05% (w / v) Trypsin-EDTA for 5 minutes at 37 ° C. before reaching saturation.

Example 3: Cell adhesion assay

Primary human keratinocytes were harvested by 0.05% (w / v) Trypsin-EDTA, resuspended in Keratinocyte-SFM, washed three times with growth medium containing 500 μg ml-1 Soybean Trypsin Inhibitor, Plated at 5 x 10 ⁴ cells per well in Keratinocyte-SFM. 24-well plates were coated overnight with KGF2, FN10 or KGF2-FN10 (0.5-1 μM) under the conditions described at 4 ° C. and then blocked for 30 minutes with 1% (w / v) BSA in PBS. And washed with PBS.

Nonspecific attachment was blocked by incubation with 0.5% BSA in PBS for 1 hour at 37 ° C. After 45 min at 37 ° C, adherent cells were washed twice with PBS, mixed with 3% (w / v) paraformaldehyde (Sigma) and then 0.25% (w / v) Crystal violet (Sigma) in 2% (v / v) stained with ethanol / water. After rinsing with distilled water, the plates were dried. Absorbance was measured at 570 nm and nonspecific attachment as a negative control was determined in wells coated with 1% (w / v) BSA.

3 is a graph comparing the adhesion of primary human keratinocytes to plates coated with KGF2, FN10, and KGF2-FN10. Attachment analysis was performed on keratinocytes planted on various substrata as described. The result is the OD value of the cells stained with crystal violet (average SE). (*, p <0.05 n = 4).

Example 4: Growth assays

Cell growth was determined by the MTS (3- (4,5-dimethylthiazol-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) -2H-tetrazolium), which counted the number of viable cells as described. It was analyzed by tetrazolium assay (Celltiter96TM AQ Non-radioactive Cell proliferation Assay, Promega, USA). This assay measures the conversion of a methyl terazol sulfate (MTS) to a water-soluble formazan product that absorbs 490 nm.

The cells were grown in 24-well plates at a concentration of 5000 cells per well with them adding FN10, KGF2, or KGF2-FN10 to a concentration of 0.5 μM. After incubation of cells at 37 ° C. for 5 days, MTS (40 μL) was added and then additionally hatched at 37 ° C. for 4 hours. Optical concentration was measured at 490 nm when using an ELISA reader (Tecan).

4 is a graph showing the growth-stimulating effect of KGF2-FN10 on human keratinocytes. Human keratinocytes were hatched with FN10, KGF2, and KGF2-FN10 for 5 days. Data are presented as percentage of untreated control and mean SE (*, p <0.05 n = 4).

Example 5: Quantitative real-time RT-PCR

First strand cDNA was synthesized from total RNA (2 μg) using the SuperScript first strand synthesis system for RT-PCR (Invitrogen) according to the manufacturer's instructions. The amount of reaction mixture was 50 μl. Quantitative real-time PCR was performed using SYBR GreenER qPCR SuperMix reagents (Invitrogen) and Bio-Rad iCycler. Relative transcript amounts were calculated using the ΔΔCt method with β-actin as the endogenous related gene amplified from the sample. The primer sequence is as follows: human cytokeratin K10 forward: 5'-gaaccacgaggaggaaatga-3 ', reverse: 5'-tgcacacagtagcgaccttc-3' involucrin forward: 5'-caactgaagcatctggagca-3 ', reverse: 5'-agggctggttgaatgtcttg-3' β- actin forward: 5'-TTGCCGACAGGATGCAGAA-3 ', reverse: 5'- GCCGATCCACACGGAGTACTT -3'.

5 is a graph showing the effect of KGF2-FN10 on endogenous cytokeratin K10 and involucrin mRNA levels in human keratinocytes. All RNAs were obtained from human keratinocytes treated with KGF2 or KGF2-FN10 and subjected to quantitative real-time PCR after one day incubation to quantify endogenous levels of cytokeratin K10 and involucrin mRNA. Data is shown as fold expression, meaning signal of untreated control as 1 unit. The value is the mean of at least 3 experiments ± SE (*, p <0.05).

Result 1: Expression and purification of the recombinant fusion protein in E. coli

To link KGF2 and fibronectin fragments, the major cell-linked FN domains that make up the tenth type III domains of FN (FN10) were fused with KGF2 and named KGF2-FN10. The cDNA encoding FN10 was subcloned into pBAD / HisA-KGF2 eexpression vector at the XhoI restriction enzyme site for expression in bacteria as described in Example 1. Such vectors include the amino-terminal polyhistidine sequence for affinity purification and the araBAD promoter for strongly-regulated expression.

E. TOP10 cells were cultured overnight in 37 ° C. LB-Amp medium for expression of recombinant KGF2-FN10. When the culture reached A600 = 0.6, induction was initiated using 0.02% (w / v) L-arabinose as inducer. After 3 hours the bacteria were pelleted by centrifugation, lysed and sonicated. Soluble extract was prepared by centrifugation at 14,000 × g for 30 minutes in a refrigerated centrifuge and the supernatant was transferred to a fresh tube.

Crude protein obtained from supernantant of sonicated bacteria is purified by connecting a hexahistidine tag to a nickel-nitrilotriacetic acid resin column (located at the amino terminal end of the protein). The degree of purification of the recombinant protein is determined by Coomassie blue staining of 10% (v / v) SDS-PAGE under denaturing conditions. In induction with L-arabinose, E. Top 10 produced proteins of Mr550,000 (measured by SDS-PAGE) that are expected to be fusion proteins containing KGF2-FN10 and amino-terminal His. (FIG. 2).

Result 2: Cell adhesion activity of KGF2-FN10 fusion protein

In order to analyze the ability of KGF2-FN10 fusion proteins to enhance cell adhesion, primary human keratinocytes were planted on plastic tissue-culture plates coated with FN10, KGF2 and KGF2-FN10. The cells adhered well to both FN10-coated plates and KGF2-FN10-coated plates. However, it was observed that little cells were requested on the KGF2-coated plates or non-coated plates (FIG. 3).

Outcome 3: effect of KGF2-FN10 on cell growth

Next, the mitogenic activity of KGF2-FN10 against human keratinocytes in culture was evaluated. Analyzes were performed in the absence of supplements, excluding the addition of other spontaneous substances such as brain extracts. As shown in Figure 4, KGF2-FN10 significantly stimulated the proliferation of primary human keratinocytes compared to KGF2 or FN10 (p <0.05). These results suggest that KGF2 fused with FN10 enhances the mitogenic activity of KGF2 to human keratinocytes.

Outcome 4: Effect of KGF2-FN10 on the keratinocyte differentiation on keratinocyte differentiation

To analyze the effect of KGF2-FN10 on keratinocyte differentiation, we tested the effect of KGF2-FN10 on the expression of differentiation markers by real-time PCR. As shown in Figure 5, KGF2-FN10 significantly increased the expression of differentiation markers, cytokeratin K10 and involucrin mRNA compared to KGF2 (p <0.05). These results suggest that KGF2-FN10 fusion proteins have more potential than KGF2 in their capacity for keratinocyte differentiation.

As described above, according to the present invention, the KGF2-FN10 fusion protein showed significantly elevated mitogenic activity and keratinocyte differentiation activity of human keratinocytes as compared to the original KGF2. Therefore, the KGF2-FN10 fusion protein of the present invention may be effectively used as a cosmetic or medicament for promoting skin regeneration.

FIG. 1A is a map of the vector pBAD / HisA used to make the recombinant vector of the present invention, and FIG. 1B is a map of the recombinant vector pBAD / HisA-KGF2-FN10 finally prepared according to the embodiment of the present invention.

2 is a photograph confirming the expression of purified recombinant KGF2-FN10 fusion protein by SDS-PAGE.

3 is a graph comparing the adhesion of primary human keratinocytes to plates coated with KGF2, FN10, and KGF2-FN10.

4 is a graph showing the growth-stimulating effect of KGF2-FN10 on human keratinocytes.

5 is a graph showing the effect of KGF2-FN10 on endogenous cytokeratin K10 and involucrin mRNA levels in human keratinocytes.

<110> SNU R & DB FOUNDATION          GENOSS CO., LTD. <120> Novel KGF2-FN10 fusion protein and its use for promoting skin          regeneration <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 140 <212> PRT <213> Homo sapiens <400> 1 Ser Tyr Asn His Leu Gln Gly Asp Val Arg Trp Arg Lys Leu Phe Ser   1 5 10 15 Phe Thr Lys Tyr Phe Leu Lys Ile Glu Lys Asn Gly Lys Val Ser Gly              20 25 30 Thr Lys Lys Glu Asn Cys Pro Tyr Ser Ile Leu Glu Ile Thr Ser Val          35 40 45 Glu Ile Gly Val Val Ala Val Lys Ala Ile Asn Ser Asn Tyr Tyr Leu      50 55 60 Ala Met Asn Lys Lys Lys Gly Lys Leu Tyr Gly Ser Lys Glu Phe Asn Asn  65 70 75 80 Asp Cys Lys Leu Lys Glu Arg Ile Glu Glu Asn Gly Tyr Asn Thr Tyr                  85 90 95 Ala Ser Phe Asn Trp Gln His Asn Gly Arg Gln Met Tyr Val Ala Leu             100 105 110 Asn Gly Lys Gly Ala Pro Arg Arg Gly Gln Lys Thr Arg Arg Lys Asn         115 120 125 Thr Ser Ala His Phe Leu Pro Met Val Val His Ser     130 135 140 <210> 2 <211> 103 <212> PRT <213> Artificial Sequence <220> <223> The tenth type III domains of fibronectin (FN10) <400> 2 Gln Gln Ser Thr Val Ser Asp Val Pro Arg Asp Leu Glu Val Val Ala   1 5 10 15 Ala Thr Pro Thr Ser Leu Leu Ile Ser Trp Asp Ala Pro Ala Val Thr              20 25 30 Val Arg Tyr Tyr Arg Ile Thr Tyr Gly Glu Thr Gly Gly Asn Ser Pro          35 40 45 Val Gln Glu Phe Thr Val Pro Gly Ser Lys Ser Thr Ala Thr Ile Ser      50 55 60 Gly Leu Lys Pro Gly Val Asp Tyr Thr Ile Thr Val Tyr Ala Val Thr  65 70 75 80 Gly Arg Gly Asp Ser Pro Ala Ser Ser Lys Pro Ile Ser Ile Asn Tyr                  85 90 95 Arg Thr Glu Ile Asp Lys Pro             100 <210> 3 <211> 744 <212> DNA <213> Artificial Sequence <220> <223> cDNA of KGF2-FN10 fusion protein <400> 3 agctacaatc accttcaagg agatgtccgc tggagaaagc tattctcttt caccgagtac 60 tttctcaaga ttgagaagaa cgggaaggtc agcgggacca agaaggagaa ctgcccgtac 120 agcatcctgg agataacatc agtagaaatc ggagttgttg ccgtcaaagc cnttaacagc 180 aactattact tagccatgaa caagaagggg aaactctatg gctcaaaaga atttaacaat 240 gactgtaagc tgaaggagag gatagaggaa aatggataca atacctatgc atcatttaac 300 tggcagcata atgggaggca aatgtatgtg gcattgaatg gaaaaggagc tccaaggaga 360 ggacagaaaa cacgaaggaa aaacacctct gctcactttc ttccaatggt ggtacactca 420 ctcgagatct gcagccaaca atcaacagtt tctgatgttc cgagggacct ggaagttgtt 480 gctgcgaccc ccaccagcct actgatcagc tgggatgctc ctgctgtcac agtgagatat 540 tacaggatca cttacggaga aacaggagga aatagccctg tccaggagtt cactgtgcct 600 gggagcaagt ctacagctac catcagcggc cttaaacctg gagttgattg taccatcact 660 gtgtatgctg tcactggccg tggagacagc cccgcaagca gcaagccaat ttccattaat 720 taccgaacag aaattgacaa acca 744 <210> 4 <211> 249 <212> PRT <213> Artificial Sequence <220> <223> KGF2-FN10 fusion protein <400> 4 Ser Tyr Asn His Leu Gln Gly Asp Val Arg Trp Arg Lys Leu Phe Ser   1 5 10 15 Phe Thr Lys Tyr Phe Leu Lys Ile Glu Lys Asn Gly Lys Val Ser Gly              20 25 30 Thr Lys Lys Glu Asn Cys Pro Tyr Ser Ile Leu Glu Ile Thr Ser Val          35 40 45 Glu Ile Gly Val Val Ala Val Lys Ala Ile Asn Ser Asn Tyr Tyr Leu      50 55 60 Ala Met Asn Lys Lys Lys Gly Lys Leu Tyr Gly Ser Lys Glu Phe Asn Asn  65 70 75 80 Asp Cys Lys Leu Lys Glu Arg Ile Glu Glu Asn Gly Tyr Asn Thr Tyr                  85 90 95 Ala Ser Phe Asn Trp Gln His Asn Gly Arg Gln Met Tyr Val Ala Leu             100 105 110 Asn Gly Lys Gly Ala Pro Arg Arg Gly Gln Lys Thr Arg Arg Lys Asn         115 120 125 Thr Ser Ala His Phe Leu Pro Met Val Val His Ser Leu Glu Ile Cys     130 135 140 Ser Ser Gln Gln Ser Thr Val Ser Asp Val Pro Arg Asp Leu Glu Val 145 150 155 160 Val Ala Ala Thr Pro Thr Ser Leu Leu Ile Ser Trp Asp Ala Pro Ala                 165 170 175 Val Thr Val Arg Tyr Tyr Arg Ile Thr Tyr Gly Glu Thr Gly Gly Asn             180 185 190 Ser Pro Val Gln Glu Phe Thr Val Pro Gly Ser Lys Ser Thr Ala Thr         195 200 205 Ile Ser Gly Leu Lys Pro Gly Val Asp Tyr Thr Ile Thr Val Tyr Ala     210 215 220 Val Thr Gly Arg Gly Asp Ser Pro Ala Ser Ser Lys Pro Ile Ser Ile 225 230 235 240 Asn Tyr Arg Thr Glu Ile Asp Lys Pro                 245  

Claims (15)

Fusion protein characterized by binding of keratinocyte growth factor 2 (KGF2) and fibronectin's tenth type III domain (FN10) The fusion protein of claim 1, wherein keratinocyte growth factor 2 (KGF2) has the amino acid sequence of SEQ ID NO: 1. 2. The fusion protein of claim 1, wherein the tenth type III domain of fibronectin (FN10) has the amino acid sequence of SEQ ID NO: 2. The fusion protein of claim 1, wherein the fusion protein has the amino acid sequence of SEQ ID NO. 4. A polynucleotide encoding a fusion protein to which keratinocyte growth factor 2 (KGF2) and fibronectin's tenth type III domain (FN10) are bound. The polynucleotide of claim 5, wherein the polynucleotide has a nucleotide sequence encoding a fusion protein having an amino acid sequence of SEQ ID NO: 4. 7. The polynucleotide of claim 5, wherein the polynucleotide has a nucleotide sequence of SEQ ID NO. Recombinant vector comprising a polynucleotide according to claim 5. The recombinant vector of claim 8, wherein the recombinant vector is pBAD / HisA-KGF2-FN10 having a cleavage map of FIG. 1B. A host cell transformed with the recombinant vector according to claim 8. The host cell of claim 10, wherein the host cell is Escherichia coli . Culturing the host cell according to claim 8; Expressing a fusion protein to which keratinocyte growth factor 2 (KGF2) and fibronectin's tenth type III domain (FN10) are bound; And Method for producing a KGF2-FN10 fusion protein comprising the step of separating the fusion protein. Composition for promoting cell proliferation and differentiation of keratinocytes containing the fusion protein according to claim 1 as an active ingredient. A composition for promoting skin regeneration comprising the fusion protein according to claim 1 as an active ingredient. The composition of claim 14, wherein the composition is used as a cosmetic for improving skin or as a medicament for treating wounds.

Images