SU1741610A3 - Method for obtaining human @@@-dismutase - Google Patents

Abstract

The present invention relates to a genetic engineering method for the preparation of human Mn superoxide dismutase (hMn-SOD), to the DNA sequences which code for this enzyme, to suitable vectors which contain these DNA sequences, and to host cells which are able to express these DNA sequences, as well as to the enzyme hMn-SOD itself. Proposed uses of this enzyme are also described.

Description

The invention relates to biotechnology and genetic engineering, in particular, to methods for producing human MnOjr dismutase for therapeutic purposes, for example, as an anti-inflammatory agent.

The method consists in the fact that mRNA is isolated from human placental or hepatic tissue, poly (A) + RNA is obtained, a double-stranded cDNA is synthesized, a cDNA bank is constructed,

 DNA sequence encoding Mn-O-dismutase using probe |

i С С С S -TGITA ТТ ТС TCIGTIACITT-3

and T - T T

ASA

S TCIGTIAC tt TCCA TTIAT-J

G T G

or cDNA sequences of the human MnO2 dysmutase gene, the DNA sequence is extended to the start codon or stop codon, the mitochondrial leader / W is placed directly behind the start codon of the gene, the DNA sequence of S.cerevisiae or human DNA sequence. The Mp02 Dismutase is used to construct the expression vector.

SA)

317 I6104

these, consisting of promoters ADHI EV1 1161 / EBI 1164 + EBI 1167 / EBI 1160 ADHII, pairs of oligonucleotides of the formula

EBI 1161 Sph I 5 "

CCTATCACATATAAATAGAGTGCCAGTAGCGACTTTTTTCACACTCG GTACGGATAGTGTATATTTATCTCACGGTCATCGCTGAAAAAAGTGTGAGl

AAATACTCTTACTACTGCTCTCTTGTTGTTTTTATCACTTCTTGTTTCTTCT TTTATGAGAATGATGACGAGAGAACAACAAAAATAGTGAAGAACAAA

EBI 1164 5 TG

EBI 1167 5

GTAAATAGAATATCAAGCTACAAAAAGCATACAATCAACTA GAAGAACCATTTATCTTATAGTTCGATGTTTTTCGTATGTTAGTTGAT TSAASTATTAAS AGTTGATAATTGAGCT5 EBI 1160

Xho I

EBI 1161 / EBI 1164 + EBI 1159 / EBI 1168 formulas EBI 1161

five

CCTATCACATATAAATAGAGTGCCAGTAGCGACTTTTTTCACACTCG GTACGGATAGTGTATATTTATCTCACGGTCATCGCTGAAAAAAGTGTGAG C - "

AAATACTCTTACTACTGCTCTCTTGTTGTTTTTATCACTTCTTGTTTCTTCT TTTATGAGAATGATGACGAGAGAACAACAAAAAiAGTGAAGAACAAA

EBI 1164 5 TG

EBI 1159 5

GTAAATAGAATATCAAGCTACAAAAAGCATACAATCAACTA. GAAGAACCATTTTATCTTATAGTTCGATGTtTTTCGTATGTTAGTTGAT TCAACTATTAACTATATCC

AGTTGATAATTGATATAGAGCT5 EBI 1168

Xho I

EBI 1161 / EBI 1164 + EBI 1165 / EBI 1166 of the formula EBI 1161 5

CCTATCACATATAAATAGAGTGCCAGTAGCGACTTTTTTCACACTCG GTACGGATAGTGTATATTTATCTCACGGTCATCGCTGAAAAAAGTGTGAG C

AAATTCTTACTACTGCTCTCTTGTTGTTTTTATCACTTCTTGTTTCTTCT TTTATGAGAATGATGACGAGAGAACAACAAAAATAGTGAAGAACAAA

EBI 1164 5 TG

EBI 1165 5

GTAAATAGAATATCAAGCTACAAAAAGCATACAATCAACTA GAAGAACCATTATCXTATAGTTCGATGTTTTTCGTATGTTAGTTGAT TCAACTATTAACTATATCGTAATAC

AGTTGATAATTGATATAGCATTATGAGCT 5 EBI 1166 Xho I

 or CUP1, a signal for initiating a stop codon and an ADHII terminator, a mitochondrial leader, or a-derived expression vectors pWS550A, a signal sequence. Saccha- or pWS4 $ OA, or rI8491A, or Gotchusev cerevisiae or human pWS371A, or pWS372A or pWS373A,

or - AB, or pE025 - AU, or pE02T - AD, or, or pEOAl, or, or, or pЈOM, or, or pE050, or pЈ05t transform Saccharomyces cerevisiae strains or plasmid pSV2 dhfr -SOD1 or pSV2 dhfr, which transform the strains of cultured cells, cultivate the transformed cells, isolate and purify the target product by extraction, precipitation and chromatography,

When implementing the proposed method, the ADHI promoter (pES103), registration number DSM 013 (fragment Your Hl / XhoI with a length of 1500 bp (base pairs); accelerated promoter ADHI, registration number DSM 4016 (pWS 323E) (fragment Bam HI / Xho I with a length of M) 0 PLO.);

terminator AIHII (pGD2), registration number DSM 4014, (fragment

Xa I / Hind III with a length of 336 n "o.); Bam HI buffer: 150 ppm NaCl, 6 mM Tris-HCl, pH 7.9, 6 mM MgCl2, 100 μl / ml of cattle serum albumin (ASKRS); Core buffer: 50 mM Tris-HCl, pH 8.0, 10 mM MgClft, 50 mN NaCl; denaturation solution: 0.5 M NaOH, 1.5 M NaCl;

Denhardt's solution (50x}: 1 g of polyvine l pyrroli don with a mole, weight ZBOOOO, 1 g Ficoll, 1 g ASKRS, up to 100 ml;

E.coli C 600: F, sup E44, thil, thrl, leuB6, lac YT, ton A21tfTATCC 3372);

E. coli IM fOlrsup E, thiA (lac-pro AB), F, tra B36 pro AB, lac, D15;

buffer X: 100 mM NaCl, 50 mM Tris-HCl, pH 7.5, 10 mM MgClfc, 1 mM dithiotrietol (DTT);

Y buffer: 10 mM Tris-HCl, pH J, 5, 60 mM NaCl, 10 mM MgCl4 1 mM captoethanol, 100 μg / ml ASKRS - - hybridization solution corresponds to - a solution of preliminary hygiene synthesis, but without DNA from sperm salmon containing the Klenov fragment, a reaction solution of 22 μl of DNA / H20, 2.5 μl of 10-buffer NTP (0.5 M Tris-HCl g pH 7.2, 0.1 M MgS04, 1 mM DTT, 500 μm / ml ARMS } on 1 mkl 2 mM dATP, dCfP

dTTP, 2.5 units fragment maple (0.5 μl);

17,11610

0

five

0

- L buffer: 100 mM Tris, pH 7.5, 0 mM MgCJ4, 1 mM ethylenedinitrilotetraacetic acid (EDTA); agar LB: liquid medium LB, 15 g / l baktoagara;

liquid LB medium: 10 g / l bactotryptone, 5 g / l yeast extract, 5 g / l NaCl, 10 M NaOH to pH 7, ligation solution: 66 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 5 mM DTT, 1 mM ATP, 1 unit. T-DNA ligase; neutralization solution: 0.5 M Tris-HCl, pH 7.50, t, 5 M NaCl; Z buffer: 50 mM KCl, 50 mM NaCl, 50 mM Tris-HCl, pH 8.0, 10 mM MgCla; pre-hybridization solution: 5 h SSC buffer, 5 Denhardt solution, 50 mM sodium phosphate buffer, pH 6.8, 1 mM Na2P407, 100 µM ATP, 0.1% sodium dodecyl sulfate (100 (50) µg / ml, and denatured by ultrasound DNA from salmon sperm;

5 pURA3 ISM 4015 registration number; S.cerevisiae DBY47: a, leu 2, his 3, trpl Ura 3;

Wednesday SC-URA: 0.67% BYNB (Difco), 2% glucose, 2% 50 mixture of amino acids (g / l): histidine 1; leucine 6; tryptophan 2.5; lysine; adenine 1,2; arginine 2; methionine t, phenylalanine 6; threonine 5; isoleucine 6; Sma I buffer: 10 mM Tris-HCl, pH 8.0, 20 mM KCl, 10 mM MgClЈ, 10 mM 2-mercaptoetznol, 100 μg / ml ASKRS; Sph I buffer: 10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 10 mM MgClI, 10 mM 2-mercaptoethanol, 100 μg / ml ASKRS; SSC (20X): 3.0 M NaCl, 0.3 M Na3-citrate, pH 7.0;

SSPE (20X): 3.6 M NaCl, 0.2 M NatHP04. 20 mM EDTA, NaOH (Yun.) To pH 7; TE buffer: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA;

Tha l buffer: 50 mM Tris-HC1 „pH 8.0, 10 mM MgClЈ;

top agarose: liquid medium LB, 0.7% agarose;

pre-washing solution: IM NaCb50 mM Tris-HCl, pH 8.0, 1 mM EDTA, $ 0.1 SDS Example,

Construction of genebanks cDNA. X Fresh human placenta is subjected to rapid freezing in liquid nitrogen, triturated at temperatures below -80 ° C, extracted with RNA, from which poly (A) RNA is obtained.

0

five

0

five

0

five

ten

20

Synthesize DNA, clone it in EcoRI gtlO using E. coli SOO. The titer of the cDNA of gt 10 is 1, forming units. ml and the number of independent clones

EXAMPLE 2 Gene amplification of the% t 10 gene.

Strain recipient E. coli {for example, C 600, Genotype F,, sup E44. thill, thrl, leu B6, lac YI, ton A2CG are grown at overnight in L & n medium containing 0.2% maltose.

The culture was centrifuged and suspended in 10 mM mag-j5 sulphate solution or to optical density, 0 at bLnnm. The obtained Mg -cellulars at 4 ° C and the cells are mixed with a suspension of phages (50,000 plaque-forming units of DNA gene-bank per plate) and incubated for 20 minutes at 37 ° C. Then melted and brought to top agarose (containing 10 mM magnesium sulfate) are added, mixed, poured onto preheated 25 LB-agar plates (13.5 cm in diameter) containing 10 mM magnesium sulfate, and incubated for 6 - 12 hours at 37 ° C

Example Primary screening to identify recombinant α-phages.

but). Processing nitrocellulose filters.

The plates at the end of incubation are cooled to A ° C. Nitrocellulose filters are placed on the surface of the plates. After 1 min after the impregnation, the filters are carefully removed, put into the solution of the denaturer and incubated for one minute at room temperature. Neutralization is carried out in a neutralizer solution for 5 min at room temperature, then incubated for 30 seconds in a buffer at same temperature. Copies are made from the plate. Filters are dried, DNA is fixed at 80 ° C, t

b). Obtaining P-labeled DNA probes

The synthesis of oligonucleotides is carried out on the synthesizer 381 A. The oligonucleotides are purified by polyacrylamide gel electrophoresis (20 & 8 M urea), followed by desalting on Sephadex G-50, thus synthesized DNA probes are complementary to the sequence of bases RNA

;

five

thirty

55

35

40

45

50

ten

20

j5 25

 ,

610 8

; coding for amino acids 39 b (a) and 200 to 207 (6): They have the following base sequences:

five

-f

,one

g

thirty

C C C

a) 5r TG ITA TT TS TS IGT IAC ITT

T T T

ASA

b) 51 TS IGT IAC TT TC CCA TT IAT

G T G

at). In situ hybridization.

In order to remove residues of agarose and bacteria from nitrocellulose, the filters are incubated in a prewash solution at 65 ° C for several hours with stirring. Filters are incubated for 1-12 hours at 37 ° C in a preliminary hybridization solution, which is subjected to preliminary vacuum degassing.

Radioactively labeled DNA probes used for hybridization (about cpm / µg) are added to the degassed hybridization solution heated to 37 ° C. To maintain a high level of DNA concentration in the hybridization solution, a minimal amount of liquid is used. Hybridization is carried out for 12-18 hours at 37 ° C.

Nitrocellulose filters are washed three times in buffer and 0.05% SDS (t ° C), twice for 30 minutes at ° C, as well as in a freshly prepared solution containing 3 AND tetramethylammonium chloride, 50 mM Tris-HCi, pH 8, 22 mN EDTA and 0.05S SDS as follows: three times at room temperature, two times for 30 minutes at room temperature and three times for 30 minutes at 9 ° C, then dried in air. The X-ray film is exposed for 2-8 days at - 70 ° C.

Example1. Cleaning blinks.

After the autoradiograms are developed, the areas that give a positive hybridization signal on both nitrocellulose filters are isolated from the agar plate. For this, the desired site is removed from the agar and transferred to 0.3-0.6 ml of fl buffer. 55 One drop of chloroform is added, the phages are allowed to diffuse from the agar overnight at 1 ° C and each individual phage suspension is in the form of several. These dilutions are applied to the plates.

35

40

45

50

Plates having 300-1000 plaques are again used to make a copy of a nitrocellulose filter, which is hybridized using both DNA probes. This process is repeated until all plaques of one plate give a positive hybridization signal.

P.1i mep 5 o Analysis of phage clones obtained,. but). Titration of 71 phages.

Phage suspensions are diluted with fl buffer in a T: 10 ratio, mixed and applied to plates. After incubation at 37 ° C, the titer is determined in plate-forming units. For purified phage suspensions, the titer is 2.2-8.6 M010 units. ml „

b) Obtaining fl-phage DNA „

After isolation and titration of homogeneous phage clones, they are applied to density units (see Petri dishes with culture medium of the following composition: 1.5% agarose, 10 g / l tryptophan, 5 g / l yeast extract, 5 g / l NaCl, 10 mM MgS (4 and 0.2% glucose) together with 200 µl of E.coli C 600 Mg cells (optical density C at 600 nm), are incubated in

for 5 hours at

37 ° C

and then cooled to C C, the elution of the phages is carried out by peeling the plates with 8 ml of D-oufer and a few drops of chloroform with weak rocking at 4 ° C overnight. The supernatant purified by centrifugation was removed and the phages were centrifuged at 5000 rpm for 30 minutes at room temperature. After adding 500 µl of buffer and incubating with ribonuclease A (10 µg / ml) and deoxyrib nuclease (1 µg / ml) for 30 minutes at 37 ° C and the salt concentration is increased by adding 25 µl of 0.5 M EDTA, 12 µl of 1 M Tris-HCl, pH 8; 0 and 6.5 µl of 20% SDS and incubated at 70 ° C for 15 minutes. After extraction with phenol and double extraction with a mixture of chloroform and isoamyl alcohol (), the DNA is precipitated by adding 0.1 volume ZM of sodium acetate with a pH of 5.2 and 2 volumes of alcohol, centrifuged, washed with 70% alcohol, dried and, dissolved. µg TE buffer.

at). Restriction analysis.

2 μl of the DNA solution is incubated with 5 units. EcoRI in buffer X for 2 h at 37 ° C, fragments obtained

0

five

separated on a 1% agaroen gel. Fragments of a length of 500 to 1000 bp, eluted from the gel and analyzed.

d). Sequence analysis

100 ng of fragments are inserted into a suitably prepared form of dsDNA (replicative form, 50 ng) of the vector by incubating for 2 to 12 h at 10 ° C in I) μl of the ligation solution. Recombinant construction with the designations BS3, BS5, BS8, BS9, BSJ2. BSt3, BSXIII transform competent E. coli cells (strain W 101).

The single-stranded DNA of recombinant phages was isolated and Sanger sequence analysis was performed using computational programs on

Selected clone 8 (BS8) contains the coding sequence of amino acid 22 of the mature enzyme.

PRI me R 6. Design of the Expression Cassette.

For the expression of human MpO-lysmutase (cpd-d) in yeast, an ADHI promoter with an initial length of about 1500 bp is used, an ADHI promoter of about 400 bp shortened by 0. and ADHII terminator,

but). Replenishment of the gene.

Since the isolated clone 8 cDNA does not have a segment corresponding to 21 amino acids at the N-terminus, to replenish the gene, 2 oligonucleotide pairs (XhoI / Xbal fragment) are constructed and synthesized according to the choice of yeast codon:

0

five

five

0

five

0

five

5 TCGAGTATACAATGAAGCACTCTTTGCCAGACTTG 3 CATATGTTACTTCGTGAGAAACGGTCTGAAG Xho I

CCATACGAGTACGGTGCT GGTATGCTGATGCCACGAGATC Xba I

and (fragment Xba I / Ncol according to the formula (OP 2):

5 CTAGAACCACACATCAATGCTCAAATCATGCAA 3 TTGGTGTGTAGTTGCGAGTTTAGTACGTT Xba I

TTGCACCACTCTAAGCAC AACGTGGTGAGA TTCGTGGTAC

Nco i i

OP1 is inserted through Xho I / Xba I

to plasmid VI7 (obtained from pUCl8 after restriction of Hinc II and introduction

eleven

 Xho I linkers (dCCTCGAGG) and Smal restriction of the resulting plasmid pES102, followed by isolation of Nco I linkers (dCCCATGGG), and OP2 via Xba I / Nco I as follows.

4 µg of VI7 DNA is digested 10 units. Xba I and Nicole or Xho I and Xba I for 2 hours at 37 ° C and purified by gel electrophoresis (0.7% agarose). 5 μl of the synthesized OPT and OP2 threads (each time 10 pM /

/ µl) stirred, incubated in

mi6io

plamid PKHI, respectively PKN2 through Xho I / Eco RI.

In plasmid REZ 103, containing the ADHI promoter as a fragment of Bam I / Xho I length of 1500 p. O. in PES 102 (PES 102 is a derivative that, at the site of the Hinc II cut, contains the linker U Xho 1U, the Bgl II linker is introduced after restriction Sma I (1 μg of plasmid is digested 5 units of Sma I in Sma I buffer for 2 h

for 10 min at 65 ° C and slowly cooled to room temperature. The 1 / TO of the obtained volume is ligated with 50 sliced XNO I and Xba I vectors (in the case of OP1) or cut

at 37 ° C), purification and isolation. Plasmid thus obtained

Plasmid P15 # is transformed by restriction by incubation with Klenow fragment and re-ligation.

After digesting Xho I and Hind

Xba I and Nco I vectors (in the case of OP2) „20 IJI 8 buffer Kore in plasmid pES103

After double digestion of Sea I and Xba I in Kora buffer for 2 hours at 37 ° C, purification and isolation of the cut vectors by USEL2 and HSOD3 gel electrophoresis. Ligated (cloning oligonucleotide pairs OP1 and OP2) to obtain the HSODY plasmid, which is digested with restriction enzyme Nco I, incubated with a fragment maple and hydrolyzed with restriction enzyme Eco RI. At the same time, 5 μg of DNA is incubated with 18 units. Nco I for several hours in 50 μl of buffer X at 37 ° C, the cut DNA is purified by gel electrophoresis and half is incubated with Klenow fragment.

The DNA is purified by gel electrophoresis, 7.5 units are isolated and hydrolyzed. Eco RI in 20. µl of buffer X is cleansed and isolated once more. A BS8 plasmid containing the isolated cDNA clone 8 was transformed into competent E. coli cells (strain IM101) and a plasmid was obtained.

10 μg of the plasmid is digested with 25 units of Tha I in 0 μl of Thai buffer for 8 hours at 6 ° C, a fragment of 75 U. p. In length, hydrolyzed with ECO RI, followed by purification using gel electrophoresis. The Tha I / Eco RI fragment is combined with the HSOD4 plasmid to produce HSOD6. The HSOD6 plasmid contains the complete cDNA for, including Metg. The reading frame is thus maintained.

b). Expression cassette design.

Plasmid HSOD6 is digested with Xho I and Eco RI in the Core buffer, excreted the Xho I fragment and introduced into

25

thirty

35

insert the synthesized linker — Xho I, Eco RI, Xba I, Hind III. This linker has the following sequence:

TCGAGGAATTCTCTAGAA

CCTTAAGAGATCTTTCGA, P150 / 1 plasmid (after digestion of Xba I / Hind III, an ADHII terminator was inserted into the Core buffer, obtaining a 150/2 plasmid. The ADHII terminator was prepared as follows. The Xba I linker (CTCTAGAG) is inserted into the vector of VI8 and the Hindi cut is inserted at the site of the cut.The Xba I / Sph I fragment of 335 bp is introduced into pUCIS (pGD2),

The vector VI8 is obtained by introducing the Hind III linker at Sma I site into pUd8. The site of multi-cloning in VI8 contains Eco RI, Sst I, Kpn I, Hind III, Bam. HI, Xba I, Sall Pst, Sphl. After digesting Xba I

45 and Hind III, the ADHII terminator is isolated. Thus, except for the p150 / 2 plasmid introduced through Xho I Eco RI, it contains the promoter of about 1500 i.e., 7 p.o linker, the linker Eco RI long. 6 bp, linker Xba I, 7 bp long, terminator, 329 PoO length. These units are inserted through Bam Hi / Hind III into the vector

55. In the resulting plasmid pKH1, the ADHI promoter is replaced with the shortened ADHIk promoter from the Bam HI / / Xho I fragment (H12 bp long) of the pKH2 plasmid.

40

50

i6io

plamid PKHI, respectively PKN2 through Xho I / Eco RI.

In plasmid REZ 103, containing the ADHI promoter as a fragment of Bam I / Xho I length of 1500 p. O. in PES 102 (PES 102 is a derivative that, at the site of the Hinc II cut, contains the linker U Xho 1U, the Bgl II linker is introduced after restriction Sma I (1 μg of plasmid is digested 5 units of Sma I in Sma I buffer for 2 h

at 37 ° C), purification and isolation. Plasmid thus obtained

was transformed into plasmid P15 # by restriction by incubation with Klenow fragment and repeated ligation.

After digesting Xho I and Hind

five

0

five

insert the synthesized linker — Xho I, Eco RI, Xba I, Hind III. This linker has the following sequence:

TCGAGGAATTCTCTAGAA

CCTTAAGAGATCTTTCGA, P150 / 1 plasmid (after digestion of Xba I / Hind III in Kore buffer), an ADHII terminator was inserted to obtain plasmid 150/2. The ADHII terminator is prepared as follows. The pMW5 ADHII plasmid was first digested with Hind III, then Spn I, and a fragment of 605 PsOo cloned into vector VI8 and the Xba I linker (CTCTAGAG) was inserted at the site of the Hindi cut. Fragment Xba I / Sph I length 335 p. introduced into pUCIS (pGD2),

The vector VI8 is obtained by introducing the Hind III linker at Sma I site into pUd8. The site of multi-cloning in VI8 contains Eco RI, Sst I, Kpn I, Hind III, Bam. HI, Xba I, Salll, Pst, Sphl. After digesting Xba I

5 and Hind III, the ADHII terminator is isolated. Thus, with the exception of the p150 / 2 plasmid introduced through Xho I Eco RI, it contains the promoter of about 1500 pp length, the 7 pb linker, the linker Eco RI long. 6 bp, linker Xba I, 7 bp long, terminator, 329 PoO length. These units are inserted through Bam Hi / Hind III into the vector

five . In the resulting plasmid pKH1, the ADHI promoter is replaced with the shortened ADHIk promoter from the Bam HI / / Xho I fragment (length H12 bp) of the plasmid pKH2.

0

0

13

In both plasmids, the complete cDNA gene cut out from HSOD6, is inserted into the Xho I / Eco RI sites. The resulting plasmids HSOD7 / 1 and HSOD7 / 2 differ from each other only by different ADHI and ADHIk promoters. After double digestion of Bglll / Hind III and isolation expression fragments manufactured expression cassettes are inserted into respectively prepared yeast transformation vectors YHp13 (ATCC 37 115 PIDB207 (DSM J181) pEAS102 YIpb (ATCC)) through the cut sites of Bam HI and Hind III,

Example. Preparation of the yeast mutant suitable for expression.

The yeast mutant gene is contained as a Bam HI fragment in vector PL41. After restriction Bam HI fragment of length n "o. cleaned by gel electrophoresis, are isolated and subcloned by the Bam HI site into the VO vector.

The VO vector is obtained due to the fact that% 1 µg of pVC18 is hydrolyzed with Hind in restriction enzyme, the fragment is isolated from the gel, the protruding ends are supplemented with Klenow polymerase and ligated with ligase

The resulting SODY1 plasmid is converted to SODYJ by hydrolysis with Nrv1 restriction enzyme and insertion of the Hind III linker (CAAGCTTG). The URA3 gene obtained from pURA3 is inserted into the incision site. SODY3 was digested with Hind III and idephosphorylated under the following conditions. To a 0 µl reaction mixture, 0 µl hjO, 10 µl 1 mM EDTA, 5 µl Tris-HCl, pH 9.5, 1 µl 100 mM spermidine and 1 µl (1 mg / ml) calf intestine alkaline phosphatase (FTC) and incubated at 36 ° C. After 15 minutes, 1 µl of PTK is added again and incubated for 15 minutes. The dephosphorylated vector is purified by agar gel electrophoresis. 2 µg of pVRA3 plasmid was cut with Hind III and the 1.2 kb fragment, containing the yeast VRA3 gene, was isolated and inserted into the prepared vector.

The plasmids SODY7 and SOUY8 produced by this oraoma contain the UKA3 gene in the yeast Mn-D gene and are distinguished by the orientation of the UKA gene relative to the Mn-D gene.

 ,

ten

15

20

25

thirty

35

40

45

50

610I

The orientation of the URA3 gene is relative; the Mn-L gene can be established, since the URA3 gene contains an asymmetric Pst Io location.

Plasmid SODY7 and SODY8 transform the strain DBY 7 7 (genotype a, leu 2, his 3, trpl, ura3) as follows. 2 micrograms of SODY7 and SODY8 cut 50 units. Bam HI in 200 µl of Bam HI buffer (150 mM NaCl, 6 mM Tris-HCl, pH 7.9, 6 mM MgCIa, 1 mM DTT) and the entire mixture (without separating part of the pUC) is extracted with phenol and precipitated with ethanol. The DNA is dissolved in water and used to transform the yeast.

Transformants are grown in SC-VRA medium overnight at 28 ° C. The cells were separated by centrifugation, destroyed and examined for the content of Mn-D /. In order to determine

Mn-D, on the one hand, and Cu / Zn fl, on the other hand, work by known methods using gel electrophoresis by separating proteins, followed by staining with nitrosinic tetrazolium,. Sensitivity can be increased by staining with dianisidine spectrometric method using alkaline dimethyl sulfoxide as an oxygen-releasing system and cytochrome C as a reducing agent, Mp L and Cu / Zn-D can be distinguished by adding KCNt Strains SUDY / 72, SODY7 / 6, SODY7 / 8 and SODY7 / 10 show activity Mn-D.

PRI me R 8, Obtaining expression vectors.

Plasmids HSOD7 / 1 and HSOD7 / 2 cut out the Bg III Hind III fragments. Plasmids YEp13, pIDB and pEAS 102 also hydrolyze Hind III and Bam HI o 50 μg of vector DNA and 200 μg of the insert are ligated and transformed into E. coli HB 101 strain

Table 1 shows the designation of the corresponding plasmids.

55

Table 1 Vector (Insert HSOD7 / 1 IHSOD7 / 2

II

pWS 550A pWS 490A pVV 491A

pVV 371A pWS 372A pWS 373A

For example, Preparation of a yeast strain suitable for transformation (WS30-5g).

A yeast strain is obtained, which in addition to the genetic markers described for the SOUY / 2 strain, additionally contains a mutation in one of the lysosomal basic proteases and, thus, when yeast cells are destroyed, they release less proteases.

For this, the deficient -Mn-D strain of SODY7 / 2 is crossed with the protease-deficient strain (a, Ieu2, his3, trpt, ura3, pep4) “The strain WS30-5g can be transformed, it meets the relevant requirements

Such crosses can be successfully performed with other known yeast strains, for example, with 20 V-12.

Example 10. Yeast transformation and expression in yeast.

The SODY / 2 strain is transformed with plasmids pWS371A, pWS372A n pWS373A. Transformants are examined for expression. Transformants are grown in liquid SC-lleu with shaking. (100 µl of the culture is inoculated into k ml of YP5% D (% yeast extract, 2% peptone, 5% glucose) and grown overnight, the cells are separated and split according to example 7. Such amount of crude liquid is applied to the activating gel which corresponds to 1 ml of culture. The activity determination test is carried out according to example 7o I

Yeast strain WS30-5g (Ieu2,

his3, trpl, pep4, sodt) also transform with plasmids pWS550A, pWS490A, PW491A,

Measured in yeast in these conditions, the amount of Mn-D corresponds to

approximately 0.5 mg / l of culture.

Example T1 “Linker synthesis.

Six different oligonucleotides EBI656, EBI636, EBI643, EB1643 EB1646, EBI660 and EBI638 are made with the following sequence and length

EBJ, 5

656:

TCOAGTATACMTGTTCGCGAAAACAGCTGCAGCTAATTTA

EBI 536: 5

TCTTGGTTAAATTAGCTGCAGCTGTTTTCGCGAACATTGTATAC -

M p.

EBI 643: 5

AACAAGMGGGTGGTTTGTCATTGCTCTCCACCACGAGAGGAAC

W p.

EBI 646: .5

Mr. AGTGCTTGGTTCTCCTTGCTGTGGTGGAGAGCAATGACAAACCACCCT, EBI 660: CV b.

 3

AAGUACTCTTTGCCAGACTTGCCATACGAGTACGGTGCT EBI 638 :, „p.

/ JJ P.O.

CTAGAGCACCGTAGTCGTATGGCAAGTCTGGCAAAG

36 b.p.

Oligonucleotides EBI636, EBI643, EBI646 and EBI660 are phosphorylated from the 5 ends under the following conditions.

The initial reaction mixture No. 1 contains 2 µl of EBI 636 (100 pmol), 1 amkl of Juchlinker kinase buffer, 3 µm of 10 mM ATP, 1 µl of T-Polynuk

3

41

Pgo.

3

3

W p.

3

leotidkinase (10 units / μl), 3 μl of water.

The initial reaction mixture V2 is similar to the mixture Nt, but with 2 μl (100 pmol EBI 660.

The initial reaction mixture of If 3 contains 2 µl of EBI 643 oligonucleotide

DNA ligase (7 units / μl). The reaction is carried out a for 15 hours at.

The DNA was separated on a 1% agarose gel and the DNA fragment was 128 bp long. isolated from the gel by elution

PRI me R 12, Construction of expression vectors.

Plasmid HSOD6 was digested with rest (100 pmol), 1 μl of kinkase Schlinker buffer ,. 3 μl of 10 mM ATP, 1 μl of Tp-polynucleotide kinase (10 units / μl, 1 μl of water) „

10 kinase linker buffer consists of 0.7 M Tris-HCl, pH 7.6, 0.1 M, MgCl, 0.05 M DTT.

The reaction is carried out for

30 min at 37 ° C. Then, T-polynucleotide with Xho I and XBa I rithases and inserted tidkinase inactivate by heating into it a linker of a length of 128 and. (Xho I - up to 100 ° C. The mitochondrial leader is XBa I) and the EBI 656 and EBI 638 oligonucleotides, by the well-known method (pE022-Ah Gene hMp-L, which form the 5 ends of the finished DNA supplied with a mitochondrial yeast insert 128 bp in length, t5 leader DNA sequence

p T1 is subjected to double digestion

xh ° „Xho I and Eco RI and through Xho I - Eco RI

5 l

Start

inserted into pKH1 (pE023 A). TCGAGTAfACAATGTTCGCGAAAACAGCTGCAGCTAA The thus prepared ex-CATATGTTACAAGCGCTTTGTGACGTCGATT20 press cassette is inserted in a manner analogous to Example 8 via the Bgl II / Hind III TTTAACCAAGAAGGGTGGTTTTTTTTTCTTTCTTTTCTTTCTTTCTTTCTTTCTTTCTTTTTTTTTGTGTGTTAGTAGTAATAACTAAAACACACTAGTGAGCCAAAACAGCTGCAGCCTAA.

into yeast transformation vectors. YEpl3 pIDB207 and pEAS102 on Waga HI and Hind III sites,

Lysine

TCCACCACAGCAAGGAGAACCAAGCACTCTTT AGGTGGTGTCGTTCCTCTTGGTTCGTGAGAAA I

GCCAGACTTGCCATACGACTACGGTGCT 3 CGGTCTGAACGGTATGCTGATGCCACGA

Xba I

do not phosphorylate to avoid the formation of multimeric DNA inserts in the subsequent ligation reaction stage.

The linker is constructed from individual oligonucleotides according to the scheme:

5 Shch656 P EB | 6AZ JLI5I6.6. 3

3 55Ш6 ... LJIIi6.6. Ј 1§1§38 5

2 µl (100 pmol) of EBI656 is added to the reaction mixture No. 1, and 2 µl of EBI 638 to the reaction mixture No. 2

25 Lreemer13 ° Transformation of yeast and expression in yeast,

Yeast strain WS30-5g (an example is transformed with the resulting plasmids and transformants are examined for their

30 expression (example 10),

Strain WS30-5g grown in a culture of the following composition, g / l: yeast extract 6,7; glucose 10; arginine 0.16; lysine 0.25; tryptophan

35 0.06; methionine 0.08; cysteine 0.03 histidine 0.10; tyrosine 0.16; fenil-alanine 0.17; threonine 0.16; isoleucus by 0.18; valine 0.21; glutamic acid 0,0; glycine 0.21; cysteine

40 0.02; Alanin 0.15; aspartic acid 0.20; proline 0.20; serine 0.15; asparagine 0.10; glutamine 0.20 adenine 0.025; uracil 0.050, the growing process is carried out at an aera (100 pmol) and a gibration reaction is carried out until optical oligonucleotides are optically reached with each other,

Already 2 complementary oligonucleotides are present in the initial reaction mixture (EBI 643, EBI 646). 3 mixtures are heated for 2 minutes at 100 ° C and slowly cooled.

The short double-stranded DNA fragments obtained in reactions No. 1–3 are lithiated with each other as follows: 10 µl of Mixture No. 1 (EBI 636 + EBI 656) | 10 μl of mixture No. 2 (EBI 660 EBI 638)} 10 μl of mixture K 3 (EBI 643 EBI 646); 3 μl of 10 mM ATP; 1 µl

DNA ligase (7 units / μl). The reaction is carried out a for 15 hours at.

The DNA was separated on a 1% agarose gel and the DNA fragment was 128 bp long. isolated from the gel by elution

PRI me R 12, Construction of expression vectors.

Plasmid HSOD6 was digested with Xho I and XBa I restrictases and inserted into it a linker 128 long, i.e. (Xho I is the mitochondrial leader — XBa I) and inserted into pKH1 (pE023 A). The expression cassette thus prepared is inserted as in Example 8 via Bgl II / Hind III.

into yeast transformation vectors. YEpl3 pIDB207 and pEAS102 on Waga HI and Hind III sites,

Lrimer13 ° Yeast transformation and expression in yeast,

The yeast strain WS30-5g (Example 9) is transformed with the resulting plamides and the transformants are examined for their

expression (example 10),

Strain WS30-5g grown in a culture of the following composition, g / l: yeast extract 6,7; glucose 10; arginine 0.16; lysine 0.25; tryptophan

0.06; methionine 0.08; cysteine 0.03 histidine 0.10; tyrosine 0.16; fenil-alanine 0.17; threonine 0.16; isoleucine 0.18; valine 0.21; glutamic acid 0,0; glycine 0.21; cysteine

0.02; Alanin 0.15; aspartic acid 0.20; proline 0.20; serine 0.15; asparagine 0.10; glutamine 0.20; adenine 0.025; Uracil 0.050, the growing process is carried out with aera

0.01 at nm with the use of a magnetic stirrer

The main culture of the composition: 8.0 g / / l {Ш4) g. 504; 2.56 g / l (

1.16 g / l KC1; 0.60 g / L MgS04-7H20;

0.56 g / l of CaC12 "2H20; 0.04 mg / l biotin; 80 mg / l m-inositol; 40 mg / l Sapantothenate; 8 mg / l thiamine; 2 mg / l pyridoxine; 3.1 mg / l CuS04

H5Ngo; 19 mg / l FeCl3 6HZ0; 12 mg / l ZnSO4 7% 0; 14mg / l MnS04 HzO; 3 mg / l Y3bO; 1 mg / l KI; 2 mg / l Na2MgS04x 2HgO; -1 g / l yeast extract; 0.2 g / l uracil; 0.1 g / l adenine;

nineteen

ten

0.5 g / l of litonic acid; 15 g / l) glutamine acid; 0.2 g / l of histidine; 0.5 g / l tryptophan; 100 g / l glucose, get in a fermenter with a capacity of 20 liters. The inoculum used is 5% of the amount of pretreatment. The cultivation is carried out by aeration with stirring (100 rpm) and a constant pH value of 5.0 at 28 ° C.

After reducing the glucose content to 50 g / l, 50 g / l of glucose is added again and the fermentation is continued until the glucose content is 10 g / l (approximately after kS h) is cooled, centrifuged and the biomass is frozen with Biomass yield 18 g / l wet cells.

PRI me R I C Obtaining yeast mitochondria

In order to establish whether the introduction of yeast mitochondria / leader leader results in sequencing before the PMP-D gene to import protein into mitochondria, yeast mitochondria are prepared and the activity of Mn-D in mitochondria and cytoplasm is determined.

The culture is grown by shaking (300 rpm) at 28 ° C overnight, inoculated into 225 ml of YPD medium, and grown under these conditions overnight. After reaching an optical density of 5-7 at 6000 nm, the cells are centrifuged at 6500 rpm for 5 minutes. Cells are washed with water, suspended in 1 of Manmann ,.

investigate the activity of Mn-D. Red brown, centrifuged, washed with b fer (white cytoplasmic components are poured out) and then the mitochond is suspended in 2.5 ml of the same buffer. The contaminants are again removed by centrifugation at 000 rpm for 5 minutes. Mitochondria are removed from the packed liquid by repeated centrifugation (at 122000 rpm for 10 minutes). The mitochond is destroyed with the help of glass globes, ricks and, using an activating gene of 15, their studies are examined for the content of Mn-D.

PRI me R 15. Cleaning PMC-D. - Stage 1: Cell Disruption.

I

Cells (Example 13) are washed in 10 ml of distilled water per g wet weight and centrifuged at 16000 rpm for 15 minutes. Wasp is resuspended in sodium-potassium phosphate buffer (50 mM, pH 7.0) at a ratio of 1: 3 - Then the cells are destroyed in the mill with glass beads with a diameter of 0.1 mm at a flow rate of 6 l / h. The cell extract is centrifuged for 30–15 min (16000 rpm), and the precipitate is removed

Step 2: precipitation of polyethylene by min.

A 5% aqueous solution of polyethylenimine (pH 8.0) of a final concentration of 0.5 & Then continue stirring for another 30 minutes and the precipitate is removed by centrifugation.

20

25

20 mM KR; (KNgP04 / KgNROL), pH 7 ,,

1 mg / ml tsimolazy mol. MAS- 40 AT 1 ° C / min for 30 minutes. } Soi 500 and 2 hours shake (50 rpm) at 28 ° C to obtain spheroplasts. Their

centrifuged at 3000 rpm for 5 minutes, washed with a solution

Stage 3: deposition by heat treatment with

The supernatant of the second stage with heating is heated to

1 M mannitol, 20 mM CR; , pH 7 ,, 1 mM 45 6 О С in a water bath with temperature

 “. . . OP G. w

phenylmethylsulfonyl fluoride (FFMS) The supernatant is removed and glass beads with a diameter of 0.1 mm are added in an amount corresponding to 1-2 volumes of the washed cells.

The cells are disrupted, suspended in 2.5 ml of 0.65 M mannitol, 1 mM EDTA, 1 mM PFMS, centrifuged at 2000 rpm for 5 minutes. The mitochondria are separated from the supernatant by centrifugation at 12000 rpm for 12 minutes. 10 min. The supernatant contains the cytoplasm and is therefore stored so that

80 ° C, located in steel stacks. Then in an ice bath, cool to room temperature. The precipitated protein is removed by centrifuging at 50 ™ rpm for 10 min.

Stage k: ammonium sulfate precipitation

The supernatant of stage 3 is 55 with ammonium sulphate up to 20% and the precipitate is separated by centrifugation (about 0000 rpm for 15 minutes at 4 ° C). Then the concentration of ammonium sulfate is increased to $ 90 and the precipitate

ten

.

and a,

7M61020

investigate the activity of Mn-D. Red-brown, centrifuged washed with buffer (white cytoplasmic components are poured) and then mitochondria are suspended in 2.5 ml of the same buffer. The contaminants are again removed by centrifuging at 000 rpm for 5 minutes. Mitochondria are removed from the packed liquid by re-centrifugation (at 122000 rpm for 10 minutes). Mitochondria are destroyed with the help of glass hats, ribs and, using an activating gel, 15 of them are examined for the content of Mn-D.

PRI me R 15. Cleaning PMC-D. - Stage 1: Cell Disruption.

I

Cells (Example 13) are washed in 10 ml of distilled water per g wet weight and centrifuged at 16000 rpm for 15 minutes. The precipitate is resuspended in sodium-potassium phosphate buffer (50 mM, pH 7.0) at a ratio of 1: 3 - Then the cells are destroyed in the mill using glass beads with a diameter of 0.1 mm at a flow rate of 6 l / h. The cell extract is centrifuged for 30–15 minutes (16000 rpm ° C) and the precipitate is removed

Stage 2: precipitation with polyethyleneimine.

To the supernatant of the first, 5th stage, add a 5% aqueous solution of polyethyleneimine (pH 8.0) with a final concentration of 0.5 & Then continue stirring for another 30 minutes and the precipitate is removed by centrifugation.

20

25

At 1 ° r / min for 30 min.

Stage 3: Deposition by Heat Treatment

The supernatant of the second stage is heated to

6 ° C in a water bath with temperature

6 ° C in a water bath with temperature

OP G. w

80 ° C in steel glasses. Then in an ice bath, cool to room temperature. The precipitated protein is removed by centrifuging ™ rpm for 10 min at rc).

Stage k: ammonium sulfate precipitation

The supernatant of stage 3 is saturated with ammonium sulfate to 20% and the precipitate is separated by centrifugation (O 0000 rpm for 15 min at 4 ° C). Then the concentration of ammonium sulfate is increased to $ 90 and the precipitate

2117

separated by centrifugation (10,000 rpm for 15 min at gC), the precipitate is absorbed in an insignificant amount (50 mM, pH 6.0) of 2-morpholinoethanesulfonic acid morpholinoethanesulfonate buffer (MES buffer) and dialyzed overnight using the same buffer.

Stage 5: chromatography on cation exchanger.

The column containing the mono-S-HR 5/5 cation exchanger is equilibrated with 5 volumes of MES buffer. After filing the extract on

the column unbound proteins are washed with MES buffer volumes. Then PMPT, 1 is eluted with 20 volumes of MES buffer with a linear gradient from 0 to 50 mM NaCl. The fractions containing the activity of Mn-D are combined and dialysis-T using sodium-potassium phosphate buffer (5 mM, pH 7.0).

Stage 6: hydroxylapatite chromatography,

A phosphate buffer equilibrated with (5 mM, pH 7.0) hydrosilatapite column is supplied to the dialysate of the stage, and the CMP-D is eluted with 20 volumes of sodium-potassium phosphate buffer pH 7.0 with a linear gradient from 5 to 300 mM of the indicated salts. The purity of cpd-D is monitored by polyacrylamide gel electrophoresis using SDS.

As a result of the purification, 21 mg (1.16 mg / cell) are obtained. HMnO2-dismuTESYo

Example1b, Characteristics chmp-D.

Purified hMAP-D is analyzed using pressure gel chromatography under pressure, reverse phase liquid chromatography under pressure, gel electrophoresis using LTOs, native gel electrophoresis, and isoelectric focusing and compared with natural CMP-D.

but). Liquid gelchromatografil under pressure

t

Column: Waters Protein Pak I 125.2X (7, .mm), gel particle diameter 10 microns; eluent: 0.5 M, 0.02 M NaH / jLP04, pH 7.0, 0.04% Thein 20, 25% propylene glycol; feed rate 0.5 ml / min; detection: UV absorption, 21 nm „

22

Natural and obtained by the proposed method CMP-D shows the main peak of the enzyme tetramer at mol. mass 70,000 and 76,000 respectively

five

0

five

0

are made using four standard protein proteins.

b). Liquid chromatography with reverse phase under pressure.

Column: Backerbond Bfl, 4.6 t 250 mm, 5 μm particle diameter, pore diameter: 30 nm; eluent A: 0.1% trifluoroacetic acid in water; Eluent B: 0.1% trifluoroacetic acid in acetonitrile; gradient: 20% B for 2 min, 20 - 68% B for 2k min, 68% B for 10 min, 68 - 20% B for 1 min; feed rate 1.0 ml / min; detection: UV absorption, 21ft nm and 280 nm,

Natural and obtained by the proposed method chimp-DP exhibit a retention time of about 21 minutes (20.7 and 5–20.9 minutes, respectively),

at). Gel electrophoresis using SDS,

Separating gel - 15% acrylamide; stacking gel-ft% acrylamide; 0 silver color; gel size 0.75 mm (8 x U cm); mode: 60 min, 150 V,

In the preparation of samples for PMTP, the samples are mixed with DTT as a reducing agent and boiled. In the LTO gel, the CMP D monomer is found with a mole. weighing about 25,000, depending on the degree of completeness of the reduction reaction, the presence of a tetramer with a mole weighing about 90,000 can also be proved,

g) Native gel electrophoresis.

Separating gel - 7.5% polyacrylamide gel; stacking gel - 2% acrylamide + sucrose; the value of g- 5 liters 0.75 mm (cm); mode: 75 min, 150 Bj Coomassie blue staining,

After chromatography on hydroxylapatite, cAMP-D, after electrophoresis, appears as after staining with Kumasissin (applied

the amount of chMp-D is 0.3 µg), and after the activating staining with o-dianisidine, a single band in the same position

d). Isoelectric focusing,

The range of pH values is 3.5-9.5; LKB gay plates (1 mm (cm); electrode solutions: 1 M phosphoric

23

acid (anode), 1 M sodium lye (cathode); cooling temperature sample volume of 4.0 and 6.5 µg, respectively; mode: pre-focusing 500 HF; focusing 3000 Wm in general ;; coloring: Kumasi - blue, o-dianizidNo

As the isoelectric point, 15 is determined.

Example 17 Constructing a cDNA genobank from human liver tissue.

17

The reaction is carried out for 1 h at 14 ° C and stopped by the addition of 5 μl of 250 mN EDTA. Unbound radioactivity is removed on a bio-analog column of Example 1 from fresh ne -. „„ ™ “,, i,, Ma. ™. pa ™ j. t iiogecular tissue (approximately 1 kg) by Plem P6-DG. P.NA was isolated as eluent, poly (A) RNA was obtained, and TE buffer was used. Hybridization of one-, -in-nut / se.,.,., Ln-1 pp is found according to example 3.

Example 19. Inclusion of the mitochondrial human leader 20 DNA sequence of MnOj dismutase before the MpO -dismutase gene.

Joint hybridization of two synthesized oligonucleotides (EBI 917, EBI 919) produces a DNA fragment with a length of 122 bp. with Xho I / / Xba I protruding ends. This fragment corresponds to the formula OP1 given in Example 6, with the difference that between the start codon

synthesize cDNA. The preparation of the flgt10 genebank is carried out analogously to example t.

PRI me R 18o Using the MnO2 dismutase gene as a DNA probe.

The complete cDNA of the MpO -dismutase gene (Example 6) is used as a radioactively labeled DNA probe. 5 mg of plasmid HSOD6 DNA is hydrolyzed with restrictase EcoRI and Xho I. After it is separated in 1% aga25

 .-.- .. I-W f Vf- J% r, / f4

DNA frag-30 ATC and a codon for lysine AAG, including a 600 bp length containing the Mn04-dismutase gene, were isolated from the gel from the gel, it was radioactively labeled and used as a DNA probe.

Reaction mix: 5 µl translation buffer; 10 uM DNA is generated from human leader DNA sequence.

The DNA sequence containing the 35 MpO -dismutase human gene insert has the following. structure.

Xho I

Pvu ii

Start

EBI 9t7 S ICGAGTATACAATGTTGAGCCGGGCAGTGTGCGGCACCAGCAGGCAGCTGCCTCCG

 CATATGTTACAACTCGGCCCGTCACACGCCGTGGTCGTCCGTCGACGGAGGC

EBI 919 3

Lys

GTTTTGGGGTATCTGGGeTCCAGGCAGAAGCACTCTTTGCCAGACTTGCCATACGACTACGGTGCT CAAAACCCCATAGACCCGAGGTCCGTCTTCGTGAGAAACGGTCTCAACGGTATGCTGATGCCACGA

Plasmid HSOD6 is hydrolyzed with Xho I and Xba I restrictases and inserted with a length of 122 nc (linker) (Xhol-human mitochondrial leader Xba I). The plasmid pKH22-A is prepared, digested with pecfpnKTasaMH Xho I and Eco RI (5 units μg of DNA) and inserted into pKN 1. The plasmid PKH23-A is obtained.

The expression cassette thus obtained is analogous to Example 12 at the Bglll / Hind III sites (after double digestion of plasmids and

16102k

fragment; 15 μl 0 G P 1STR / 3000 Cf (mmol, aqueous solution); 1 μl 1 mM dATP {1 μl TTP; 1 μl 1 mM dCTP; 5 units of DNA polymerase 1; water up to. 50 μl

 the translation buffer contains 0.5 M Tris-HCl, pH 7.2; 0.1 m MgSO4; 1MM dithiothreitol; 500 μg / ml of serum albumin from cattle.

The reaction is carried out for 1 h at 14 ° C and stopped by the addition of 5 μl of 250 mN EDTA. Unbound radioactivity is removed on a column of bioge. „„ ™ “,, i,, Ma. ™. pa ™ j. t iiogem P6-DG. Buffer TE is used as eluent. Hybridization is carried out according to Example 3.

30 ATCs and a lysine codon for AAG include the human leader DNA sequence.

The DNA sequence containing the 35 MpO -dismutase human gene insert has the following. structure.

0

expression cassette isolates) insert the vectors YEp13, pIDB207 and pEAS102 to the Ban HI and Hind III sites. Y Table 2 shows the corresponding plasmids.

Table 2 The resulting plasmid

Vector

five

I

PIDB207 PEAS102 YEP13

RKN24-AV RKN25-AS RKN26-A

The yeast strain WS3C-5g, analogously to Example 10, is transformed with the expression plasmid pKH

The expression of the plasmid in strain 5 WS30-5g confirmed using the method of example 13.

To confirm whether the introduction of a yeast mitochondrial lederma sequence before the MpO -dismutase gene gene leads to the fact that the protein is introduced into the mitochondria, yeast mitochondria are obtained according to example I and analyze the activity of MpO -dismutase in the mitochondria, as well as 15 cytoplasm

Example 200

Construction of the expression cassette with the ADHII promoter (alcohol dehydrogenase II) “20

In the pKH1 expression cassette (Example 66), the ADHI promoter is replaced by the ADHII promoter at Xho I / / Vata HI sites. The ADHII promoter was isolated from the plasmid pMW 5 - ADH II / B / X, Plasmid 25 pMW 5-ADHII B / X contains the Bam Hi / Hind III fragment containing the ADHII promoter and having an ADHII 760 bp gene fragment, an EcoRI restriction site at the beginning of the coding region, 30 linkers are converted into Xho I-szyt restriction, and two Bam HI sites are obtained, located on both sides of the EBI 1161 SphI

The Xho I site of the Sph I "Xh containing the butt-site promoter and gene, is replaced by nucleotide cars to remove the encoding part of ADHII and insert rules for the MnOg dismutase gene. 3 different oligonucleo OL1, OL2 and OL3 analogue or 36, which are not long nucleotide sequence promoter

According to example 11 about the reaction of hybridization of com oligonucleotides:

W 1 EBI 1161 / EBI 1164 No. 2 EBI 1I67 / EBI 1160 No. 3 EBI 1159 / EBI 1168 No. 4 EBI 1165 / EBI 1166

Synthesis of EBI I64, EBI 11 EBI 1165 and ligation of types

No. 1 + No. 2 OL1

No. 1 -f If 3 OL2

№ 1 + m i | "QL3

in order to obtain three pairs of OL1, OL2 pairs following DNA sequence

Oligonucleotide pairs from EBI 1161 / EBI 1164 + E / EBI 1160

5f

CCTATCACATATAAATAGAGTGCCAGTAGCGACTTTTTTCACACTCG

GTACGGATAGTGTATATTTATCTCACGGTCATCGCTGAAAAAAGTGTGAG

J

AAATACTCTTACTACTGCTCTCTTGTTGTTTTTATCACTTCTTGTTTCTTCT TTTATGAGAATGATGACGAGAGAACAACAAAAATAGTGAAGAACAAA

EBI 1164 5

TG EBI

rt

1167

GTAAATAGAATATCAAGCTACAAAAAGCATACAATCAACTA GAAGAACCATTTATCTTATAGTTCGATGTTTTTCGTATGTTAGTTGAT

TCAACTATTAAG

AGTTGATAATTGAGCT 5 EBI 1160

Xho I Oligonucleotide pair number 2 (OL2) of

EBI 1161

 five

I

CCTATCACATATAAATAGAGTGCCAGTAGCGACTTTTTTCACACTCG

GTACGGATAGTGTATATTTATCTCACGGTCATGGCTGAAAAAAGTGTGAG G

The Xho I site of the Sph I "Xho I fragment containing the junction between the promoter and the gene is replaced with oligonucleotide lars in order to remove the coding region of the ADHII gene and insert the correct transition to the MnOg dismutase gene. Three different oligonucleotide pairs, OL1, OL2 and OL3, are constructed analogously to Example 1 or 36, which are slightly different in the length of the nucleotide sequence of the promoter part.

According to Example 11, hybridization reactions of complementary oligonucleotides are carried out:

W 1 EBI 1161 / EBI 1164 No. 2 EBI 1I67 / EBI 1160 No. 3 EBI 1159 / EBI 1168 No. 4 EBI 1165 / EBI 1166

Synthesis of EBI I64, EBI 1167, EBI 1159 EBI 1165 and ligation of igonucleotides

No. 1 + No. 2 OL1

No. 1 -f If 3 OL2

№ 1 + m i | "QL3

in order to obtain three oligonucleotide pairs OL1, OL2 and OL3 with the following DNA sequences:

Oligonucleotide pair IP 1 (OLf) of EBI 1161 / EBI 1164 + EBI 1167 / / EBI 1160

EBI 1161 / EBI 1164 + EBI П59 / ЕВ1 1168

.it

AAATACTCTTACTACTGCTCTCTTGTTGTTTTTATCACTTCTTGTTTCTTCT TTTATGAGAATGATGACGAGAGAACAACAAAAATAGCGAAGAACAAA

EBI 1164 5 TG

EBI 1159 5

GTAAATAGAATATCAAGCTACAAAAAGCATACAATCAACTA GAAGAACCATTTTATCTTATAGTTCGATGTTTTTCGTATGTTAGTTGAT TCAACTATTAACTATATCC AGTTGATAATTGATATAGAGCT 5 EBI 1168 Xho I

Oli gon gluotid pair M 3 (OL3) / EBI 1166 of EBI I61 / EB1 1164 + EBI 1165 / t5

EBI 1161

five

CCTATCACATATAAATAGAGTGCCAGTAGCGACTTTTTTCACACTCG

GTACGGATAGTGTATATTTATCTCACGGTCATCGCTGAAAAAAGTGTGAG C

AAATACTCTTACTACTGCTCTCTTGTTGTTTTTATCACTTCTTGTTTCTTCT TTTATGAGAATGATGACGAGAGAACAACAAAAATAGTGAAGAACAAA,

The EBI H64 5 TGADHII - promoter part was isolated by sequential hydrolysis of Xho I and Bam HI digestion digests and, instead of the ADHI promoter, was introduced into the pKH1 expression cassette. As a result of using three different oligonucleotide pairs, three different expression cassettes are obtained:

pKH1 - ADHII-OL1

pKHI - ADHII-OL2

pKH2 - ADHII-OL3

The MnOg -dismutase gene was isolated from the plasmid pE022-A (Example 12) as an Xho I-Eco RI fragment and ligated into all three ASHI-expresson cassettes. Expression cassettes equipped with Ypo-dismutase genome are cut with Bg1II and Hind III and, via ligation, introduced into the yeast vectors pID207 and YEp13 via the restriction sites Bam HI and Hind III.

50

The CUP1 promoter analogs 20, by replacing the ADHII-pr, are inserted into pKHI by Bam HI and Xho I digestion. The D CUP1 promoter is ligated with nucleotides, synthesizing as in Example 36 or 1

Yeast expression plasmids with the ADHII promoter are listed in

TabL 3 EBI1691 yat HI

five

GATCCCATTACCGACATTTGGGCGCTATACGTGCATATGTTCATGTATGTA TCTGTATTTAAAACACTTrTGTATTATTTTTTCCTCATATATGTGTATAGG TTTATACGGATGATTTAATTATTACTTCA EBI 1692

.it

CT

Table3

Vector + promoter

Expression Plasmid

PIDB207-ADHII-OL1pE040

PIDB207-ADHII-OL2pE041

PIDB207-ADHII-OL3рЕ042

YEP13-ADHII-OL1рЕ043

YEP13-ADHII-OL2.pE044

YEP13-ADHII-OL3 pE045

The yeast strain WS30-5g is transformed with expression plaemides listed in Table 3, and the transformation products, as in Example 13, will be examined for expression

PRI me R 21 „

Construction of the expression cassette with the thionein / copper promoter (CUP1).

The CUP1 promoter, analogously to Example 20, is inserted into the pKHI via the Bam HI and Xho I restriction sites by replacing the ADHII promoter. The CUP1 yeast promoter is ligated to 8 oligonucleotides synthesized analogously to Example 36 or 11.

29-17M6103 °

 j

five/

GGGTGGTGAAGTAATAATTAAATCATCCGTATAAACCTATACACATATA

 TGAGGAAAAATAATACAAAAGTGTTTTAAATACAGATACATACATGA

ACATATGCACGTATAGCGCCCAAATGTCGGTAATGG

EBI 1696

5 CCACCCTTTATTTCAGGCTGATATCTTAGCCTTGTTACTAGTTAGAAAAAG

ACATTTTTGCTGTCAGTCACTGTCAAGAGATTCTTTTGCTGGCATT1CTT

EBI 1704 5

CTAGAAGAAATGCCAGCAAAAGAATCTCTTGACAGTGACTGACAGCAAA

AATGTCTTTTTCTAACTAGTAACAAGGCTAAGATATCAGCCTGAAATAA

A

EBI 1711

Xba I

five

CTAGAAGCAAAAAGAGCGATGCGTCTTTTCCGCTGAACCGTTCCAGCAAA

AMOACTACCMCGCMTATGGATTGTCAGAATCATATAAAAGAGAAG

CAAATAA

EBI 1710

five

CAAGGAGTTATTTGCTTCTCTTTTATATGATTCTGACAATCCATATTGCGT

TGGTAGTCTTTTTTTGTGGAACGGTTCAGCGGAAAAGACGCATCGCTGTTT

TTGCTT

Xba I

EBI 1716

five

CTCCTTGTCTTGTATCMTTGCATTATAATATCTTCTTGTTAGTGCAATAT

CATATAGAAGTCATCGAAATAGATATTAAGAAAAACAAACTGTACAA

TCAATCAATCAATCATC

Xho I EBI 1717 5

TCGAGATGAITGATTGATTGATTGTACAGTTTGTTTTTCTTAATATCTAT TTCGATGACTTCTATATGATATTGCACTAACAAGAAGATATTATAATGC

To achieve the desired combination of oligonucleotides EBI 1691/1692 / CUP1 promoter with individual / 1696/1704/1711/1710/1716 according to the scheme:

Bam HIXba I

GATCC EBI 1631 EBI 1696 EBI 1711 EBI 1716

EBI 1692 EBI 1704 CTAG EBI 1710 EBI 1717 AGTC

I

50., Carried out: ligation of oligonucleotides

1) synthesis of oligonucleotides EBI, with oligonucleotides If 1 and 2, according to 1692, EBI 1704, EBI 1710, EBI 1716 but example 11; DNA fragment elui2) oligonuch hybridization reaction-. from 2% agarose gel and polypeptides. 55 Bam HI - Xba I sites are entered into pES102v

N 1EBI 1691 / EBI 1692 (Example 6a). Get, plasmid rOOCH,

If 2EBI 1696 / EBI 1704 oligonucleotides K 3 and k are ligated

If 3EBI 1711 / EBI 1710 with a friend, the DNA fragment is eluted.

(f 4EBI 1716 / EBI 1717 from a 2% agarose gel and administered

3117ЈЯ610

by Xba I - Xho I sites Get a plasmid Now the whole CUP 1 promoter can be ligated into pKH1 via the Bam H1 and Xho I sites, the resulting expression cassette is called pOO8

The MpO -dismutase gene was isolated from the plasmid pE022-A (Example 12) by restriction with the enzymes Xho I and Eco RI and ligated into an expression cassette. The expression cassette equipped with the MpOg dismutase gene is hydrolyzed with the Bglll restriction enzyme and analogously to Example 8, the Bam HI and Hind III sites are introduced into the yeast vectors pIDB207 and 15 uEp13.

Yeast expression plasmids with the CUP 1 promoter are shown in Table.

ten

20 d 25

T a b l and c a 4

AGCTTACAAGCAATGTCTTCAGAAAACCTAGGGTCCAAGGTTAAGCCATA

TCCCAGCTCAGTAAAGCCAGGAGCATCCTCATTTCCCAATG

OL40:

five

AAATGAGGATGCTCCTGGCTTTACTGAGCTGGATATGGCTTAACCTrGGA

CCCTAGGTTTTCTGAAGACATTGCTTGTA

OL 41:

five

GCCC7CCTGTTCCCTCTACTGGCAGCCCTAGTGATGACCAGCTATAGCCCTG

TGGATCTCTGGGCAAGCACAGCCTCCCCGACCTGCCCTACGACTACGGTGCT

OL42:

five

CTAGAGCACCGTAGTCGTAGGGCAGGTCGGGGAGGCTGTGCTTGCCCAGAGA

TCCAACAGGGCTATAGCTGGTCATCACTAGGGGTGCCAGTAGAGGGAACAG

GAGGGCCATTGGG

get a DNA fragment length of 192 l „o with protruding ends Hind III /

Hind IIICAP website

five

AGCTTACAAGCAATGTCTTCAGAAAACCTAGGGTCCAAGGTTAAGCCATA ATGTTCGTTACAGAAGTCTTTGGATCCCAGGTTCCAATTCGGTAT

leader

TCCCAGCTCAGTAAAGCCAGGAGCATCCTCATTTCCCAATGGCCCTCCTGTT CC

AGGGTCGAGTCATtTCGGTCCTCGTAGGAGTAAAGGGTTACCGGGAGGACA

32

five

The yeast strain WS30-5g was transformed analogously to example 13 with express-1 sionic plasmids listed in the table., And the transformation products were examined for expression

EXAMPLE 22: Expression of MnO, dysmutase in eukaryotic cells of animal origin

a) o Construction of expression plasmids.

The MnOg dismutase gene is supplied with synthetic oligonucleotides at the end of 5 with the corresponding control and leader sequences. The necessary control sequences are the CAP site and the start signal of the exchange. For secretion in the medium, an omega-interferon (CO-IF) sequence is used. For intracellular production, the human mitochondrial immune sequence of MnOg dismutase is used. 5 By combining four synthetic oligonucleotides 01.39 ,, OL40, OL41, OL42, obtained according to example 36 or 11:

/ Xba I.

3317M6YU34

AGG

CTCTACTGGCAGCCCTAGTGATGACCAGCTATAGCCCTGTTGGATCTCTGGG

GAGATGACCGTCGGGATCACTACTGGTCGATATCGGGACAACCTAGAGACC C

-ys-start Mp02-dismutase

Xba I

CAAGCACAGCCTCCCCGACCTGCCCTACGACTACGGTGCT GTTCGTGTCGGAGGGGCTGGACGGATGTGATGCCACGAGATC

This DNA fragment is a 5-untranslated region (0-IF with an ATS site, a starting ATC signal, a CO-IF-leader sequence (21 amino acids) and

first thirteen section

"

OL43:

with I

TTGAGCCGGGCAGTGTGCGGCCCAGCAGGGAGCTGCCTCCGGTTTGGGGTA TCTGGGCTCCAGGCAGAAGCACAGCCTCCCCGACCTGCCCTACGACTACGGTG

ST

OL44:

five

CTAGAGCACCGTAGTCGTAGGGCAGGTCGGGGAGGCTGTGCTTCTGCCTGGA

GCCCAGATACCCCAAAACCGGAGGCAGCTGCCTGCTGGTGCCGCACAGTGCCC

GGCTCAACATTGGG

get a DNA fragment length of 196 p. with protruding ends of Hind III /

SAR website

Hind HI 5

AGCTTACAAGCAATGTCTTCAGAAAACCTAGGGTCCAAGGTTAAGCCATA ATGTTCGTTACAGAAGTCTTTGGATCCCAGGTTCCAATTCGGTAT

MpOg dismount start

TCCCAGCTCAGTAAAGCCAGGAGCATCCTCATTTCCCAATGTTGAGCCGGGC A

AGGGTCGAGTCATTTCGGTCCTCGTAGGAGTAAAGGGTTACAACTCGGCCC GT

GTGTGCGGCACCAGCAGGCAGCTGCCTCCGGTTTTGGGGTATCTGGGCTCCAG CACACGCCGTGGTCGTTCGTCGACGGGGCCAAAACCCCATAGACCCGAGGT C

Lys-start protein Mn02-dismutase, Xba I

GCAGAAGCACAGCCTCCCCGACCTGCCCTACGACTACGGTGCT CCGTCTTCGTGTCGGAGGGGCTGGACGGGATGCTGATGCCACGAGATC

 This DNA fragment is .. a part of the untied $ - site of CO-IF with the ATS site and the ATC start signal, as well as the mitochondrial leader sequence of human MnOg dismutase (2k amino acids) for intracellular production of MnO2 dismutase and the coding region first thirteen amino acids of dismutase.

amino acids Mpci-dismutaei (from lysine to alanineT

By combining the synthetic oligonucleotides OL39, OL40 of the indicated formulas and the synthetic oligonucleotides OL43 and OLA4

UHB I.

s

Oligonucleotides OL39, OLA2 and OL44 are phosphorylated at the B1-end using T-polynucleotide kinase in order to ensure the implementation of the subsequent ligation reaction.

Reaction mixture: 2 µl oligonucleotide (100 pmol); 1 μl fer linker kinae; j μl 10 mM ATP; 1 μl of TA polynucleotide kinase, 10 units / μl.,

35

10 buffer linker kinase contains 0.7 M Tris-HCl, pH 7.6; 0.1 M MgCl1; 0.05 M dithiothreitol.

The reaction is carried out for 30 minutes at 37 ° C, the enzyme is inactivated by heating to 100 ° C.

Oligonucleotides OL40, OLA1 and OL43 forming the 5 ends of the finished DNA fragments do not phosphorylate to avoid the formation of multimeric DNA inserts during the subsequent ligation reaction.

Hybridization of the complementary oligonucleotides with each other is carried out as follows:

Oligonucleotides A and B are complementary oligonucleotides.

Reagents: № 1: А OL39 № 2: А N 3: А 01ЛЗ Reaction mixture:

B 01LO B B OIM 1 μl of oligonucleotide A (100 pmol); 1 μl of oligonucleotide B (100 pmol); 8 μl of water „

The reaction mixtures No. 1 - 3 are heated at 100 ° С for 2 min and are slowly cooled in a water bath to room temperature,

The results obtained for reactions of 1 to 3 short DNA strand DNA fragments are ligated to each other as follows:

LiderW-IF: 5 μl of the reaction mixture No. 1; 5 μl of the reaction mixture No. 2; 1.5 μl / ml 10 mM ATP; 0.5 µl / / ml DNA ligase (7 units / µl) o

Mitochondrial leader sequence of MpO -dismutase: 5 µl of the reaction mixture No. 1; 5 μl of If 3 reaction mixture; 1.5 μl 10 mM ATP 0.5 μl DNA ligase (7 units

The reactions proceed for 15 hours at 4 ° С,

The DNA was sized for 2% agarose gel and the desired DNA fragments for a length of 192 and 196 bp were eluted from the gel.

The finished DNA fragment, 192 bp long, with the O) -IF leader for secretion of MpO -dismutase, is ligated to HgOD6 on Hind III and Xba I sites. The plasmid HSODJ U is obtained. forming blunt ends then digest hind iii and large dncm

17 161036

fragment approximately 700 p;

0

five

about. were isolated from a 1.5% agarose gel, the DNA fragment was ligated into the eukaryotic vector pSV2 gptdhfr, which was obtained from pBR 322 dhfr by cutting Esp I and Hind III, filling it with the Klenow fragment and ligating into pSVigpt vector at Eco sites RI - Bam HI, filled with a fragment of Klenow and processed by alkaline 1 fatase

Ligation of an isolated large DNA fragment having approximately 700 bp. into the vector pSV2gptdhfr carried out after preliminary hydrolysis of the vector with Ara I, filling the restriction site with the Klenow fragment and additional hydrolysis with Hind III. Thus, the gpt gene in the vector is replaced with the MpO-dismutase gene. The ligation mixture is used to transform E. coli HB101c After restriction analysis of the plasmid DNA of positive clones, an expression plasmid is obtained, which is designated as pSV2dhfrSOD1.

Similarly, the DNA fragment with the mitochondrial leader MnO2 dismutase 196 Leo in length by Hind III – X sites is diversified in HS016. The HSOD12 Gene with regulatory sequences is obtained. The plasmid mi is cloned into the eukaryotic vector pSV2gptdhfr by Hind III – Eco RI restriction digest. Eco RI ends of the Klenow enzyme with the resulting expression plasmid is designated as pSV2dhfrSOD2c The expression of pSV2dhfrSOD1 and pSV2dhfrSOD2 is carried out in CHO cells with a dehydrofolate reductase deficiency, which are cultured in order-I-I-I-I, I-I-I-I-I-I lines, I-I-I, I-I-I, I-Ie lines, I, I, I, I, will be able to do this. ooot- i ki, hypoxanthine, thymidine) "Trans fektsiyu CHO cell expression plasmids pSV2dhfrSOD1 / D2 effected known obrazomo The day before transfection, cells fed on nutrient plates

The cells are treated with calcium phosphate precipitation product, containing up to 10 µg of plasmid DNA, at 37 ° C for k hours. Then the medium is А-sucked and replaced with 55 selection medium 06-MEM containing 10% fetal calf serum, which every two days are replaced. Colonies of transformed cells appear

0

five

0

4S

50

37

after 12-16 days. The supernatant (medium) is examined for the presence of MpO /, - dismutase

PRI me R 23. Purification of Mn02 dismutase,

a) Cell disruption. Analogously to example 15 cellular

the mass is washed with distilled water and at a concentration of 30% is suspended in 50 mM Tris-acetic acid, pH 8.5. The cells are destroyed in a mill containing glass beads with a diameter of 0.5 0.5 mm. The cell extract is centrifuged (16000 rpm, 15 min, ° C and the precipitate is removed).

b) Precipitation by heating and acid

Supernatant from stage

II-N

 and heated to 60 ° C., cooled in an ice bath to 20 ° C., the pH was adjusted to 5.5 by addition of tM acetic acid, centrifuged at 16000 rpm and dialyzed with tris-acetic acid (60 mM. pH 5 ,five).

c) Cation exchange chromatography The dialysate containing MnOg dismutase from step b is fed to a CM Sepharose column, equilibrated with 60 mM Tris-acetic acid, pH 5.5, eluted with a linear gradient (15 column volumes) from 60 mM Tris-acetic acid acids to 0.12 M sodium acetate

d) Gel Permeation Chromatography. The fractions with MpO -dismutase activity from step C are collected and fed to a column containing sephacryl S 300 HR or superose 12, equalized with 0.1 M phosphate buffer,, 8.

EBI 1161 Sph I 5 "

CCTATCACATATAAATAGAGTGCCAGTAGCGACTTTTTTCACACTCG GTACGGATAGTGTATATTTATCTCACGGTCATCGCTGAAAAAAGTGTGXG C

AAATACTCTTACTACTGCTCTCTTGTTGTTTTTATCACTTCTTGTTTCTT TTTATGAGAATGATGACGAGAGAACAACAAAAATAGTGAAGAACAAA

EBI 1164 5 TG

EBI 1167 5

GTAAATAGAATATCAAGCTACAAAAAGCATACAATCAACTA GAAGAACCATTTATCTTATAGTrCGATGTTTTTCGTATGTTAGTTGAT TSAASTATTAAS AGxrGATAATTGAGCT 5 EBI

16103 #

The elution is carried out with the same buffer.

Obtain 20 mg of 0.1 mg / r cell) NMO3 dismutase.

s

Claims (1)

Invention Formula The method of obtaining human JQ MnO -dismutase, which consists in the fact that mRNA is isolated from human placental or hepatic tissue, poly (A) is obtained, two-stranded cDNA is synthesized, 15 cDNA genebank is constructed, then the DNA sequence encoding Mn-0 is extracted -dismutase with probes: С С С 5 5 (TGITA ТТ ТС TCIGTIACITT, T T T IASA, S TCIGTIAC gg. TCCA TTIAT g or cDNA sequences of the human dysmutase gene, the DNA sequence is extended to the start codon or stop codon, the mitochondrial leader or signal sequence of the MpO -dismutase S DNA, cerevisiae or human is placed directly behind the start codon of the gene, then the DNA sequence encoding MnO dismutase is used for constructing an expression vector consisting of ADHI or ADHII promoters, oligonucleotide pairs EBI 1161 / EBI 1164 + EBI 1167 / / EBI 1160 of the formula 39 1741610 U Xho I EBI 1161 / EBI 1164 + EBI 1159 / EBI 1168 of the formula EBI 1161 5 CCTATCACATATAMTAGAGTGCCAGTAGCGACTTTTTTCACACTCG GTACGGATAGTGTATATTTATCTCACGGTCATCGCTGAAAAAAGTGTGAG; WITH. AAATACTCTTACTACTGCTCTCTTGTTGTTTTTATCACTTCTTGTTTCTTCT TTTATGAGAATGATGACGAGAGAACAACAAAAATAGTGAAGAACAAA EBI 1164 5 Tg. EBI 1159 five GTAAATAGAATATCAAGCTACAAAAAGCATACAATCAACTA GAAGAACCATTTTATCTTATAGTTCGATGTTTTTCGTATGTTAGTTGAT TCAACTATAACTATATC AGTTGATAATTGATATAGAGCT 5 EBI 1168. Xho I EBI 1161 / EBI 1164 + EBI 1165 / EBI 1166 of the formula EBI 1161 5 CCTATCACATATAAATAGAGTGCCAGTAGCGACTTTTTTCACACTCG GTACGGATAGTGTATATTTATCTCACGG TCATCGCTGAAAAAAGTGTGAG C AAATACTCTTACTACTGCTCTCTTGTTGTTTTTATCACTTCTTGTTTCTTCT TTTATGAGAATCATGACGAGAGAACAACAAAAATAGTGAAGAACAAA EBI 1164 5 TG EBI 1165 five GTAAATAGAATATCAAGCTACAAAAAGCATACAATCAACTA GAAGAACCATTATCTTATAGTTCGATGTTTTTCGTATGTTAGTTGAT TCAACTATTAACTATATCGTAATAC AGTTGATAATTGATATAGCATTATGAGCT 5 EBI 1166 Xho I I or CVP1, a signal of either pE042, or, or, or initiation, of a mitochondrial ly-, or rEF50, or pE051, with which a nuclear or signal sequence 0 is transformed by Saccharomyces strains. Scythian Creature or other codwheels; , or pWS373A, 4 $ Ki, isolate and purify the target pro, - or pE02CH - AB,. or pE025 - AC, or, by extraction, precipitation, and - AD, or rOECHO; or, chromatography.