TH4455A - There is a nectin obtained from the recombinant and the manufacturing process thereof. - Google Patents

Abstract

The invention involved the production of a new human protein, the minactivin. By recombinant DNA technology, characterization of gene sequences Transcription and bioactive minactivin Large quantity from the host recombinant It is also involved in the purification of the original biologically active minactivins, as well as the minacutivine-derived peptides and their amino acid sequences.

Claims (7)

1. DNA molecules with the sequence as 1 GTCAGACAGCAACTCAGAGAATAACCAGAGAACAACCAGATTGAAACA 49 ATG GAG GAT CTT TGT GTG GCA AAC ACA CTC TTT GCC CTC AAT TTA 94 TCC AAG CAT CTG GCA AAA GCA AGC CCC ACC CAG AAC CTC TTC A TCG 139 TCC CCC TGG TCC ACC ATG GCC ATG GTC TAC ATG GCC 184 TCC AGG GGC AGC ACC GAA GAC CAG ATG GCC AAG GTG CTT CAG TTT 229 AAT GAA GTG GGA GCC AAT GCA GTT ACC CCC ATG ACT CCA GAG AAC 274 TTT ACC AGC TGT GGG TTC ATG CAG CAG ATC CAG AAG GGT AGT TAT 319 CCT GAT GCG ATT TTG CAG GCA CAA GCT GCA GAT AAA ATC CAT TCA 364 TCC TTC CGC TCT CTC AGC TCT GCA ATC AAT GCA TCC ACA GGG AAT 409 TAT TTAG CTG GAA AGT GTC AAT AAG CTG TT GGT GAG AAG TCT GCG 454 AGC TTC CGG GAA GAA TAT ATT CGA CTC TGT CAG AAA TAT TAC TCC 499 TCA GAA CCC CAG GCA GTA GAC TTC CTA GAA TGT GCA GAA GAA GCT 544 AGA AAA AAG ATT AAT TCC TGG GTC AAG ACT CAA ACC AAA GGC AAA 589 ATC CCA AAC TTG TTA CCT GAA GGT TCT GTA GAT GGG GAT ACC AGG 634 ATG GTC CTG GTG AAT GCT GTC TAC TTC AAA GGA AAG TGG AAA ACT 679 CCA TTT GAG AAG AA A CTA AAT GGG CTT TAT CCT TTC CGT GTA AAC 724 TCG GCT CAG CGC ACA CCT GTA CAG ATG ATG TAC TTG CGT GAA AAG 769 CTA AAC ATT GGA TAC ATA GAA GAC CTA AAG GCT CAG ATT CTA GGA 814 CTC CCA TAT GCT GGA GAT GTT AGC ATG TTC TTG TTG CTT CCA GAT 859 GGA ATT GCC GAT GTG TCC ACT GGC TTG GAG CTG CTG GAA AGT GAA 904 ATA ACC TAT GAC AAA CTC AAC AAG TGG ACC AGC AAA GAC AAA ATG 949 GCT GAA GAT GAA GTT GAG GTA TAC ATA CCC CAG TTC AAA TTA GAA 994 GAG CAT TAT GAA CTC AGA TCC ATT CTG AGA AGC ATG GGC ATG GAG 1039 GAC GCC TTC AAC AAG GGA CGG GCC AAT TTC TCA GGG ATG TCG GAG 1084 AGG AAT GAC CTG TTT CTT TCT GAA GTG T CAC CAA GCC ATG GTG 1129 GAT GTG AAT GAG GAG GGC ACT GAA GCA GCC GCT GGC ACA GGA GGT 1174 GTT ATG ACA GGG AGA ACT GGA CAT GGA GGC CCA CAG TTT GTG GCA 1219 GAT CAT CCT TTT CTT TTT CTT AT ATG CAT AAG ACC AAC TGC 1264 ATT TTA TTT TTC GGC AGA TTT TCC TCA CCC TAA AAC TAA GCG TGC 1309 TGCTTCTGCAAAAGATTTTTTGTAGATGAGCTGTGTGCCTCAGAATTGCTATTTCAAATTG 1369 CCAAAAATTTAGAGATGTTTCTACATTTCTTCA TCTGCTACCCA 1429 CTAAATAAAAACACAGAAATAATTAGACAATTAGACAATTGTCTATTATAACATGACAACCCTATTAA 1489 TCATTTGGTCTTCTAAAATGGGATCATGCCCATTTAGATTTTCCTTACTATCAGTTTATT 1549 TTTATAACATTAACTTTTACTTTGTTATTTATTATTTTATATAATGGTGAGTTTTTAAAT 1609 TATTGCTCACTGCCTATTTAATGTAGCTAATAAAGTTATAGAAGCAGATGATCTGTTAAT 1669 TTCCTATCTAATAAATGCCTTTAATTGTTCTCATAATGAAGAATAAGTAGGTATCCCTCC 1729 ATGCCCTTCTGTAATAAATATCTGGAAAAAACATTAAACAATAGGCAAATATATGTTATG 1789 TGCATTCTAGAAATACATAACACATATATATGTCTGTATCTTATATTCAATTGCAAGTA 1849 TATAATGTCATAATTTCAAGACCAGCCTGGCCAACATAGCGAAACCCTACCTCCACTAAA 1909 AATACAGAAATGAGCCGGGAGTGGTGGCAAAGTGGTGAGCAVVTGTGATCCCAGCCCACTG 1969 TGGAGGCCGAGGCAGGACAATCACTTGAACCCAGGAGGCGGAGGCTGCAGTGAGCTGAGA 2029 TCGCTCCACTGCACTCCAGCCTGGGCAACAGAGCAAGATTCCATCTCAAAATACATTAAA 2089 AAAAAAAAACCTATCTGAGGACTCTGAAAAGTAAATGGTAGCAGATAGATTTGAGAAGGG 2149 ACTAGAACTTGAAGCACAATCTATCTGGTGCTCTTTCFTTACTTTTGCTTGTTTTCTCCCA 2209 ATCTTCCAGTCTGGATACAAAGGCAGCCCAATTTCTAGAAATGTATACCAGCCATGAAGA 2269 GATAAAGCTCCAAGAGGAGATTTCTCTTTCTGGTATAAGGTATGTGTGTG. TGTATATGGGGG 2329 GCGATAAGGTTGGGAGTGTGCAGGAATACAGACGTCGGAGGAAATCCATTATTTCCACCCTCT 2389 CTCTTGCCATTGCAACCAGAC Or a fragment of it that encodes the code of a bioactive or immunoglobulin peptide with a biological or immunoglobulin effect of minactiwin. Or a fragment containing a characteristic sequence of minactivin 2. a recombinant DNA molecule that consists of a DNA molecule according to claim 1 and a vector DNA 3. A recombinant molecule. DNA from claim 2, where vector DNA consists of plasmids selected from: pMSG, pKC, pBR322, pUC or pUR system; zPIP Neo SV (X); pLK57 or pLK58 as defined above herein 4. DNA recombinant molecule according to claim 2 or claim 3, where the sequence controls the expression against the DNA molecule in such a way that Function 5. DNA recombinant molecule according to claim 5, where the characterization control sequence is selected from the gene. Beta-galactosidase of E. coli, Oteron, trp, prototypes to the left of the bateriophage? Late repeated sequences of Moloney Leukaemia virus, mouse mammary tumors. And the early SV40 prototypes. 6. Fusible genes that consist of a movable probe. Start of code translation And genes coded for minatylin 7. host transformant transfixed with at least one recombinant DNA molecule as per any of the claims of Clause 2 to 5. 8. Transformant host according to claim 7 where Transformant host is selected from bacteria, yeast, other mold, animal host. Plant host And eukaryotic tissue cells 9. Transformant host according to claim 8 where the bacteria were selected from E. Coli, Pseudomonas group and Bacillus 1 group. Mant according to claim 8, where eukaryotic tissue cells are selected from the human cell and other mammalian cells 1 1. Recombinant peptide that It consists of amino acid sequences as shown in Figure 23, or as some of them contain the biologic and immunogenic activity of minactwin 1 2. Recombinant peptide. Clause 11 when homogenized 1 3. Recombinant peptide according to claim 11 or 12 when characterized by mammalian cells 1 4 . A polypeptide derivative from pure recombinant minactwin, wherein this polypeptide has the characteristics of minactivin 1. 5. Polypeptide based on Any claim Of Clause 11 to 14 when prepared by any claim process of Article 31 through 46 1 6. Polypeptides prepared from transfused microbes Where all or part of the polypeptide The amino acid sequence of minactwin 1 7. Synthetic oligonucleotide probe. The probe contains nucleotide molecules that are transcribed and coded for the amino acid sequence of the polypeptide in accordance with any of the claims 11 to 16 1. 8. Process for producing CDNA molecules. That acts as a coded sequence of the amino acid sequence of the minactwin. The process consists of separating RNA from eukaryotic cells that characterize the minactivin, splitting its mRNA, synthesizing DNA molecules. The mRNA molecule is the paired strand of the DNA molecule. Into the carrier of self-propagating cloning Transformation host cells with recombinant cloning vectors, select transcribed host cells. Where the DNA molecules inserting the code for minactwin Or part of the minactiwin And show the nature of the DNA molecule The implant that is inside the transfused host cell cloning carrier 9. Process for producing minactwin-coded eDNA. Or the part of the minactwin that has the characteristics of the minactwin Or the minactivin part showing the immunological or biological activity of the minactivin and characterizing that molecule in the recombinant host. A process consisting of a. Extract mRNA from appropriate cell strains, b. Form cDNA clusters from mRNA, c. Cloning cDNA clusters from (b) into appropriate host, and d. All or part of the minactivin gene is either its derivative or a combination of the above 2 0. Clause 19 process where appropriate host is E. Coli or Bacteroophage. Lambda II 1. Procedures according to claim 19 or 20 by examining the identity of the clones as follows: a) Select, hybrid and decode; b) Hybridize with DNA sequences as obtained by synthesis. chemical In particular, the tracer composed of an oligonucleotide synthetic adder according to this invention c) hybridized using a labeled cDNA synthesized from induced and non-induced mRNA. d) The cDNA group was recruited using immunosuppressive methods, with antibodies against minactivin or another immunologically similar molecule, and / or e) for the cDNA group transcribed to the biologically active substance. Using labeled eurokinase or eurokinase and antibody against eurokinase 2. 2. Procedure according to claim 21, where the TNA probe is an oligonucleus probe. Synthetic Tide According to claim 17 2. 3. Process of any claim Of claims 19 to 22, which the process includes additional separation of cDNA clones A positive result was obtained by using a specific primer to obtain the late sequences necessary for obtaining the complete minactivin gene. 2. 4. Methods for obtaining cDNA with the minactivin code. And characterize that molecule in the recombinant host where the process consists of A. induce the cell to induce the formation and transcription of minactivin B. extract mRNA from the proper cell strains C. transcription of the mRNA model. Invitro and precipitated immunosuppressive products to form a complex with eurokinase D. Separate the mRNA fraction from (B) and detect the activity-containing fraction sequence for minactivin E. . Create cDNA groups from mRNA from (B) and (D) F. Clone cDNA groups from (E) into suitable host cells such as E. Coli or Bacteroophage Lampda G. Detect clones. With a) hybridized and transplanted using (C) b) hybridized with a specifically chemically synthesized DNA sequence. C) Hybridized by labeled eDNA synthesized from induced and non-induced mRNA d) Detected cDNA group. That is decoded by immunological methods using Antibody to minactivin or immunologically similar molecule e) detecting cDNA group transcribed to bioactive substances using labeled eurokinase or eurokinase and eurokinase antibody. S H. Connect the cloned genes. It was made from the cDNA group using oligonucleotide primers obtained from the partial minagnetvin gene sequence. Specifically, the hylagon nucleotide sequence revealed in the scope of this invention I. Minaptivin gene nucleotide sequence. J. Minactiin gene decoding in E. coli. K. Deciphering biologically active recombinant minagnostic by cloning in other host cells such as multicellular animal cells and / or L. Purification and biological properties to be used for treatment 2 5. Procedures according to claim 24 where the appropriate host is E. coli or Bacteriophage Lamda 2. 6. Process according to claim 24. Or 25 where the DNA probe is a synthetic oligonucleotide probe in accordance with claim 17 2 7. Procedure according to any of the claims 24 through 26 where the host in Another alternative is eukaryotic cell 2. 8. The process of preparing the DNA recombinant molecule according to any claim from clauses 2 to 5, which consists of combining the DNA carrier with the DNA sequence in accordance with the right claim. 1 2 9. Procedures according to claim 28, in which the process is to add the insertion of the transcription control sequence into the DNA carrier 3 0. The process of host transfusion. It consists of introducing the recombinant DNA molecule into the host cell according to one of two to five claims. The peptide preparation process is derived from pure minuctivin, consisting of Homogeneous purification of minactivin and sequencing for the unique amino acid minactivin 3 1. Methods for the preparation of recombinant-derived peptides. The pure win process consists of homogenizing of the purified recombinant minacutvin and the unique amino acid sequence of the minactivin was obtained by recombination. Purified binant minactivin 3 2. Process according to claim 31, consisting of a) culturing transgenic striated cells b) retaining vitreous c) sequencing the vitreous. Cells by chromatography and electrophoresis; d) analysis of the minactivin-active fraction sequence and / or e) for the unique amino acid sequence of Minactivin 3 3. Procedure according to claim 32, consisting of a) culturing minactivin-producing strains b) storage of microorganisms containing minactivin c) sequencing. The portion of the liquid obtained by the chromatography with the hydrophobic and / or charge-exchange medium d) the prepared minactivin was sequenced by chromatography. The graphene on the gel e) the liquid with the minactivin was made isoelectrophoresis and / or f) the fraction sequence with the minactivin was fractionated. By partition chromatography 3 4. Procedures according to claim 32 or 33, where the cultured cells were cultured without serum and / or containing one or more substances in sufficient quantities. For inhibiting the creation of eurokines Or inducing continuous minactivin generation 3 5. Clause 34, where the substance is Dexamethasone 3. 6. Process of any claim from 32 to 35 by cell culture. When PMA 3 is present 7. Procedure according to one of the claims from 32 to 36, where the concentration is initiated is performed using a hollow fiber dialysis / concentration unit with a membrane-containing cartridge. 3 8. Process according to any claim from Articles 33 to 37 by hydrophobic chromatography and / or ion exchange. Use a column of phenyl-cefarose 3. 9. Process according to claim 38 by graduating the column with pH in steps. Electrophoresising gel with 1 molar glycine with 1. Millimolar EDTA pH 9.0 4 1. Procedure according to one of the claims from items 33 to 39 by tracing of electrophoresis with antibodies to find the minactivin band 4. 2. The process according to one of the claims 33 through 41, the partition chromatography procedure is HPLC 4. 3.Process according to any claim from Articles 33 to 42 by digesting pure minaccharides with endoproteinase LysC 4. 4. Procedures according to one of the claims from Articles 33 through 43, separating the peptides obtained by HPLC 4. 5. Production process of minactivin without adding glycosides consisting of Prepared a gene coding of minactivin from mRNA obtained from monocytes. The resulting genes were inserted into the prokaryotic microorganisms, selectively and cultured them to produce an uninverted minagnostic Add glycosides and store minectivins without the addition of the glycosides 4 6. Process of polypeptide production consisting of the minactivin part of the minactivin characteristic. Feed the host transformed with recombinant DNA molecules. This includes DNA molecules that act as a coded sequence of the amino acid sequence of the minactwin and store the polypeptide 4. 7. Process for producing synthetic oligonucleotide probes according to claim 17 The process consists of amino acid sequencing of peptide fragments derived from pure minactwin. And synthesize the corresponding oligonucleotides with