KR100419530B1 - Method for mass-producing human ferritin using recombinant methylotropic yeasts - Google Patents

Abstract

The present invention relates to a method for mass-producing ferritin, a human iron storage protein, using yeast, and more particularly, to a functional AOX (alcohol oxidase) promoter in which human ferritin genes are induced by methanol. Linking to prepare an expression vector; Transforming the Pichia strain, which is a methanol magnetized yeast with the expression vector; Inducing the expression of ferritin by culturing the transgenic yeast primarily in a medium containing glucose and glycerol to massively multiply and then adding methanol secondly; And it relates to a method for mass production of human ferritin using methanol magnetizing yeast, comprising the step of recovering human ferritin from the culture. According to the method of the present invention, not only ferritin can be produced with high yield, but also ferritin can be produced with high safety and efficiency in terms of function and action, so that ferritin can be used as a raw material for safe and functional iron supply preparation. Can be supplied in bulk.

Description

Method for mass-producing human ferritin using recombinant methylotropic yeasts

The present invention relates to a method for mass-producing ferritin, a human iron storage protein, using yeast, and more particularly, to a functional AOX (alcohol oxidase) promoter in which human ferritin genes are induced by methanol. Ligation was performed to prepare an expression vector, and transform the Pichia genus strain, which is a methanol magnetized yeast with the expression vector, and then culture the transformed yeast primarily in a medium containing glucose and glycerol to multiply. And secondly, by adding methanol to induce the expression of ferritin, the present invention relates to a method for mass production of human ferritin using yeast.

Iron (Fe) is one of the trace elements essential for the human body, and plays an important role in the body as an essential component such as hemoglobin, myoglobin, cytochrome, iron-sulfur protein, lactoferrin and various enzymes. do. Normal adult males contain about 4-5g of iron, about two-thirds of which are in the form of hemoglobin bound in circulating red blood cells, and about 11% of iron enzymes play an important role in cellular metabolism. In the form of iron enzymes, about 15-25% are in storage form, such as ferritin or hemosiderin.

Ferritin is an intracellular iron storage protein, a spherical protein surrounded by iron ions. All ferritins consist of 24 protein subunits, while ferritin isolated from vertebrates consists of two units, H and L, while ferritin isolated from plants and bacteria consists only of H units. In general, one ferritin is known to store up to 4,500 iron molecules. The H unit is connected to a core that catalyzes the oxidation of two Fe (II) ions. The H unit plays an important role in the oxidation of Fe (II) and the L unit plays a role in forming the center.

Ferritin stores iron in the embryonic red blood cells and uses it to produce hemoglobin.In addition, ferritin stores iron and supplies it to the necessary metabolic processes. It is the main iron storage protein. Ferritin is also reported to be an important protein that protects cells from excess iron toxicity and prevents the reaction with oxygen to protect cellular proteins and lipids (Levis et al., Biochemistry 28: 5179-5184, 1989). The cell protective effect of ferritin is due to the ability of ferritin to oxidize highly toxic Fe (II) to form hydroxy radicals into less toxic Fe (III) and store it in the cavity. In most higher animals, ferritin functions more importantly as an iron storage protein, but in prokaryotic cells and the like, the importance of ferritin is more emphasized.

For this reason, ferritin is used as an index for measuring iron deficiency in the body, and is used as an iron supply agent for treating various diseases such as anemia due to iron deficiency. Since iron is not a component synthesized in the body, the metabolism of iron is entirely through ingestion through food, and once absorbed into the body, iron is excreted continuously, although in small amounts in the form of urine or bile. Destroyed, not newly produced, so must be consumed through food or iron preparations. In particular, infants, pregnant women, adolescents, and children are seriously deficient in iron deficiency and anemia caused by them, and in these cases, deficiency may not be resolved by naturally ingesting iron in food. It is required to take ˜50 mg of iron daily in the form of a formulation having high bioavailability.

In general, there are two main methods for supplying iron. The first method is to extract ferritin from the bovine or horse's spleen and administer it to the patient.The bovine horse's spleen extract is treated with ammonium sulfate, and then the precipitate is spray-dried to obtain ferritin (L 'Informatore Farmaceutico, Italian directory of drugs and manufacturers 52th edit, Italy, A-13, 1992). However, the method has been raised hygiene problems due to the risk of diseases that can be caused in animals, such as mad cow disease, which was largely judged to be unsuitable and gave great distrust to consumers. In addition, some differences in the fermentin amino acid sequence and human ferritin amino acid sequence has been raised problems in efficiency and function.

Another method for supplying iron is a nonferritin preparation, which uses organic iron, such as iron succinate or iron polymaltose complex. However, this method also has a disadvantage in that the solubility of iron is very low compared to ferritin, resulting in poor absorption of the body and causing gastrointestinal disorders by causing vomiting, diarrhea, heartburn, and discomfort in the upper abdomen (Jojnson et al., Exp. Hematol. 18: 1064-1069, 1990; Klaassen et al. , Toxicology 3th edit, USA, 613, 1986).

Therefore, there has been a need for a new method of supplying ferritin, such as ferritin preparation, which has high body absorption efficiency and is safe from risk factors such as diseases that can be caused in livestock. In particular, the domestic iron hematopoietic product market reaches about 70 billion won per year, but considering that more than 90% of domestic iron preparations are inadequate, most of the food additives and iron products as pharmaceuticals depend on imports. The development of iron formulations with high functionality and safety will be of great value in terms of ripple effects on the market.

Accordingly, the present inventors have tried to develop a method for preparing ferritin, which has high safety and higher functionality than conventional ferritin preparations, and thus, a ferritin gene induced by methanol by introducing human ferritin gene into yeast, preferably methanol magnetized yeast. In addition to achieving a high expression rate, the human gene is used to improve safety, and the eukaryotic expression system, yeast, is used to produce an expression system capable of mass-producing functional ferritin with correct posttranslational modification. The present invention was completed by developing.

It is an object of the present invention to provide a method for producing ferritin with high safety and functionality by solving the problems of ferritin production as a conventional iron supply formulation.

Specifically, an object of the present invention is to provide a method for mass production of ferritin, which is safer, higher in expression rate, and more functionally efficient than ferritin isolated from livestock, and an expression system for producing ferritin.

It is also an object of the present invention to provide optimized expression conditions for maximizing ferritin production in recombinant yeast expression systems for producing human ferritin.

In addition, an object of the present invention is to provide an iron supply formulation for food addition or pharmaceuticals, using as an active ingredient human ferritin produced by the above method.

1 is a cleavage map showing the vector composition of pPICH-FE and pPICL-FE in which human ferritin H-type and L-type genes were introduced into a pPICZaA expression vector,

2 is a result of performing a PCR reaction to select a transformant cloned with the human ferritin gene in E. coli transformed with the recombinant vector,

Lane 1: size marker (λ- Hind III)

Lanes 17,33: positive control (ferritin)

Lanes 2-16: H-ferritin transformants

Lane 18-32: L-ferritin transformant

Figure 3 is the result of performing a PCR reaction to select a transformant is cloned properly in the human ferritin gene in the yeast ( Pichia pastoris ) transformed with the recombinant vector,

1, 14: size marker (λ- Hind III)

Lane 11: positive control (ferritin)

Lanes 12 and 13: negative control

Lane 2-6: H-ferritin transformant

Lane 7-10: L-ferritin transformant

4 is a result of confirming the expression of ferritin protein in the yeast transformed with the recombinant vector by an electrophoresis (SDS-PAGE) pattern,

Lane 1: Size Cover (Protein High)

Lane 2-5: H-ferritin expression sample

Lane 6-9: L-ferritin expression sample

5 is a result confirming the expression of the ferritin protein in yeast transformed with the recombinant vector by Western blot.

Lanes 1-4: H-ferritin expression samples

Lanes 5-8: L-ferritin expression samples

In order to achieve the above object, the present invention provides a method for mass production of ferritin, a human iron storage protein, using recombinant methanol magnetized yeast. In addition, the present invention provides a recombinant eukaryotic expression vector wherein the expression of human H or L ferritin gene is regulated by an AOX (alcohol oxidase) promoter induced by methanol; Methanol magnetized yeast strain transformed with the vector; The recombinant methanolized magnetized yeast is primarily cultured in a medium containing glucose and glycerol, followed by mass propagation, and secondly, methanol is added to induce the expression of the ferritin gene, thereby providing a method of producing human ferritin in large quantities.

In addition, the present invention provides an iron supply formulation comprising the recombinant yeast or human ferritin produced by the method as an active ingredient.

Hereinafter, the present invention will be described in detail.

The production method of human ferritin using the methanol magnetized yeast of the present invention,

1) preparing a recombinant plasmid for yeast expression functionally linked with the AOX promoter such that the human ferritin gene is regulated by the AOX gene promoter;

2) transforming methanol magnetized yeast with the recombinant plasmid;

3) inducing human ferritin gene expression by adding methanol to the culture medium of the recombinant methanolized yeast; And

4) recovering human ferritin from the culture.

In the above, the human ferritin gene may be a H or L human ferritin gene. In the present invention, "H-type ferritin gene" or "L-type ferritin gene" means a gene encoding H unit or L unit constituting ferritin, respectively.

In the embodiment of the present invention, as a preferred example of the recombinant plasmid for the expression of human ferritin gene, pPICH-FE or pPICL-FE in which human type H or L type ferritin gene was introduced into pPICZaA was prepared.

In the present invention, the pPICZaA vector, which is used as a preferred example for constructing a recombinant plasmid for expressing a human ferritin gene in methanol magnetized yeast, is an AOX (alcohol oxidase) promoter, α-factor secretion signal (α-factor secretion signal), C-terminal Poly histidine site (6 × His), transcription termination site of AOX and zeocin resistance gene as selection marker gene. The AOX promoter suppresses gene expression in the presence of a non-carbon source, and expression is induced only by the addition of methanol, thereby precisely regulating the expression of the downstream linked genes, and targeting foreign genes of interest in Pichia yeast. Has the advantage of expressing at high levels. In addition, the α-factor secretion signal sequence allows the secretion of most proteins from the strain, the 6 × His site facilitates the isolation of recombinant proteins, and the transcription termination site of AOX is the same as polyadenylation of mRNA. mRNA processing enhances stability.

In the method for producing human ferritin of the present invention, prior to inducing the expression of the human ferritin gene by adding methanol to the medium, glucose and glycerol are sequentially included as the carbon source of the medium to suppress the expression of the human ferritin gene. And derepression.

In the method for producing human ferritin of the present invention, the methanol magnetizing yeast is preferably Pichia strain, more preferably Pichia pastoris . As described above, the Pichia strain is more easily cultured than the production of human ferritin through animal cells, and since the eukaryotic cell expression system is used, the posttranslational modification process is correctly performed, which is efficient in terms of function and function. Ferritin can be produced, and compared with ferritin isolated from animals, there is an advantage of less infection of the disease. In addition, the integration of the desired foreign gene into the AOX gene region present in the yeast occurs efficiently, and the expression of the foreign gene can be precisely controlled by methanol.

In particular, in terms of fermentation engineering, it is easy to scale up the culture scale to 10.000 times or more, and has an advantage that the expression rate of foreign genes is much higher than that of Saccharaomyces cerevisiae .

Due to the above characteristics, Pichia strains have been successfully applied to produce various foreign proteins until now, especially 8 g / l (tumre necrosis factor) (Sreekrishna et al., Biochemistry 28 : 4117-4125, 1989), 12 g / L (teareus toxin fragment C) (Clare et al., Bio / Technology 9: 455-460, 1991), human serum albumin In the case of the high expression rate of 4g / L (Ikegaya et al., Anal. Chem. 69: 1986-1991, 1997), but has not been reported to produce human ferritin protein using this yet.

In the method of producing human ferritin of the present invention, the step 3 is preferably induced by the expression of the human ferritin gene through the AOX promoter by culturing for about 5 days after adding methanol at a concentration of about 0.5%.

Human ferritin produced by the above method forms a homopolymer of at least a monomer or a dimer of an H-type ferritin unit or an L-type ferritin unit according to the recombinant plasmid used.

Meanwhile, in the production of human ferritin by the method of the present invention, two recombinant plasmids each comprising an H-type human ferritin gene and an L-type human ferritin gene, respectively, are transformed into Pichia yeast strains and individually homopolymerized. In addition, by using the recombinant plasmid developed in the present invention, an expression cassette was prepared, and then a human ferritin was produced by culturing the transformed yeast by constructing a plasmid containing both an H-type ferritin gene and an L-type ferritin gene. It has the advantage that can be produced in the form of a heteropolymer (heteropolymer).

For example, the recombinant plasmids pPICH-FE and pPICL-FE of the present invention were made by restriction enzyme treatment to make a cassette including the AOX promoter, ferritin gene and expression termination gene, and recombined to insert H and L genes simultaneously. Make a new plasmid. It is possible to produce human ferritin in the form of a heteropolymer of H-type and L-type ferritin subunits by culturing the transgenic yeast by transforming it into Pichia pastoris.

The present invention also provides a human ferritin produced by the above method and an iron supply preparation containing the ferritin as an active ingredient. The human ferritin may be used as a pure separation from the yeast culture, but more preferably may be added in the form of cultured yeast itself or dry powder thereof, in which case it can be used immediately without going through a special purification process There is an advantage. The iron supply preparation may be used for the purpose of functional food additives for iron supply or for the treatment of anemia for the treatment of iron deficiency symptoms, and may be formulated according to the preparation of general pharmaceutical preparations for oral or parenteral administration. .

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and liquid preparations for oral use include suspensions, solvents, emulsions, and syrups. Water is a simple diluent commonly used. In addition to liquid paraffin, various excipients may be included such as wetting agents, sweetening agents, fragrances, preservatives and the like. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.

In the iron supply formulation containing the human ferritin of the present invention as an active ingredient, the iron content of the human ferritin as the active ingredient or the methanol magnetized yeast producing the human ferritin is 2000 ppm or more, and in view of this, the general iron supply amount is 10 to 50 mg. Appropriate amounts may be formulated and administered according to known methods to meet / day. At this time, the specific dosage is determined based on the known amount of iron formulation, it can be specifically modified and adjusted according to the condition of the patient.

In a preferred embodiment of the present invention, PCR was first performed to amplify and clone the human ferritin gene and to produce an expression vector. As a PCR template, four types of oligonucleotides having restriction enzyme cleavage sites for insertion into a recombinant vector are synthesized based on human ferritin cDNA and PCR primers based on known human H-ferritin and L-ferritin gene sequences. Was used. Recombinant plasmids expressing the gene amplified by the PCR were selected with an AOX promoter, which is much more potent than the conventional GAL promoter and can induce expression using methanol as a carbon source to overexpress the ferritin gene inserted into the expression vector. As a marker gene, a Pichia expression vector (pPICZaA; Invitrogen, USA) having an antibiotic zeocin resistance gene was used. Recombinant plasmids expressing the human ferritin gene were prepared by inserting each of the PCR-amplified H-ferritin gene and L-ferritin gene into the Eco RI / Xba I position of the pPICZaA vector, respectively, and the pPICH-FE and pPICL-FE, respectively. Named. Thereafter, each of the recombinant plasmids was transformed with E. coli DH5α. The present inventors deposited the E. coli transformant containing the human H-type ferritin gene in Korea microbial culture center on August 22, 2000 (Accession No .: KCCM-10209), and E. coli containing the human L-type ferritin gene. The deposit was made on August 29, 2000 with the Depositary (KCCM-10213).

On the other hand, the recombinant plasmid that has been mass-proliferated in E. coliPmeI was cut into I, made linear, and then introduced into the AOX locus of genomic DNA of the genus Pichia, a methanol magnetizing yeast, by electroporation. In an embodiment of the invention transformed Pichia pastoris As a preferred example of yeast, Pichia pastoris KM71 (aox1Δ :: SARG4 his4 arg4, MutsHis-, Invitrogen) was used. Subsequently, in order to select the transformed yeast, an individual whose colonies were formed in YPD (Yeast Peptone Dextrose) medium containing zeosin was selected as the zeocin antibiotic resistance gene as the selection marker gene.

In order to confirm that the selected colonies were formed by transforming properly, each genomic DNA was extracted and PCR was performed. Only the ferritin genes were amplified by PCR and inoculated in minimal media.

Expression induction control of the transformed yeast was largely divided into two steps. First, glucose and glycerol were added sequentially as a carbon source in a minimal medium to induce a suppression mechanism and a derepression mechanism. Ferritin is not expressed in the suppression and deinhibition stages and is propagated using a carbon source by a gene possessed by the yeast ( Pichia pastoris ) itself. Subsequently, by adding methanol in the minimal medium in two steps, the AOX promoter induced by methanol inserted into the yeast genomic DNA was activated, and the transcription of the human ferritin gene linked downstream of the AOX promoter occurred to produce human ferritin. Finally, it was confirmed that ferritin was expressed by SDS-PAGE and Western blot in culture.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Example 1 Cloning of Human Ferritin Gene and Preparation of Expression Vector

1-1) Amplification of the Human Ferritin Gene

Polymerase chain reaction (PCR) was performed to amplify the human ferritin gene. As a template, human ferritin cDNA was used, and as primers for PCR, Eco- R1 cleavage sites were obtained based on human H-ferritin (GenBank Accession No. M97164) and L-ferritin (GenBank Accession No. M11147) gene sequences. Forward primers (SEQ ID NOs: 1 and 3) and reverse primers (SEQ ID NOs: 2 and 4) having Xba I cleavage sites were synthesized and used. Primer base sequences used in the PCR are shown in the table below.

Gene to be amplified Primer order SEQ ID NO: Human H-ferritin Forward direction GCGCGAATTCATGACGACCGCGTCCACC One Reverse GCGCTCTAGATTAGCTTTCATTATCACT 2 Human L-ferritin Forward direction GCGCGAATTCATGAGCTCCCAGATTCGT 3 Reverse GCGCTCTAGATTAGTCGTGCTTGAGAGT 4

PCR conditions using a thermocycler (PTC-100, MJ Research, USA), PCR buffer containing 1 unit of Taq DNA polymerase (10mM dNTP, 1.5mM MgCl ₂ , 20mM Tris-Cl, 50mM KCl) After modifying the template and the primer for 5 minutes at 94 ° C, 30 cycles were performed at 94 ° C for 1 minute, 50 ° C for 1 minute, and 73 ° C for 1 minute, and finally reacted at 73 ° C for 5 minutes. About 560 bp of product was amplified by the above PCR (H-type: 572 bp, L-type: 548 bp).

1-2) Construction of human ferritin gene expression vector

The PCR product of about 560 bp amplified above was cut into Eco Ri and linearized, and then recovered by precipitation with 100% ethanol. The DNA was again cleaved with Xba I and electrophoresed on agarose gel to separate target DNA fragments of 564 bp (type H) and 540 bp (type L) containing human ferritin genes. The DNA fragment was placed on the Eco R I / Xba I position of the yeast expression vector pPICZaA (Invitrogen, USA) containing an AOX (alcohol oxidase) promoter and a zeocin resistance gene as a selectable marker gene using a T4 ligase. Inserted in

Through the above process, the expression plasmids in which the human ferritin H gene or L gene is functionally linked downstream of the AOX promoter, respectively, and the zeocin resistance gene as the selection marker gene were named pPICH-FE and pPICL-FE. The manufacturing process and structure of these are shown in FIG.

Meanwhile, E. coli DH5α was transformed with pPICH-FE and pPICL-FE, respectively, to prepare an E. coli transformant, which was prepared on August 22, 2000 and August 29, 2000, respectively. Center of Microorganisms) (accession numbers: KCCM-10209 and KCCM-10213).

Example 2 Mass Propagation of pPICH-FE and pPICL-FE in Escherichia Coli

In order to multiply the human ferritin expression plasmids pPICH-FE and pPICL-FE prepared in Example 1 in E. coli in a large amount, E. coli DH5α was transformed with each plasmid. First, each of the pPICH-FE and pPICL-FE was introduced into E. coli DH5α made in a competent state using electroporation under the conditions of 2.5 kV, 200 Ω and 4.5 to 4.8 msec. The solution was recovered by incubation at 37 ° C. for about 1 hour while gently shaking with addition of SOC medium. After recovering the transformed E. coli, plated on low-salt media zeocin plate containing 25 μg / ml zeocin, incubated at 37 ° C., and colonies were formed. The transformants were selected. Among them, PCR was performed on about 30 colonies to select transformants in which human ferritin H and L genes were cloned properly. PCR conditions were the same as in Example 1, oligonucleotides shown in Table 1 were used as each primer. Agarose gel electrophoresis of the PCR product confirmed that about 560 bp H-type ferritin was amplified in five colonies, and 540 bp L-type ferritin was amplified in six colonies to confirm that these genes were inserted (see FIG. 2 ). ).

The colonies selected above were cultured in LB medium containing zeocin, denatured protein by phenol-chloroform organic solvent (phenol: chloroform = 1: 1), extracted plasmid DNA, and then each plasmid was extracted with Eco RI and It was finally confirmed that the ferritin gene was correctly inserted by treating with Xba I to confirm the electrophoretic pattern. The transformants with the ferritin H or L gene inserted correctly were treated with chloroamphenicol to massively propagate the plasmids, and then purified.

Example 3 Transformation and Selection of Yeast Strains

The expression plasmids pPICH-FE and pPICL-FE prepared above for mass production of functional human ferritin were transformed into Pichia pastoris , a methanol magnetized yeast strain. First, the bulk purified pPICH-FE and pPICL-FE in Example 2 was treated with restriction enzyme Pme I to make a linear DNA state and concentrated. As a yeast strain to be transformed, Pichia pastoris KM71 (Invitrogen, USA) was inoculated in YPD (yeast, peptone, dextrose) medium and incubated until OD ₆₀₀ reached 1.3 to 1.5. The cultured strain was centrifuged at 1500 ° C. for 5 minutes at 4 ° C. and the pellets were repeatedly dissolved in cold sterile distilled water. Thereafter, 1M of sorbitol was treated, and the centrifugation process was repeated to obtain competent cells having a final volume of 1.5 ml. 80 μl of the competent cells were mixed with 10 μl of pPICH-FE or pPICL-FE DNA which was linearly treated with Pme I, placed in a 0.2 cm electroporation cuvette, and allowed to stand on ice for 5 minutes, followed by 1.5 kV, Transformation was performed by puncturing at 200 Ω. Immediately, 1 ml of 1M sorbitol was added to transfer to sterile tubes and cells were recovered by standing incubation at 30 ° C. for 1-2 hours. 50-200 μl of the culture solution was plated in YPDS (yeast extract peptone dextrose sorbitol) solid medium containing 100 μg / ml of zeocine and incubated for 2 to 3 days until colonies were formed at 30 ° C.

Genomic DNA was extracted in order to select that the human ferritin gene was inserted into the genome of the yeast among the colonies formed, and then PCR was performed under the same conditions as in Example 2. PCR products were confirmed by 1% agarose gel electrophoresis, and as a result, it was confirmed that 4 out of 9 colonies were subjected to amplification of the H-type ferritin gene and 3 of the L-type ferritin gene (see FIG. 3 ). ).

Example 4 Induction and Confirmation of Expression of Human Ferritin

4-1) Induction of Human Ferritin Expression through Culture of Recombinant Yeast

To express human ferritin in yeast Pichia pastries transformed with a recombinant plasmid, a colony of the recombinant yeast selected in Example 3 was taken, followed by 20 ml of BMGY medium using glycerol as a carbon source (Yeast extract, Peptone, Yeast). Nitrogen base, Biotin, Glycerol) was inoculated in small amounts and shaken for 30 days at 30 ℃. As described above, glucose and glycerol were sequentially used as carbon sources to suppress and depress expression of foreign genes. The culture broth was centrifuged to separate yeast and inoculated in 200 ml of BMMY medium containing inorganic iron (Yeast extract, Peptone, Yeast nitrogen base, Biotin, Methanol, 5 mM FeSO ₄ ), and at 30 ° C., aerobic conditions. 5 days of incubation under induced expression of the human ferritin gene regulated by the AOX promoter.

After culturing for 5 days, the culture solution was collected and centrifuged at 4000 × g for 10 minutes to recover yeast. In order to confirm the expression of human ferritin, the collected yeast was crushed using glass beads and Brekin buffer (PMrea, EDTA, Glycerol, sodium phosphate buffer) and water-soluble protein was extracted. This was confirmed by 13% SDS-PAGE, and the H-ferritin and L-ferritin bands were confirmed at about 20 kDa positions (see FIG. 4 ).

4-2) Western Blot Analysis

On the other hand, in order to more clearly confirm the expression of H-ferritin and L-ferritin, Western blot analysis was performed on a part of the protein extracted in the above 4-1). First, protein extracts were electrophoresed with 13% SDS-PAGE and then transferred to nitrocellulose membranes. Transfer of the protein was carried out using a mini blot transition cell kit (BioRad, USA) in a low temperature chamber at 4 ° C. (20% methanol, 0.05% SDS, 25 mM Tris-HCl, 192 mM glycine). Was performed at 100V for 1 hour. Thereafter, the mixture was reacted with phosphate buffered saline (PBS) containing 1% skim milk at room temperature for 1 hour, and washed three times with PBST solution (1% Triton X-100 in PBS). The ferritin antibody as primary antibody was diluted 1000-fold with PBS solution to react with the protein bound to the membrane. After completion of the reaction, the membrane was washed with PBST solution at room temperature, and then reacted by diluting the IgG antibody bound with alkaline phosphatase as a secondary antibody. After washing off any excess antibody that did not participate in the reaction, BCIP / NBT (5-bromo-4-chloro-3-indolyl phosphate / nitro blue tetrazolium; Promega, USA) was added as a chromogenic substrate to detect the signal ( Fig. 5 ). As a result, it was confirmed that human H-type ferritin and L-type ferritin were expressed by molecular weight difference, respectively.

4-3) Determination of iron content

Inductively Coupled Plasma (ICP) Emission Spectrometer was used to measure the iron content of expressed ferritin protein. 0.5 g of cells confirmed to express ferritin by SDS-PAGE were collected using a centrifuge, washed three times with 100 mM Tris-HCl (pH 7.5) solution to remove unbound iron, and then at 50 ° C. Dry for 48 hours. The dried cells were decomposed with nitric acid solution for 12 hours, the precipitates were removed, and iron content was measured using ICP. As a result, the human ferritin produced in the present invention was found to contain more than 2000 ppm iron.

By using the recombinant yeast expression system of the present invention, it is possible to produce ferritin with high safety and high functionality which solves the problem of ferritin production as an existing iron supply agent. Specifically, it is safe to be used as an active ingredient for food supplement or pharmaceutical iron supply preparation by producing large quantities of ferritin through recombinant yeast, which is safer and higher in expression rate than ferritin isolated from livestock, and functionally efficient compared to nonferritin preparations. It is possible to mass produce efficient and efficient human ferritin.

Claims (13)

1) preparing a recombinant plasmid for yeast expression functionally linked with the AOX promoter such that the human ferritin gene is regulated by an AOX (alcohol oxidase) gene promoter; 2) transforming methanol magnetized yeast with the recombinant plasmid; 3) inducing human ferritin gene expression by adding methanol to the culture medium of the recombinant methanolized yeast; And 4) recovering human ferritin from the culture, Process for producing iron-containing human ferritin using methanol magnetized yeast. The method of claim 1, wherein the human ferritin gene is an H-type or L-type human ferritin gene. The method of claim 1, wherein the recombinant plasmid is pPICH-FE or pPICL-FE, using methanol magnetized yeast to produce iron-containing human ferritin. The method of claim 1, wherein only methanol and glycerol are sequentially included as a carbon source of the medium before methanol is added to the medium to induce the expression of the human ferritin gene, thereby suppressing and suppressing the expression of the foreign ferritin gene. A method for producing iron-containing human ferritin using methanol magnetizing yeast, further comprising the step of derepression. The method of claim 1, wherein the methanol magnetizing yeast is Pichia pastoris , wherein the methanol-containing yeast is used to produce iron-containing human ferritin. [Claim 2] The human-containing iron using methanol magnetizing yeast according to claim 1, wherein step 3 induces expression of human ferritin gene through AOX by adding methanol at a concentration of 0.5% and incubating for 5 days. How to produce ferritin. The method of claim 1, wherein the ferritin is obtained in the form of a homopolymer or heteropolymer comprising a monomer, a dimer, or three or more molecules of the H- or L-type unit. A method of producing human ferritin containing iron using methanol magnetizing yeast. The H-type and L-type ferritin monomers according to claim 1, by using a plasmid simultaneously containing a gene encoding H-type human ferritin monomer and L-type human ferritin monomer as a recombinant plasmid comprising the human ferritin gene of step 2. A method for producing iron-containing human ferritin using methanol magnetizing yeast, characterized in that the ferritin is produced in the form of a heteropolymer. delete delete delete The human H-type ferritin gene is functionally linked to be regulated by an AOX (alcohol oxidase) promoter, has a zeocin resistance gene as a selection marker gene, and is introduced into a methanol magnetized yeast strain to be capable of mass expression of human ferritin gene. Plasmid pPICH-FE (Accession No .: KCCM-10209). The human L-type ferritin gene is functionally linked to be regulated by an AOX (alcohol oxidase) promoter, has a zeocin resistance gene as a selection marker gene, and is introduced into a methanol magnetized yeast strain to be capable of expressing a large amount of human ferritin gene. Plasmid pPICL-FE (Accession No .: KCCM-10213).