SU1318600A1 - Method for solid-phase synthesis of oligonucleotides - Google Patents

Abstract

The invention relates to sugars, in particular to the solid phase synthesis of oligonucleotides (ONA). An increase in the yield of POCs, acceleration and simplification of the process is achieved by conducting it under other conditions. Solid-phase synthesis of ONK includes modification of a segmented carrier (CH) based on cellulose tissues. CH is preactivated by alkaline treatment with concentrated aqueous ammonia or its mixture with pyridine (Ijl by volume). The modification is carried out by attaching the first nucleoside with the help of a protected nucleoside — 3-0-succinate. Subsequent buildup of the oligoiucleotide chain with protected nucleotide blocks is carried out in the presence of a condensing agent. Tests show that disks from cellulose fabrics are washed with solvents from reagents 1.5–2 times faster than paper disks. In addition, pre-activation of conc. NH cellulose tissue leads to a significant increase in the load of the first nucleoside (1.8 times for linen and 5 times for cotton). The method provides an increase in the yield of the PMC by 2.5 times. 1 hp f-ly, 1 tab. (L 00 and

Description

113

The invention relates to bioorganic chemistry and biotechnology and can be used for the solid-phase synthesis of oligonucleotides, both in manual and in automated form.

The purpose of the invention is to increase the yield of oligonucleotides, accelerate and simplify the technology, which is achieved by using cellulose-based carriers in solid-phase synthesis.

Example 1. Cellulose tissue samples are prepared: from a cotton cloth — disks with a diameter of 1 cm and a length of tape of 1 × 1 cm, whose edges are fixed with polyethylene, from linen cloth (containing about 30% polyester) — disks with a diameter of 1 cm, whose edges are fixed with polyethylene, and a thread length of about 3 cm. A portion of cotton and linen discs are treated with concentrated ammonia (a preparation of 25-28% concentration is used) for 3 hours, washed with water (4x1 5 ml) with acetone (3x15 ml) and dried in air overnight. To the prepared cellulose tissue samples (with a total weight of about 100 mg), 108 mg (0.15 mmol) of 5-0-dimethoxytritylthymidine-3 -0-succinate, 0.1 ml (1.35 mmol) of 1-methylimidazo- yes, the mixture was evaporated with abs, pyridine (3x10 ml) and 1 ml of abs added. pyridine and 136 mg (0.45 mmol) of 2,4,6-triisopropane ((B1-benzenesulfonyl chloride). After 1 h, the disks are washed with pyridine (4 X 10 ml), 0.2 ml of 1-methylimidazole is added, the mixture is evaporated with abs. pyridine (3x10 ml), 0.4 ml of freshly distilled acetic anhydride and 2 ml of abs < RTI ID = 0.0 > pyridine < / RTI > were added. After 20 min, discs were rinsed with pyridine (4-10 ml), chloroform (3x10 ml) with pentane (3x10 ml) and dried on air.

The load of the first nucleoside is determined spectrophotometrically by the amount of dimethoxytrityl carbinol (499 71700 in a mixture of perchloric acid and ethanol 3: 2).

The number of the first nucleoside (load) on a carrier based on cellulose fabrics is presented in the table,

PRI mme R 2. Two disks (one is paper from Whatman paper - ZMM, the other is from cotton fabric) containing 5-0 as the first nucleoside.

02

dimethoxytrityl-K, 6-benzoyl-adenosine, is placed in a column-type reactor of an apparatus for the automatic synthesis of oligonucleotides, and automated synthesis of oligodeoxyribonucleotide d (TCATTTTTCTATACAAATTA) is carried out. Removal of the dimethoxytrityl protecting group and all washes of the carriers are carried out automatically, a solution

nucleotide component and condensing reagent in abs. pyridine is fed to the reactor with a syringe.

After the last stage of condensation, the disk and the removal of the dimethoxytrityl protecting group of the disks (each separately) are treated with 1.5 ml of a 0.5 M solution of p-nitrobenzoyl aldioximate lithium (pyridine-water 8: 2) for 20 hours, the solvent

evaporated on a rotary evaporator and discs are processed in 10 ml of concentrated ammonia for 20 hours at 45 C. The solution is filtered, the disks are interrupted with water (2 x 5 ml, the combined filtrates are evaporated to half the volume. Organic impurities are extracted with chloroform (2 x 5 ml), the aqueous fraction is evaporated to dryness The reaction mixture was desalted on a R-2 biogel column, the Target oligonucleotide was synthesized by anion-exchange HPLC in a potassium-phosphate buffer gradient. The yield of oligodeoxyribonucleotide d (TSATTTTSTATASAAATTA)

based on the first nucleoside, it is 0.6% for a carrier based on Whatman-ZMM paper (lime process) and 1.6% for a carrier based on cotton fabric.

As can be seen from the table, the pre-activation of cellulose tissue with concentrated ammonia leads to a significant increase in the load of the first nucleoside (1.8 times for

flax and 5 times for cotton), a 2-fold decrease in the ammonia concentration (for example, using a mixture of pyridine - concentrated ammonia 1: 1) gives similar results

After the activation and introduction of the first nucleoside, cellulose-based carriers, unlike paper ones, do not swell and retain high strength (mechanical

stability),

Example Paper wheels Watman-ZMM or cellulose tissue containing covalently attached

5 -0-dimethoxytritylthymidine is placed in the reactor of the plant and the dimethoxytrityl protecting group is removed using 3% trichloroacidic acid in chloroform (visual control until the dimethoxytritylcation color disappears) and then washed with chloroform until neutral, the red line is given by a red line with a red line that is given by a red line with 89 g of light to give an element, a red line, 95 g of light is left, a red line, 95 g of acid, 3) every 1-1.5 minutes of washing). The time required to complete these operations is determined; the total detritity time is 5-7 minutes for paper discs and 3-4.5 minutes for fabric discs, and the time for complete removal of acid by chloroform is 6-8 minutes for paper discs and 4-6 minutes for fabric discs

Thus, by comparing the proposed method of solid-phase synthesis of olgonucleotides with a known method, it is confirmed (Example 1) that the possibility of achieving a high load of the first nucleoside on cellulosic tissues (compared with the load on paper disks in the known method) by means of preliminary alkaline activation and subsequent attachment of the first nucleoside. In addition, in multistep oligonucleotide synthesis (Example 2) with exactly the same reaction conditions in all synthetic procedures, the yield of the final

Cotton fabric

disk

tape cut

Flax on cloth disc

tape cut

VNIIPI

Order 2479/22 Circulation 347

Subscription

Random polygons pr-tie, Uzhgorod, st. Project, 4

5 products (20-measure) on a carrier of cellulose fabric more than 2.5 times the yield obtained on a paper disk. In this case, disks made from cellulose fabrics (Example 3) are washed with solvents from reagents 1.5–2 times faster than paper disks.

Claims (2)

1. A method of solid-phase oligonucleotide synthesis, including modifying a cellulose-based segmental carrier by attaching a first nucleoside with a protected nucleoside-3 -0-succinate and subsequent extension of the oligonucleotide chain with protected nucleotide blocks in the presence of a condensing reagent, in order oligonucleotides, speeding up and simplifying the process, a carrier based on cellulose fabrics, previously activated alkaline o processing. 2. Method POP.1, tlichi ayu-0 shch and the fact that alkaline treatment is carried out with concentrated ammonia or a mixture of pyridine-concentrated aqueous ammonia (1: 1 by volume). 0 five 208 148 Subscription