SK280623B6 - Recombinant dna plasmid vector, mammalian cell transformed with this vector, recombinant human erythropoietin, and method of its production - Google Patents

Abstract

The invention refers to a recombinant DNA plasmid vector containing cDNA encoding human EPO of clone lambda HEPOFL13 (ATCC 40153) and mammalian cell transformed with this vector. Recombinant human erythropoietin characterised by the presence of O-linked glycosilation, obtainable by the steps of (a) culturing in a suitable medium CHO cells containing a DNA sequence encoding human erythropoietin said DNA sequence operatively linked to an expression control sequence and (b) recovering and separating the EPO from the cells and the medium. The recombinant human erythropoietin can be characterised by a glycosilation pattern comprising fucose, which glyocosilation pattern comprises relative molar levels of hexoses to N acetylglucosamine (Nacglc) of 1.4 : 1, specifically galactose : Nacglc = 0.9 : 1 and mannose : Nacglc = 0.5 : 1.

Description

Technical field

The invention relates to a recombinant DNA plasmid vector comprising a cDNA encoding human erythropoietin, a mammalian cell transformed with the transfer of the vector, a recombinant human erythropoietin prepared in these cells by an in vitro process, and a method for producing the same.

BACKGROUND OF THE INVENTION

Erythropoietin (hereafter referred to as EPO) is a circulating glycoprotein that stimulates erythrocyte production in higher organisms, see Camot et al., Compt. Rend., 143: 384 (1906). As such, EPO is sometimes referred to as an erythropoesis stimulating factor.

The lifetime of human erythrocytes is about 120 days. About 1/120 of total erythrocytes are degraded daily in the reticulo-endothelial system. At the same time, a relatively constant number of erythrocytes is produced daily to maintain a certain level of erythrocytes (Guyton, Textbook of Medical Physiology, pp. 56-60, W. B. Saunders Co., Philadelphia 1976).

Erythrocytes are produced by mirroring and differentiating erythroblasts in bone marrow and EPO is a factor that acts on less differentiated cells and induces their differentiation to erythrocytes (Guyton).

EPO is a promising therapeutic agent for the clinical treatment of anemia or, in particular, renal anemia. In practical therapy, the use of EPO is not yet common because of its low availability.

For the use of EPO as a therapeutic agent, consideration should be given to possible antigenicity problems and it is therefore preferable to prepare EPO from a raw material of human origin. For example, human blood or urine of patients suffering from aplastic anemia or similar diseases that cause the secretion of large amounts of EPO may be used. However, these raw materials are available in limited quantities, see, for example, White et al., Rec.Progr.Horm.Res., 16; 219 (1960), Espada et al., Biochem. Med., 3; 475 (1970), Fisher Pharmacol. Rev., 459 (1972) and Gordon, Welcome. Horm. (N.Y.) 31; 105 (1973), which are incorporated herein by reference.

The preparation of EPO products has usually been done by concentrating and purifying the urine of patients having a high level of EPO, for example, patients suffering from aplastic anemia and the like, see, for example, U.S. Pat. 4397840, 4303650 and 3865801. The limited supply of such urine is an obstacle to the practical use of EPO and it is therefore highly desirable to prepare EPO products from the urine of healthy persons. The problem of urine use in healthy people is its low EPO content compared to anemic patients. The urine of healthy individuals contains certain inhibitory factors that counteract erythropoiesis at a sufficiently high concentration so that a sufficient therapeutic effect can only be achieved with EPO obtained from such urine using the following significant purification procedure.

EPO can also be regenerated from sheep blood plasma, and separation of EPO from this blood plasma yielded sufficiently potent and stable water-soluble preparations. See Goldwasser, Control Cellular Dif.Develop., Vol. A, p. 487-494, Alan R.Liss, Inc., N.Y. (1981). However, sheep EPO can be expected to be antigenic to humans.

Thus, conventional isolation and purification methods using natural EPO sources are not adequate for mass production of this desired therapeutic agent.

Sugimoto et al. U.S. Pat. No. 4377513 disclose one method of mass production of EPO, comprising multiplying in vivo human lymphoblastoid cells, including Namalwa, BALL-1, NALL-1, TALL-1, and JBL.

Reports of EPO production by other genetic engineering methods have appeared in the standard literature. However, no reproducible method of manufacture or chemical characterization of the product has been published. In contrast, the present invention provides a reproducible method for mass production of proteins having the biological properties of human EPO. In this way, it is also possible to produce proteins which may be chemically different from authentic human EPO while having similar (and in some cases improved) properties. For simplicity, all proteins having the biological properties of human EPO are referred to herein as EPO regardless of whether or not they are chemically identical to them.

SUMMARY OF THE INVENTION

The present invention provides a recombinant DNA plasmid vector comprising a cDNA encoding a human EPO clone of lambda HEPOFL13 (ATCC 40153) and further a mammalian cell transformed with this transfer vector. Said mammalian cell is preferably a 3T3, C127 or CHO cell.

Preferably, the mammalian cell of the invention comprises a plasmid that contains all bovine papilloma virus DNA and the cDNA sequence of Table 3 encoding human EPO. The cell may be a C127 or a 3T3 cell. The EPO DNA in this cell is preferably under the transcriptional control of the mouse metallothionene promoter. In a preferred embodiment, such a cell comprises a plasmid containing DNA from pdBPV-MMTneo (342-12) (ATCC 37224).

The present invention further provides recombinant human erythropoietin, characterized by the presence of O-linked glycosylation, obtainable by the steps of

(a) culturing CHO cells comprising a DNA sequence encoding human erythropoietin in a suitable medium, wherein said DNA sequence is operably linked to an expression control sequence; and

b) recovering and separating EPO from the cells and the medium.

The recombinant human erythropoietin of the invention preferably comprises glycosyl residues including fucose residues. A preferred erythropoietin of the invention is characterized by a glycosylation profile including a relative molar ratio of hexoses to N-acetylglucosamine (Nacglc)

1.4: 1, specifically galactose. Nacglc = 0.9: 1 and mannose: Nacglc = 0.5: 1. Such erythropoietin also preferably contains N-acetylgalactosamine.

Finally, the present invention also provides a process for the production of recombinant human erythropoietin (hEPO), comprising the steps of:

(a) culturing CHO cells containing a DNA sequence encoding hEPO operably linked to an expression control sequence in a suitable medium; and

(b) recovering and separating the produced recombinant hEPO from the cells and the medium, which comprises using CHO cells having the ability to provide N- and O-linked glycosylation with the introduction of fucose and N-acetylgalactosamine, and recovering from the cells and the medium; separates recombinant hEPO with N- and O-linked glycosylation.

Thus, the present invention relates to the cloning of a gene that expresses surprisingly high levels of human EPO, its expression, and mass production of active human EPO in vitro. Suitable expression vectors for EPO production, expression cells, purification schemes, and related processes are also described.

As described in more detail below, EPO was obtained in partially purified form and was further purified to homogeneity and digested with trypsin to form specific fragments. These fragments were purified and sequenced. EPO oligonucleotides were designed and synthesized based on these sequences, these oligonucleotides were used to screen the human genomic library from which the EPO gene was isolated.

The EPO gene was verified based on its DNA sequence that corresponded to many of the sequenced tryptic protein fragments. A portion of the genomic clone was then used to demonstrate hybridization that EPO mRNA could be detected in human fetal mRNA (20 weeks old). A human fetal liver cDNA library was prepared and screened. Three EPO cDNA clones were obtained (after screening> 750,000 recombinants). Two of these clones were determined to be full-length according to the complete coding sequence and essentially the 5-end and 3-end of the untranslated sequence. These cDNAs were expressed in SV-40 virus transformed monkey cells (COS-1 cell line: Gluzman, Cell 23: 175182 (1981)) and Chinese Hamster Ovary cells (CHO cell line; Urlaub G. and Chasin LA Proc.Natl.Acad) Sci., USA 77: 4216-4280 (1980)). EPO, produced from COS cells, is biologically active EPO in vitro and in vivo. EPO produced from CHO cells is also biologically active in vitro and in vivo. The EPO cDNA clone has an interesting open reading frame of 14-15 amino acids (aminoacids -aa) with an initiator and terminator of 20 to 30 nucleotides (nt) upstream of the coding region. A representative sample of E. coli, transfected with the cloned EPO gene, was deposited with the American Type Culture Collection, Rockville, Maryland and is available under accession number ATCC 40153.

BRIEF DESCRIPTION OF THE DRAWINGS

Table 1 is the 87 exon base pair sequence of the human EPO gene;

FIG. 1 illustrates the detection of EPO mRNA in human fetal liver mRNA;

Table 2 illustrates the amino acid sequence of EPO primed, derived from the nucleotide sequence of lambdaHEPOFL13;

Table 3 illustrates the nucleotide sequence of EPO cDNA in lambda-HEPOFL13 (shown schematically in Figure 2) and the amino acid sequence derived therefrom;

FIG. 3 illustrates the relative positions of the DNA inserts of the four independent human EPO genomic clones;

FIG. 4 is a map of the apparent intron and exon structure of the human EPO gene;

Table 4 illustrates the DNA sequence of the EPO gene illustrated in FIG. 4B;

FIG. 5A, 5B and 5C illustrate the construction of vector 91023 (B);

FIG. 6 illustrates SDS polyacrylamide gel analysis of EPO produced in COS-1 cells compared to native EPO,

Table 6 illustrates the nucleotide and amino acid sequence of the EPO clone, lambda-HEPOFL8;

Table 7 illustrates the nucleotide and amino acid sequence of the EPO clone, lambda-HEPOFL13;

FIG. 7 is a schematic illustration of plasmid pRK1-4; and FIG. 8 is a schematic illustration of the plasmid pdBPV-MMTneo (342-12).

The present invention relates to the cloning of EPO genes and the production of EPO in vitro by expression of these genes.

Numerous methods suitable for the production of recombinant proteins are disclosed in the patent and scientific literature. Generally, these techniques include isolating or synthesizing the desired gene sequence and expressing such a sequence in either a prokaryotic or eukaryotic cell using techniques commonly known to those skilled in the art. Once the gene has been isolated, purified anderted into the transfer vector (i.e. cloned), the availability of a substantial amount is ensured. The vector with the gene cloned therein is transferred to a suitable microorganism or cell line, for example bacteria, yeast, mammalian cells such as COS-1 cells (monkey kidney), CHO (Chinese hamster ovary), insect cell lines, and the like, where the vector replicates in the proliferation of a microorganism or cell line and from which the vector can be isolated by conventional means. Thus, a renewable gene source for further manipulations, modifications, and transfers to other vectors or other sites in the same vector is provided.

Expression can often be achieved by transferring the cloned gene in the correct orientation and reading frame to a suitable site in the transfer vector such that a translational reading procedure from a prokaryotic or eukaryotic gene results in the synthesis of a protein precursor containing an amino acid sequence encoded by the cloned gene linked to Met or amino-terminal a sequence from a prokaryotic or eukaryotic gene. In both cases, the transcription and translation initiation signals can be delivered by a suitable genomic fragment of the cloned gene. Many specific protein cleavage techniques can be used to cleave the protein precursor, when produced, at a desired point so as to release the desired amino acid sequence, which can then be purified by conventional means. In some cases, a protein containing the desired amino acid sequence is produced without the need for specific cleavage techniques and can also be released from the cells into extracellular growth medium.

Isolation of human EPO genomic clone

Human EPO was purified to homogeneity from the urine of patients suffering from aplastic anemia as described. Complete digestion of this purified EPO with protease trypsin gave fragments which were separated by reverse phase high-pressure liquid chromatography, obtained from gradient fractions and subjected to micro-sequence analysis. Tryptic fragment sequences are underlined in Tables 2 and 3 and are discussed in more detail below. Two amino acid sequences, Val-Asn-Phe-Tyr-Ala-Trp-Lys and Val-Tyr-Ser-Asn-Phe-Leu-Arg, were chosen to design oligonucleotide probes (resulting in an oligonucleotide pool of 17 nt long and 32 times degenerate and oligonucleotide pool 18 nt long and 128 times degenerate from the earlier tryptic fragment, as well as to two pools of 14 nt long, each 48 times degenerate, from the later tryptic fragment). A 32-fold degenerate 17-mer pool was used to screen a human genomic DNA library in a Ch4A vector (22) using a Woo-a and O'Malley modification in an in situ amplification procedure (47) to prepare filters for screening.

The Arabic numerals in parentheses (1) to (81) are used to indicate publications that are listed by the numbers at the end of this description.

Phages hybridizing to the 17mer were selected, pooled into small groups and probed with the 14mer and 18mer pools. Phages hybridizing to 17mer, 18mer and

SK 280623-6

The 14mer pool was purified and the fragments were subcloned into the M13 vectors for the dideoxy chain sequence terminating by the method of

Table 1

ĽtttcctacimttrIggccarcggccigagccttcugKgaťccttgactccccgifgctgtgIgcatttcaff and

ACG GGC TGT GCT GAA CAC TGC AGC TTG ΛΤΛΤGAG ΛΛΤ ATC

Thly Gly Cys Ala Clu His Cys Ser Leu Asn Glu Asn White

ACT CTC CCA OAC ACC AAA CTT ΛΛΤ TTC TAT GCC TGC AAG

Thr Val Pro Asp Thr Lys Vtil Asn Phe Tyr Ala Trp Lys

AGG AŤG GAGjrtgagttcclttttttttltttttcctttctUtggognatctcatttgcgagcctg

Arg MET Glu 3 atttlggatgaaagggagaalgate

TABLE 2 GLIT VAL HIS GLU CYS PHO ALA TUP LEV Irtf LEU LCU LEU $ £ P. LEV LEU SER LEU GLU l £ B FOR VAL LEU GLY »l. Pro fru Arr L »· II» ^{w Aw>,!> T} - ^{Art w l} ° ^{u clu Arg TyT 0111 A} '*

G! W_.AI «_- Ghj *« IJ »_ TK> Thr Cly» U nu III. Cp ««. »Leu A« * Clu itn 11 «Thr

1 # «

»Pre · Th r r r r A A A r r r r r r r r r r r Met Met Met Met Met Met Met

Table 3 cteggigce í «« g «g <«

CCCttt »C» t CCgCCCECtC CtCCÍggCCC gitgggcCgg _xa 'ec »g ₍ en» £ ccee »t cUgctgagg M« «» gte ígccgcgiíg ccgigcctcc cttCatCACSC cccccgtcjt -2 J

HtT CLT TAL 11 CLU CTS MO

ATC CCC CTC CAC CAA TCT CCT ▲

ALA TU LEU TV LEU LEU LEU LE1 LEU LEV MO LEV -CLT LEU MO VAL LCU CLE

CCC TGC CTC TCC CTT CTC CTC TCC CTG CIC TCC CTC CCT CTG

Ltu Phe Ar »Tyr Ser * Phe. l.e »_Ar» Cly ty e l.eu Ly «Lem Tyr Thr Cly Cl» AU

CTC TTC CSA CTC TAC TCC AAT TTC CTC CCG OCA AAC CTC AAC CTC Tie ACA CCC CAC CCC

Si US

Cví Ar Thr Cl Arg

TCC ACC ACA CCG CAC ACA TCA Ct'E tEtecaeetc jteatacce · e _and cccagcg ccascct (ce ccacftacac ccuauBtg gpcacagee tlCPtCcta

CCCICtGCCí teaeamee • CgectSt »geaíEgacic aaett £ ig [g e« CC «C'Gt etcaccHcc ccugagcag ereaetq-ge CCDCCegftt» agaggíacrg gsagcactci »ccecgeaaa cceagagagc β» tεgTcec |

Sanger and Coulson (23) (1977). The sequence of the region hybridizing to the 32-fold degenerate 17mer in one of the clones is shown in Table 1. The DNA sequence contains, in the open reading frame, nucleolides that could accurately encode the tryptic fragment used to derive the 17mer oligonucleotide pool. Further, DNA sequence analysis indicates that the 17mer hybridizing region was contained within the 87bp exon bound at the potential splice acceptor and donor sites.

Positive confirmation that these two clones (referred to herein as lambda-HEPO1 and lambda-HEP02) are EPO genomic clones were obtained by sequencing additional exons containing another tryptic fragment encoding the information.

Isolation of EPO cDNA clones

A Northem analysis (56) of human fetal (20 weeks old) liver mRNA was performed using a 95nt single-stranded probe prepared from an M13 clone containing a portion of the ex 87bp 87bp described in Table 1. As illustrated in FIG. 1, a strong signal could be detected in fetal nuclear mRNA. Accurate identification of this band as EPO mRNA was performed using the same probe to screen the bacteriophage lambda lambda cDNA library of fetal liver mRNA (25). Several hybridizing clones were obtained at a frequency of approximately 1 positive per 250,000 recombinants. The complete nucleotide and derived from these clones (lambdaHEPOFL13 and lambda-HEPOFL8) are shown in Tables 5 and 6. EPO encoding information is contained in 594nt in the 5-end half of the cDNA, including a very hydrophobic 27 amino acid leader and 166 amino acid mature protein.

The identification of the N-terminus of the mature protein was based on the N-terminal sequence of the protein secreted into the urine of individuals with aplastic anemia, see Table 1, and as published by Goldwasser (26), Sue and Sytkowski (27) and Yangawa (21). Whether this N-terminus (Ala-Pro-Pro-Arg-) represents the true N-terminus bound to EPO in circulation or whether there is any cleavage in the kidneys or urine is currently unknown.

The amino acid sequences that are underlined in Tables 2 and 3 indicate those tryptic fragments or portions from which the protein sequence was obtained. The deduced sequence exactly matches the tryptic fragments that have been sequenced, confirming that the isolated gene encodes human EPO.

Structure and sequence of the human EPO gene

The relative positions of the DNA inserts of the four independent human EPO genomic clones are shown in FIG. 3. Hybridization analysis of these clones with oligonucleotide probes and different probes, prepared from two classes of EPO cDNA clones, places the EPO gene in the approximately 3.3 kb region shown in FIG. 3 with a dark line. Complete sequence analysis of this region (see Example 4) and comparison with cDNA clones leads to a map of the intron and exon structure of the EPO gene shown in FIG. 4. The EPO gene is divided into 5 exons. Part of exon I, all exons II, III and IV and part of exon V contain a protein encoding the information. The remaining exons I and V encode the 5-end and 3-end of the untranslated sequence.

Transient expression of EPO in COS cells

To demonstrate that biologically active EPO could be expressed in an in vitro cell system, a COS cell expression study was performed (58). The vector used for the transient studies, p91023 (B), is described in Example 5. This vector contains the adenovirus major late promoter, the SV40 polyadenylation sequence, the SV40 origin of replication, the SV40 enhancer, and the adenoviral VA gene. The cDNA insert in lambda-HEPOFL13 (see Table 6) was inserted into the p91023 (B) vector downstream of the major late promoter. This new vector is designated PPTFL13.

Twenty-four hours after transfection of this construct into an M6 strain of COS-1 cells (Horowitz et al., J. Mol. Appl. Genet. 2: 147-149 (1983)), cells were washed, transferred to serum-free serum, and cells were harvested. 48 hours later. The level of release of EPO into the culture supernatant was then evaluated using quantitative radioimmunoassay for EPO (55). As shown in Table 8 (Example 6), immunological reactive EPO was expressed. The biological activity of EPO produced from COS-1 cells was also evaluated. In a separate experiment, the vector containing the EPO cDNA from lambda-HEPOFL13 was transfected into COS-1 cells and the medium was harvested as described. The EPO in the medium was then quantified in either two in vitro bioassays, ³ H-thymidine and CFU-E (12, 29) and then two in vivo assays, a hypoxic mouse and a starved mouse (30, 31) (see Table 9, example). 7). These results demonstrate that biologically active EPO is produced in COS-1 cells. In Western blotting using a polyclonal anti-EPO antibody, EPO produced by COS cells has mobility on SDS-polyacrylamide gels that is identical to that of native EPO prepared from human urine (Example 8). The extent of glycosylation of EPO produced by COS-1 may be similar to that of native EPO.

Various vectors containing other promoters can also be used in COS cells or other mammalian or eukaryotic cells. Examples of such other promoters useful in the practice of the invention include the SV40 early and late promoters, the mouse metallothionein gene promoter, the promoter found in long terminal repeats of avian or mammalian retroviruses, the baculovirus polyhedron gene promoter, and others. Examples of other cell types useful in the practice of this invention include E. coli, yeast, mammalian cells such as CHO (Chinese Hamster Ovary), C127 (monkey epithelium), 3T3 (mouse fibroblast), CV-1 (African monkey kidney) (African monkey kidney) and insect cells such as cells from Spodoptera fugiperda and Drosophila melangaster. These alternative promoters and / or cell types may allow regulation of the timing or level of EPO expression, the production of cell specific types of EPO, or the growth of large amounts of EPO producing cells under less expensive, more easily controllable conditions.

An expression system that retains the benefits of mammalian expression but requires less time to produce a higher level of cell line expression consists of an insect cell line and a DNA virus that reproduces in that cell line. The virus is a nuclear polyhedrosis virus. It has a double-stranded circulating DNA genome of 128 kb.

The nucleocapsid is rod-shaped and is enveloped in two forms, the non-occluded form of the membrane-growing virus, and the occluded form, encased in the protein crystal in the nucleus of the infected cell. These viruses can be routinely propagated in in vitro insect cell culture and are adaptable to all routine viral methods in animals. Cell culture medium is typically nutrient saline and 10% fetal calf serum.

In vitro, virus growth is initiated when non-occluded virus (NOV) enters the cell and passes into the nucleus where it replicates. Replication is nuclear. During the initial phase (8-18 hours after infection) of viral application, the nucleocapsids are collected in the nucleus and subsequently grow through the plasma membrane as NOV and spread the infection in cell culture. In addition, some nucleocapsids subsequently (18+ hours after infection) remain in the nucleus and are occluded in the protein matrix and are known as polyhedral inclusion bodies (PIBs). This form is not infectious in cell culture. The matrix is composed of a protein known as polyhedrin, mol. weight 33 kd. Each PIB is approximately 1 mm in diameter and can be up to 100 PIB in the core. In the late phase of the infection cycle, such a large proportion of polyhedrin is produced that makes up to 25% of the total cellular protein.

Since PIB has no role in the in vitro replication cycle, the polyhedrin gene can be deleted from the viral chromosome without affecting in vitro viability. Using the virus as an expression vector, the polyhedrin gene encoding the region of the foreign DNA to be expressed was replaced and placed under the control of the polyhedrin promoter. The result is a non-PIB viral phenotype.

This system has been used by several researchers, of which Pennock et al. and Smith et al. Pennock et al. (Gregory D. Penock, Charles Shoemaker, and Lois K. Miller, Molecular and Cell Biology 3: 84, pp. 399-406) describe a high level of expression of a bacterial protein, S-galactosidase, when placed under the control of the polyhedrin promoter.

Another expression vector derived from the core polyhedrosis virus has been described by Smith et al. (Gale E. Smith, Max D. Summers and M. J. Fraser, Molecular over Cell Biology, May 16, 1983, pp. 2156-2165). These authors demonstrated the efficacy of their vector in the expression of human B-interferon. The synthesized product was found to be glycosylated and secreted from insect cells if expected. Example 14 describes modifications of a plasmid containing the Autographa califomica core polyhedrosis viral (AcNPV) polyhdrone gene that allow easy insertion of the EPO gene into the plasmid so that it can be under transcriptional control of the polyhedrin promoter. The resulting DNA is co-transfected with intact chromosomal DNA from wild type AcNPV into insect cells. Genetic recombination results in replacement of the AcNPVC region of the polyhedrin DNA gene from the plasmid. The resulting recombinant virus can be identified among the viral progeny by having the DNA sequences of the EPO gene. This recombinant virus is expected to produce EPO upon reinfection of insect cells.

Examples of EPO expression in CHO, C127 and 3T3 and insect cells are given in Examples 10 and 11 (CHO), 13 (C 127 and 3T3) and 14 (insect cells).

Recombinant EPO, produced in CHO cells as in Example 11, was purified by conventional column chromatography methods. The relative amounts of sugars present in the glycoprotein were analyzed by two independent methods [(I) Reinold, Methods in Enzymol. 50: 244-249 (Methanolysis) and (II) Takemoto H. et al., Anal. Biochem. 145: 245 (1985) (pyridylamination, together with an independent assay for sialic acid)]. The results obtained in each method were in perfect agreement. Several assays were performed, giving the following average values, where N-acetylglucosamine is designated for comparison purposes as 1:

Sugar relative mola level N-acetylglucosamine 1 hexoses: 1.4 galactose 0.9 mannose 0.5 N-acetyluraminic acid 1 fucose 0.2 N-acetylgalactosamine 0.1

It should be noted that significant levels of fucose and N-acetylgalactosamine were reproducible observed using both independent methods of sugar analysis. The presence of N-acetylgalactosamine indicates the presence of O-linked glycosylation to the protein. The presence of O-linked glycosylation was further indicated by SDS-PAGE analysis of the glycoprotein followed by cleavage of the glycoprotein

SK 280623 Β6 with various combinations of glycosidic enzymes. After enzymatic cleavage of all N-linked carbohydrates on glycoproteins using the peptide endo F N-glycosidase enzyme, the molecular weight of the protein was further reduced by subsequent digestion with neuraminidases as determined by SDS-PAGE analysis. The in vitro biological activity of purified recombinant EPO was assayed by the method of G. Krystal, Exp. Hematol. 11: 649 (1983) (spleen cell proliferation bioassay) with protein terminated, calculated based on amino acid composition data. After multiple terminations, the in vitro specific activity of purified recombinant EPO was calculated to be greater than 200,000 units / mg protein. The mean value was in the range of about 275,000 to 300,000 units / mg protein. In addition, values greater than 300,000 were also observed. In vivo / polycythemic assay in mice, Kazal and Erslev, Am. Clinical Lab. Sci., Vcl. B, p. 91 (1975) / in vitro activities observed for recombinant material ranged from 0.7 to 1.3.

It is of interest to compare the glycoprotein characteristics reported for the recombinant CHO-produced EPO material, previously disclosed in International Patent Application Publication No. WO 97/32710. WO 85/02610 (published Jun. 20, 1985). A corresponding comparable sugar analysis, described on p. 65 of this application gives a zero value for fucose and for N-acetylgalactosamine and a hexose: N-acetylgalactosamine ratio of 15.09: 1. The absence of N-acetylgalactosamine indicates the absence of O-linked glycosylation in the aforementioned glycoprotein. In contrast to this material, the recombinant CHO-produced EPO of the present invention, which is characterized, contains significant and reproducible observable amounts of both fat and Nacetylgalactosamine, contains less than one-tenth the relative amount of hexoses, and is characterized by O-linked glycosylation. Furthermore, the high specific activity of the described CHO-obtained recombinant EPO of the invention may be directly related to its characteristic glycosylation pattern.

Biologically active EPO, produced by prokaryotic or eukaryotic expression of the cloned EPO genes of the present invention, can be used for in vivo treatment of mammalian species by physicians and / or veterinarians. The amount of active ingredient will, of course, depend on the severity of the disease being treated, the route of administration chosen and the specific activity of the active EPO, and will ultimately be determined by the physician or veterinarian concerned. Such an amount of active EPO, as determined by the physician, is also referred to herein as a "therapeutically effective EPO" amount. For example, in the treatment of induced hypoproliferative anemia associated with chronic sheep renal failure, the daily amount of EPO was 10 units / kg for 15 to 40 days. See Eschbach et al., J. Clin. Invest., 74: 434 (1984).

Effective EPO may be administered by any route appropriate to the condition being treated. Preferably, EPO is injected into the blood stream of the treated mammal. One of skill in the art will recognize that the preferred route of administration will vary with the condition being treated.

For active EPO, it may be administered either as a pure compound or a substantially pure compound, it is preferable to administer it in the form of a pharmaceutical formulation or preparation.

The formulations of the present invention, for veterinary as well as human use, comprise an active EPO protein as described, together with one or more pharmaceutically acceptable carriers thereof and optionally other therapeutic ingredients. The carrier (s) must be acceptable in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. It is desirable that the formulation does not contain oxidizing agents and other substances known to be incompatible with the peptides. The formulation may preferably be in unit dosage form and may be prepared by any method known in the art of pharmacy. All methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more accessory ingredients. Generally, the formulations are prepared by homogeneous and intimate association of the active ingredient with liquid carriers or finely divided solid carriers, or both, and then, if necessary, the products are shaped to the desired shape.

Formulations suitable for parenteral administration typically include sterile aqueous solutions of the active ingredient with solutions that are preferably isotonic with the blood of the recipient. Such formulations may advantageously be prepared by dissolving the solid active ingredient in water to form an aqueous solution and sterilizing the solution in one or more vial containers, for example, sealed ampoules or vials.

EPO / cDNA as used herein includes the mature EPO / cDNA gene preceded by the ATG codon and EPO / cDNA encoding allelic variations of the EPO protein. One allele is illustrated in Tables 2 and 3. The EPO protein comprises a 1-methionine derivative of the EPO protein (Met-EPO) and allelic variations of the EPO protein. The mature EPO protein, illustrated by the sequences in Table 2, begins with the sequence Ala-Pro-Pro-Arg ..., the beginning of which is indicated in Table 2 by the number "1". Met-EPO would start with the sequence Met-Ala-Pro-Prc-Arg ....

The following examples serve to better understand the invention, the scope of which is set forth in the appended claims. It is to be understood that modifications may be made to the above procedures without departing from the scope of the invention. All temperatures are in degrees Celsius and are not corrected. The micron or micro symbol, e.g. the microliter, micromol, etc., is "p", e.g. pl, pm etc.

DETAILED DESCRIPTION OF THE INVENTION

Example 1

Isolation of the genomic clone EPO

EPO was purified from the urine of patients with aplastic anemia essentially as described (Miyake et al., J. Biol. Chem., 252: 5558 (1977)) except that the phenol treatment was omitted and replaced by the heat treatment at 80 ° C for 5 minutes to inactivate neuraminidase.

The final purification step was fractionation on a C-4 Vydac HPLC column (The Separation Group) using a 0 to 95% acetone gradient with 0.1% trifluoroacetic acid (TFA) over 100 minutes. The position of EPO in the gradient was determined by goal electrophoresis and N-terminal sequence analysis (21.26, 27) of the major peaks. The EPO was eluted with approximately 53% acetonitrile and represents approximately 40% of the protein subjected to reverse phase HPLC. The fractions containing EPO were evaporated to 100 µl, adjusted to pH 7.0 with ammonium bicarbonate, completely digested with 2% TPCK-treated trypsin (Worthington) for 18 hours at 37 ° C. The tryptic digestion product was then subjected to reverse phase HPLC as described. The optical density was monitored at both 280 and 214 nm. Well separated peaks were evaporated to near dryness and subjected directly to N-terminal amino acid sequence analysis (59) using an Applied Biosystems Model 480Ab gas phase sequencer. The sequences obtained are underlined in Tables 2 and 3. As mentioned herein, two of these tryptic fragments were selected for synthesis of oligonucleotide probes.

From the Val-Asn-Phe-Tyr-Ala-Trp-Lys sequence, 17mer 32-fold degenerations of TTCCANGCGTAGAAGTT and 18 mer 128-fold degenerations of CCANGCGTAGAAGTTNAC were prepared (amino acids 46-52 in Tables 2 and 3).

From the sequence Val-Tyr-Ser-ASn-Phe-Leu-Arg (amino acids 144-150 in Tables 2 and 3), two pools of 14mer, each 32-fold degenerate TACACCTAACTTCCT and TACACCTAACTTCTT, were prepared that differ in the first position of the leucine codon prepared. . Oligonucleotides are labeled at the 5-terminus with ³² P using polynucleotide kinase (New England Biolabs) and gamma ³² P-ATP (New England Nuclear). The specific activity of the oligonucleotides varied between 1000 and 3000 Ci / mmol of the oligonucleotide. The human genomic DNA library in lambda bacteriophage (Laen et al., 22) was screened using an in situ modification of the amplification procedure originally described by Woo et al. (47) (1978). Approximately 3.5 x 10 ⁵ phages were plated at a density of 6000 phages per 150 mm Petri dish (NZCYM medium) and incubated at 37 ° C into visible coatings that are small (approximately 0.5 mm). After 1 hour cooling at 4 ° C, duplicate copies of the coating samples were transferred to nylon membranes (New England Nuclear) and incubated overnight at 37 ° C on fresh NZCYM plates. The filters were then denatured and neutralized for 10 minutes on a thin film of 0.5N NaOH-IM NaCl and 0.5M Tris (pH 8) -IM NaCl for 10 minutes. After vacuum drying at 80 ° C for 2 hours, the filters were washed in 5 x SSC, 0.5% SDS for 1 hour, and cell debris on the filter surface was removed by gentle scraping with a damp cloth. This scraping reduces the substantial binding of the probe to the filters. The filters were then washed with water and prehybridized for 4-8 hours at 48 ° C in 3M tetramethylammonium chloride, 10 mM NaPO 4 (pH 6.8), 5 x Denhardt's solution, 0.5% SDS and 10 mM EDTA. ³² P labeled 17mer was then added at a concentration of 0.1 pmol / ml and hybridization was performed at 48 ° C for 72 hours. After hybridization, the filters were washed extensively with 2 x SSC (0.3M NaCl - 0.03M Na-Citrate, pH 7) at room temperature and then for 1 hour in 3M TMAC1 - 10 mm NaPO4 (pH 6.8) at room temperature and from room temperature. 5 to 15 minutes at hybridization temperature. Approximately 120 strong duplicate signals were detected 2 days after autoradiography under intensification screening. Positives were selected, pooled at 8 and re-refined three times using one half 14-meter pool on each of the two filters and 127-meter on the third filter. The conditions and the 17mer for plate placement are described except that the hybridization for the 14mer was at 37 ° C. After autoradiography, the probes were removed from a 17-mer filter in 50% formamide for 20 minutes at room temperature and the filter was rehybridized at 52 ° C with an 18-mer probe. Two independent phages hybridize to all three probes. DNA from one of these phages (lambda HEPO1 herein) was digested with Sau3A and subcloned into M13 for DNA sequence analysis using the dideoxy chain terminating method of Sanger and Coulson, (23) (1977). The nucleotide sequence and deduced open reading frame amino acid sequence encoding an EPO tryptic fragment (underlined region) are described herein. Intron sequences are shown in lowercase letters, exon sequences (87nt) in capital letters. Sequences that match the acceptor (a) and donor (d) splice sites are underlined (see Table 4).

Example 2

Northern analysis of human fetal liver mRNA pg human fetal liver mRNA (prepared from the liver of a 20-week human fetus) and adult human liver mRNA was electrophoresed in a 0.8% agarose formaldehyde gel and transferred to nitrocellulose using the method of Derman et al., Cell, 23: 731 (1981). A single chain probe was then prepared from the M13 template containing the insert illustrated in Table 1. The primer was 20mer, obtained from the same tryptic fragment as the original 17mer probe. The probe was prepared as described by Anderson et al., PNAS, (50) (1984), except that following Amal digestion (which produces the desired 95nt probe containing 74nt coding sequences), a small fragment was purified from ml3. of the template by chromatography on a C14B sepharose column

Table 4 aget cceggget tecagaeet <IGC (c tt IgeggaaeteaEeaflcecaggea Tete gact eteegeeeaaeacc gg | * i £ eeeeceagf, A (gcgceegc (tigeec «gccctieecagni ge.igcteegceegtcceaíictetgctc · · ISO ccttctfcuctcccctcccBcgiicccaixi'ccefxgageageccecattacecaeaef'.caeiiuteeí'Bcagecc cr ic .-> Bcecccr. acccteAacccaEgcgtcct £ cecetgctctgaccecgEttggeccctacceet ((CBaccce 300 tcacBcneacatcetetcceccacecccaccegŕgeacgcaeaeetEcagacancafiecccEaecceeiiccaga neCReaej> Rtceet _e8geen rCCCC ': cCCCTCCCTCCĽCTCCUCCCCACCGC <; CTCTCCTCr.aWACCCCCACCC and 50 t: CCCC * * CCCCecCCCCTCTCCTCCC CACCCCCCCCCCTCCACAKCCCCCCTCTCCTCCACCCCCCTCCCCCTCC CCCTĽĽACCCCCCACCTTCCCCCt'ATrACCGCCCCCCCTCTCCTCACCCCCCCCCCCCCACCTCCCTCACCCACC 660 (jCCCCCAUCCCCCCACATCCCCCTCCACCgtgagtaccegegggctcggcEcteecgeecgecetggtcectgtt Hetf.lyVaillIaG tgagcggggatttagcgccceggctaetgtecaggaggtggetgggttcaDggaccggegaettgteaaggaecc 750 cggaaggfiggaBEggBStlSetCMCCtecacgtgccARCftSAgact' wtgggngtectt jtgggatgeeenaaac ccgacctgtgaagEgcaeacagtttggiggetEAggEgaacaaEEtceggggEgCtctgctttgccag tggagag 900 gaagetgataagctBatiacctgggCBctggagccBecacttatccgccagatggta »£ crtccgtcaeaceagg at tgnngtttgBecg | agaagtgcatectt | tigcctgggr.C <CRggCgtt * ^cac tg ^ea E <* <l! gmt ggcci'BggAggcagcaecigagcgcctccatgEtcggggacatgaeggaegagettgggcagagaegtggggatg aagcaegctctcettccaea (1200 ceacccttctcccteceeBeetgactcteageetggŕtatetgt tetaEAATCT '- CCrCCCTCriCTCTCRCTTCTCCTCTCCCTCCTGTCCCTCCCTCTCCCCCTCaACTCCTCtXCCCCCCACCAcÉc FroAlaTrpLcuTrpl.col oLcuSerl ^ ^ uLcuSerLeuProLauClytauProValLeuCIyAlaFroProArg CTCATCtCTCACACCCCACTCCTtXACACCTACCTCTrec.AĽCCCAACCACCCCCACAATATCACCgtBatecce I35Ď, Lenil eCyaAapSerArgValleuCl uArgTyrLauLauCluAIaLyaCluAlaGluAtnl leThr c 11 c 11 crcnRcnca ccacngaac t cnŕf.et caRggc 11 cc ce ftggaiic t tc · cag c r.at (a * ec t (C ggccrgEítgcggaEctEBgaagctagacaecgeeeceeiaeacaagaacaagtetggtagececaaaccataccc GCAC 1500 ggaaaccaggcaagBagcaaaecengcagatcctacgectgtggccagggceagBgecttcegggacccttgnet cceeBBgetgegtgeatteeagACCCCCTCTCCTCAACACTCCACCTTCAATCACAATATCACTCTCCCACACAC 1650 'nirCJyCysAlaClulUeCyaSaiLauAanCLuAaallaThrValProAapTh

CAAAGnAATTTCTATCCCTCCAACACCATCCACgtgagttcctttttCttCttttttcctttcttttggageat rLyaValA «NPI>« TyrAlaTrpLy <ArgHetClu cCcutttBCgagcctgatcctggatgaaagggaEaaegategAEggaaaggEaaaatggagcagcagagatgagB 1800 etgcetgggegcagagECtcn <: geerntaatcecagBetgagatg | ccgAgatgggagaatt | cttgagccctgg aBtttcagaceaaccraBgcateatagtgaEateceeeateteteeaaacatttaaaaaaattaBCeaggtiaag 1950 tggttcatBttglcigteceatatatttttaaggccgaggcgggagtatcgcttgsgcecagB'at'tgaggc'E ^ca 8 ^t B ^and BC (Etg ^and teacaccactgcactccaBectcagtgacagagtgaBgetctgtctcaaaaaagaaaaea.ia 2100 aaataaaaatAntgBggBctBtatxgeatarEttcnrtsttcnttcaetfactcaeteeereatteatteatte · cecattcaacaagtcceattgeataeettctgettBcteei'ettggtgeCtggEgctgctBaggtgcaggegi'Ea 2250

BOBtgtgacatcccleagetgacteeeagagtecactceetgtagCTCCCGCAGCACCrCCTACAACTCTCCCAC

ValeJyClnClnAtaValCluValtrpCln fCCCTCGCCCTCCTCTCCCAACCTCTCCTCCCCCCCCACCCCCTCTTCGTCAACTCTTCCCACCCCTCCGACCCC «00 C lyl.au AlnLauLeugcrCluAlaValLauAraClyCLnAlaLauLauValAenSarSarClnFreTrpCluPTO CTCCACCTCCATCrcCATAAACCCCTCACTCGCCTTCCCACCCTCACCACTCTCCTTCCCCCTCTCCCACCCCAC LeuCinLeutlUValAspLy (AlaValSarClyLcuArsScrLeuThrTbrLeuLeuArgAlaL.cuGlyAlaGJn RtgagtaecaEecgacacttetgetetcectttctgCaagaaggcgagaaEggtcttgetaagBagtacaggaac 2350 tgtccgtattcettcectttctgtggeaecgcagcgacctectgttttctecttggcagAAGCAACCCATCTCCC LyaClyAlalleSarP £ TCCACATCCGCCCTCACCTCCTCCACTCCCAACAATCACTGCTGACACTTTCCCCAAACTCTTCCCACTCIACT 2700 roFroAapAlaAlaSerAlaAlBProLauArgThrllcThrAlaAapTTirPhaArgLyeLcuPheArgValTyrS f.CAATTrCCTCCCCCGAAACCTCAACCtCTACACACCĽCACCCCTCCACCACACCCCACAr.ATCACCACCTCTC7 erAsnPheLeuArcClyLyaLeul.yaLeuTyrThrClyCluAlaCyiArgTlirClyAapArg 'CCACCTCGCCATATCCACCACCTCCCTCACCAACATrCCTrGTCČCACACCCTCČCCCCCCACTČCT (: AACCCCC 2850 TCeACCCfíCTCTCACCTCACCCCCACCCTCTCCCATCCACACTCCACTCCCACCAATCACATCTCACCCCCCASA CCAACTGTCCAffA CACCAACTCTGACATCTAACCATCTCACACCCCCAACTTCACCCCCCACACCACCAAGCATT 3000 CAGACACCACCrTTAAACTCACGGACACACCCATJKTCCCAAGACCCCTCAtň ^ CACrCCCCACCCTGCÄAAArT TCATCCCACCACACCCTTTGGACCCCATTt ACCTCTTTTCCCACCTACCATCAGCCACACGATGACCTCCACAAC TTACCTCCCAAGCTGTCACTTCTCCACCTCTCACCCCĽArCCCCACTCCCTTCCTCCCAACACCCCCCTŤGACAC 3150 (? 5300 CeCCTCCTCCCAACCATCAACACACCATCCCCCCTCCCCTCTCCCTCTCATCGOCTCCAAGTTŕTCrCTATTCT TCAACCTCATTCACAACMCTCAAACCACCaatatgaeccttggccttCctcttttctttiaaeeteeaaetccc ctggctctgtcceactcctggcagca 3400 to 0, NaOH 0.2 M-NaCl. The filter was hybridized to approximately 5x10 ⁶ cpm of this probe for 12 hours at 68 ° C, washed in 2 x SSC at 68 ° C and subjected to intensive screening for 8 days. A single marker mRNA with 1200 nt (indicated by an arrow) was run in an adjacent pathway (Fig. 1).

Example 3 fetal liver cDNA

A probe identical to the probe described in Example 2 was prepared and used to screen the baking cDNA library.

Fetus, prepared in the lambda-Ch21A vector (Toole et al., Nature, (25) (1984) using standard screening (Benton Davis, Science, (54) (1978)). Three independent positive clones ( lambda-HEPOFL6 (1350 bp), lambda-HEPOFL8 (700 bp), and lambda-HEPOFL3 (1400 bp) were isolated after screening with 1 x 10 ⁶ coatings The entire lambda-HEPOFL13 insert and lambda-HEPOFL6 were sequenced after subcloning 13. (Tables 7 and 5) Only portions of lambda-HEPOFL8 were sequenced and the remainder were considered identical to the other two clones (Table 6) The 5-end and 3-end of the untranslated sequence are shown in lowercase letters.

In Tables 2 and 3, the deduced amino acid sequence shown below the nucleotide sequence is numbered such that the number 1 applies to the first amino acid of the mature protein. The predicted leader peptide is indicated by writing full abbreviations for amino acid notation. Cysteine residues in the mature protein are further indicated by SH and potentially N-linked glycosylation sites by an asterisk. Amino acids that are underlined refer to those residues identified by N-terminal protein sequencing or sequencing of EPO tryptic fragments as described in

Table 5

Val Aan Ser Ser Cln 7r «Trp Clu For Leu CU Leu Hla Val

LTC AAC TCT TCC CAC CCC TCC CAC CCC

Cl, Leu Atg Ser Uu Thr Flusher Uu Lau

GCC CTT CCC ACC CTC

Pro Pro Aap AU AU Ser Ala Ala Pro

CCT CCA CAT CCC CCC TCA GCT GCT CCA

Table 7

CTS

TCT

CAT

Lya Ala

AAA CCC

Val CTC

I0O Ser

ACT

AIA

CCC

TUP TCC

SKB TCC

LTU

CTC ixir CTC

SLH

TCC

Honor CCC

VAL CTC

CU CCC ta

Tyr TAC

CTC

TTC

Clu

CAC

Cl,

CCC

Clu

Leu

TTC

AAT

II e ATC

ACT> 0

TCC

CAC

TTC CTC

AAC

A boat

CAC ľro

CCC

Trp

TCC

Clu CAC

CCC

Cla

CAC

Leu CTC nii

CAT

Val CTC * ‘P

CAT

U ·

AAA

10 »

Ser

ACT

Ser Aen Pha

TCC-TTC

Cly ten

CCC CTT

Ser Leu Thr ACC

Lea CTC

Leu CTT

110

Arg Ala 1x «Cly Ali

Ctili CCT CTC CCC CAC AAG

Cla Lyi

But

CCC of the ATC

CCT

CCA

Arz

Tlie TTC

Aan fh «Leu

AAT TTC CTC

CTC AAC CTC

T, r Thr 01y «h TAC ACA CCC * '

CAC

110

Arg cco

CCT

Pha

TTC leo Ar Cly CTC CCC CCA

Lya U «lya U« Tyr MC CTC AM CTC TAC

Thr Sir

ACA CCC

THEY ARE

Cy. TCC ACC

166: ac ACA

TCA ecaggtg tgttcacetg

B * t ⁹ tur '• gc'eageg

U ⁹ < agtgtci staaggatg

ICaCAgggCC ugagcag igagcagct tcaaaeteag ggaeigagcc gacgcccgag ^C U 'aggaeaeget

ΒΒ · Μ'Β <

• M · ' »·

Ltltgl

IW 't _U <

and "CCT" and <t | "B *

Table 6 cccggtt: get | cge

Igegccgc cgcgctglcc ctgagcc ttaccggggc eaccgcgcct gctctgctccg acaccgcgce ccetggaeag eegeeetctt gCBCi: C '<M tlgeaccg ggtcacccgg cgcgccccag gtcgctgagg gaccccctgagg

ATC CCC <

CBUA'caggt

CAC sei

TCC

LEV

CTC

Lion CTC

Afg

CCC

Leu

CTC

GAC to Atg CCA

Val CTC

Lea

CTG

Clu CAC

Tyr

TAC

CTC

Lau

TTC

Clu

CAC

Clu CAC

11 «ATC

tkr

ACC

Thr ACC

Cly

CCC

But

CCT

SH Cya

TCC

Ser

ACC

Leu

TTC

CCA

CAC

ACC

Val cn

Tyr TAT

TCC

Lya AAC

ACC

CTC

Cl, CCC

wall

CTA

Cle CAA

Val CTC

Trp TOC

A boat

CAG

Cl, occ

CTC

Ala

CCC

Leu CTC

U. CTC

Ser TCC

Clu

CAA

Ala CCT

wall

CTC

lAJ

CTC

Ui

CTC

120

ATC TCC

140

Ar »L, a

CCC ΑΑΛ cecAjagce Μ “« ΙΒΒΒ 'caccgcgccc ictctfttccg aeaeegegne

IB'caceegt egegceccag gtcgetcngg gaeceeggcc ce «'g« teg

CB'B <UM ecgoget'ee «Μ · (| · ΙΜ« «tlgrgl

-H

KCT CCT 'AL HIS ClO CTS no ATC CCC CTC CAC CAA TCT CCT

CCC TCC CTC TCC CTC CTC CTC TCC CTC CTC

I

Ala

Tyr - - ... Á etí č ač

Leu

Ala

T® ^- t Sll 30 SB

Clu Al. Blu Ara U. Tfcr - Thr - CT Cya AU Clu Ma C, e Ser

CM CCC CM AAT Ate ACC ^ ACC CCC TCT CCT CAA CAC TCC ACC

Val Pro Aap Thr t, Val Aan Phe Tyr Ala Trp Irt Arg Het

CTC CCA CAC ACC AAA ATT

Tel LU Vil Trp Clly Clu Leu Ale Uu Leu Set Clu Ale Val

Lru Arg Cly Cln

CCC CCC CCC CAC

Ala Leu Registration Number CTC tw Val A »n $ er_Set__Cln Iro Tra CU Pre l.ru Cla Leu Hla Val

TTC CTC AAC TCT TTC C * C CCC TCC CAC CTC CTC CTC CAT CTC CAT MA CTC CTC fily lau Arg Ser Uu Thr Tlie Leu Lea Ara Ala U «Cly Ala ccc cc cc acc cc acc act c ru ccr ctc ca. ccc

100

with

AGT no

Fr, Pre Aap Ala Ala Ser Aln AU Pro Leu Arg Thr IU Thr Ale Aap Tl.r Phe Arg, <XT CCA GAT GCC CCC TCA CCT CCT CCA CTC CCA ACA ATC ACT CCT CAC ACT TTC CCC

140 ty · AAA

Leu Jhi — ÄX. CTC .'r ^s '. CTC TAC TCC Ara Mie Flying AAT UC CTC Ar || Cly Lyi CCC CCA AAC Uu Lya Uu CTC AAC AT Tyr π-r Cly TAC ACA CCC ILU Clu Ala ~ Ώδ CEC $ 11 ACC ACA 1U CJy Alp Arg GOl CAC MA TCA ccaggtg tgtccacetg ggcatatccu ccocclccct ea'CM'att gcttgtgcea eaccclcccc c | c <actcct (taceccgcc (IU • | CC «t cagcccagcg ccagcctgtc teeagcgcea gcaetgaeat ctetgujcc agaggaaecg tccagagagc aactctgaga tcícntggcc aaettguutt cceaew'ac gaagcactca emiaececcc ccaaacroe • rgetggga » gaegeccgag cteaecegge • eeetgcaaa «tctgacgcc aggaeucgct lUS'Bt'B * rttaeetgtt ttcgeacct » ceatcaggga c.U.'ga tggagaeetr aggcggraag etgtf-AETT tettggttte lemeaiu g <a <t 'Eetee geeetettga eaeetttt '· CIMH0CC.1 tg.iagAcagg • 'IIA' t ^'c i ececccgtec C'C4Eígggt ecaagctccg tgtattcttc aauccaeraa

Example 1. Partial underline indicates residues in the amino acid sequence of certain tryptic fragments that could not be unambiguously determined. The lambda-HEPOFL8 and lambda-HEPOFL13 cDNA clones were screened, stored and available from the American Type Culture Collection, Rockville, Maryland under accession numbers ATCC 40156, ATCC 40152 and ATCC 40153.

Example 4

Genomic structure of EPO gene

The relative sizes and positions of the four independent genomic clones (lambda-HEPO1, 2, 3 and 6) from the HaeII / Alul library are illustrated by the overlapping lines in FIG. 3. The thick line indicates the position of the EPO gene. The scale (in kb) and the positions of the known restriction endonuclease cleavage sites are shown. The region containing the EPO gene was completely sequenced from both strands using a controlled series of deletions in this region. A schematic representation of the five exons encoding EPO mRNA is shown in FIG. 4. The exact 5-terminal exon I bond is currently unknown. The protein encoding the exon moieties is darker. The complete nucleotide sequence of the region is shown in Table 4. The known boundaries of each exon are indicated by thick vertical lines. The genomic clones lambda-HEPO1, lambda-HEPO2, lambda-HEPO3 and lambda-HEPO6 were deposited and are available from American Type Culture Collection, Rockville, Maryland under accession numbers ATCC 40154, ATCC 40155 and ARCC 40150 and ATCC 40151.

Example 5

Construction of vector p91023 (b)

The transformation vector was pAdD26SVpA (3) described by Kaufman et al., Mol.Cell Biol., 2: 1304 (1982). The structure of this vector is shown in FIG. 5A. Briefly, this plasmid contains the mouse dihydrofolate reductase (DFHR) cDNA gene, which is under the transcriptional control of the main late promoter adenovirus 2 (Ad2). The 5-end splice site is indicated in adenoviral DNA and the 3-end splice site derived from the immunoglobulin gene is present between the Ad2 major late promoter and the DFHR coding sequence. The SV40 early polyadenylation site is present after the DHFR coding sequence. The prokaryotic-derived section of pAdD26SVpA (3) is from pSVOd (Mellon et al., Cell, 27: 279 (1981)) and does not contain pBR322 sequences known to inhibit replication in mammalian cells (Lusky et al., Nature, 293 Rev.: 79 (1981)).

pAdD26SVpA (3) was transformed into plasmid pCVSVL2 as illustrated in FIG. 5A. pAdD26SVpA (3) was converted to plasmid pAdD26SVpA (3) (d) by deletion of one of the two PstI sites in pAdD26SVpA (3). This was accomplished by partial digestion with Pstl using an enzyme deficit to obtain a subpopulation of linearized plasmids in which only one Pstl site was digested, followed by Klenow treatment, ligation for recirculation, and screening for the Pstl site deletion of the 3-terminal poly-terminal to the 40-terminus. sequence.

The adenoviral three-part leader and the virus-linked genes (VA genes) were inserted into pAdD26SVpA (3) (d) as illustrated in FIG. 5A. First, pAdD26SVpA (3) (d) was digested with PvuII to obtain a linear molecule open at the 3-terminus of the three-part leader element. Then, pJAW 43 (Zain et al., Cell, 16: 851 (1979)) was treated with Klenow, digested with PvuII, and the 140 bp fragment containing the second part of the third leader was isolated by acrylamide gel electrophoresis (6% in Tris borate buffer) Maniatis et al., Supra). The 140 bp fragment was then ligated into PvuII digested pAdD26SVpA (3) (d). The ligation product was used to transform E. coli to tetracycline resistance, and colonies were screened using the Grunstein-Hogness procedure using a ³² P labeled probe, hybridizing to a 140 bp fragment. DNA was prepared from positively hybridizing colonies to test whether the PvuII reconstructed site was 5-terminal or 3-terminal inserted with 140bp of DNA specific to the second and third adenoviral late leader. The correct orientation of the PvuII site is at the 5-terminal side of the 140bp insert. This plasmid is designated tTPL in FIG. 5 A.

The SV40 Ava II D fragment containing the SV40 enhancer sequence was obtained by digesting SV40 DNA with Ava II, stepping the ends with Klenow pol I fragment, ligating the Xho 1 linkers to the fragments, digesting with Xho 1 to open the Xho 1 site and isolating the fourth largest (D) fragment by gel electrophoresis. This fragment was then ligated to Xho 1 cleaved pTPL to give plasmid pCVSVL2-TPL. The orientation of the SV40 D fragment in pCVSVL2-TPL was such that the SV40 late promoter was in the same orientation as the adenoviral major late promoter.

To introduce adenovirus-linked (VA) genes into pCVSVL2-TPL, a plasmid pBR322 containing the type 2 Hind III B fragment adenovirus was first constructed. Adenovirus type 2 DNA was digested with Hind III and the B fragment isolated by gel electrophoresis. This fragment was inserted into pBR322, which had been pre-digested with Hind III. After transformation of E. coli to ampicillin resistance, the recombinants were screened for insertion of the Hind IIIB fragment and the orientation of the insert was determined by restriction enzyme digestion. pBR322-Ad Hind III B contains the type 2 Hind III B adenovirus fragment in the orientation shown in FIG. 5B.

As illustrated in FIG. 5B, the VA genes are preferably obtained from the plasmid pBR322-Ad Hind IIIB by digestion with Hpa I, addition of EcoRI linkers, and digestion with EcoRI followed by removal of the 1.4 kb fragment. The fragment having EcoRI sticky ends is then ligated into the EcoRI site of the PTL previously cleaved with EcoRI. After transformation of E. coli HB101 and selection for tetracycline resistance, colonies were screened by filter hybridization to VA gene-specific DNA. DNA was prepared from positively hybridizing clones and characterized by restriction endonuclease digestion. The resulting plasmid is designated p91023.

As illustrated in FIG. 5C, two EcoRI sites in p91023 were removed by complete digestion of p91023 with EcoRI to produce two DNA fragments, one about 7 kb and the other about 1.3 kb. The latter fragment contains VA genes. The ends of both fragments were then ligated to each other. Plasmid p91023 (A), containing the VA genes and the like p91023, but with a deletion of two EcoRI sites, was identified by Grunstein-Hogness screening with the VA gene fragment and conventional restriction site analysis.

The single PstI site in p91023 (A) was removed and replaced with an EcoRI site. p91023 (a) was completely cut with PstI and treated with the Klenow Poli fragment to form the blunt ends. EcoRI linkers were ligated to the blunted PstI site of p91023 (A). Linear p91023 (A) with EcoRI linkers attached to the blunt Pst site were separated from the non-ligated linkers and fully digested with EcoRI and religated. The plasmid p91023 (B), as shown in FIG. 5C, and was identified as having a structure similar to p91023 (A) but with the EcoRI site of the earlier PstI site. Plasmid p91023 (B) was deposited and is available from the American Type Culture Collection, Rockville, Maryland under accession number ATCC 39754.

Example 6 cDNA clones (lambda-EPOFL6 and lambda-EPOFL13, Example 3) were inserted into plasmid p91023 (B) to produce PPTFL6 and PPTFL13. 8 µg of each purified DNA was then used to transfect 5 x 10 ⁶ COS cells using the DEAEdextran method (infra). After 12 hours, the cells were washed and treated with chloroquine (0.1 mm) for 2 hours, washed again, and exposed to 10 ml of medium containing 10% fetal calf serum for 24 hours. The medium was changed to 4 ml of serum-free serum and collected 48 hours later.

The production of immunologically active EPO was quantified by radioimmunoassay as described by Sherwood and Goldwasser (55). The antibody was provided by Dr. ludith Sherwood. The iodinated marker was prepared from the homogeneous EPO described in Example 1. The assay sensitivity was approximately 1 ng / ml. The results are shown in Table 8 below.

Table 8

Vector level of EPO released into medium (ng / ml) pPTFLI3 330 pPIFLδ 31

SK 280623-6

COS cells transfected with EPO activity

100 ng / ml

20.5 U / ml

3.1 L, 8 U / ml

j./ml

j./ml

PTFL13 was deposited and is available from the American Type Culture Collection, Rockville, Maryland under accession number ATCC3990.

Example 7

EPO cDNA (lambda-HEPOFL13) was inserted into the p91023 (B) vector and transfected into COS-1 cells and harvested as described above (Example 6) except that the chloroguin treatment was omitted.

In vitro, biologically active EPO was determined using a mouse fetal liver cell colony assay as a CFU-E source, or a 3 H-thymidine uptake assay using spleen cells of mice previously injected with phenylhydrazine. The sensitivities of these assays are approximately 25 milliunits / ml. In vivo, biologically active EPO was measured using either hypoxic mouse or fasted rat methods. The sensitivity of these assays is approximately 100 milliunits / ml. No activity was detected in both assays and control. The results of EPO, expressed by EPOFL13 clone, are shown below in Table 9, where the reported activities are expressed in units / ml using commercial quantified EPO (Toyobo, Inc.) as a standard.

Table 9 EPO expressed from type I cDNA RIA CFU-E ³ II-Thy hypoxic starved mouse test

Example 8 Analysis of EPO from COS cells on polyacrylamide gel

180 ng of EPO released into COS cell medium transfected with EPO (lambda-HEPOFL13) cDNA in vector 91023 (B) (see above) was electrophoresed on a 10% SDS Laemli polyacrylamide gel and electrotransfered onto nitrocellulose paper (Towbin et al., Proc. Natl Acad Sci USA 76: 4350 (1979)). The filter was probed with anti-EPO antibody as described in Table 8, washed and re-screened with ¹²⁵ I-staph A protein. The filter was processed by autoradiography for two days. Native homogeneous EPOs described in Example 1, either before (lane B) or after iodination (lane C), were subjected to electrophoresis (see Figure 8). Markers used include ³⁵ S labeled methionine, serum albumin (68,000 d) and ovalbumin (45,000 d).

Example 9 Construction of RK1-4

Bam HI-PvuII fragment from plasmid PSV2DHFR (Subramani et al., Mol. Cell. Biol. 1: 854-864 (1981)) containing the SV40 early promoter region linked to the mouse dihydrofolate reductase (DHFR) gene, SV40 enhancer, small the intron t antigen and the SV40 polyadenylation sequence was isolated (fragment A). The remaining fragments were obtained from vector p91023 (B) (see above) as follows: p91023 (A) was digested with Pst I at a single Pst I site, near the adenoviral promoter for linearization of the plasmid and either ligated to synthetic Pst I to EcoR1 converters and recirculated ( formation of Pst 1 sites - EcoR1 - Pst I at the original Pst I site; 91023 (B ') or treated with a large DNA polymerase 1 fragment to disrupt the Pst I sites and ligated to a synthetic EcoRl linker and recirculated (by creating an EcoR1 site at the original Pst I site) 91023 (B), each of the resulting 91023 (B) and 91023 (B ') fragments was digested with Xba and EcoR1 to form two fragments (F and G), combining the F fragment of p91023 (B) and the G fragment of p91023; (B ') and the G fragment of p91023 (B) and the F fragment of p91023 (B'), two new plasmids were generated that contain either an EcoR1-Pst I site or a Pst I-EcoR1 site at the original Pst I site. Pst I - EcoRl site where Ps The I site is closest to the adenoviral major late promoter, it was named p91023 (C).

The vector p91023 (C) was completely digested with XhoI, and the resulting linearized sticky-end DNA was blunt-ended by filling ends with a large fragment of E. coli from DNA polymerase I. A 340 bp Hind III EcoR1 fragment containing the SV40 enhancer was ligated to this DNA. as follow:

The Hind III-Pvu II fragment from SV40, which contains the SV40 origin of replication and enhancer, was inserted into plasmid c lac (Little et al., Mol.Biol.Med. 1: 473-488 (1983)). The c lac vector was prepared by digesting c lac DNA with BamHI, filling the sticky ends with a large DNA polymerase I fragment, and digesting the DNA with Hind III. The resulting plasmid (c SVHPIaC) regenerated the BamHI site upon ligation to the blunt-ended Pvu II. The EcoRI-Hind III fragment was prepared from c SVHPlac and ligated to the EcoRI-Hind III fragment of pSVOd (Mellon et al., Supra), which contained a plasmid origin of replication and the resulting plasmid PSVHPOd was selected. A 340 bp EcoRI-Hind III fragment from PSVHPOd containing SV40 origin / cnhancer was then prepared, blunt-ended at both ends with a large DNA polymerase 1 fragment, and ligated to the XhoI cleaved, blunt p91023 (c) vector described above. The resulting plasmid (p91023 (C) / Xho / blunted plus EcoRI / Hind III / blunted SV40 origin plus enhancer) in which the orientation of the Hind III-EcoR1 fragment was such that the BamHI site in this fragment was as close as possible to the VA gene was designated pES105 . Plasmid Pes105 was digested with Bam HI and PvuII as well as PvuII alone and a BamH1-PvuII fragment containing the adenovirus major late promoter (fragment B) and a PvuII fragment containing the gene resistance duration plasmid (tetracycline resistance) and other sequences (fragment C) was isolated. . Fragments A, B and C were ligated and the resulting plasmid is shown in FIG. 7 and was isolated and named RK1-4. Plasmid RK1-4 was deposited with the American Type Culture Collection, Rockville, Maryland, where it is available under accession number ATCC 399940.

Example 10

Expression of EPO in CHO cells - method 1

DNA (20 µg) from plasmid pPTFL13 described (Example 6) was digested with Cla I restriction endonuclease to linearize the plasmid and was ligated to Cla I-digested DNA from plasmid pAdD26SVP (A) 1 (2 µg) containing intact reductase dihydrofolate. (DHFR) gene driven by the adenovirus major late promoter (Kaufman and Sharp, Mol. And Cell.Biol. 2: 1304-1319 (1982)). The DNA thus ligated was used to transfect DHFR-negative CHO cells (DUKS-B1I, Chasin L.A. and Urlaub).

G. (1980) PNAS 77 4216-4220) and allowed to grow for two days, cells that incorporated at least one DHFR gene were selected in alpha medium lacking nucleotides and supplemented with 10% dialyzed fetal bovine serum. After two weeks of growth in selective medium, colonies were removed from the original plates, pooled into groups of 10-100 colonies per group, replated on the plate and left

Growth into mating in a nucleotide-free medium. Media supernatants from groups raised prior to methotrexate selection were assayed for EPO by RIA. Groups that had positive EPO production grew in the presence of methotrexate (0.02 μΜ) and were then subcloned and retested. EPO Cla 4 4.02-7, the only subcloned from the EPO Cla 4 4.02 group, releases 460 ng / ml EPO into media containing 0.02 μΜ MTX (Table 10). EPO Cla 4 4.02-7 is the cell line of choice for EPO production and has been deposited with the American Type Culture Collection under accession number ATCC CRL8695. Currently, this clone is subjected to sequential selection at increasing MTX concentrations and will likely provide cells that also produce higher levels of EPO. For groups that were negative on the RIA, methotrexate resistant colonies obtained from duplicate cultures that grew in the presence of methotrexate (0.02 µM) were again tested in the EPO groups by RIA. These non-positive cultures were subcloned and grown at increasing concentrations of methotrexate.

Sequential methotrexate selection (MTX) was achieved by repeating cell culture cycles in the presence of increasing concentrations of methotrexate and selecting survivors. For each cycle, EPO was measured in supernatant cultures by RIA and in vitro biological activity. The levels of methotrexate used in each sequential amplification were 0.02 pM, 0.1 pM and 0.5 pM, respectively. As shown in Table 10, significantly higher EPO levels were released into the culture medium after one round of selection in 0.02 µM MTX.

Table 10

The level of EPO released into the medium sample group An exam obtained from the medium 0,02 μΜ methotrexate alpha in alpha medium 4 4 RIA 17 ng / ml 50 ng / ml single colony 4 4 kloň (.02-7) RIA - 460 ng / ml

Example 11

Expression of EPO in CHO Cells - Method II

DNA from the lambda clone HEPOFL13 was digested with EcoRI and a small fragment containing the EPO gene was subcloned into the EcoRI site of plasmid RK1-4 (see Example 10). This DNA (RKFL13) was then used to transfect DHFR-negative CHO cells directly (without cleavage) and selection and amplification was performed as described in Example 10.

RKFL13 DNA was also inserted into CHO cells by protoplast fusion and microinjection. Plasmid RKFL13 has been deposited and is available from the American Type Culture Collection, Rockville, Maryland under accession number ATCC 39989.

Table 11

EPO level, released to the arena sample An exam obtained with media 0.02 pH matrexate. alpha in alpha colony group A RIA 3 ng / ml 4 2 ng / ml (group) ISO ng / nl (kloon) ³ H-Thy - 1.5 U / ml only RIA - with ng / ml colony ³ H-Thy - 5.9 U / ml lion (.O2C-2) alkroinjektovaná group RIA 60 ng / ml 160 ng / ml (DEFO-1) ³ H-Thy 1.8 j. /! -

The preferred single colony clone has been deposited and is available from the American Type Culture Collection, Rockville,

Maryland under accession number ATCC CRL8695.

Example 12

Expression of EPO genomic clone in COS-1 cells

The pSVOd vector (Mellon et al., Supra) was used to express the EPO genomic clone. DNA from pSVOd was completely digested with Hind III and blunted with a large fragment of DNA polymerase I. The EPO genomic lambda-HEP3 clone was completely digested with EcoRI and Hind III, and the 4.0 kb fragment containing the EPO gene was isolated and blunted as is described. The nucleotide sequence of this fragment from the Hind III site to the region immediately behind the polyadenylation signal is shown in FIG. 4 and Table 4. The EPO gene fragment was inserted into the pSVOd plasmid fragment and the correctly constructed recombinants in both orientations were isolated and verified. Plasmid CZ2-1 has the EPO gene in the "a" orientation (i.e., the 5 'end of the EPO closest to the SV40 origin) and the plasmid CZ1-3 is in the opposite orientation ("b" orientation).

Plasmids CZ1-3 and CZ2-1 were transfected into COS-1 cells as described in Example 7, and media were harvested and assayed for immunologically reactive EPO. Approximately 31 ng / ml EPO was defective in the culture supernatant of CZ2-1 and 16-31 ng / ml CZ1-3.

The genomic clones HEPO1, HEPO2 and HEPO5 can be inserted into COS cells for expression in a similar manner.

Example 13

Expression in C127 and 3T3 cells. Construction of pBPVEPO.

A plasmid containing the EPO cDNA sequence under transcriptional control of the mouse metallothionein promoter and fused to bovine papilloma virus complete DNA was prepared as follows:

pEPO49F

Plasmid SP6 / 5 was obtained from Promcga Biotec. This plasmid was digested completely with EcoRI and the 1340 bp EcoRI fragment from lambda-HEPOFL13 was inserted by DNA ligase. The resulting plasmid in which the 5 'end of the EPO gene was closest to the SP6 promoter (determined by digestion with BglI and Hind III) was named pEPO49F. In this orientation, the BamHI site in the PSP6 / 5 polylinker is directly attached to the 5 'end of the EPO gene.

pMMTneo BPV

Plasmid pdBPV-MMTneo (342-12) (Law et al., Mol. And Cell Biol., 3: 2110-2115 (1983)), illustrated in FIG. 8, it was digested completely with BamHI to form two fragments - a large fragment of about 8 kb in length containing the BPV genome and a smaller fragment of about 6.5 kb in length containing the pML2 origin of replication and the ampicillin resistance gene, metallothionein promoter, neomycin resistance gene, and SV40 polyadenylation signal. The digested DNA was recirculated by DNA ligase and plasmids containing only the 6.8 kb fragment were identified by EcoRI and BamHI restriction endonuclease digestion. One of these plasmids was named pMMTneo BPV.

pEPO15a pMMT neo BPV was completely digested with BglII. pEPO49f was digested completely with BamHI and BglII and an approximately 700 bp fragment was prepared by gel isolation. BglII digested with pMMTneo BPV and 700 bp Bam11

SK 280623-6

The HI / BgIII Epo fragment was ligated and the resulting plasmids containing EPO cDNA were identified by colony hybridization with an oligonucleotide d (GGTCATCTGTCCCCTGTCC) probe that is specific for the EPO gene. Of the plasmids that were positive in the hybridization assay, one (pEPO15α) having EPO cDNA in the orientation such that the 5 'end of the DNA was closest to the metallothionein promoter was identified by digestion with EcoRI and Kpnf.

pBPV-EPO

Plasmid pEPO15A was digested completely with BamHI to linearize the plasmid. Plasmid pdBPV-MMTneo (342-12) was also digested completely with BamHI to give two fragments of 6, 5 and 8 kb. An 8 kb fragment containing the entire bovine Papilloma virus genome was isolated on a gel. pEPO15a / BamHI and the 8 kb BamHI fragment were ligated together and the plasmid (pBPV-EPO) containing the BPV fragment was identified by colony hybridization using the oligonucleotide probe d (PCCACACCCGGTACACA-OH), which is specific for the BPV genome. Digestion of pBPV-EPO DNA with Hind III indicates that the transcription direction of the BPV genome was the same as that of the metallothionein promoter (as in pdBPV-MMMTnec (342-12) see Figure 8). Plasmid pdBPV-MMTneo (342-12) is available from the American Type Culture Collection, Rockville, Maryland under accession no. ATCC 37224.

expression

The following methods were used to express EPO.

Method I

PBPV-EPO DNA was prepared and approximately 25 µg was used to transfect about 1 x 10 ⁶ C127 (Lowy et al., J. of Virol. 26: 291-98 (1978)) of CHO cells using standard calcium phosphate precipitation techniques ( Grahm et al., Virology, 52: 456-67 (1973)). Five hours after transfection, transfection media was removed, cells were subjected to glycerin shock, washed and fresh α-medium containing 10% fetal bovine serum was added. After 48 hours, cells were trypsinized and digested 1: 10 in DME medium containing 500 µg / ml 0418 (Southem et al., Mol. Appl.Genet. 1: 327-41 (1982)), and the cells were incubated for two up to three weeks. G418 resistant colonies were then individually isolated into microtiter wells and allowed to grow to the stage in the presence of G418. The cells were then washed, fresh medium containing 10% fetal bovine serum was added, and the media was harvested 48 hours later. Conditioned medium was tested and found to be positive in radioimmunoassay and in vitro biological assays.

Method II

C127 or 3T3 cells were transfected with 25 µg pBPV-EPO and 2 µg pSV2neo (Southem et al., Supra) as described in Method I. There is an approximately 10-fold molar excess of pBPV-EPO. After transfection, the procedure is the same as in Method 1.

Method III

C127 cells were transfected with 30 µg of pBPV-EPO as described in Method I. After transfection and digestion (1:10), fresh medium was changed every three days. After about 2 weeks, foci of transformed cells were evident. Individual foci were collected individually into 1 cm wells of the microtiter plate, allowed to grow into a sub-contiguous mono layer and assayed for EPO activity or antigenicity in the conditioned medium.

Example 14

Expression in insect cells. Construction of pIVEV EPOFL13.

The plasmid vector pIVEV was deposited and is available in the American Type Culture Collection, Rockville, Maryland under accession no. ATCC 39991. The vector was modified as follows:

pIVEVNI pIVEV was digested with EcoRI to linearize the plasmid, blunted using a large DNA polymerase I fragment and a single NO linker GGCGGCCGCC

CCGCCGGCGG was inserted by ligation to blunt ends. The resulting plasmid is called pIVEVNI.

pIVEVSI pIVEV was digested with SmaI to linearize a single Sfil linker

GGGCCCCAGGGGCCC

CCCGGGGTCCCCGGG, was inserted by ligation to blunt ends. The resulting plasmid was named pIVEVSI.

pIVEVSIBgKp

The plasmid pIVEVSI was digested with KpnI to linearize the plasmid, and approximately 0 to 100 bp was obtained from each end by digestion with double-stranded exonuclease Bal 31. Any ends that were not perfectly blunt were digested with a large DNA polymerase I fragment and polylinker _Xho_I_XbaI pEgjj. ECCTIS! Kpni AGATCTCG ^ GAATTCTAG ¹ A ¹ rCGA 'GGTAcTCTAGAGCTCTTAAGATCTAGCTACCATGG was inserted by blunt end ligation. The polylinker was inserted in both orientations. The plasmid in which the polylinker is oriented so that the BglII site in the polylinker is closest to the promoter of the polyhedron gene is termed pIVEVSIBgKβ. The plasmid in which the KpnI site in the polylinker is closest to the polyhedron gene promoter is termed pIVEVSIKpBg. The number of base pairs that were deleted between the original KpnI site in pIVEVSI and the polyhedron promoter was not determined. pIEIVSIBgKp has been deposited and is available in the American Type Culture Collection, Rockville, Maryland under accession no. ATCC 399988.

IEVSIBgKpN1 pIVEVNI was digested completely with KpnI and PstI to form two fragments. The larger fragment containing the plasmid origin of replication and the 3 'end of the polyhedron gene was prepared by gel isolation (fragment A). pIEVSIBgKp was digested completely with pstI and Kpn to form two fragments, and a smaller fragment containing the polyhedron gene promoter and polylinker was prepared by gel isolations (fragment B). Fragments A and B were then ligated with a DNA ligase to form a novel plasmid p1VESIBgKpNI, which contains a partially deleted polyhedron gene into which a polylinker has been inserted, and also contains a N?

PIVEPO pIVEVSI BGKpNI was digested completely with EcoRI to linearize the plasmid and a 1340 bp EcoRI fragment from lambdaHEPOFLI3 was inserted. Plasmids containing the EPO gene in orientation such that the 5 'end of the EPO gene is the closest polyhedron promoter and the 3' end of the polyhedron gene were identified by digestion with BglII. One of these plasmids in the orientation described was designated pIVEPO.

EPO expression in insect cells

Large quantities of the pIVEPO plasmid were produced by transformation of E. coli strain JM101-tg1. Plasmid DNA was isolated by a lysate purification technique (Maniatis and Fritsch, Cold Spring Harbor Manual) and further purified by CsCl centrifugation. L-1 DNA polyhedrosis of wild-type Autographa califomica virus (AcNPV) was prepared by phenol extraction of virus particles followed by CsCl purification of viral DNA.

The two DNAs were then co-transfected into Spodoptera frugiperda IPLB-SF-21 cells (Vaughn et al., In Vitro, Vol. B, pp. 213-17 (1977)) using a calcium phosphate transfection procedure (Potter and Millere, 1977). 1 µg of wild type AcNPV DNA and 10 µg of pIVEPO were used for each plate of transfected cells and incubated at 27 ° C for 5 days, then the supernatant was separated and EPO expression in the supernatant was confirmed by radioimmunoassay and in vitro biological assay.

Example 15 Purification of EPO

COS-cell conditioned media (121) with EPO concentrations up to 200 µm / liter was concentrated to 600 ml using ultrafiltration membranes with a separation capability of 10,000 mol. weight such as Millipore Pellicans 0.46 m ² per membrane. The assays were performed by RIA as described in Example 6. The retentate from the ultrafiltration was diafiltered against 4 ml of 10 mM 10 mM sodium phosphate, adjusted to pH 7.0. Concentrated and diafiltered conditioning media contain 2.5 mg EPO in 380 mg total protein. The EPO solution was further concentrated to 186 ml and the precipitated proteins were removed by centrifugation at 110,000 xg for 30 minutes.

The supernatant containing EPO (2.0 mg) was adjusted to pH 5.5 with 50% acetic acid, stirred at 4 ° C for 30 minutes and the precipitate was removed by centrifugation at 13,000 x g for 30 minutes.

Carbonylmethylsepharose chromatography

The centrifugation supernatant (20 ml) containing 200 µg EPO (24 mg total protein) was loaded onto a column packed with CM-Sepharose (20 ml) equilibrated in 10 mM sodium acetate pH 5.5, washed with 40 ml of the same buffer. . EPO, which bound to CM-Sepharose, was eluted with a 100 mL gradient of NaU (0-1) in 10 mM sodium phosphate pH 5.5. Fractions containing EPO (total 50 µg in 2 mg total proteins) were pooled and concentrated to 2 mL using an Amicon YM10 ultrafiltration membrane.

Reversed phase HPLC

Concentrated fractions from CM-Sepharose containing EPO were further purified by reverse phase HPLC using a Vydac-4 column. The EPO was applied to a column equilibrated in 10% solvent B (solvent A was 0.1% CF ₃ CO ₂ H in water; solvent B was 0.1% CF ₃ CO ₂ H in CF ₃ CO ₂ H in CF ₃ CN ), at a flow rate of ml / min. The column was washed with 10% B for 10 minutes and EPO eluted with a linear gradient B (10-70% 60 minutes). Fractions containing EPO were pooled (about 40 µg EPO in 120 µg total proteins) and lyophilized. Lyophilized EPO was reconstituted in 0.1 M Tris HCl at pH 7.5 containing 0.15M NaCl and chromatographed by reverse phase HPLC. Fractions containing EPO were pooled and analyzed by SDS-polyacrylamide (10%) gel electrophoresis (Lameli UK, Nature). The pooled EPO fractions contain 15.5 µg EPO in 25 µg total protein.

The invention has been described in detail by its preferred embodiments. One skilled in the art can readily make modifications and improvements on the basis of the description and the present drawings without departing from the spirit and scope of the invention as set forth in the appended claims.

1. Jacobson L.O., Goldwasser E. Fried W., and Pizak L. F., Trans. Assoc. Am. Phsicians TO: 305-317 (1957).

2. Krantz, S. B. and Jacobson, L.O. 29-31.

3. Hammond D. and Winnick S. Ann. N.Y. Acad. Sci. 230: 219-227 (1974).

4. Sherwood J. B. a. Goldwasser E., Endocrinology 103: 866-870 (1978).

5. Fried, W. Blood 40: 671-677 (1972).

6. Fisher J. J. Lab. and Clin. Med. 93: 695-699 (1979).

7. Naughton B.A., Kaplan. S. M., Roy M., Burdowski A. J., Gordon A. S., and Piliera S. J. Scier 196: 301-302.

8. Lucarelli G. P., Howard D., and Stohlman F., Jr. J. Clin. Invest 43: 2195-2203 (1964).

9. Zanjani E. D., Poster J., Burlington H., Mann L. I., and Wasserman L. R. J. Lab. Clin. Med. 89: 640-644 (1977).

10. Krantz S. B., Gallicn-Lartiguc O., and Goldwasser E. J. Biol Chem, 238: 4085-4090 (1963).

11. Dunn C. D., Jarvis J. H. and Gresnman J. M. Exp. Hematol. 3: 65-78 (1975).

12. Crystal G. Exp. Hematol. 11: 649-660 (1983).

13. Iscove N. N. and Guilbert L. J., M.J. Murphy, Jr. &amp; (Ed.) New York: Springer-Verlag 3-7 (1978).

14. Goldwasser E., ICN UCLA Symposium. Control of Cellular Division and Development. A. R. Liss, Inc. 487-494

15. Cline M.J. and Golde D. W. Nature 277: 177-181 (1979)

16. Metcalf D., Johnson G. R., and Burgess A. W. Blood 55: 138- (1980).

17. Krane N. Henry Ford Hosp. Med. J. 31: 177-181 (1983).

18. Eschbach J., Madenovic J., Garcia J., Wahl P., and Adamson J. J. Clin. Invest. 74: 434-441 (1984).

19. Anagnostou A., Barone J., Vedo A., and Fried. W. Br. J. Hematol. 37: 85-91 (1977).

20. Miyake T., Kung C., and Goldwasser E. J. Biol. Chem. 252: 5558-5564 (1977).

21. Yanagawa, S., Hirade, K., Ohnota, H., Sasaki, R., Chiba

H., Veda M., and Goto, M. J. Biol, Chem., 259: 2707-2710 (1984).

22. Lawn R. M., Fritsch E. F., Parker R. C., Blake G., and Maniatis. T. Cell 15: 1157- (1978).

23. Sanger F., Nicklen S., and Coulson A. R. Proc. Nat'I Acad. Sci., U.S.A., 74: 5463- (1977).

24. Zanjanc E D, Ascensao J L, McGlave P B, Banisadre M, and Ash. R. C. J, Clin. Invest. 67: 1183- (1981).

25. Toole JJ, Knopf JL, Wozney JM, Sultzman LA Buecker L., Pittman DD, Kaufman R. J Brown E., Shoemaker C., Orr EC, Amphlett GW, Foster WB, Coe M, L. Knutson GJ, Fass D N., and: Hewick RM Nature in Press.

26. Goldwasser E. Blood Suppl. L 58, xlii (abstr) (1981).

SK 280623-6

Sue JM and Sytkowdki A.J. Proc. Nat'I Acad. Sci U.S.A. 80: 3651-3655 (1983).

29. Bersch N. and Golda D. W., In Vitro Aspects of Ervthropoiesis. M.J. Murphy (Ed.) New York: Spinger-Verlag (1978).

30. CotesP. M. and BanghamD. R. Nature 191: 1065- (1961).

31. Gotdwasser E. and Gross M. Methods in Enzvmol 37: 109-121 (1975).

32. Nabeshima Y. -i. Fujii-Kuriyama Y., Muramatsu M., and Ogata K. Nature 308: 333-338 (1984).

33. Young R.A., Hagencuhle O. and Schibler U. Cell 23: 451-558 (1981).

34. Medford R. M., Nguyen H. T., Destree A. T., Summers E. and Nadal-Ginard B. Cell 38: 409-42 (1984).

35. Ziff E. B. Nature 287: 491-499 (1980).

36. Earlv P. Cell 20: 313-319 (1980).

37. Sytkowski A. Bio. BIOPAL. Res. Comm. 96: 143-149 (1980).

38. Murphy M. and Miyake T. Acta. Haematol. Jpn. 46: 1380-1396 (1983).

39. Wagh P. V: and Bahl, O. P. CRC Critical Rieviews in Biochemistry 307-377 (1981).

40. Wang F. F., Kung C. K. H. and Goldwasser E. Fed. Proc. Fed. Am, Soc. Exp., Biol. 42: 1872 (1983).

41. Lowy P., Keighley G. and Borsook H. Nature 185: 102-103 (1960).

42. VanLenten L. and Ashwell G. J. Biol. Chem. 247: 4633-4640 (1972).

43. I-ee-Huang S. Proc. Nat'l Acad. Sci. U.S.A. 81: 2708-2712 (1984).

44. Fyhrquist F., Rosenlof K., Gronhagen-Riska C., Hortling L. and Tikkanen I. Nature 308: 649-562 (1984).

45. Ohkubo H., Kageyama R., Vjihara M., Hirose T., Inayama S., and Nakanishi S. Proc. Nat'l Acad. Sci. U.S.A. 80: 2196-2200 (1983).

46. Suggs S.V., Wallace R. B., Ilirose T., Kawashima E. H. ar. Itakura K. Proc. Nat'l. Acad. Sci. U.S.A.-78: 6613-6617 (1981).

47. Woo S. L. C., Dugaiczyk A., Tsai M. J., Lai E. C., Catterall J. F. and O'Malley B. W. Proc. Nat'l. Acad. Sci.U.S.A. 75: 3688- (1978).

48. Melchior W. B. and VonHippel P. H. Proc. Natl Acad, Soc. U.S.A. 70: 298-302 (1973).

49. Orosz JM and Wetmis JG Biopolvmers 16: 1183-1199 (1977).

50. Anderson S.Kingston I. B. Proc. Nat'l Acad. Sci. U.S.A. 80: 6836-6842, 61983).

51. Ullrich A., Coussens L., Hayflick JS Duli TJ, Gray A., Tam AW, Lee J., Yarden Y., Libermann TA, Schlessinger J., Downward J., Mayes ELV, Whittle H., Waterfield MD , and Seeburg PH Nature 309: 418-425 (1984).

52. Fisher J. Proc. Soc. Exptl. Biol. and J Med. 173: 289-305 (1983).

53. Kozak M. Nuc. Acid Res. 12: 857-872 (1984).

54. Benton W. D. and Davis R. W. Science 196: 180-182 (1977).

55. Sherwood J. B. and Goldwasser E. Blood 54: 885-893 (1979).

56. Derman E., Krauter K., Walling L., Weinberger C., Ray M., and Damell, J. T., Cell 23: 731- (1981).

57. Gluzman Y. Cell 23: 175-182 (1981).

58. Hewick R. M., Hunkapiller M. E., Hood L. E., and Dreyer W. J. J. Biol, Chem, 256: 7990-7997 (1981).

59. Towbin H., Stachelin T., and Gordon J., Proc. Nat'l Acad. Sci. 76: 4380- (1979).

60. Camott P., DeFlandre, C. C. R. Acad. Sci. Paris 143: 432- (1960).

Claims (13)

PATENT CLAIMS A recombinant DNA plasmid vector comprising a cDNA encoding human erythropoietin (EPO) of the lambda clone HEPOFL13 (ATCC 40153). A mammalian cell transformed with a vector transfer according to claim 1. The cell of claim 2, wherein said mammalian cell is a 3T3, C127 or CHO cell. 4. A mammalian cell comprising a plasmid that contains all bovine papilloma virus DNA and the cDNA sequence of Table 3 encoding human EPO. The cell of claim 4 which is a C127 or 3T3 cell. The cell of claim 5, wherein said EPO DNA is under transcriptional control of the mouse metallothionene promoter. The cell of claim 5, which comprises a plasmid containing DNA from pdBPV-MMTneo (342-12) (ATCC 37224). 8. Recombinant human erythropoietin, characterized by the presence of O-linked glycosylation, preparable by steps a) culturing the CHO cells of claim 3 comprising a DNA sequence encoding human erythropoietin in a suitable medium, wherein said DNA sequence is operably linked to an expression control sequence; and b) recovering and separating EPO from the cells and the medium. The recombinant human erythropoietin of claim 8, its glycosyl residues including fucose residues. Recombinant human erythropoietin according to claim 9, characterized by a glycosylation profile comprising a relative molar ratio of hexoses to N-acetylglucosamine (Nacglc) of 1.4: 1, namely galactose: Nacglc = 0.9: 1 and mannose: Nacglc = 0.5: first Recombinant human erythropoietin according to claim 9 or 10, characterized by the presence of N-acetyl-galactosamine. A method for producing recombinant human erythropoietin (hEPO) comprising the steps of (a) culturing CHO cells containing a DNA sequence encoding hEPO operably linked to an expression control sequence in a suitable medium; and (b) recovering and separating the produced recombinant hEPO from the cells and the medium, characterized in that CHO cells having the ability to provide N- and O-linked glycosylation with the introduction of fucose and N-acetylgalactosamine are used; separates recombinant hEPO with N- and O-linked glycosylation. The method of claim 12, wherein the recombinant hEPO has the following glycosylation profile: a molar ratio of hexoses to N-acetylglucosamine (Nacglc) of 1.4: 1, in particular a molar ratio of galactose to Nacglc of 0.9: 1 and mannose to Nacglc 0.5: 1.