DD251788A5 - Process for the preparation of a human cDNA clone - Google Patents

Abstract

The invention relates to a method for producing a human cDNA clone expressing biologically active erythropoietin which is used, for example, for the treatment of anemia. The object of the invention is to provide an improved method for cloning a gene which expresses a surprisingly high amount of human erythropoietin. The process according to the invention is carried out in such a way that a) purified erythropoietin protein is digested by trypsin.

Description

For this 11 pages drawings

\ Application Field of the Invention

The invention relates to a method for producing a human cDNA clone, the biologically active erythropoietin j

expressed. This is used as a medicine, for example for the treatment of anemia.

In particular, the present invention relates to cloned genes of human erythropoietin which surprisingly provide high levels of expression, the expression of said genes, and the in vitro production of human erythropoietin.

Characteristic of the known technical solutions

Erythropoietin (hereinafter abbreviated to EPO) is a circulating glycoprotein that stimulates red blood cell production in higher organisms (see Carnot et al., Compt. Rend. 143, 384 [1906]). Therefore, EPO is sometimes referred to as an electropore stimulating factor.

The lifetime of human erythrocytes is about 120 days. This means that approximately V120 of the total erythrocytes are destroyed daily in the reticuloendothelial system. At the same time, a relatively constant number of erythrocytes are produced daily to keep the concentration of erythrocytes constant (Guyton, Textbock of Medical Physiology, p.55-60, W.B. SaundersCo., Philadelphia [1976]).

Erythrocytes are formed during maturation and differentiation of the erythroblasts in the bone marrow. EPO is a factor that affects less differentiated cells and induces their differentiation into erythrocytes (Guyton, supra). EPO is a promising therapeutic agent for the clinical treatment of anemia or, in particular, renal anemia. The use of EPO is unfortunately not yet familiar in practical therapy due to its low availability. In order to be able to use EPO as a therapeutic agent, consideration should be given to the possible antigenic effect, and therefore, EPO should preferably be prepared from raw material of human origin. For example, human blood or urine can be used by patients suffering from aplastic anemia or similar diseases and excreting high levels of EPO. However, these raw materials are available only in limited quantities (see, for example, White et al., Rec. Progr. Horm. Res. 16,219 [1960]; Espada et al., Biochem Med 3,475 [1970]; Fisher, Pharmacol 24,459 [1972] and Gordon, Vitam. Horm. [NY] 31,105 [1973]).

EPO products have generally been prepared by concentrating and purifying urine from high EPO level patients suffering, for example, aplastic anemia or similar diseases (see U.S. Patent Nos. 4,397,840, 4,303,650 and 3,865,801). The limited availability of such urine is an obstacle to the practical use of EPO. Therefore, it is desirable to produce EPO urine products from healthy people. The problem with using urine from healthy people is the low content of EPO compared to that of anemic patients. In addition, the urine of healthy people contains certain inhibitory factors which are sufficiently high. Concentrations against electropoiesis act, so that a satisfactory therapeutic effect can only be obtained after thorough purification of the EPO.

EPO can also be obtained from the blood plasma of sheep. The separation of EPO from the blood plasma gives sufficiently strong and stable water-soluble preparations (see Goldwasser, Control Cellular Dif., Develop., Part A, pp. 487-494, Alan R. Liss, Inc., N.Y. [1981]). However, ovine EPO could have an antigenic effect in humans.

Although EPO is a desirable therapeutic agent, current isolation and purification techniques from natural sources are not adequate for mass production of this compound. Sugimoto et al. No. 4,377,511.3 describe a method for the mass production of EPO which comprises the in vivo multiplication of human lymphoblastic cells such as Namalwa, BALL-1, NALL-1, TALL-1 and JBL.

The production of EPO via other genetic engineering methods is described in the literature. However, neither a complete disclosure nor the chemical nature of the product has been published so far. The present application provides complete disclosure for the mass production of proteins and demonstrates the biological properties of the proteins and the human EPO. Such techniques also make it possible to produce proteins that differ chemically from authentic human EPO but have similar (and in some cases better) properties. Such proteins having biological properties of human EPO will be referred to hereinafter as EPO, irrespective of whether or not they are chemically identical to EPO.

Object of the invention

The aim of the invention is to provide a novel method for producing a human cDNA clone expressing the biologically active erythropoietin. -

Explanation of the essence of the invention

It is an object of the present invention to enable the cloning of a gene expressing a surprisingly high level of human EPO, its expression and in vitro mass production of active human EPO. The appropriate expression vectors for the production of EPO, expression cells, purification schemes and related processes are described in the present invention.

The inventive method for producing a human cDNA clone expressing biologically active erythropoietin is characterized in that

a) a purified erythropoietin protein is digested by trypsin.

In accordance with the present invention, host cells are grown in an appropriate medium containing a DNA sequence as shown substantially in Fig. 3B, which is operatively linked to an expression control sequence and which is thus differentiated from the cells and Medium produced erythropoietin is separated. Preferably, eukaryotic host cells are grown in an appropriate medium containing a DNA sequence as shown substantially in Fig. 4C, which is operatively linked to an expression control sequence, and which is thus differentiated from the cells and Medium produced erythropoietin is separated. According to the invention, the host cells are mammalian cells, for example 3T3 cells or Chinese hamster ovary (CHO) cells.

Furthermore, according to the invention, the DNA sequence in question is contained in a vector which also contains the bovine papilloma virus DNA.

As will be further described below, EPO was obtained in partially purified form, completely purified and digested with trypsin to produce specific fragments. These fragments were purified and sequenced. From these sequences, EPO oligonucleotides were assigned and synthesized. These oligonucleotides were used to screen a human gene map from which an EPO gene was isolated.

The accuracy of the EPO gene was determined by its DNA sequence, which matches many sequenced tryptic protein fragments. A portion of the genomic clone was then used to show by hybridization that EPO could be detected in human fetal 20 week old mRNA. A cDNA library of the human fetal liver was set up and tested in the screening method. Three EPO cDNA clones were obtained (after the screening of 750,000 recombinants). Two of these clones were full-length, as deduced from the complete coding sequence and the essentially untranslated sequence of the 3 'and 5' ends. This cDNA was amplified both in SV-40 virally transformed monkey cells (COS-1 cell line, Gluzman, Cell 23, 175-182 [1981]) and in Chinese hamster ovary ovaries (CHO cell line, Urlaub G. and Chasin LA, Proc. Natl. Acad. See, USA 77, 4216-4280 [1980]). The EPO produced by COS cells is in vitro and in vivo biologically active EPO. The EPO produced by CHO cells is biologically active in vitro and has not been tested in vivo.

The EPO cDNA clone has an interesting open reading frame of 14-15 amino acids (aa) with initiator and terminator of 20-30 nucleotides (nt) above the coding region. A representative sample of E. coli transferred with the cloned EPO gene was deposited with the American Type Culture Collection, Rockville, Maryland, and is available under the designation number ATCC 40153.

Brief description of the drawings

Figure 1 represents the base sequence of an 87 base pair exon of the human EPO gene.

Figure 2 shows the detection of EPO mRNA in human fetal liver mRNA.

Figure 3a shows the amino acid sequence of an EPO protein derived from the nucleotide sequence of lambda HEPOFL13.

Figure 3 b shows the nucleotide sequence of the EPO cDNA in lambda HEPOFLI 3 and the amino acid sequence derived therefrom.

Figure 4a shows the relative positions of DNA inserts of four independent human EPO genome clones.

Figure 4b shows a map of the aparent intron and exon structures of the human EPO gene.

Figure 4c shows a DNA sequence of the EPO gene shown in Figure 4b.

Figures 5a, 5b and 5c show the construction of vector 91023 (B).

Figure 6 shows the SDS-polyacrylamide gel analysis of the EPO produced in COS-1 cells compared to the native EPO.

Figure 7 shows the nucleotide and amino acid sequence of the EPO clone, lambda HEPOFL6.

Figure 8 shows the nucleotide and amino acid sequence of the EPO clone lambda HEPOFL8.

Figure 9 shows the nucleotide and amino acid sequence of the EPO clone lambda HEPOFL13.

Figure 10 shows a schematic representation of the plasmid pRKL-4.

Figure 11 shows a schematic representation of the plasmid pdBPV-MMTneo (342-12).

More detailed description

The present invention relates to the cloning of EPO genes and the production of EPO by the in vitro expression of these genes.

Patent literature and scientific literature are overflowing with processes applicable to the production of recombinant products. These techniques generally involve the isolation or synthesis of the desired gene sequence and the expression of this sequence in prokaryotic or eukaryotic cells, using techniques customary to one skilled in the art. Once a particular gene has been isolated, purified and inserted (i.e., cloned) into a transfer vector, its availability is assured in greater quantities. The vector is transferred with its cloned gene into a suitable microorganism or cell lines, e.g. B. in bacteria, yeast, mammalian cells such. COS-1 (monkey kidney), CHO (ovary of Chinese hamster), insect cell line, and the like, in which the vector is replicated as the microorganism or cell line proliferates, and from which the vector can be isolated by conventional methods , In this way, a continuously renewable source of the gene is delivered allowing for further manipulation, modification, and transfer to other vectors or other locations within the same vector. Expression can often be achieved by transferring the cloned gene (in the correct direction and reading frame) to the appropriate site of a transfer vector such that translation from a prokaryotic or eukaryotic gene results in the synthesis of a protein precursor. This includes the amino acid sequence encoded by the cloned gene linked to methionine or to an amino-terminal sequence of the prokaryotic or eukaryotic gene. In other cases, the transcriptional and translational initiation signals may be provided by a corresponding genomic fragment of the cloned gene. A variety of specific protein cleavage techniques can be used to cleave the protein precursor at a desired point so as to cleave the desired amino acid sequence, which can then be purified by conventional methods. In some cases, the protein containing the desired amino acid sequence is produced without the need for specific cleavage techniques, and thus can also be delivered by cells into the extracellular nutrient medium.

Isolation of a gene clone of the human EPO

Human EPO has been isolated from urine of patients with aplastic anemia in a highly purified form, as described below. This purified EPO was completely digested by trypsin. In this case, fragments were obtained, which were separated by reversed-phase HPLC. From the gradient fractions, the individual fragments were recovered and subjected to microanalysis. The sequences of the tryptic fragments are underlined in Figure 3 and are discussed in more detail below. Two amino acid sequences, Val-Asn-Phe-Tyr-Ala-Trp-Lys and Val-Tyr-Ser-Asn-Phe-Leu-Arg were selected for the construction of oligonucleotide probes (yielding a 17 nucleotide and 32x degenerate pool of oligonucleotides or an 18-nucleotide and 128-fold degenerate pool of oligonucleotides, from the earlier tryptic fragments, and two 14-nucleotide, 48-fold degenerate pools of the latter tryptic fragments). The 32-fold degenerate 17-mer pool was used to screen a human genomic DNA library in a Ch4A vector (22) by modifying the Woo-and-Malal-initu for the screening filters Reinforcement Procedure (47).

The Arabic numbers (1) - (61) used in the text refer to the publications listed in numerical order at the end of this application.

The phage which hybridize to the 17-mer nucleotides were pooled, pooled into small groups and probed with the 14-mer and 18-mer pools. The phage that hybridize to the 17-mer, 18-mer, and 14-mer pools were purified by plaque technique and fragments were subcloned into M13 vectors for sequencing by the dideoxy-chain termination method of Sanger and Coulson (23rd ed.) ) (1977). The sequence of the region that hybridizes to the 32-fold degenerate 17-mer nucleotide in one of the clones is shown in Figure 1. Within an open reading frame, this DNA sequence contains the nucleotides that could accurately encode the tryptic fragment used to derive the 17-mer pool of oligonucleotides. Furthermore, analysis of the DNA sequence revealed that the 17mer hybridization region was contained within an 87 bp exon bounded by potential splice acceptors and donor sites. The positive confirmation that these two clones (hereinafter referred to as lambda HEP01 and lambda HEP02) are EPO genome clones was obtained by sequencing additional exons containing additional code information obtained via tryptic fragmentation.

Isolation of EPO cDNA clones

Northern analysis (56) of human fetal (20 week old) liver mRNA was performed using a 95 nucleotide-long single-stranded probe prepared from an M13 clone that forms part of the 87 bp exon described in Figure 1 contains. As shown in Figure 2, a strong signal could be detected in fetal liver mRNA. The exact identification of this band as EPO mRNA was achieved by using the same sample for sreaning the bacteriophage lambda cDNA library of the fetal liver mRNA (25). Several hybridization clones were obtained at a frequency of approximately 1 per 250000 recombinants. The complete nucleotide and deduced amino acid sequences for these clones (lambda HEPOFL13 and lambda HEPOFL8) are shown in Figures 7 and 8. The EPO coding information is contained within 594 nucleotides in the 5 'half of the cDNA, which includes a very hydrophobic, 27 amino acid long initial and the final protein 166 amino acids in length. The assignment of the N-terminus of the final protein is based on the N-terminal sequence of the protein excreted in the urine of persons with aplastic anemia (see Figure 1, Goldwasser [26], Sue and Sytkowski [27] and Yanagawa [21 ]). Whether this N-terminus (Ala-Pro-Pro-Arg-) represents the current N-terminus of the circulating EPO, or whether liver or urinary splittings occur, is currently unknown.

The amino acid sequences underlined in Figure 3 indicate those tryptic fragments or parts of the N-terminus for which the protein sequence was obtained. The deduced amino acid sequence exactly matches the tryptic fragments that were sequenced, confirming that the isolated genes encode human EPO.

Structure and sequence of human EPO genes

Figure 4a shows the relative positions of DNA inserts of 4 independent human EPO genome clones. Hybridization analyzes of these cloned DNAs with oligonucleotide probes and with various probes prepared from two different classes of EPO cDNA clones show the position of the EPO gene within the 3.3 kb region, as shown in Figure 4a by the dark lines will be shown. Full sequence analyzes of this region (see Example 4) and comparison with the cDNA clones yield the map of the intron and exon structures of the EPO genes (see Figure 4b). The EPO gene is divided into five exons. Part of exon I, the entire exons II, III and IV and part of exon V contain the protein coding information. The remainder of exon I encodes the 5 'and 3' untranslated sequences.

Transient expression of EPO in COS cells

To demonstrate that biologically active EPO can be expressed in an in vitro cell culture system, COS cell expression studies were performed (58). The vector p91023 (B) used for the transient studies is described in Example 5. This vector contains the adenovirus major late promoter, an SV40 polyadenylation sequence, an SV40 origin of replication, an SV40 enhancer and the adenovirus VA gene. The cDNA insert lambda HEP0FL13 (see Figure 8) was inserted into a p91023 (B) vector, below the adenovirus major late promoter. This new vector is identified as pPTFL13.

Twenty-four hours after transfection of this construct into the M6 strain of COS-1 cells (Horowitz et al., J. Mol. Appl. Genet., 2,147-149 [1983]), the cells were washed and the medium replaced with serum-free medium. The cells are harvested 48 hours later. The degree of delivery of EPO to the culture supernatant was then assayed by quantitative radioimmunoassay for EPO (55). As shown in Table 1 (Example 6), immunologically reactive EPO was expressed. The biological activity of EPO produced by COS-1 cells was also examined. In a separate experiment, the vector containing lambda HEP0FL13 EPO cDNA was transferred to COS-1 cells and the media harvested as described above. EPO was then quantitatively determined in the medium by one of two in vitro biological assays, ³ H-trymidine and CFU-E (12,29), and by one of the two in vivo assays (in hypoxic mice and fasting rats [30 , 31]) (see Table 2, Example 7).

These results show that biologically active EPO is produced in COS-1 cells. In Western blots, it was demonstrated by means of a polyclonal anti-EPO antibody that EPO produced by COS cells has a mobility on SDS-polyacrylamide gels identical to that of the native EPO prepared from human urine was (Example 8). Therefore, it can be concluded that the extent of glycosylation of COS-1 produced EPO is similar to that of the native EPO.

Different vectors containing other promoters may also be used in COS cells or in other mammalian cells or eukaryotic cells. Examples of such other promoters within the meaning of the present invention include SV40 early and late promoters, the mouse metallothionein gene promoter, the promoter found in avian or mammalian retroviruses, the bacculovirus polyhedron gene promoter, and others , Examples of other cell types for the purposes of the present invention include E. coli, yeast, mammalian cells, such as E. coli. CHO (Chinese hamster ovary), C127 (monkey epithelium), 3T3 (mouse fibroblasts), CV-1 (African green monkey kidney) and insect cells, such as. B. those of Spodoptera frugiperda and Drosophila metanogaster. These variable promoters and / or cell types can effect regulation of the time or degree of EPO expression by producing a cell-specific type of EPO or allowing growth of large quantities of EPO-producing cells under less expensive but more easily controllable conditions ,

An expression system that has the merit of mammalian expression but takes little time to produce a high-level expression cell line is composed of an insect cell line and a DNA virus that proliferates in that cell line. The virus is a nuclear polyhedrosis virus. It has a double-stranded circular DNA genome of 128kb. The nucleocapsid is rod-shaped and exists in two forms, the non-occluded form in the membrane-bound virus and in an occluded form enveloped in the infected nucleus by a protein crystal. These viruses can usually be propagated in in vitro insect cell cultures and are alterable by all routine animal-virological methods. The cell culture medium is usually a nutripriming solution of 10% fetal calf serum. Virus growth is initiated in vitro when an unoccluded virus (NOV) enters a cell and travels to the nucleus where it reproduces. Replication takes place at the core. During the initial phase (8-18 hours after infection) nucleocapsids are accumulated in the nucleus and then germinate as NOV through the plasma membrane, thus spreading the infection through the cell culture. Some nucobial capsids then remain in the nucleus (more than 18 hours after infection) and are occluded in a protein matrix (known as the polyhedral inclusion body, [PIB]). This form is not infectious in cell culture. The matrix is composed of a protein known as polyhedrin (molecular weight 33 kd). Each PIB has an approximate diameter of 1 mm and can contain several hundred PIB per nucleus. Certainly, a large amount of polyhedrin is produced late in the infection cycle (approximately 25% of the total cellular protein level).

Since the PIBs play no role in the in vitro replication cycles, the polyhedrin gene can be deleted from the virus chromosome with no lasting effect on in vitro viability. By using the virus as the expression vector we have replaced the coding region for the polyhedrin gene with the foreign DNA to be expressed by placing it under the control of the polyhedrin promoter. This results in a non-PIB-forming virus phenotype.

This system has been used by many researchers, notably Pennock et al. and Smith et al. Pennock et al. (Gregory D. Pennock, Charles Shoemaker and Lois K. Miller, Mol. Cell Biol. 3,399-406 [1984]) reported the high level of expression of a bacterial protein, 0-galactosidase, when placed under the control of the polyhedrin promoter becomes. Another nuclear expression vector derived from the polyhedrosis virus has been described by Smith et al. (GaIe E. Smith, Mas D. Summers and M.J. Fraser, Mol. Cell Biol., May 16, 2156-2165 [1983]). The authors demonstrated the effectiveness of their vector through the expression of human / 3-interferon. The synthesized product was found as a glycosylated form and secreted by insect cells as expected. In Example 14, modifications of the plasmid containing the polyhedron gene of the Autographa californica nuclear polyhedrosis virus (AcNPV), which allows for easy insertion of the EPO gene into the plasmid, are described under the transcriptional control of polyhedron -Promotors stands. The resulting DNA is co-transfected into insect cells with intact chromosomal DNA of the wild-type AcNPV. A genetic recombination experiment results in the replacement of the AcNPVC polyhedrin gene region by the DNA of the plasmid. The

-b- ίθI / OO

resulting recombinant virus can be identified from the viral progeny by the presence of the DNA sequences of the EPO gene. This recombinant virus was expected to produce EPO after reinfection of insect cells.

Examples of EPO expression in CHO, CI27 and 3T3 and insect cells are given in Examples 10 and 11 (CHO), 13 (C127 and 3T3) and 14 (insect cells).

The biologically active EPO produced by prokaryotic or eukaryotic expression of the cloned EPO genes of the present invention may be used by physicians and / or veterinarians for the in vivo treatment of mammals. The amount of active ingredients will, of course, depend on the severity of the condition to be treated, on the route of choice of administration, on the specific activity of the active EPO, and will ultimately be decided by the attending physician or veterinarian. The amount of active EPO determined by the attending physician is hereinafter referred to as the "EPO treatment-effective amount." For example, for the treatment of induced hydroproliferative anemia, which is associated with chronic renal failure in sheep, over the period of 15 to 40 days a daily effective amount of EPO of 10 U / kg was found (see Eschbach et al, J. Clin Invest 74, 344 [1984]) .The active EPO can be administered in any way depending on the condition to be treated Preferably, the EPO is injected into the bloodstream of the mammal to be treated It will be readily appreciated by those skilled in the art that the preferred route of administration may vary depending on the nature of the condition to be treated, although it is possible to use the active EPO in pure form or as an almost pure compound, it is preferably administered as a pharmaceutical composition.

The pharmaceutical compositions of the subject compounds, for both veterinary and human use, comprise the active EPO protein as described above together with one or more pharmaceutically acceptable carriers and optionally other therapeutic ingredients. The excipients must be compatible with other ingredients of the composition and not harmful to the patient. The composition should not contain any oxidizing agents and other substances known to be incompatible with peptides. The compositions may conveniently be packaged in unit dosage forms and may be prepared by many methods known in the pharmaceutical arts. All methods include the step of mixing active ingredient with the carrier material composed of one or more excipients. In general, the compositions are prepared by uniformly and vigorously mixing active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, converting the product to the desired form of the composition.

The compositions for parenteral administration suitably comprise sterile aqueous solutions of the active ingredient and solutions which are preferably isotonic with the blood of the recipient. Such compositions may conveniently be prepared by dissolving the solid active ingredient in water to produce an aqueous solution, and under sterile conditions this solution may be administered in unitary or multi-dose dosage forms, e.g. B. in sealed ampoules or containers.

The EPO cDNA used herein includes the mature EPO cDNA gene preceded by an ATG codon and EPO cDNA encoding allelomorphic variations of the EPO protein. An allelomorphic variation is shown in Figures 3a and 3b. The EPO protein contains the 1-methionine derivative of the EPO protein (Met-EPO) and allelomorphic variations of the EPO protein. The mature EPO protein represented by the sequence in Figure 3 a begins with the sequence Ala-Pro-Pro-Arg ..., the beginning of which is indicated by the number "1" in Figure 3. The Met EPO would start with the sequence Met-Al-Pro-Pro-Arg ...

embodiment

The following examples are provided for a better understanding of the present invention, the true scope of which is set forth in the appended claims. Likewise, variations of the stated methods are possible, which are included in the present invention. All temperatures are given in ⁰ C and are uncorrected. The symbol for Micron or Micro, eg Microliter, Micromol etc., is "u", eg ul, etc.

Example 1: Isolation of a genome clone of EPO

EPO from the urine of patients with aplastic anemia was purified essentially according to the method developed by Miyake et al., J. Biol. Chem. 252, 5558 (1977), except that the phenol treatment was not performed and by heat treatment at 8O ⁰ C (five minutes) to inactivate neuraminidase. The final step of purification was by fractionation on a C-4 Vydac HPLC column (The Separative Group) by applying a 0-95% acetonitrile gradient with 0.1% trifluoroacetic acid (TFA) for 100 minutes. The EPO fraction was determined by gel electrophoresis and N-terminal sequence analysis (21,26,27) of the major fractions. The EPO was eluted at about 53% acetonitrile and represented about 40% of the protein separated by reversed-phase HPLC. The EPO-containing fractions were rotated to ΙΟΟμ.1, adjusted to pH 7.0 with ammonium bicarbonate and completely digested with 2% TPCK-treated trypsin (Worthington) at 37 ° C for 18 hours. The tryptic digest products were then subjected to reversed-phase HPLC as described above. The optical density at 280nm and 214nm was measured. Well-separated peaks were concentrated to near dryness and subjected directly to N-terminal amino acid sequence analysis (59) (Applied Biosystems Model 480A Gas phase sequenator). The resulting sequences are underlined in Figure 3. As previously described, two of these tryptic fragments were selected for the synthesis of oligonucleotide probes. From the sequence Val-Asn-Phe-Tyr-Ala-Trp-Lys (amino acids 46-52 in Figure 3) was 17mer with 32-fold degeneracy

AAA

TTCCANGCGTAGAAGTT and an 18mer with 128fold degeneration

AAA

CCANGCGTAGAAGTTNAC produced. From the sequence Val-Tyr-Ser-Asn-Phe-Leu-Arg (amino acids 144-150 in Figure 3) two pools of

14mers, each degenerate 32 times

TTGN T T

TACACCTAACTTCCT and TTGN TT

TACACCTAACTTCTT

which differ in the first position of the leucine codon. The oligonucleotides were labeled at the 5 'end with ³² P by polynucleotide kinase (New England Biolabs) and ³² P-ATP (New England Nuclear). The specific activity of the oligonucleotides varied between 1000 and SOOOCi / mmol. In the screening of the human genomic DNA library in bacteriophage lambda (Lawn et al., [22]), a modification of the in situ propagation method was performed, as originally described by Woo et al. (47) (1978). About 3.5 ^s χ 10 phage were incubated with a density of 6000 phage on petri dishes with a diameter of 150mm (NZTYM medium) platiertund at 37 ⁰ C until plaques of about 0.5 mm were visible. After one hour of cooling to 4 ° C duplicate replica of the plaques patterns were transferred to nylon membranes (New England Nuclear) and transferred overnight at 37 ⁰ C to refresh NZCYM plates incubated. The filters were then denatured and neutralized by washing with 0.5 N NaOH / 1 M NaCl and 0.5 M Tris (pH 8) / 1 M NaCl for 10 minutes. After it, the following heating in a vacuum at 8O ⁰ CfUr two hours, the filters were washed (5 x SSC, 0.5% SDS; 1 h) and the cell debris removed on the filter surface by gently scratching with a damp cloth. This scratching reduces the adhesion of the sample to the filters. The filters were then washed with water for a period of 4-8 hours at 48 ⁰ C in 3 m tetramethylammonium chloride, 1OmM _NaPO4 (pH 6.8), 5 x Denhardt's, 0.5% SDS, and 1OmM EDTA prehybridized. The ³² P-labeled 17mer was then added at a concentration of 0.1 pmol / ml and hybridization was carried out at 48 C for 72 hours ^0th After hybridization, the filters were washed extensively with 2 x SSC (0.3 M NaCl / 0.03 M Na citrate, pH 7) at room temperature, then for one hour in 3 mM TMA / 10 mM NaPO ₄ (pH 6.8) at room temperature and then at the hybridization temperature for 5-15 minutes. After two days of autoradiography with a reinforcing screen, approximately 120 strong doublet signals were recorded. The positives were picked, pooled in eight, replated and screened using one half of the 14mer pool on each of the two filters and the 17mer on the third filter. Conditions for plate application and hybridization are described above, but hybridization of the 14mer was performed at 37 ° C. After autoradiography the sample from the 17mer filter in 5O ⁰ C formamide was converted, and after 20 minutes at room temperature, the filter was rehybridized at 52 ⁰ C with the 18mer probe. Two independent phages hybridized in all three samples. The DNA of one of these phages (hereinafter referred to as lambda HEPO1) was completely digested with Sau3A and subcloned into M13 for DNA sequence analysis using the dideoxy chain termination method of Sanger and Coulson (23) (1977). The nucleotide sequence and deduced amino acid sequence of the open reading frame encoding the EPO tryptic fragment (underlined region) is described in this application. The intron sequences are indicated in lower case letters, the exon sequences (87 nucleotides) are given in capital letters. Matching sequences between splice acceptor (a) and donor (d) sites are underlined (see Figure 4c).

Example 2: "NortherrT analysis of human fetal liver mRNA

5 / xg of the human fetal liver mRNA (prepared from a 20-week-old fetal liver) and an adult liver mRNA were electrophoresed in a 0.8% agarose-formaldehyde gel and analyzed by the method of Derman et al., Cell, 23, 731 (1981) to nitrocellulose. A single-stranded sample was then prepared from the M13 template containing the insert shown in Figure 1. The primer was a 20-mer derived from the same tryptic fragment as the original 17mer sample. The sample was prepared as previously described by Anderson et al., PNAS, (50) (1984), except that after digestion with SmaIl (to produce the desired sample of 95 nucleotides in length, the 74 Containing nucleotides of the coding sequence), small fragments of the M13 template were purified by chromatography on a Sepharose CI4B column with 0.1 N NaOH / 0.2 M NaCl. The filter was hybridized to approximately 5 x 10 ⁶ cpm of this sample for 12 hours at 68 ⁰ C, washed twice with SSC at 68 ° C and exposed for six days an intensifying screen. A single marker mRNA of 1 200 nucleotides (indicated by an arrow) was run as a control in the adjacent row (see Figure 2).

Example 3: Flutaneous Liver cDNA

A sample identical to Example 2 was prepared and used for the screening of a fetal liver cDNA library prepared by the standard pasaques screening method (Benton Davis, Science [54] [1978]) in the vector Lambda-Ch21A (Toole et al., Nature, [25] [1984]). Three independent positive clones (hereinafter referred to as lambda HEPOFL6 [1350 bp], lambda HEPOFL8 [700bp] and lambda HEPOFL13 [1400 bp]) were isolated and then screened for the 1 × 10 ⁶ spots. The entire insert of lambda HEPOFL13 and lambda HEPOFL6 was sequenced and then subcloned into M13 (see Figures 9 and 7, respectively). From lambda HEPOFL8, only parts were sequenced and the residue assumed to be identical to the other two clones (see Figure 8). The 5 'and 3' untranslated sequences are indicated by lowercase letters. The coding region is represented by uppercase letters.

Referring to Figures 3 a and 3 b, the deduced amino acid sequence depicted below the nucleotide sequence is numbered beginning with number 1 for the first amino acid of the finished protein. The putative precursor peptide is also given. Cysteine residues in the finished protein are additionally indicated by the designation SH and possible N-glycosylation sites by a star. The underlined amino acids indicate those residues identified by N-terminal protein sequencing or by sequencing of the tryptic fragments of EPO as described in Example 1. Partial solid lines indicate residues in the amino acid sequence of certain tryptic fragments that could not be uniquely determined. The cDNA clones lambda HEPOFL6, lambda HEPOFL8 and lambda HEPOFL13 have been deposited and are available from American Type Culture Collection of Rockville, Maryland under the designation numbers ATCC 40156, ATCC 40152 and ATCC 40153.

Example 4: Genome structures of the EPO genes

The relative sizes and positions of the four independent genome clones (lambda HEPO1, 2, 3, and 6) from the Haeill / Alul library are shown by the overlapping lines in Figure 4a. The more solid line indicates the position of the EPO gene. A scaling (in Kb) and the positions of the known cleavage sites for the restriction endonucleases are given. The EPO gene-containing region was completely sequenced from both strands using exonuclease-IM generated series of extinctions within this region. A schematic representation of five exons encoding EPO mRNA is shown in Figure 4 b. The exact 5 'limit of exon I is currently unknown. The protein coding part of these exons is shaded. The complete nucleotide sequence of this region is shown in Figure 4c. The known boundaries of each exon are outlined by vertical bars. The genome clones lambda HEPO1, lambda HEPO2, lambda HEPO3 and lambda HEPO6 have been deposited and are available from the American Type Culture Collection, Rockville, Maryland, under the designation numbers ATCC 40154, ATCC 40155, ATCC 40150 and ATCC 40151.

Example 5 Construction of Vector p91023 (B)

The transformation vector used was pAdD26SVpA (3) as described by Kaufman et al., Mol. Cell. Biol. 2,1304 (1982). The structure of this vector is shown in Figure 5a. This plasmid contains a murine dihydrofolate reductase (DHFR) cDNA gene which is under the transcriptional control of the adenovirus 2 (Ad2) major late promoter. A 5 'splice site is indicated in the adenovirus DNA and a 3' splice site derived from an immunoglobulin gene is located between the Ad2 major late promoter and the DHFR coding sequence. The SV40 early polyadenylation site is located in the strand below the DHFR coding sequence. The prokaryotic-derived section of pAdD26SVpA (3) is derived from pSVOd (Mellon et al., Cell 27, 279 [1981]) and does not contain the pBR322 sequences known to inhibit replication in mammalian cells (Lusky et al., Nature 293.79 [1981]).

pAdD26SVpA (3) was transformed into the plasmid pCVSVL2 (see Figure 5a). pAdD26SVpA (3) was transferred to plasmid pAdD26SVpA (3) (d) by deleting one of the two Pst1 sites in pAdD26SVpA (3). This was achieved by partial digestion with Pst1 using a deficiency of enzyme to give a subpopulation of linearized plasmids in which only a single Pst1-stele was cleaved, followed by treatment with Klenow, ligation, to recircular and screen for Pst1 site deletions located at the 3 'end of the SV40 polyadenylation sequence.

The adenovirus tripartite leader and the virus-associated genes (VA genes) were inserted into pAdD26SVpA (3) (d) (see Figure 5a). First, pAdD26SVpA (3) (d) was cleaved with Pvull to obtain a linear molecule open within the 3 'region of the three elements comprising the tripartite leader. Then pJAW43 (Zain et al., Cell 16,851 [1979]) was digested with Xhoi, treated with Klenow, digested with Pvull, and the 140 bp fragments containing the second part of the third leader were electrophoresed on acrylamide gel (6% in Tris-borate buffer; Maniatis et al., Supra). The 140 bp fragment was then joined to the Pvull-digested pAdD26SVpA (3) (d). The joined product was used to transform E. coli tetracycline resistance and colonies were g.escreent according to the Grunstein-Hoguess process by a ³² p-labeled probe was used which hybridizes to the 140 bp fragment. DNA from positively hybridized colonies was prepared to test whether the reconstructed Pvull site was a 5 'or 3' end of the inserted 140 pb DNA specific for the second and third adenovirus late leaders. The correct orientation of the Pvull location is the 5'-end of the 140 bp slot. This plasmid is referred to as pTPL in Figure 5a.

The SV40 AvallD fragment containing the SV40 enhancer sequence was obtained by digesting SV40 DNA with Avail, the ends were blunt ended with the Klenow fragment in Poll, Xho1 linkers were ligated to the fragments, digested with Xho1 to open the Xho1 sites and the four largest (D) fragments isolated by gel electrophoresis. This fragment was then linked to Xho1-cut pTPL, thus obtaining the plasmid pCVSVL2-TPL. The orientation of the SV40-D fragment in pCVSVL2-TPL was such that the SV40 late promoter was in the same orientation as the adenovirus major late promoter.

To convert the adenovirus-associated (VA) genes into the pCVSVL2-TPL, a plasmid pBR322 was first constructed that contained the adenovirus type 2 HINDIII B fragment. The adenovirus type 2 DNA was digested with HindIII and the B fragment isolated by gel electrophoresis. This fragment was inserted into pBR322 previously digested with HindIII. After the transformation of E. coli to ampicillin resistance, the recombinations were screened for the insertion of the HindIII B fragment and the inserted orientation determined by digestion with restriction enzymes. pBR322-AdHindIII-B contains the adenovirus type 2 HindIII B fragment in the orientation shown in Figure 5 b. As shown in Figure 5 b, the VA genes are usually obtained from the plasmid pBR322-AdHindIII-B by digestion with Hpal by adding EcoR1 linker and digested with EcoR1 and then recovering the 1.4 kb fragment. The fragment with the EcoR1 protruding ends is then linked to the EcoR1 site of PTL, which was previously digested with EcoR1. Following transformation of E. coli HB101 and selection for tetracycline resistance, the colonies were screened for fiter hybridization to DNA specific for the VA genes. The DNA was prepared from positively hybridized clones and characterized by digestion with restriction endonucleases. The resulting plasmid is designated p91023.

As shown in Figure 5c, the two EcoR1 sites in p91023 are removed by completely cutting p91023 with EcoR1 to generate two DNA fragments, one at about 7 kb, the other at about 1.3 kb. The latter fragment contained the VA genes. The ends of both fragments were filled in using the Klenow fragment of Poll and the two fragments were then joined together. A plasmid p91023 (A) containing the VA genes, which is similar to p91023 but does not contain the two EcoR1 sites, was screened for both the Grunstein-Hogness screening procedure with the VA gene fragment and conventional Restriction site analysis identified. The single Pst1 site in p91023 (A) was removed and replaced with an EcoR1 site. p91023 (A) was completely cut with Pst1 and treated with the Klenow fragment of Poll to give fresh ends. EcoR1 linkers were linked to the smooth Pst1 sites of p91023 (A). The linear p91023 (A) with the EcoR1 linkers on the smooth Pst1 sites was separated from the unlinked linkers and digested to completion with EcoR1 and recombined. A plasmid p91023 (B) was obtained (see Figure 5 c) and characterized with a structure similar to p91023 (A), but with an EcoR1 site in place of the former Pst1 site. Plasmid p91023 (B) has been deposited and is available from the American Type Culture Collection, Rockville, Maryland, under the designation number ATCC 39754.

Example 6:

The cDNA clones (lambda HEPOFL6 and lambda HEPOFL13, see Example 3) were inserted into plasmid p91023 (B) to give pPTFL6 and pPTFU3, 8 / Kj of each purified DNA was then used 5x10 5 ^{6 to} transfect COS cells using the DEAE-dextran method (see below). After 12 hours, the cells were washed and treated with chloroquine (0.1 mM) for two hours, washed again and exposed to 10 ml of medium containing 10% fetal calf serum for 24 hours. The medium was then changed to 4 ml of serum-free medium and harvested 48 hours later. The production of immunologically active EPO was quantified using a radioimmunoassay using the Sherwood and Goldwasser method (55). The antibody was provided by Dr.Judith Sherwood. The iodinated tracer was made from the purified EPO (see Example 1). The sensitivity of the assay is about 1 ng / ml. The results are shown in Table 1.

Table 1 Vector conc. On in the medium

released EPO (ng / ml)

pPTFL13 330

pPTFL6 31

pPTFL13 has been deposited and is available from America η Type Culture Division, Rockville, Maryland under the number ATCC 3999.

Example 7

The EPO cDNA (lambda HEPOFL13) was inserted into the p91023 (B) vector, transferred to COS-1 cells and harvested as above (Example 6), except that the chloroquine treatment was omitted.

In vitro biologically active EPO was measured using either a colony-forming mouse fetal liver cell assay as a source of CFU-E or the ³ H-tymidine uptake assay using spleen rows of phenylhydrazine-injected mice. The sensitivity of this detection is about 25mU / ml. Biologically active EPO was measured in vivo either by the hypoxic mouse or starving rat method. The sensitivity of this detection is about 100mU / ml. In both tests, no activities were detected in blind experiments. The results of the EPO expressed by the clone HEP0FL13 are shown in Table 2, in which the activities are expressed in U / ml using commercial EPO (Toyobo Incorp.) As standard.

Table 2 EPO secreted from cells transfected with type I EPO cDNA

proof activity ng / ml RIA 100 U / ml CFU-E 2 <0.5 U / ml ³ H-Thy 3.1 <1.8 U / ml hypoxic mouse 1 U / ml starving rat 2

Example 8: SDS-polyacrylamide gel analysis of EPO from COS cells

180 ng of EPO released into the medium of COS cells transferred with EPO (lambda HEP0FL13) cDNA in vector 91023 (B) (see above) were grown on a 10% SDS-Laemlli-polyacrylamide- Gel electrophoretically separated and electrotransferred to nitrocellulose paper (Towbin et al., Proc. Natl. Acad. Sei., USA 76, 4350 [1979]). The filter was checked with anti-EPO antibodies as described in Table 1, washed and rechecked with ¹²⁵ l-staph A protein. The filter was autoradiographed for two days. Native pure EPO as described in Example 1 was electrophoretically separated either before (line B) or after iodination (line C) (see Figure 6). The markers used include ³⁵ S-methionine-labeled serum albumin (68,000 D) and ovalbumin (45,000 D).

Example 9: Construction of RK1-4 «.

The BamHI-Pvull fragment from the plasmid PSV2DHFR (Subramani et al., Mol. Cell. Biol. 1, 854-864 [1981]), which encodes the SV40 early-region adjacent to the murine dihydrofolate reductase (DHFR) gene. Promoter, an SV40 enhancer containing small t antigen intron and the SV40 polyadenylation sequence was isolated (fragment A). The remaining fragments were obtained from the vector p91023 (A) (see above) as follows: p91023 (A) was digested with PstI at the single PstI side next to the adenovirus promoter to ionize the plasmid and either with synthetic PstI or linked to EcoRI converters and recircularized (thereby producing sites PstI-EcoRI-PstI at the original PstI site, 91023 [B ']) or treated with the large fragment of DNA polymerase I to add the PstI sites and linked to the synthetic EcoR1 linkers and recircularized (creating an EcoRI site at the original PstI site, 91023 [B]). Each of the two resulting plasmids 91023 (B) and 91023 (B ') was digested with Xba and EcoRI to form two fragments (F and G). By joining fragment F from p91023 (B) and fragment G from p91023 (B ') and fragment G from p91023 (B) and fragment F from p910 _v 23 (B'), two new plasmids were generated, encoding either an Eco RI site Site or a PstI-EcoRI site at the original PstI site. The plasmid containing the PstI-EcoRI site, where the PstI site is closest to the adenovirus major late promoter, was designated p910'23 (C).

The vector p91023 (C) was completely digested with Xhol and the resulting linearized DNA with protruding ends was transformed with a large fragment of E. coli DNA polymerase 1 into blunt ended DNA. To this DNA was ligated a 340 bp HindIII-EcoRI fragment containing the SV40 enhancer prepared as follows: The HindIII Pvull fragment from SV40 containing SV40 origin or replication and enhancer inserted into the plasmid c-lac (Little et al., Mol. Biol. Med. 1,473-488 [1983]). The c-lac vector was prepared by digesting c-lac DNA with BamHI, then filling the protruding ends with a large fragment of DNA polymerase 1 and digesting the DNA with HindIII. The resulting plasmid (c-SVHPIac) regenerated the BamHI site by joining the blunt ends of Pvull. The EcoRI-HindIII fragment was made from c-SVHPIac and linked to the EcoRI-HindIII fragment of PSVOd (Mellou et al., Supra) containing the plasmid origin of replication, and the resulting plasmid PSVHPOd was selected. The 340 bp EcoRI-HindIII fragment of PSVHOd ₁ containing the SV40 origin / enhancer was then prepared, both ends blunt-ended with a large fragment of DNA polymerase and ligated to the Xho1-digested p91023 (c) vector, as described above. The resulting plasmid (p91023 [C] / Xho / blunt end plus EcoRI / HindIII / blunt end, SV40 origin plus enhancer) in which the orientation of the HindIII-EcoRI fragment was such that the BamHI site within that fragment became the Closest to VA gene was designated pES105. The plasmid pES105 was digested with BamHI and Pvull and also with Pvull alone, and the BamHI-Pvu-II fragment containing the adenovirus major late promoter (fragment B) and the Pvull fragment containing the plasmid within the resistance gene (tetracycline resistance) containing other sequences (fragment C) were isolated. Fragments A, B and C were linked and the plasmid shown in Figure 10b was isolated and designated RK1-4. The plasmid RK1-4 has been deposited with the American Type Culture Collection, Rockville, Maryland and is available under the reference number ATCC 39940. **

Example 10 Expression of EPO in CHO Cells (Method I)

The DNA (20 μg) from the plasmid pPTFL13 (see Example 6) was digested with the restriction endonuclease CIal to linearise the plasmid and was digested with Cla-1 digested DNA from the plasmid pAdD26SVp (A) 1 (FIG. 2 ^ g) containing an intact dihydrofolate reductase (DHFR) gene regulated by the adenovirus major late promoter (Kaufman and Sharp, Mol. And Cell. Biol., 2, 1304-1319 [1982]). This linked DNA was used to transfect DHFR-negative CHO cells (DUKX-BII, Chasin LA and Urlaub G., Proc Natl Acad., 77, 4216-4220 [1980]) and after two days of culture For example, cells containing at least one DHFR gene were fractionated in nucleoside-free alpha medium and 10% dialyzed fetal calf serum added. After two weeks growth in selective media, the colonies were removed from the original plates, assembled in groups of 10 to 100 colonies, replated and grown in nucleoside-free alpha medium. The supernatants of the pools washed prior to methotrexate selection were tested for EPO using an RIA. Positive EPO production pools were cultured in the presence of methotrexate (0.02 UM), then subcloned and retested. EPO Cla4alpha4.02-7, a single subclone from the EPO Cla4alpha4.02 pool, delivers 460 ng / ml EPO to the medium containing 0.02 μM MTX (see Table 3). EPO-Cla4alpha4.02-7 is the cell line of choice for EPO production and has been deposited with the American Type Culture Collection (assignment number ATCC CRL8695). At present, this clone undergoes a stepwise selection with increasing concentrations of MTX and is expected to yield cells producing even higher concentrations of EPO. For pools that were negative in RIA, methotrexate-resistant colonies obtained from the countercultures grown in the presence of methotrexate (0.02uM) were re-assayed for EPO by RIA. Those cultures that were not positive were subcloned and cultured in further increasing concentrations of methotrexate.

Stepwise methotrexate (MTX) selection was achieved by repetitive cycles of cell culture in the presence of increasing concentrations of methotrexate and selection of surviving cells. After each run, EPO in the culture supernatant was measured by RIA and by in vitro biological activity. The concentrations of methotrexate used in each incremental enhancement were 0.02M, 0.1M and 0.5M. As shown in Table 3, after passage of selection into 0.02M MTX, significant concentrations became from EPO into the culture medium.

Table 3 Concentration of EPO released into the medium

Sample test alpha-medium-emte 0.02 μM methotrexate in

deralpha-medium harvest

4 _a 4 pool RIA ^ g / ml 50ng / ml

4 _a 4 single

(.02-7) RIA - 460ng / ml

Example 11 Expression of EPO in CHO Cells (Method 2)

The DNA of clone lambda HEPOFL13 was digested with EcoRI and the small R1 fragment containing the EPO gene was subcloned into the EcoRI site of plasmid RK1-4 (see Example 10). This DNA (RKFL13) was then used to directly transfect the DHFR-negative CHO cells (without digestion). The selection and amplification was carried out as described in Example 10.

The RKFL13 DNA was also inserted into CHO cells by protoblast fusion and microinjection. Plasmid RKFL13 has been deposited and is available from the American Type Culture Collection, Rockville, Maryland, under the designation number ATCC 39989.

Colony Poo! A RIA 3 ng / ml ³ H-Thy - single Kolonieklon RIA - ³ H-Thy - 5.9 U / ml Mikroinji- RIA 60ng / ml zierterPool (DEPO-I)

Table 4 Concentration of EPO released into the medium

Sample assay alpha-medium-emte 0.02 μM methotrexate

Indian alpha medium harvest

42 ng / ml (pool) 150ng / ml (clone) 1.5 U / ml

90ng / ml (.02C-Z)

160ng / ml

³ H-Thy 1.8 U / ml -

The preferred single colony clone has been deposited and is available from the American Type Culture Collection, Rockville, Maryland, under the designation number ATCC CRL8695.

Example 12: Expression of the EPO genome clone in COS-1 cells

The vector used for the expression of the EPO genome clone is pSVOd (Mellon et al., Supra). The DNA of pSVOd was digested to completion with HindIII and the ends were blunt-ended with the large fragment of DNA polymerase-I. The EPO genome clone lambda HEPO3 was completely digested with EcoRI and HindIII and the 4.0 kb fragment containing the EPO gene was isolated and converted to blunt ends as described above. The nucleotide sequence of this fragment from the HindIII site to the regioli above the polyadenylation signal is shown in Figure 4. The EPO gene fragment was inserted into the pSVOd plasmid fragment. Correctly constructed recombinants in both directions could be isolated and verified. The plasmid CZ2-1 has the EPO gene in orientation "a" (i.e., the 5 'end of EPO is closest to the SV40 origin), and the plasmid CZ1-3 has the opposite orientation (orientation "b").

Plasmids CZ1-3 and CZ2-1 were transferred to COS-1 cells as described in Example 7, the medium harvested and tested for immunologically active EPO. Approximately 31 ng / ml of EPO was detected in the culture supernatant of CZ2-1 and 16-31 ng / ml of CZ1-3, respectively

 The genome clones HEP01, HEP02 and HEP06 can be inserted into COS cells for expression in a similar manner.

Example 13: Expression in C127 and CHO cells and construction of pBPVEPO

A plasmid containing the EPO cDNA sequence under the transcriptional control of the mouse metallothionein promoter and linked to the complete bovine papilloma virus DNA was prepared as follows:

pEPO49f.

Plasmid SP6 / 5 was purchased from Promega Biotec. Purchased. This plasmid was completely digested with EcoRI and the 1340bp EcoRI fragment of lambda HEP0FL13 was inserted by DNA ligase. The resulting plasmid, in which the 5 'end of the EPO gene was closest to the SP6 promoter (determined by BglI and HindIII digestion), was designated pEPO49f. In this orientation, the BamHi site in the PSP6-5 poly linker is directly adjacent to the 5 'end of the EPO gene.

pMMTneo ^A BPV - - ·

The plasmid pdBPV-MMTneo (342-12) Law et al., Mol. And Cell Biol. 3, 2110-2115 [1983]), shown in Figure 11, was completely digested with BamHI to generate two fragments: A large fragment about 8kb in length, containing the BPV genome, and a smaller fragment of about 6.5kb in length, containing the pML2 origin of replication and the ampicillin resistance gene, the methallothionein promoter, contains the neomycin resistance gene and the SV40 polyadenylation signal. The digested DNA was recircularized by DNA ligase and the plasmids containing only the 6.8 kb fragment were identified by digestion with EcoRI and BamHI restriction endonucleases. One of these plasmids was designated pMMTneo ^A BPV

pEP015a

pMMTneo BPV was completely digested with BglII. pEP049f was completely digested with BamHI and BglII and the approximately 700 bp fragments containing the entire EPO coding region were prepared by gel isolation. The BglII digested pMMTneo BPV and the 700bp BamHI / BGIII-EPO fragments were linked and the resulting plasmids containing the EPO cDNA were identified by colony hybridization with the oligonucleotide d (GGTCATCTGTCCCCTGTCC) probe specific for the EPO gene is. Of the species that were positive in the hybridization analysis, one (pEP015a) having the EPO cDNA in the orientation such that the 5 'end of the EPO cDNA was closest to the metallothionein promoter was by digestion EcoRI and Kpnl identified. pBPV-EPO

The plasmid pEPO15a was completely digested by BamHI to linearize the plasmid. The plasmid pdBPV-MMTneo (342-12) was also completely digested with BamHI to generate two fragments of 6.5 and 8kb. The 8 kb fragment containing the entire bovine papilloma virus genome was isolated (gel). pEPO15a / BamHI and the 8kb BamHI fragment were linked together and a plasmid (pBPV-EPO) containing the BPV fragment was identified by colony hybridization using an oligonucleotide probe d (P-CCACACCCGGTACACA-OH) specific for this for the BPV genome. Digestion of pBPV-EPO DNA with HindIII indicated that the direction of transcription of the BPV genome was the same as the direction of transcription of the metallothionein promoter (as in pdPBV-MMTneo [342-12], see Figure 11) ). The plasmid pdBPV-MMTneo (342-12) is available from the American Type Culture Collection, Rockville, Maryland, under the designation number ATCC 37224.

expression

The following methods were used for the expression of EPO.

Method I

DNA pBPV-EPO was prepared and approximately 25μρ was used to transfect approximately 10 ⁶ CI27 (Lowy et al., J. of Virol. 26, [1978]) CHO cells using the standard calcium phosphate precipitation technique ( Grahm et al ..

Virology 52, 456-467 [1973]). Five hours after transfection, the transfection medium was removed, the cells quenched with glycerol, washed, and fresh alpha medium supplemented with 10% fetal bovine serum. Forty-eight hours later, the cells were trypsinized and in the ratio 1:10 in DME medium of 500 / g / ml G418 (Southern et al., Mol. Appl.

Genet. 1,327-341 [1982]) and the cells are incubated for two to three weeks. G418-resistant colonies were individually isolated in microtiter plates and grown in the presence of G418. The cells were then washed, fresh medium supplemented with 10% fetal bovine serum and the media harvested 24 hours later. The conditioned media were tested by radioimmunoassay and in vitro biological experiments and were positive for EPO.

methods

C127 or CHO cells were cotransfected with 25 μg of pBPV-EPO and 2 μg of pSV2neo (Southern et al., Supra;

Method I). This represents an approximately 10-fold molar excess of pBPV-EPO. After transfection the procedure is the same as in method I.

Methodelll

C127 cells were transferred with 30 μg of pBPV-EPO (see Method I). After transfection and division (1:10), the medium was changed to fresh every three days. After about two weeks, spots of pBPV-transformed cells became visible. Individual spots were separately placed in 1 cm wells of microtiter plates, grown to a subconfluent monolayer, and assayed for EPO activities or for antigenicity in the conditioned medium.

Example 14: Expression in insect cells Construction of pIVEV EPOFLI3

The plasmid vector pIVEV has been deposited and is available from the American Type Culture Collection, Rockville, Maryland under the designation number ATCC 39991. The vector was modified as follows:

pIVEVNI

piVEV was digested with EcoRI to linearize the plasmid, using a large fragment of DNA polymerase I, the ends were converted to blunt ends and a single NotI linker

GGCGGCCGCC CCGCCGGCGG

was inserted by joining the blunt ends. The resulting plasmid is called pIVEVNI.

plVEVSI

pIVV was digested with SmaI to linearize the plasmid and a single sfil linker

GGGCCCCAGGGGCCC CCCGGGGTCCCCGGG

was inserted by joining the blunt ends. The resulting plasmid was named plVEVSI.

pIVEVSIBgKp

The plasmid pIVVSI was digested with KPnI to linearize the plasmid, and about 100OOpp was removed from each end by digestion with the double-stranded exonuclease Bal31. All the resulting ends that were not completely smooth were converted to blunt ends using the large fragment of DNA polymerase I and the poly-linker

Xho'l Xbal

BgL ¹ II EcoKI CIaI Kpnl

¹ AGAT ¹ CTbGAGAATTCTAGATCGATGGTACC TCTAGAGCTCTTAAGATCTAGCTACCATGG

was inserted by joining the blunt ends. The poly linker was inserted in both directions. A plasmid in which the poly-linker is oriented so that the BglII site within the poly-linker is closest to the polyhedron gene promoter is termed pIVEVSIBgKp. A plasmid in which KpnI site within the poly linker is closest to the polyhedron gene promoter is termed pIVEVSIKpBg. The number of base pairs deleted between the original KPnI site in pVEVSI and the polyhedron promoter was not determined.

plEIVSIBgKp has been deposited and is available under the designation number ATCC 39988 from the American Type Culture Collection, Rockville, Maryland.

pIVEVSIBgKpN

pIVENVI was completely digested with KPnI and PstI to obtain two fragments. The larger fragment containing the plasmid origin of replication and the 3 'end of the polyhedron gene was prepared by gel isolation (fragment A). pIVVSIBgKp was completely digested with PstI and KPn to obtain two fragments as well as a small fragment containing the polyhedron gene promoter. The poly-linker was prepared by gel isolation (fragment B). Fragments A and B were then ligated together by DNA ligase to form the new plasmid pIVEVSIBgKpNI, which contains a partially deleted polyhedron gene into which a poly-linker has been inserted, and which also contains the NotI site (replace the disrupted EcoRI site) and a Sfil site flanking the polyhedron gene region.

plVEPO

plVEVSI BgKpNI was completely digested with EcoRI to linearize the plasmid and the 1 340bpEcoRI fragment of lambda HEPOFL13 was inserted. The plasmids containing the EPO gene in orientation so that the B 'end of the EPO gene was closest to the polyhedron promoter and the 3' end of the polyhedron gene were identified by digestion with BglII. One of these plasmids in the orientation described above was named plVEPO. Expression of EPO in insect cells

Large amounts of the plVEPO plasmid were prepared by transformation of E. coli strain JM101-tgl. The plasmid DNA was isolated by the cleared-lysate technique (Maniatis and Fritsch, Cold Spring Harbor Manual) and further purified by CsCl centrifugation The L-1 DNA from the wild type autographa californica polyhydrosis virus (AcANPV ) was prepared by phenol extraction of virus particles and subsequent CsCl purification of the viral DNA, and these two DNAs were then transfected into spod.-frugiperda cells IPLB-SF-21 (Vaughn et al., in vitro, Vol -217 [1977]) was cotransfected using the calcium phosphate transfection method (Potter and Miller, 1977) For each plate of the cells to be cotransfected, 1j wild wild type AcNPV DNA and 10ug of plVEPO were used Plates were incubated for five days at 27 ° C. The supernatant was then harvested and EPO expression in the supernatant was confirmed by radioimmunoassay and by in vitro biological methods.

Example 15: Purification of EPO

The COS cell conditioned media (121) with EPO concentration up to 200 ^ g / l were concentrated to 600 ml using ultrafiltration membranes with a cut-off of 10,000 molecular weight, eg, a Millipore Pellikan membrane. The tests were performed by means of an RIA as described in Example 6. The supernatant from the ultrafiltration was diafiltered against 4 ml of a 10 mM sodium phosphate buffer (pH 7.0). The concentrated and diafiltered conditioned media contained 2.5 mg EPO (380 mg total protein). The EPO solution was further concentrated to 186 ml and the precipitated proteins were spun down at 120,000xg for 30 minutes. The supernatant, which contained 2.0 mg of EPO, was adjusted to pH 5.5 with 50% acetic acid, stirred for 30 minutes at 4 ^q C and the precipitate removed by centrifugation at 13.000xg for 30 minutes

Carbonylmethyl-Sepharose chromatography

The centrifugation supernatant (20 ml) containing 200 / g of EPO (24 mg total protein) was applied to a column packed with CM-Sepharose (20 ml) and equilibrated with 10 mM sodium acetate (pH 5.5) , Subsequently, the column was washed with 40 ml of the same buffer. The CMO-Sepharose bound EPO was eluted after 100 ml of a gradient of NaU (0-1) in 10 mM sodium phosphate (pH 5.5). The fractions containing EPO (total 50 / xg of 2 mg total protein) were pooled and concentrated to 2 ml using an Amicon YMIO ultrafiltration membrane. Reversed-phase HPLC

The concentrated fractions after column chromatography containing EPO were further purified by reversed-phase HPLC over a Vydac C-4 column. The EPO was applied to the column at a flow rate of 1 ml / min, which was mixed with 10% solution B (solution A was 0.1% CF ₃ COOH in water, solution B was 0.1% CF ₃ COOH in CF ₃ CN ) was equilibrated. The column was washed with 10% solution B for 10 minutes and the EPO was eluted with a linear gradient of B (10-70%, 60 minutes). The EPO containing fractions were pooled (approximately 40 / xg of EPO from 120 / xg total protein) and lyophilized. The lyophilized EPO was reconstituted in 0.1 M Tris-HCl buffer (pH 7.5) with 0.15 M NaCl and rechromatographed on a reversed-phase HPLC. The fractions containing EPO were pooled and analyzed by SDS-polyacrylamide (10%) gel electrophoresis (Lamelli, UK Nature). The pooled fractions of EPO contained 15.5 g of EPO (25 μg total protein). ,

references

1 Jacobson, L.O., Goldwasser, E., Fried, W., and Plzak, L.F., Trans. Assoc. At the. Physician TO: 305-317 (1957).

2 Krantz, S.B. and Jacobson, L.O., Chicago: University of Chicago Prize, 1970, pp. 29-31. 3. Hammond, D. and Winnick, S., Ann. N.Y. Acad. Be. 230, 219-227 (1974).

4 Sherwood, J.B. and Goldwater, E., Endocrinology 103, 866-870 (1978).

5 Fried, W., Blood, 40, 671-677 (1972).

6 Fisher, J :, J. Lab. and Clin. Med. 93, 695-699 (1979).

7 Naughton, B.A., Kaplan, S.M., Roy, M., Burdowski, A.J., Gordon, S.S., and Piliero, S.J., Science 196, 301-302.

8 Lucarelli, G.P., Howard, D. and Stohlman, F., Jr., J. Clin. Invest. 43, 2195-2203 (1964).

9 Zanjani, E.D., Poster, J., Burlington, H., Mann, L.I., and Wasserman, L.R., J. Lab. Clin. Med. 89, 649-644 (1977).

10 Krantz, S.B., Gallien-Lartigue, O., and Goldwasser, E., J. Biol. Chem. 238, 4085-4090 (1963).

11 Dunn, C. 0., Jarvis, J.H., and Greenman, J.M., Exp. Hematol. 3, 65-78 (1975).

12 Xrystal, G., Exp. Hematol. 11, 649-660 (1983).

13 Iscove, N.N., and Guilbert, L.J., M.J. Murphy, Jr. (Ed.) New York: Springer Verlag, pp. 3-7 (1978).

14 Goldwasser, E., ICN UCLA Symposium, Control of Cellular Division and Development, A.R. Liss, fnc, pp. 487-494 (1Γ31)

15 Cline, M.J., and Golde, D.W., Nature 277, 177-181 (1979).

16 Metcalf, D., Johnson, G.R., and Burgess, A.W., Blood 55, 138 (1980).

17 Krane, N., Henry Ford Hosp. Med. J. 31, 17-181 (1983).

18 Eschbach, J., Mladenovic, J., Garcia, J., Wahl, P., and Adamson, J., J. Clin. Invest. 74, 434-441 (1984).

19 Anagnostou, A., Barone, J., Vedo, A., and Fried, W. Br., J. Hematol 37, 85-91 (1977).

20 Miyake, T., Kung, C, and Goldwasser, E., J. Biol. Chem. 252, 5558-5564 (1977).

21 Yanagawa, S., Hirade, K., Ohnota, H., Sasaki, R., Chiba, H., Veda, M., and Goto, M., J. Biol. Chem. 259, 2707-2710 (1984 ).

22 Lawn, R.M., Fritsch, Ef.F., Parker, R.C., Blake, G., and Maniatis, T., Cell 15,1157 (1978).

23 Sanger, F., Nicklen, S., and Coulson, A.R. Proc. Natl. Acad. Sci., U.S.A. 74, 5463 (1977).

24 Zanjanc, E.D., Ascensao, J.L., McGlave, P.B., Banisadre, M., and Ash, R.C., J. Clin. Invest. 67, 183 (1981).

25 Toole, JJ, Knopf, JL, Wozney, JM, Sultzmann, LA., Buecker, J.L., Pittman, DD, Kaufmann, RJ, Brown, E., Shoemaker, Cl, Orr, EC, Amphlett, GW, Foster , WB, Coe, M; L, Knutson, GJ, Keg, DN, and Hewick, RM, (in press).

26 Gold Water, E. Blood, Suppl. 1.58, xlii (abstr) (1981).

27 Sue, J.M. and Sytkowdki, A.J., Proc. Natl. Acad. Be. U.S.A. 80,3651-3655 (1983).

29 Bersch, N. and Golde, D.W., "In Vitro Aspects of Erythropoiesis", M.J. Murphy (Ed.) New York: Springer. Verlag (1978).

30 Cotes, P.M. and Bangham, D.R., Nature 191, 1065 (1961).

31 Goldwater, E. and Gross, M., Methods in Enzymol. 37, 109-121 (1975).

32 Nabeshima, Y.-l, Fujii-Kuriyama, Y., Muramatsu, M., and Ogata, K., Nature 308, 333-338 (1984).

33 Young, R.A., Hagenbuchle, O., and Schibler, U., Cell 23,451-558 (1981).

34 Medford, R.M., Nguyen, H.T., Destree, A.T., Summers, E., and Nadal-Ginard, B., Cell 38: 409-421 (1968).

35 Ziff, E.B., Nature 287, 491 ^ 99 (1980).

36 Early, P., Cell 20, 313-319 (1980).

37 Sytkowski, A., Bio. Biop. Res. Comm. 96, 143-149 (1980).

38 Murphy, M. and Miyake, T., Acta Haematol. Jpn. 46.1380-1396 (1983).

39 Wagh, P.V. and Bahl, 0.P., CRC Critical Reviews in Biochemistry 307-377 (1981).

40 Wang, F.F., Kung, C.K.H., and Goldwasser, E., Fred. Proc. Fed. At the. Soc. Exp. Biol. 42, 1872 (abstr) (1983).

41 Lowy, P., Keighley, G., and Borsook, H., Nature 185, 102-103 (1960).

42 Van Lenten, L and Ashwell, G., J. Biol. Chem. 247, 46333-4640 (1972).

43 Lee Huang, S. Proc. Natl. Acad. Be. U.S.A. 81, 2708-2712 (1984).

44 Fyhrquist, F., Rosenlof, K., Gronhagen-Riska, C, Hortung, L., and Tikkanen, I., Nature 308, 649-652 (19.4.).

45 Ohkubo, H., Kageyama, R., Vjihara, M., Hirose, T., Inayama, S., and Nakanishi, S., Proc. Natl. Acad. Be. UNITED STATES. 80, 2196-2200 (1983).

46 Suggs, S.V., Wallace, R.B., Hirose, T., Kawashima, E.H., and ltakura, K., Proc. Natl. Acad. Be. U.S.A. 78, 6613-6617 (1981).

47 Woo, S.L.C, Dugaiczyk, Α., Tsai, M.-J., Lai, E.C., Catterall, J. F., and O'Malley, B.W., Proc. Natl. Acad. Be. U.S.A. 75,3688 (1978).

48 Melchior, W.B. and by Hippel, P.H., Proo. Natl. Acad. Soc. U.S.A. 70, 298-302 (1973).

49 Orosz, J.M. and Wetmis, J.G., Biopolymers 16, 1183-1199 (1977).

Anderson, S. and Kingston, I.B., Proc. Natl. Acad. Be. U.S.A. 80, 6836-6842 (1983).

51 Ullrich, Α., Coussens, L., Hayflick, JS, Dull, TJ, Gray, A., Tarn, AW, Lee, J., Yarden, Y., Libermann, T.Α., Schlessinger, J., Downward, J., Mayes, ELV, Whittle, H., Waterfield, MD, and Seeburg, PH, Nature, 309, 418-425 (1984).

52 Fisher, J., Proc. Soc. Exptl. Biol. And Med. 173, 289-305 (1983).

53 Kozak, M., Nucl. Acid Res. 12,857-872 (1984).

54 Benton, W.D. and Davis, R.W. Science 196, 180-182 (1977).

55 Sherwood, J.B. and Goldwasser, E., Blood 54: 8585-893 (1979).

56 Derman, E., Krauter, K., Walling, L, Weinberger, C, Ray, M., and Darnell, J. T., Cell 23, 731 (1981).

57 Gluzman, Y., Cell 23, 175-182 (1981).

58 Hewick, R.M., Hunkapiller, Me.E., Hood, L.E., and Dreyer, W.J., J. Biol. Chem. 256: 7990-7997 (1981).

59 Towbin, H., Stachelin, T., and Gordon, J., Proc. Natl. Acad. Be. 76,4380 (1979).

60 Carnott, P., De Flandre, C.C.R. Acad. Be. Paris, 143 432 (1906).

Fig. 1

gatcctacgcctgtggccagggccagagccttcagggacccttgactccccgggctgtgtgca tttcag

ACG thr GGC GIy TGT Cys GCT Ala GAA GIu CAC His TGC Cys AGC Ser TTG Leu GAGgtgagttcctttttttttttttttcctttctttggagaatctcatttgcgagcctg GIu d AAT. As η GAG GIu AAT Asn ATC Hey ACT thr GTC. Val CCA Pro GAC Asp ACC Thr AAA Lys GTT VaI AAT As η TTC Phe TAT Tyr GCC Ala TGG Trp AAG Lys AGG Arg ATG 'MET

attttggatgaaagggagaatgatc

Fig. 2

Adult liver fetal liver

Fig. 3 A

TRP LEU TRP LEU LEU LEU SER LEU LEU SER LEU PER MET GLY VAL • Leu HIS GLU CYS PER ALA 10 LEU GLY LEU PER VAL LEU GLY 1 Per Per bad Leu me Cys Asp Ser bad Val Leu Glu 20 Ala bad Tyr Leu Glu Ala Lys

Ala Glu As η He Thr Thr SH GIy Cys 30 Ala Glu His Cys Ser Leu Asn Glu Asn He 40 Thr Val Per Asp Thr Lys Val As η Phe Tyr SH 50 AIa Trp Lys bad mead Glu Val Gly Gin Gin 60 Ala Val Glu Val Trp Gin Gly Leu Ala Leu 70 leu Ser Glu Ala Val Leu bad Gly Gin Ala 80 leu Leu Val As η Ser Ser Gin Per Trp Glu 90 Pro Leu Gin Leu His Val Asp Lys Ala Val 100 ser Gly Leu bad Ser Leu Thr Thr Leu Leu 110 arg Ala Leu Gly Ala Gin Lys Glu Ala He 120 ser Per Per Asp Ala Ala Ser Ala Ala Per 130 leu bad Thr He Thr Ala Asp Thr Phe bad 140 Lys Leu Phe bad Val Tyr Ser Asn Phe Leu 150 Arg Gly Lys Leu Lys Leu Tyr Thr Gly Glu 160 aaa

Cys Arg SH

Thr GIy

166 Asp Arg

Claims (1)

A process for producing a human cDNA clone expressing biologically active erythropoietin, characterized in that a) purified erythropoietin protein is digested by trypsin, b) preparing a pool of oligonucleotide probes based on the amino acid sequence of the tryptic fragments produced in step a), c) a human genomic DNA library is screened with the oligonucleotide knockout samples from step b); d) clones are selected which hybridize to the samples and the clones are sequenced to determine if they are erythropoietin clones, e) an erythropoietin clone of step d) is identified, f) a clone from step e) is used for the screening of a cDNA library prepared from human fetal liver, and g) an erythropoietin clone is selected from the fetal liver cDNA library.