SK108697A3 - Methods and compositions for regulation of cd28 expression - Google Patents

Description

Methods and compositions for regulating CD28 expression

Technical field

The invention relates to the modulation of gene expression by oligomers, in particular those oligomers, which are effective in the treatment of diseases caused by the immune system.

BACKGROUND OF THE INVENTION

The immune system plays a crucial role in protecting higher organisms against life-threatening infections, but this immune system also plays a critical role in the pathogenesis of many diseases. Diseases in which the immune system has a significant role include an autoimmune disease where the immune system reacts against an autologous (self) antigen, such as systemic lupus erythematosus, or a disease associated with an immunoregulatory response against a foreign antigen, such as is observed when transplants are rejected.

The emergence and further development of many diseases caused by T cells is due to an inadequate immune response caused by abnormal T cell activation. Many skin diseases caused by T cells have been shown to have activated T cells (Simon et al., J. Invest. Derm., 103: 539-543, 1994). For example, psoriasis, which affects 2% of the western population, including four million Americans, is a skin disease characterized by hyperproliferation of keratinocytes and abnormal infiltration of activated T cells into the dermis and skin. It is believed in many publications that these activated T cells play a major role in psoriasis pathogenesis (Baadsgaard et al., J. Invest. Derm., 95: 275-282, 1990; Chang et al., Ar. Derm., 128). Schlaak et al., J. Invest. Derm., 102: 145-149, 1994) and that these activated T cells also play a critical role in psoriasis due to AIDS (Duvic, J.

Invest. Derm., 90: 38S-40S (1990). In psoriasis, the activated T cells present in the lesions mainly release cytokines produced by Th1 cells (IL-2, interferon t, see Schlaak et al., J. Invest. Derm., 102: 145-149, 1994).

These secreted cytokines induce expression of the same phenotype (HLA DR ^ / ICAM-1 *) in normal (from healthy skin) keratinocytes as found in lesions of psoriasis patients (Baadsgaard et al., J. Invest. Derm., 95: 275 to 282, 1990). Because of its proinflammatory effects found in vitro and in vivo, and because it is secreted in large quantities by both activated T cells and keratinocytes present in lesions of psoriasis patients, IL-8 is considered to be one of the the main culprits of the pathological changes observed on the skin of patients suffering from psoriasis, such as hyperproliferation of keratinocytes. Furthermore, it has been shown that the BB1 receptor, one of the B7 receptor family (natural CD28 receptor ligands occurring on the surface of activated antigen presenting cells, APCs), is expressed on the surface of keratinocytes obtained from lesions of psoriasis patients but not expressed on the surface of normal keratinocytes. (Nickoloff et al., Am. J. Pathology, 142: 1029-1040, 1993).

Diseases believed to be caused by mis-activation of T-cells include type 1 diabetes (insulin dependent), thyroiditis, sarcoidosis, multiple sclerosis, autoimmune uveitis, rheumatoid arthritis, systemic lupus erythematosus, inflammatory disease (inflammatory disease) Crohn's disease and ulcerative colitis) and autoimmune hepatitis. In addition, a number of other syndromes, including septic shock and cachexia in cancer, may include T-cell activation and increased production of potentially toxic amounts of lymphokines. Activation of T-cells also causes rejection of transplanted cells and organs, since these activated T-cells provide the signals necessary to effectively destroy the foreign tissue of the donor.

T cells / CD3. intercellular

Two independent signals are required to activate T-lymphocytes that lead to T-cell proliferation, gene expression, and secretion of specific immunomodulatory cytokines. The first signal is the recognition of the antigen presented on the surface of antigen presenting cells (APC) complexed with molecules of a large histocompatibility complex. This antigen presented in the context of large histocompatibility complex molecules is specifically recognized by the receptor complex. The second signal is provided through the interaction between T-cells and APC, which is antigen-non-specific, which serves to regulate T-cell responses against the antigen. These secondary or costimulatory (helper) signals determine the strength of T-cell responses to the presence of antigen. Costimulated cells respond by increasing transcription of certain cytokine genes and by stabilizing selected mRNA molecules. If T cells are not provided with a costimulatory signal, T cell activation results in anergic T cells or no T cell response at all. One key costimulatory signal is mediated through the interaction of the CD28 T cell surface receptor with molecules related to the B7 molecule present on the surface of the APC (Linsley and Ledbetter, Ann. Rev. Immunol., 11: 191-212, 1993). The CD28 molecule is constitutively expressed on the surface of 95% CD4 + T cells (which provide helper functions to B cells in antibody production) and on the surface of 50% CD8 ⁺ T cells (which perform cytotoxic functions) (Yamada et al., Eur. J. Immunol., 15, 1164-1168 (1985). Antigen stimulation or in vitro stimulation by mitogen results in a further increase in the number of CD28 molecules on the surface of T cells, as well as the production of certain immunomodulatory cytokines. These include interleukin-2 (IL-2), which is essential for the course of the T-cell cell cycle, interferon f, which exhibits a variety of antiviral and antitumor effects, and interleukin-8 (IL-8), known as a chemotactic factor for neutrophils. and lymphocytes. The production of these cytokines has been shown to be regulated through a signaling pathway utilizing the CD28 receptor to activate T cells (Fraser et al., Science, 251: 313-316,

1991, Seder et al., J. Exp. Med., 179: 299-304, 1994; Wechsler et al., J. Immunol., 153: 2515-2523, 1994). IL-2, interferon f and IL-8 are essential for a wide variety of immune responses and have also been shown to be expressed in disproportionately large amounts in T-cell diseases.

In some skin disorders caused by T cells, such as allergic contact dermatitis or lichen planus, CD28 molecules have been expressed to a large extent on the surface of most dermal and epidermal T cells. In contrast, in healthy skin or in basocellular carcinoma (a skin disease that is not caused by T cells), CD28 molecules were expressed only on the surface of perivascular T cells. Similarly to both allergic contact dermatitis and flat lichen, the molecules of the molecule were not expressed in healthy skin or basocellular carcinoma cells on the surface of dermal dendritic cells, dermal keratinocytes (Simon et al., J. Invest. Derm., 103: 539 to 543 (1994). Thus, this suggests that the signaling pathway utilizing CD28 / B7 is an important mediator of T-cell-mediated skin diseases.

APC and on the B7 surface while these

Defective T-cell activation, which is associated with certain autoimmune diseases due to the loss of tolerance to self-antigens, is predominantly characterized by the appearance of CD28 * T-cells and the expression of a CD28 ligand, i. B7 molecules, on the surface of activated professional APCs (monocytes, macrophages and dendritic cells). Such autoimmune diseases include autoimmune Graves thyroiditis (Garcia-Cozar et al., Immunol., 12: 32, 1993), sarcoidosis (Vandenbergh et al., Int. Immunol., 5: 317-321, 1993), rheumatoid arthritis (Verwilghen et al. al., J. Immunol., 153: 1378-1385, 1994) and systemic lupus erythematosus (Sfikakis et al., Clin. Exp. Immunol., 96: 8-14, 1994). In normal T-cell activation, which mediates rejection of transplanted cells or organs, binding of CD28 and the corresponding B7 ligand during the T-cell receptor interaction is necessary to elicit a proper allogeneic response against foreign antigens such as donor tissue. (TCR) with the appropriate antigen presented complexed with MHC (Azuma et al., J. Exp. Med., 175: 353-360, 1992; Turka et al., Proc. Natl. Acad. Sci. USA, 89: 11102-11105). , 1992).

include, for example, diabetes, and can

Traditional therapies used to treat autoimmune diseases are unable to prevent T cell activation, which is an effector step in an autoreactive immune response against a self-antigen. Drugs such as steroids or non-steroid anti-inflammatory drugs (NSAIDS) are currently used to alleviate the symptoms of the disease but cannot stop the progression of the disease. In addition, steroids may exhibit side effects, among which osteoporosis, organ toxicity, or also accelerate the process of cartilage degeneration and cause so-called post-injection redness lasting 2 to 8 hours. NSAIDS can have side effects on the gastrointestinal tract and increase the risk of agranulocytosis (lack of white blood cells-granolucytes) and iatrogenic hepatitis. Another type of treatment may be the use of immunosuppressants, especially in the advanced stages of the disease. However, these drugs suppress the entire immune system, and immunosuppressive therapy usually has serious side effects, including hypertension and nephrotoxicity. Also currently used immunosuppressants such as cyclosporin or FK506 cannot inhibit the CD28-dependent pathway of T cell activation (June et al., Mol. Cell. Biol., 7: 4472-4481, 1987).

In view of the aforementioned drawbacks of the currently used medicaments and methods in the treatment of diseases caused by the immune system, it is appropriate to provide new methods and compositions useful for the treatment of such diseases.

SUMMARY OF THE INVENTION

The invention describes methods and compositions useful in the treatment of diseases caused by the immune system. The compositions of the invention are capable of reducing the expression of CD28 molecules in cells where desired, thereby alleviating the pathogenic effects of the immune system in diseases caused by the immune system. The methods (object of the invention) useful for reducing CD28 expression can also serve as methods useful in CD2S * T cells to reduce the effects of antigenic stimulation of these cells, thereby actually reducing the amount of activated CD28 * T cells and cytokine release, including interleukin- 2, interferon τ and interleukin-8, which is associated with T-cell activation. Compositions of the invention include a variety of different oligomers capable of reducing CD28 expression.

One aspect of the invention relates to oligomers capable of reducing CD28 expression by interfering with CD28 expression. The oligomers of the invention have sequence homology with the nucleic acid bases to the CD28 gene or to a CD28 gene transcript, or a portion thereof, which homology suffices under intracellular conditions to form a double-stranded or triple-stranded helix of the nucleic acid. The oligomers of the invention may be DNA, RNA, or a variety of synthetic analogs thereof. In preferred embodiments, the oligomers comprise 11 to 50 bases and comprise at least two GGGG sequences separated by 3 to 5 bases.

Another aspect of the invention relates to genetic engineering vectors useful for intracellular expression of the oligomers of the invention in cells where desired, particularly in those cells that naturally express CD28.

Another aspect of the invention relates to pharmaceutical compositions comprising one or more different oligomers of the invention. These pharmaceutical compositions may be adapted for a variety of forms of administration to the body or may be adapted for administration to cells, which will then be returned to the body.

Another aspect of the invention relates to methods useful for treating diseases caused by the immune system. The methods of the invention include modulating the expression of CD28 by administering an effective amount of the oligomers of the invention. Methods of the invention include methods useful for treating autoimmune diseases, methods useful for reducing the inflammatory response, methods useful for reducing the production of selected cytokines, methods useful for inactivating T cells, and methods useful for immunosuppressing patients who have undergone transplantation.

Brief description of the figures

Figure 1 shows the 5 'untranslated region of CD28 (1A) and the mRNA sequence of human CD28 (IB, 1C). Figures IB and 1C depict different consecutive portions of a polynucleotide sequence.

Figure 2 is a graphical representation of the percentage of viable (living) T cells (vertical axis) after they were exposed to different concentrations of phosphothioate (A) and phosphothioate-3'-hydroxypropylamine (B) oligonucleotides both specific for CD28 and control.

Figure 3 shows the expression of CD28 antigen in human T cells obtained from two donors (GV010 and JC011), which was induced by a monoclonal antibody directed against CD3 together with PMA (A, dark bars) and compared to control, non-induced lymphocytes (light bars) ). The vertical axis shows the change in fluorescence intensity (MCS) from flow cytometry. Figure 3 further depicts the effect of both CD28-specific and control (B, lot I and II) phosphothioate oligonucleotides and the effect of both CD28-specific and control (C) phosphothioate-3'hydroxypropylamine oligonucleotides on CD28 expression in human T-cells obtained from peripheral blood circulation of the same two donors, which was achieved by induction with a monoclonal antibody directed against CD3 together with PMA.

Figure 4 graphically depicts A) proliferation of mitogen-induced human T-cells derived from donor KS006. The vertical axis shows the number of decays per minute x10 ^-B . B) the effect of both CD28-specific and control-specific phosphothioate oligonucleotides on the proliferation of human T-cells induced by a monoclonal antibody directed against CD3 together with PMA. The vertical axis shows the percentage of inhibition.

Figure 5 is a graphical representation of the induction of interleukin-2 (IL-2) formation in human T cells, which was achieved by treatment with a monoclonal antibody directed against CD3 together with PMA (A). The vertical axis shows the number of decays per minute x10 ^- *. Light bars are for control cells and dark bars for anti-CD3 / PMA activated cells. Furthermore, the effect of both CD28-specific and control (B) -phosphothioate oligonucleotides and of CD28-specific phosphotioate-3'hydroxypropylamine oligonucleotides and of control (C) on IL-2 production by human peripheral blood T-cells is shown. induced by a monoclonal antibody directed against CD3 together with PMA. The graphs are calibrated in percent inhibition.

Figure 6 is a graphical representation of the induction of interferon r formation in human T cells, which was achieved by treatment with a monoclonal antibody directed against CD3 together with PMA (A). The vertical axis shows the production in pg / ml. Light bars are valid for control cells and dark bars for anti-CD3 / PMA activated cells. Furthermore, the effect of both CD28-specific and control (B) -phosphothioate oligonucleotides and control (B) and of CD28-specific phosphotioate-3'hydroxypropylamine oligonucleotides and control (C) on peripheral bloodstream-induced T-cell production of interferon τ is shown. via a monoclonal antibody directed against CD3 together with PMA. The graphs are calibrated in percent inhibition.

Figure 7 is a graphical representation of the induction of interleukin-8 (IL-8) formation in human T cells, which was achieved by treatment with a monoclonal antibody directed against CD3 together with PMA (A). The vertical axis shows the production in pg / ml. Light bars are valid for control cells and dark bars for anti-CD3 / PMA activated cells. Furthermore, the effect of both CD28-specific and control (B) -phosphothioate oligonucleotides and control (B) and of CD28-specific phosphotioate-3'hydroxypropylamine and control (C) on IL-8 production by human peripheral blood T-cells is shown. induced by a monoclonal antibody directed against CD3 together with PMA. The graphs are calibrated in percent inhibition.

Figure 8 is a graphical representation of the induction of interleukin-2 receptor (IL-2R, also known as CD25) (A) and intercellular adhesive molecule-1 (ICAM-1, also known as CD54) (B) expression on human T-cell surfaces obtained from peripheral blood circulation. Induction of expression in human T cells obtained from peripheral bloodstream was achieved by a monoclonal antibody directed against CD3 together with PMA, and this expression was measured with or without the addition of both CD28-specific and control CD40-specific oligonucleotides. The measurement was performed on a flow cytometer and the graphs are calibrated in the change in fluorescence intensity (MCS).

Figure 9 is a graphical representation of the expression of CD28 molecule on the surface of human T-cell lines HUT 78 (A) and Jurkat (B) before and after exposure of these cells to a monoclonal antibody directed against CD3 together with PMA. The measurement was performed on a flow cytometer and the graphs are calibrated in MCS. Light bars are valid for control cells and dark bars for anti-CD3 / PMA activated cells. Furthermore, the effect of CD28-specific phosphorothioate oligonucleotides on Jurkat cells exposed to a monoclonal antibody directed against CD3 together with PMA (C) is shown. The graph is calibrated in percent inhibition.

Figure 10 is a graphical representation of the effect of CD28-specific phosphothioate oligonucleotides on interleukin-2 production in human T-cell lines HUT 78 (A) and Jurkat (B) exposed to a monoclonal antibody directed against CD3 together with PMA. The graphs are calibrated in IL-2 production in pg / ml.

Figure 11 is a graphical representation of the effect of phosphorothioate oligonucleotides on surface expression of helper molecules and on cytokine secretion in activated T cells. Graphs A, B, C are calibrated in fluorescence intensity change (MCS), graph D shows scintillation in cpmx10 * and graphs E and F production in pg / mlx10 *.

Figure 12 shows the effect of phosphorothioate oligonucleotides on mRNA levels for CD28 and mRNA for CD25.

Figure 13 is a representation of the specificity of the oligonucleotides RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) with respect to inhibitory effects on the expression of a functional CD28 molecule. Graph 131 was measured on a flow cytometer and is calibrated in MCS. The graphs in column II are calibrated in pg IL-2 per ml and in column III in percent inhibition.

Figure 14 shows the development of in vitro tolerance induced by oligonucleotides specific for CD28, RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45). On the right, data are calibrated in percent of activated T-lymphocytes (C, G) and cpm x 10 * (D, H).

Figure 15 is a graphical representation of the in vitro stability of phosphorothioates labeled with phosphorous ³² P, RT03S (SEQ ID NO: 44) and RT06S (SEQ ID NO: 48), in extracellular supernatants (upper image) and Jurkat cell lysates (lower image) ).

DESCRIPTION OF EMBODIMENTS OF THE INVENTION

This section describes methods and compositions useful for treating diseases caused by the immune system in which the desired therapeutic effect is achieved by reducing expression of CD28 molecules, thereby preventing activated CD28 * T cells from performing their activity, and also reducing the activation of other immune system cells . We have discovered that antigen-dependent T cell activation can be inhibited by CD28 * T cells by reducing CD28 expression in these cells. The invention discloses a number of compounds that can be used to reduce CD28 expression in T cells.

The invention relates to the discovery that a decrease in CD28 expression in T cells may interfere with antigen-specific activation of T cells. The invention can be utilized by providing a variety of methods useful for treating diseases caused by the immune system. This treatment is performed with CD28-targeted oligomers and non-oligomeric compounds that reduce CD28 expression. By taking advantage of the discoveries of biological effects that have a reduced expression of CD28, as described herein, a number of methods useful for treating diseases caused by the immune system are provided. These methods can utilize non-oligomeric compounds that have not been synthesized or purified hitherto.

One aspect of the invention relates to oligomers that can be used to inhibit the expression of certain genes. Established technique using positive ^,, antisense oligonucleotides is often referred to as anti-sense therapy. There are a number of publications dealing with the generation and use of anti-sense genes. Examples of such publications are: Stein et al., Science, 261, 1004-1012, 1993; Milligan et al., J. Med. Chem., 36: 1923-1937, 1993; Helene et al., J. Biochem. Biophys. Acta, 1049: 99-125, 1990, Wagner, Nature, 372: 333-335, 1994, and Crooke and Lebleu, Anti-sense Research and Applications, CRC Press, Boca Raton, 1993. The term anti-sense means, if not in other words, oligomers (including oligonucleotides) capable of forming either double-stranded or triplex-stranded helices with polynucleotides so as to affect gene expression. The principles of the design and use of the anti-sense technique described in these publications or other similar publications may be used by those skilled in the art to design, prepare and use the various CD28-specific oligomers of the invention.

The oligomers of the invention are capable of modulating the expression of the CD28 gene. Oligomers of the invention include those oligomers that are capable of forming double-stranded polynucleotide helices by hybridizing to the CD28 gene transcripts (or portions thereof), or capable of forming double-stranded polynucleotide helices by hybridizing with the portion or portions of the CD28 gene, wherein the formation of these helices may take place under intracellular conditions. Oligomers of the invention may also include oligomers that are capable of influencing the regulation of gene expression by acting as molecular decoys and preventing protein-nucleic acid interactions in which transcription factors participate in the regulatory elements (sequences) of the non-translated regions of the CD28 gene. In addition, oligomers of the invention may include those oligomers that are capable of forming triple-stranded polynucleotide helices with a portion or portions of the CD28 gene, which may be produced under intracellular conditions. One of ordinary skill in the art is aware of the base-to-base relationships of nucleic acids in both double-stranded and triple-stranded helices (e.g., adenine-thymine, cytosine-guanine, uracil-thymine), and this knowledge of base pairing principles can be used to design oligomers of the invention. Regions of the CD28 gene or transcripts of the CD28 gene in which double- or triple-stranded helices may be formed with the respective oligomer of the invention are said to be targeted to those regions.

The human CD28 molecule is a homodimeric transmembrane glycoprotein with a molecular weight of 90 kDa present on the surface of a T cell subpopulation. The CD28 molecule is present on the surface of most CD4 T cells and on the surface of approximately 50% of the CD8 + T cells. The DNA sequence encoding human CD28 has been determined and can be found, inter alia, in Lee et al., Journal of Immunology, 145: 344-352, 1990, and in publicly available gene databases such as GenBank. The human CD28 gene consists of four exons, each of which encodes a functional domain of a predicted protein. It has been found that transcription of the human CD28 gene results in products of different sizes. Oligomers of the invention can be designed using either the published nucleotide sequences of the CD28 gene or using cDNA sequences derived from the CD28 gene. The compositions and methods of the invention can be readily modified for use in non-human mammals by utilizing the CD28 gene sequences obtained from non-human mammals. CD28 gene sequences from non-human mammals can be obtained, inter alia, using CD28 gene sequences obtained previously from humans (or other mammals), the previously obtained sequences being used as hybridization probes for gene libraries and / or or as primers for amplification by PCR (polymerase chain reaction). It is believed that the published nucleotide sequences of the CD28 gene are accurate (as is true), but one skilled in the art may use the information of the invention even where the published nucleotide base sequences of the CD28 gene contain sequence errors. Errors in the published nucleotide base sequences can be detected, inter alia, by repeated sequencing of regions of the CD28 gene (or CD28 gene transcripts) targeted by the oligonucleotides of the invention. Repeated sequencing can be performed using conventional sequencing methods.

Preferably, the oligomers of the invention consist of about 11 to 50 basic nucleic acid units. One of skill in the art can readily estimate that the oligomers of the invention may be substantially longer than 50 basic nucleic acid units. In a more preferred embodiment of the invention, the oligomers of the invention consist of about 8 to 25 basic nucleic acid units, in an even more preferred embodiment of the invention about 14 to 22 basic nucleic acid units. The size limitation of the oligomers of the invention in preferred embodiments of the invention relates only to those oligomers that are intended to be administered into the extracellular space of cells and do not apply to CD28-specific oligomers produced intracellularly, for example oligomers produced by vectors used for genetic manipulation of target host cells.

The oligonucleotides of the invention may comprise a number of different nucleic acid base sequences. The oligomers of the invention may be selected to reduce CD28 expression by hybridization (by nucleic acid-nucleic acid interaction) with almost any CD28 transcript region of the CD28 gene to reduce CD28 expression, or to reduce CD28 expression by hybridization (by hybridization). nucleic acid-protein interactions) with non-nucleic acid molecules that recognize the untranslated sequences of the CD28 gene. For example, the oligomers of the invention may be selected to be able to hybridize to the translated CD28 gene transcript regions, the untranslated CD28 gene transcript regions, the uncut CD28 gene transcript regions, the CD28 gene introns, the CD28 gene promoter sequences, the regulatory sequences of the CD28 gene. CD28, cap 'at the 5' end of the transcript of the CD28 gene, coding regions of the CD28 gene, and the like (including combinations of discrete regions separated from each other). In preferred embodiments of the invention, the oligomers of the invention are directed to the translational and / or transcriptional initiation regions of the CD28 gene (or transcripts thereof). By altering the site in the CD28 gene or in the CD28 gene transcript at which helix formation may occur and which is achieved by appropriate selection of the nucleic acid base sequence in the oligomer, changes in the activity (efficacy) of the oligomer can be achieved, i. that the amount of oligonucleotides required to produce the desired biological effects may be altered. In preferred embodiments of the invention, the oligomers of the invention have the greatest potency. The potency of the various oligomers of the invention can be determined by a variety of in vitro assays well known to those skilled in the art. Examples of such assays are set forth in the experimental section of this patent application. It will be appreciated by those skilled in the art that it is not desirable to produce oligomers that target polynucleotide sequences also present in regions of genes other than the CD28 gene. For example, it would not be desirable to create an oligomer directed to the Alu sequence present in the 5 'untranslated region of the CD28 gene transcript (the Alu region of the CD28 gene is described in Lee et al., Journal of Immunology, 145: 344-352, 1990). The use of oligomers that produce double-stranded or triple-stranded helices with genes other than the CD28 gene or transcripts of genes other than the transcripts of the CD28 gene can be minimized by screening for polynucleotide sequences homologous to the nucleotide sequence of the oligomer. Polynucleotide sequences can be found in publicly available databases such as the GenBank database.

In a preferred embodiment of the invention, the oligomers of the present invention show perfect complementarity of the nucleic acid bases to the selected target sequence, i.e. each nucleic acid base in the oligomer can be paired with a second (or third) base of the nucleic acid on another double (or three-) helix. However, one of ordinary skill in the art will understand that various oligomers specifically targeted to the CD28 gene and / or capable of inhibiting CD28 expression may have nucleotide base sequences that lack perfect complementarity when hybridized to the CD28 gene (any chain), the CD28 gene transcripts, or regulatory proteins. CD28 specific.

In preferred embodiments of the invention, the oligomers of the invention are those having the following nucleotide base sequences:

5 ' TTGTCCTGACGATGGGCTA 3 ' (sequences id. No .: D RT01 5 ' AGCAGCCTGAGCATCTTTGT 3 ' (sequence id. No .: 2) RT02 5 ' TTGGAGGGGGTGGTGGGG 3 ' (sequence id. No .: 3) RT03 5 ' GGGTTGGAGGGGGTGGTGGGG 3 ' (sequence id. No .: 4) RT04

In particularly preferred embodiments of the invention, the oligomers having nucleotide base sequences designated RT01, RT02, RT03 and RT04 are phosphothioates. Particularly preferred oligomers are phosphothioate-3'-hydroxypropylamines as described by Tam et al., Nucl. Acid. Res., 22: 977-986,

1994th

The oligomers of the invention can be designed to reduce CD28 expression in T cells that internalized the oligomers of the invention added to these cells extracellularly. In addition, the oligomers of the invention may be designed to reduce CD28 expression when these oligomers are produced intracellularly by expression vectors.

Inhibition of CD28 expression can be achieved by (i) interfering with the transcription process of the CD28 gene, (ii) interfering with the translation process of the transcripts of the CD28 gene, (iii) interfering with the process of transcription of the CD28 gene transcripts or any combination of (i) (ii) and (iii).

The exact degree and mechanism of interference with CD28 expression will depend on factors such as the structure of the oligomer, the nucleotide base sequence of the oligomer, the dose of the oligomer, the manner of administration of the oligomer, and the like.

The term oligomer refers to both naturally occurring oligonucleotides, such as DNA, RNA, and various artificially created analogs of naturally occurring nucleic acids that have the ability to create either double-stranded or triple-stranded 17 helices with DNA or RNA. Many oligomers, which are artificial analogs of naturally occurring polynucleotides, have properties that are preferred over DNA or RNA for use in the methods of the invention. Such properties include higher affinity for DNA / RNA, endonuclease resistance, exonuclease resistance, lipid solubility, RNAase H activation ability, and the like. For example, improved lipid solubility and / or nuclease cleavage resistance results from the substitution of an oxygen atom present in an internucleotide phosphodiester bond by an alkyl or alkyloxy group. This substitution results in the formation of alkylphosphonate or alkylphosphotriester oligonucleotides. Nonionic oligomers, such as the above-mentioned oligomers, are characterized by increased resistance to nuclease hydrolysis and / or increased cell uptake, while maintaining the ability to form stable complexes with complementary nucleic acid sequences.

While a number of oligomers that are naturally occurring nucleic acid analogs are explicitly described in this patent application and / or known to those skilled in the art from other sources, it will be appreciated that many oligomers that are nucleic acid analogues may be prepared in the future and that these nucleic acid analogs can be engineered by those skilled in the art to inhibit expression of CD28 genes. Below is a brief review of the various currently available DNA / RNA analogs that can be used as oligomers of the invention, provided that a suitable nucleic acid base sequence is used to target the CD28 genes (and transcripts of these genes). ). The various oligomers described in these publications are exemplary, but not limiting, of the various possible embodiments of the oligomers that can be modified in the methods and compositions of the invention to inhibit CD28 expression. Methylphosphonate (and other alkylphosphonate) oligomers can be prepared by a variety of methods both in solutions and on insoluble polymeric carriers (Agrawal and Fiftina, Nucl. Acids Res., 6: 3009-3024, 1979, Miller et al., Biochemistry, 18: 5134 Miller et al., J. Biol. Chem., 255: 9659-9665, 1980; Miller et al., Nucl. Acids Res., 11: 6225-6242, 1983; Miller et al., Biochemistry, 25: 1986: 5092-5097, Sinha et al., Tetrahedron Lett., 24: 877-880, 1983; Dorman et al. Tetrahedron, 40: 95-102, 1984; Eger and Engels, Tetrahedron Lett., 1984: 25: 1437-1440. , Noble et al., Nucl. Acids Res., 12: 3387-3404, 1984, Callahan et al., Proc.

Acad. Sci. USA, 83: 1617-1621, 1986, Koziolkiewicz et al., Chemica Scripta, 26: 251-260, 1986; Agrawal and Goodchild, Tetrahedron Lett., 38: 3539-3542, 1987; Lesnikowski et al., Tetrahedron Lett., 28 : 5535-5388, Sarin et al., 1987, Proc. Natl. Acad. Sci. USA, 85: 7448-7451 (1988).

Other oligoribonucleotide analogs for use as oligomers are described in Inova et al., Nucleic Acid Res., 15: 6131, 1987 (2'-O-methylribonucleotides), Inova et al., FEBS Lett., 215: 327, 1987.

A description of a process for the preparation and use of phosphothioates and phosphodithioates can be found, inter alia, in the following publications: U.S. Pat. No. 5,292,875, U.S. Pat. No. 5,286,717, U.S. Pat. No. 5,276,019, U.S. Pat. No. 5,246,423, U.S. Pat. No. 5,218,103, U.S. Pat. No. 5,194,428, U.S. Pat. No. 5,183,885, U.S. Pat. No. 5,166,387, U.S. Pat. No. 5,151,510, U.S. Pat. No. 5,120,846, U.S. Pat. U.S. Pat. No. 4,814,451, U.S. Pat. No. 4,096,210, U.S. Pat. No. 4,094,873, U.S. Pat. No. 4,092,312, U.S. Pat. No. 4,026,225, U.S. Pat. No. 4,007,197, U.S. Pat. U.S. Patent No. 3,972,887; No. 3,917,621 and U.S. Pat. 3907815, Dagle et al., Nucl. Acids Res., 18: 4751-4757,

1990, Loke et al., Proc. Natl. Acad. Sci. USA, 86: 3474-

3478, 1989, La Planche et al., Nucleic Acid Res., 14: 9081, 1986 and Stec et al., J. Am. Chem. Soc., 106: 6077, 1984 and Stein et al., Nucl. Acids. Res., 16: 3209-3221, 1988.

A description of the process for preparing and utilizing phosphoamidates can be found, inter alia, in the following publications: Agrawal et al., Proc. Natl. Acad. Sci. USA, 85: 7079-7083, 1988; Dagle et al., Nucl. Acids Res., 18 (6): 4751-4757, 1990; Dagle et al., Nucl. Acids Res., 19 (8): 1805-1810, 1991.

Other useful polynucleotide analogs include compounds whose backbone is composed of acetals or thioacetals. A description of the preparation and use of these compounds can be found, inter alia, in the following publications: Gao et al., Biochemistry, 31: 6228-6236, 1992, Quaedflieg et al., Tetrahedron Lett., 33 (21): 3081-3084, 1992, Jones et al., J. Org. Che., 58: 2983-2991, 1993.

Other useful polynucleotide analogs include compounds wherein the backbone is silyl and silyloxy bridges. A description of the preparation and utilization of these compounds can be found, inter alia, in Ogilvie and Cormier, Tetrahedron Lett., 26 (35): 4159-4162, 1985, Cormier and Oglivie, Nucl. Acids. Res., 16 (10): 4583-4594, 1988, PCT Publication WO 94/06811.

Other useful polynucleotide analogs include compounds in which the backbone is silyl and acetamidate bridges. Descriptions of methods for preparing and utilizing these compounds can be found, inter alia, in Gait et al., J. Chem. Soc., Perkin Trans. 1: 1684, 1974; Mungall and Kaiser, J. Org. Chem., 42 (4): 703-706, 1977 and Coull et al., Tetrahedron

Lett., 28 (7): 745-748, 1987.

Polynucleotide analogues whose backbone is derived from morpholine have also been described. A description of a method for preparing and utilizing these nucleotide analogs can be found, inter alia, in U.S. Patent Nos. 5034506, 5235033, 5034506 and 5185444.

Polynucleotide analogs having a wide variety of amine, peptide and other non-chiral and / or neutral bonds have been described: Culfield et al., Bioorganic and Medicinal Chem. Lett., 4 (3): 395-398, 1994, Angew. Chem. Int. Ed. Engl.

33 (2): 226-229, 1994;

No. 5,166,315 and U.S. Patent No. 5,141,047.

Polynucleotides having thioether linkages or other sulfur linkages between the units are described, inter alia, in Schneider and Brenner, Tetrahedron Lett., 31 (3): 335-388,

1990, Huang et al., J. Org. Chem., 56: 3869-3882, 1991, Musicki and Widlanski, Tetrahedron Lett., 32 (10): 1267-1270,

1991, Huang and Widlanski, Tetrahedron Lett., 33 (19): 2657-2660, 1992; Reynolds et al., J. Org. Chem., 57: 2983-2985,

1992 and PCT publication WO 91/15500.

Other useful analogs include peptide nucleic acids (PNA) and related polynucleotide analogs. A description of a method of preparing and utilizing peptide nucleic acids can be found, inter alia, in Buchardt et al., Trends in Biotech., 11) 1993 and in PCT publication WO 93/12129.

Other polynucleotides that can be used for anti-sense inhibition have been described in Thuong et al., Proc. Natl. Acad. Sci. USA, 84: 5129-5133, 1987; U.S. Patent No. 5,217,866 to Lamond, Biochem. Soc. Transactions, 21: 1-8,

1993 (2'-O-alkyloligoribonucleotides), Ono et al.,

Bioconjugate Chemistry, 4: 499-508 (1993)

2-deoxyuridine bearing at the β-position of deoxyribose an amino group linker), Kawasai et al., J. Med. Chem., 36: 831-841, 1993 (2'-deoxy-2'-fluoro phosphothioate oligonucleotides), PCT publication WO 93/23570, Augustyns et al., Nucl. Acids Res., 21 (20): 4670-4676, 1993.

In addition, the oligomers may be further modified to increase the stability of the duplexes and / or to increase their uptake by the cells. Examples of such modifications can be found in PCT publication WO 93/24507 entitled Conformationally Restrained Oligomer Containing Amide or Carbamate Linkages for Seguence Specific Binding, Nielsen et al., Science, 254: 1497-

1500, 1991, PCT publication WO 92/05186 entitled Modified Internucleoside Linkages, PCT publication WO 91/06629 filed

On Oct. 24, 1990 and U.S. Pat. No. 5,246,562 filed April 24, 1991, collectively entitled Oligonucleotide Analogs with Novel Linkages, PCT Publication WO 91/13080 entitled Pseudonucleosides and Pseudonucleotides and their Polymers, PCT Publication WO 91/06556 entitled 2'-modified Oligonucleotides, PCT WO 90/15065 filed June 5, 1990 entitled Exonuclease Resistant Oligonucleotides and Methods for Preparing the Same ”and U.S. Patent No. 5,256,775.

The oligomers of the invention contain a wide variety of nucleic acid bases. In addition to nucleic acid bases naturally occurring in DNA or SNA, for example, cytosine, adenine, guanine, timidine, uracil and hypoxanthin, the oligomers of the invention may comprise one or more nucleic acid bases which are synthetic analogs of naturally occurring nucleotide bases. Such non-naturally occurring heterocyclic bases include not only the pyrimidine analog base and dease, the purine analog base and the base, as well as other heterocyclic base analogues in which one or more carbon atoms or one or more nitrogen atoms present in the purine or pyrimidine ring have been replaced by a heteroatom. , for example, oxygen, sulfur, selenium, phosphorus and the like. Preferred bases are those bases that can be incorporated into a single strand of double-stranded polynucleotides such that they are capable of pairing with naturally occurring bases present on the complementary strand of a double-stranded polynucleotide.

The invention discloses a variety of methods useful for treating a variety of immune disorders. The term treatment or treatment, in connection with the disease, means both preventing and alleviating the symptoms of the disease that are already observable in the patient (individual). It will be appreciated by those skilled in the art that treatment may not be fully effective in preventing disease outbreaks or relieving the symptoms associated with the disease. Any alleviation of the intensity of symptoms, delaying the onset of symptoms, or delaying the progression of the symptom intensity is desirable for the patient. Immune disorders that can be treated by the methods of the invention include diseases in which undesired idiopathic effects are caused or to which T cells expressing CD28 on their surface contribute. Inhibition of CD28 expression results in a decrease in the production of cytokines normally produced by activated CD28 ¹ T cells. These cytokines include interleukin-2, interferon and interleukin-8. The methods of the invention include, but are not limited to, methods useful for treating diseases in which pathogenesis is due to interleukin-2, interferon interleukin-8, or a combination thereof, wherein the T-cell mediated immune response is disrupted or decreased. Examples of immune disorders that can be treated by administering the oligomers of the invention are transplant rejection, septic shock, cancer-induced clustering, and a number of autoimmune diseases. Autoimmune diseases that can be treated by administering the oligomers of the invention include diseases caused by T cell activation, including type I diabetes (insulin-dependent), thyroiditis, sarcoidosis, multiple sclerosis, ulcerative uveitis, aplastic anemia, systemic lupus erythromatosus, rheumatoid arthritis, inflammation and granuloma formation caused by parasites, Crohn's disease, psoriasis, polymyositis (acute muscular inflammation), dermatomyositis, scleroderma, vasculitis (vascular inflammation), psoriasis arthritis, gravastitis, myasthenia, diseases of the hepatobiliary system and the like. In addition, the methods and compositions of the invention provide tools for the treatment of a variety of syndromes, including septic shock and cancer-induced clustering, in which the pathogenic effects are caused at least in part by lymphokines secreted by activated CD28 * T cells.

The methods of the invention useful for treating diseases include the steps of administering to a patient an effective amount of the oligomers of the invention. The exact dose, i. the effective amount of CD28-specific oligomer to be administered to a patient will vary from case to case depending on a number of factors such as the nature of the disease being treated, the nature of the oligomer (s) in the therapeutic compositions, the age and condition of the patient, and the like. Methods for determining suitable pharmaceutical dosages are well known to those skilled in the art and can be found, inter alia, in Remington, Pharmaceutical Science (latest edition), Mack Publishing Company, Easton, Pa. and so on.

In addition to the direct administration of CD28-targeted oligomers to a patient, the invention also relates to methods of treatment in which CD28 ⁺ cells (or cells that can potentially express CD28) are taken from the patient (with or without other cells) and transformed with one or more different cells. oligomers of the invention. Transformation may be accomplished by any of a variety of procedures well known to those skilled in the art, for example by electroporation, using cationic lipids such as DOTMA or DOSPA and the like. The transformed cells can then be returned to the body.

Another aspect of the invention describes methods useful for treating immune diseases by administering CD28-specific oligomers, wherein the oligomers are produced intracellularly using recombinant polynucleotide expression vectors.

CD28-specific oligomers produced intracellularly must necessarily be DNA or RNA molecules. Recombinant polynucleotide vectors used to express the desired polynucleotide sequences are well known to molecular biologists. Detailed descriptions of recombinant vectors useful for expressing the desired polynucleotides can be found, inter alia, in Somatic Gene Therapy, ed. Chang L. P., CRC Press, Boca Raton, 1995, R. c. Mulligan, Science, 260: 926-932, 1993; F. W. Anderson, Science, 256: 808-

873, 1992, Culver et al., Hum. Gen. Ther., 2: 107-109, 1991 and the like. Suitable recombinant vectors useful in the methods of the invention for the treatment of immune diseases by genetic engineering are either capable of integrating into the T cell genome or are capable of replicating in the T cell cytoplasm. Preferably, the CD28-specific oligomers used in intracellular administration are substantially longer than the CD28-specific oligomers used in extracellular administration. In a preferred embodiment of the methods (which are the subject of the invention) of the intracellular administration of CD28, the CD28-specific oligomer is complementary to one or more whole transcripts of the CD28 gene or the entire CD28 gene. However, suitable CD28-specific oligomers produced intracellularly may be substantially shorter. In contrast to CD28-specific oligomers administered extracellularly, CD28-specific oligomers produced intracellularly do not have problems with intracellular uptake or hydrolysis by extracellular enzymes.

Methods for using CD28-specific intracellular oligomers may include administering recombinant vectors encoding CD28-specific oligomers directly to the patient. Another possibility is to administer vectors encoding CD28-specific oligomers directly into cells obtained from the patient (i.e., stem cells, T-cells, whole blood, bone marrow, etc.) to generate transformed cells. The transformed cells can then be returned to the body.

The invention also provides expression vectors capable of expressing one or more oligomers of the invention. Such expression vectors generally comprise, in a functional embodiment, a promoter and a polynucleotide sequence encoding an oligomer capable of inhibiting expression of the CD28 molecule in T cells. Although a variety of promoters may be used in the vectors of the invention, preferred promoters are capable of providing a high level of expression in T cells. The expression vectors of the invention may also contain various regulatory sequences. Currently available expression vectors, particularly expression vectors explicitly designed for gene therapy, can be readily engineered to express CD28-targeted oligomers of the invention. Vectors can be engineered to express CD28-targeted oligomers using conventional genetic engineering techniques such as described in Sambrook et al., Molecular Cloning, Second Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1989.

Another aspect of the invention describes pharmaceutical compositions useful for administering the oligomers of the invention so as to be effective in treating diseases caused by the immune system. These pharmaceutical compositions can be readily prepared by those skilled in the art of pharmacy. Such compositions comprise one or more oligomers of the invention. However, in embodiments of the invention that comprise a plurality of different types of oligomers, the oligomers are preferably selected such that they are not capable of hybridizing to one another. For pharmaceutical administration, the pharmaceutical compositions of the invention may be formulated in a variety of forms suitable for each mode of administration, including administration of oral, intravenous, intramuscular, intraperitoneal, topical, and the like. The pharmaceutical compositions of the invention may contain, in addition to one or more oligomers of the invention, one or more biologically inactive compounds, i. excipients such as stabilizing agents (to allow long-term storage), emulsifying agents, binders, thickeners, salts, preservatives and the like.

Pharmaceutical compositions for parenteral administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other suitable additives. The pharmaceutical compositions of the invention may be designed to promote cellular uptake of oligomers present in the compositions. For example, the oligomers may be encapsulated in suitable liposomes.

Pharmaceutical compositions for topical administration are particularly useful in localized treatment. Combination positions for topical treatment include ointments, sprays, gels, suspensions, lotions, creams and the like. Compositions intended for topical administration may contain, in addition to the oligomers of the invention, known carriers such as isopropanol, glycerol, paraffin oil, esters of alcohol and stearic acid, polyethylene glycol, etc. Pharmaceutically acceptable carriers may also include known chemical absorption promoters. Examples of absorption promoters are, for example, dimethylacetamide (U.S. Patent No. 3472931), trichloroethanol and trifluoroethanol (U.S. Patent No. 3891757), certain alcohols and mixtures thereof (U.S. Patent No. 1001949), and British Patent No. 1464975.

In addition to the therapeutic utility of the oligomers of the invention, these oligomers can also be used as analytical tools to study T cell activation. In addition to the CD28 molecule and the antigen-specific T cell receptor, T cells have several surface receptors. In studying the biological properties of individual receptors, difficulties arise with respect to the potential and actual interactions between individual receptor signaling pathways. By providing a mechanism useful for reducing CD28 expression in T cells, oligomers and methods of the invention also provide useful laboratory methods to study T cell behavior that is independent of the CD28 receptor mediated activation pathway.

The invention will be further described in the following examples. These examples are given for the purpose of illustrating the invention in detail and should not be construed as limiting its use.

DETAILED DESCRIPTION OF THE INVENTION 1

01igonukleotidy

Oligonucleotides were synthesized on an automated DNA synthesizer (Applied Biosystems, model 394) using standard procedures using phosphoamidity -cyanoethylphosphono27 midites, synthetic reagents and polystyrene coated CPG columns were purchased from Applied Biosystems (ABI, Foster City, CA). 3'-AminoModifier C3 CPG columns were purchased from Glen Research (Sterling, VA). For the synthesis of phosphorothioate oligonucleotides, the standard oxidation flask was replaced with a tetraethylthiuram disulfide / acetonitrile flask, and the standard phosphorothioate ABI phosphorothioate program was used to sequentially add the individual units linked by the phosphorothioate linkage. After cleavage from a column of defined pore diameter (CPG-controlled pore glass), the protecting groups from the oligonucleotides were removed by treatment with concentrated ammonium hydroxide at 55 ° C for 8 hours. Oligonucleotides were purified by HPLC using a C8 reverse phase semi-preparative column (ABI). After cleavage of the DMT protecting group, treatment with 80% acetic acid and ethanol precipitation, the purity of the resulting product was determined by HPLC using a C18 analytical column (Beckamn, Fullerton, CA). All oligonucleotides with a purity of> 90% were freeze-dried. Oligonucleotides were then dissolved in sterile deionized water (ICN, Costa Mesa), adjusted to 400 μΜ (concentration determined by OD 260 nm), aliquoted and stored at -20 ° C before use. In all cases at least three batches of each oligonucleotide listed in Table 1 were used.

m

ad

TH

XI

Eh

»0 r * about n c4 m 00 > 1 c4 rh r ~ r ~ - ad > N > N > N HSL xn *with- (0 (0 Π1 D > σι TT 00 00 N 00 ABOUT m m

in n

ιβ

Λ

O νβ>

ABOUT

A

0) • H

U £

E

ABOUT

1-4

U c

0) ž

at

OT jj

S ot4

I • rl

P in W 01 01 01 <a id 10 R-1 r4 R-1 £ and X) 0 0 0 VO within VO C C C (Q s 10 Ό Ό • σ (0 10 10 rd at Go up ι-1 ad ABOUT tA M Q) < <U dl M h and C and and dl '0 ψ d) C at C C 0 1 » and x and m

crj σ) fcj ie rH CN n'T (4 s g i g g

EV B Ό Ό 3 ABOUT tt « P au O-C tt it P au • O-C WITH and Ό • d • rl C • d e • d β • d P U Ό p a P 10 P 0 0 0 0 N O N 0 dl tt £ dl vo tt VO tt rh rh within d Λ d ja id Are you Are you C M ad ad 3 3 3 n 3 (Q 3 C C m C 3 B 0 0 0 c O C 0 θ ' θ ' e θ 'tt θ 'tt θ ' D • rl rl • d rd • d rd • d rh R-1 P id rd ι-1 0 0 0 0 Ί · O ď 0 ď Ά >> l 0) 3 r-10 ABOUT > IEH ABOUT ΆΕη about ΆΕ < C H C N Ad-d c from B 06 B Pd r-10 r-10 3 U H id id 0 Ei O ti C C 0 (0 o e O 10 M Pd M 06 O 0 P P P P P »> p n P n P OT C tt C tt • d Si C P B O B O O h 0 M rd tt ⁰ É! 0 EH O Eh x a m a o n Si 06 Ad 06 Ad 06

m

OT

OT

OT

OT

OT kO σι

H H gm mm

M m

mg gg

rh (N OT ιΠ 10 ι-1 CN n in ABOUT ABOUT ABOUT about about about ABOUT Ej ABOUT Ej about Ej ABOUT Ej g g y B £ Pd 06 Pd Pd Pd Pd 06 with Pd with

ABOUT

0 C ad VO rd 0 cn D rd ABOUT e about Ό E (0 (36 3 ABOUT D about B tt > ad tt U 3 ABOUT > B B «R» ad VO Ό ABOUT 0) £ ul > VO B ABOUT > 1 B n X in ca H <D the P H B Ό C and d) • rd (0 • H (ABOUT P P Se * about tt P tt tt r4 B • d B ad > □ > 3 vd 10 vd C P • H P ABOUT • d P (0 θ ' N about θ ' • H 0 ► tt i-1 and P B about W and cn about cn (36

Ό ί *

Μ • ω

Ν

r- within m r ~ CM rM «r ABOUT m ω CM CM R-1 04 (Ώ Γ- ABOUT kD kD kD σι • H 04 WHAT η within kD r * σι r * > N > N • C4 > N KM > f4 KM KM > CM KM <0 (0 (0 (Q (Q (Q ra ra the the 00 r- VO n CM m i-4 kD σι r- about σι m rM d) and 't r * R + CH 04 n n m kD r- σι r *

about n about and kD ABOUT and about rh IFL m rh kD 00 WHAT about • ^ r within about σι about r4 r4 r4 σι 1-¼ T and r4 «Η f- KM KM KM KM > 04 > N KM ra ra ra 'CM the »CM (Q ra <a ra ra σ \ σι kD m m n and n C kD σ \ 04 r * 03 ABOUT about c4 r * ABOUT CM n « σι F-i r4 ^ 4 T-4 ^ ¼ r- 1

• ο λ;

0 (0

Ε-ι υ

α (0 ί-Η)

Ο>

Ο

Α

0) • υ υ

£

J <υ

OT> 6

Υβ • Η υ

c αι>

χ

(a) η

• σ • Η

4J

Ο

0)

I

P IN IN IN «4 n n and at n 10 01 01 (0 and 10 (0 10 10 it ι-1 H H R-1 H r4 H 43 43 43 43 43 43 43 ABOUT ABOUT ABOUT ABOUT ABOUT 0 ABOUT in in IN IN 3J ’I v IN P 0) U) m oi U) 1 m 40 40 40 40 40 U 40 it 40 and io and id (0 ® (0 C C C C C 10 C 10 C r4 r4 <-i R-1 R-4 H 10 <0 10 m id Ή 10 R-1 10 I 4) and 43 43 • S Λ Ό Ό Ό Ό Ό • 9 * 3 43 Ό about 0 about ABOUT ABOUT o O C and and and 10 n O 10 ABOUT 10 S2 S2 Ό rh r4 r4 rh H R-1 rh 5 5 n) (0 m β 10 S 10 Ό X X X X X O X (0 X <! X U at at U at 5 u ABOUT 0) a) Q) at OJ U <U at αι »3 '2 »3 '3 > 3 • 3 »3 X > 4 h h M M > 3 M '3 h C C -about r ~ i n TI • n I? and and, and and and n o, • m and Ό Ό 3 3 3 3 3 2 3 and and a> 0) about 0) 3 tu 3 ABOUT) Ό Ό U Ό Ό Ό Ό S Ό 0 C C C C C Ό C σ C ABOUT ABOUT Ό Ό ABOUT Ό Ό Ό »o + » % 1 1 % % Ό i Ό X x X X X X X * M n n n n n n X n x ui

 ejm ^ tfjvor-aooiOr-itMm ^ Pinior'aoai-lr-lr4i-lr4fHMrHCSlCMfMCMCMCSlCMCMCM £ M

8S3g ^ ⁸ äg8 g S5 § 3 8 S eJ 8 i5 e * t * o <u $ δ

Eh £ S ň O 8

Q «O and y u

3 t * H in

O g

□ § g š

8 e- ä!

u u 8 8 8 ÉKOr * oocJiOrH <Mm ΟΟΟΟι · 4γΗγ4> —J._ _ _ ^ m * ω-co <nor4CM (n 04 C4 04 04 oligonucleotide Seq ID No Seq Type Target region Residues no.

RT24 AGT GGG TGG ATC ATT TGA GG 5 'untranslated region of 30 to -244 _and -225 F

RT25 TGC TTG AAA AGC AGA AG 31 AS 5'interleaved area -139 to -120

0 cn cn CM Ή * CM n σι r i-4 • * 4 r- 1 1 1 1 > (4 1 > N > N n> Q 10 RS (Q rh 03 03 03 ABOUT C rh lf) MT WHAT 1 CM 1 lf) 1 rh 1 rh 1 No. :> > · > · 44 IN 44 44 44 IN 10 in (U Q) 0) e and Q it R-L MO 43 M0 MO MO C 0 C C C 43 43 43 43 ABOUT M0 ABOUT and ABOUT Ό C Ό Ό Ό ABOUT and ABOUT ABOUT 0 and Ό and and and and 10 rh e 10 RS • H 44 • rl • H • H at e about ABOUT □ C H M C rM C H C rM 0) 1 and Φ 1 <u 1 Φ | > and e > and > and > and 44 < C 44 «4 44 44 ABOUT 1 Q) T ABOUT <D X 10 m and n and (0 and U and

CQ Cu ta ta <E- E-> Eh

CM n

m co n m

I!

I U g

WHAT P- 00 ABOUT) 0 CM CM CM CM n Eh E Eh Eh and and and and and

0) «1 c

in ra • H> 1

X

In r4

Q * • H h

4-) • H

O (0

M h

about

FROM

Vi b <H

Cell lines and T-cell purification

Peripheral blood mononuclear cells (PBMCs) were isolated from a mixture of leukocytes (buffy coat of white blood cells obtained by blood centrifugation) obtained from 60 ml of blood obtained from healthy donors isolated by Ficoll-Hypague density gradient centrifugation. The T cells were subsequently separated from the PBMCs using Lymphokwik T cell-specific lymphocyte isolation reagent (LK-25T, One Lambda, Canoga Park, CA). 40 to 60 x 106

T cells (mean of yield) were then incubated overnight pri37 ^and C in 20-30 ml RPMI-AP5 (RPMI-1640 medium (ICN ,, Costa Mesa, CA) containing 20 μΜ HEPES, pH 7.4, 5 % autologous plasma, 1% L-glutamine, 1% penicillin / streptomycin and 0.05% 2-mercaptoethanol). The purpose of this incubation was to remove contaminating adhered cells. In all experiments, T cells were washed with RPMI-AP5 medium and then seeded in 96-well microtiter plates at a total concentration of 2 x 3 x 10 6 cells / ml.

T-cell lymphoma cell lines, Jurkat E6-1 cells (CD28- / CD4-, 152-TIB) and HUT78 cells (CD28- / CD4-, TIB-162) (ATCC, Rockville, MD) were cultured in RPMI medium. -10 (RPMI-1640 medium containing 20 μΜ HEPES, pH 7.4, 10% fetal calf serum (FCS-fetal calf serum, Hyclone, Logan, UT), 1% L-glutamine and 1% penicillin / streptomycin).

Mitogen-mediated T-cell activation and oligonucleotide action

Prior to the addition of human peripheral T cells or T cell lymphoma cell lines (0.2-0.3 x 10 6), 96 well microtiter plates (in duplicate) were coated with purified anti-CD3-targeted monoclonal antibody (6.25-200 ng / well). (HIT 3a clone, Pharmingen, San Diego, CA) and washed twice with cold phosphate-buffered saline pH 7.4 (PBS-phosphate-buffered saline). T cells exposed to CD3-targeted monoclonal antibody were subsequently activated by the addition of 2 ng of mitogen 12-myristate 13-acetate phorbol (PMA) (Calbiochem, La Jolla, CA) and incubated at 37 ° C for 48 hours. T-cells activated with a monoclonal antibody directed against CD3 / PMA were immediately exposed to oligonucleotides at concentrations ranging from 1 to 20 μΜ specifically targeted to CD28 and controls, immediately after activation and 24 hours thereafter. T cells from the first plates (original) were used for immunofluorescence analysis and the second plates (duplicate) were used to analyze T-cell proliferation.

Immunofluorescence studies

After activation, 150 ml of the cell supernatant from the first plates (original) was transferred to another microtiter plate for the determination of cytokine production by the cells. The remaining cells were washed twice with isotonic saline at pH

7.4 (Becton Dickinson, Mansfield, MA), suspended in 50 ml isotonic saline and divided into two samples. One aliquot was labeled with either the PE-CD28 / FITC-CD4 fluorescent marker pair or the PE-CD54 / FITC-CD25 fluorescent marker pair and non-specific fluorescence was determined by labeling the second aliquot with an isotope-matched control monoclonal antibody labeled PE / FITC. All fluorescent labeled monoclonal antibodies were obtained from Becton Dickinson (San Jose, CA). Incubations were performed using saturating concentrations of mAh (monoclonal antibody) for 45 minutes at 4 ° C in the dark. Prior to proper analysis on a FACScan flow cytometer (Becton Dickinson), unbound label was removed by washing the sample with PBS. The density of individual antigens in gated live cells was determined indirectly and expressed as mean channel of fluorescence (MCF). Surface expression of specific antigens (CD54, CD25) was expressed as a change in fluorescence intensity (MCS-mean channel shift) obtained by subtracting MCF cells labeled with isotope-matched (IgG1) control monoclonal antibody labeled with FITC or PE fluorescent markers from MCF cells labeled with monoclonal antibodies specifically targeted given antigen-labeled FITC or PE fluorescent markers. Similarly, surface expression in a subpopulation of CD28-labeled ^4- cells labeled with anti-CD28 mAbs was determined by subtracting MCF CD28 "CD4" cells from MCF CD4 * CD28 * cells. The viability of cells obtained from several donors exposed to oligonucleotides and controls (without addition of oligonucleotides) was determined for each batch of all oligonucleotides by propidium iodide staining (viable cell dye, final concentration 5 gg / ml). The percentage of viable cells in which propidium iodide did not penetrate inside the cell was determined by flow cytometry and, after exposure of the cells to all batches of all oligonucleotides, at a dose range of 1 to 20 μΜ,> 90% (range 90 to 99%,

Figure 2).

Cytokine analysis

Concentrations of human cytokines produced by the cells were determined in supernatants from the first (original) microtiter plates. Mitogen-induced changes in interleukin-2 (IL-2) levels were determined using commercially available ELISA kits (R and D systems Quantikine kit, Minneapolis, MN) or bioassays were performed using the IL-2-dependent CTLL-2 cell line (ATCC, Rockville, MD). Mitogen-induced changes in interferon / α and interleukin-8 (IL.8) levels were determined using a commercially available ELISA kit from Endogen (Cambridge, MA, determination of interferon f or ELISA kit from R and D systems (Quantikine kit, Minneapolis) , MN, interleukin-8 assay) All results obtained by ELISA were expressed in pg / ml and the results obtained by CTLL-2 cell bioassay were expressed as counts per minute, representing the incorporation of 3H-thymidine (ICN, Costa Mesa, CA) by CTLL-2 cells.

Determination of T-cell proliferation

The second (duplicate) microtiter plates were used in all experiments to analyze mitogen-induced changes in T-cell proliferation. 72 hours after cell activation with a monoclonal antibody directed against CD3 / PMA in or in the absence of oligonucleotides, 3H-thymidine (ICN, Costa Mesa, CA) with 1 gCi activity was added to the cells and incubated overnight at 37 ° C. Mitogen-induced cell growth, determined as the amount of radiolabel incorporated, was determined after counting the cells for Wallac Betaplate counting pulses (Wallac, Gaithersburg, MD).

Inhibition of CD28 expression in activated T cells by CD28-specific oligonucleotides

CD3 / PMA targeting monoclonal antibody increased CD28 receptor surface expression in human T cells (measured by fluorescence analysis) from MCS 122.7, 74 in quiescent T cells to MCS 150 9.27 (n = 9). The difference in expression of CD28 molecules on the surface of quiescent T cells and activated T cells is defined as mitogen-induced CD28 expression (Figure 3A). Figures 3A and 3B depict the results of experiments in which T cells (from two donors) activated with a monoclonal antibody directed against CD3 / PMA were exposed to phosphothioate (referred to as S-oligomers, Figure 3B) and phosphothioate-3 'amine ( labeled as A-oligomers; Figure 3C) Forms of control oligonucleotides and CD28-specific oligonucleotides using two different batches of each oligonucleotide. Of the four RT01 to RT04 oligonucleotides (Table 1), the most active inhibitors of CD28 expression (mitogen-induced) were shown to be in the range of 2 to 10 μΜ, the phosphothioate and phosphothioate-3 'amine forms of RT03 and RT04 oligonucleotides. , inhibited induced CD28 expression by more than% (IC 50). These two oligonucleotides, which differ in length, were designed to hybridize to a region of double-stranded DNA upstream of the CD28 gene initiation codon. No similar inhibition (dose-dependent) of mitogen-induced CD28 expression was observed when using control oligonucleotides RTC01 (SEQ ID NO: 5) to RTC06 (SEQ ID NO: 10) (Table 1). All experiments were performed with at least three batches of each oligonucleotide using T cells obtained from seven donors. The fact that human T-cells have been shown to regulate CD28 expression is critical because dermal and epidermal T-lymphocytes are intended to be targets for CD28-specific oligonucleotides.

Inhibition of Mitogen-Induced T-Cell Proliferation by CD28-Specific Oligonucleotides

The mitogenic action of a monoclonal antibody directed against CD3 / PMA was demonstrated by the acceleration of proliferation observed after T-cell activation at rest. For activated cells, 3 H-thymidine incorporation, expressed as counts per minute, was 301641 47856 (n - 9) and for T cells at rest, 650 566 (n = 9). The effects of the monoclonal antibody directed against CD3 and PMA on T-cell proliferation are synergistic, as shown in Figure 4A. Figure 4B shows a representative experiment in which the effects of phosphothioate oligonucleotides, both control and CD28 specific, on T cell proliferation induced by a monoclonal antibody directed against CD3 / PMA were determined. In at least seven separate experiments, all conducted at a dose range of 2 to 10 μΜ, both phosphothioate (data not shown) and phosphothioate-3'amine (Figure 4B) were the most active monoclonal antibody-induced T-cell proliferation inhibitors targeting CD3 / PMA and inhibited T cell proliferation by up to 40%. Using similar control oligonucleotides RTC01 (SEQ ID NO: 5) to RTC06 (SEQ ID NO: 10) (Table 1), no similar (dose-dependent) inhibition of T cell proliferation induced by a monoclonal antibody directed against CD3 was observed / PMA. Here, the action of CD28-specific oligonucleotides (RT03 and RT04 oligonucleotides) was able to stop hyperproliferation of activated T cells, and it was also shown that the regulation of the CD28 activated signaling pathway has a very significant effect on one of the vital biological functions in T cell activation. for T cell proliferation.

Inhibition of activated T-cell cytokine production by CD28-specific oligonucleotides

Activated T cells produce a number of immunomodulatory cytokines including IL-2, interferon τ and IL-8. Presence has been demonstrated in the promoter and IL-8 inducible has been shown that these IL-2 and IL-8 gene sequence sequences for IL-2 by CD28 and consequently the restriction elements are regulated by the CD28 activated signaling pathway (Fraser et al., Science, 251: 313-316 (1991; Seder et al., J. Exp. Med., 179: 299-304, 1994). Interferon has also been shown to be regulated by the CD28 activated signaling pathway (Wechsler et al., J. Immunol., 153: 2515-2523, 1994). When quiescent T cells are exposed to a monoclonal antibody directed against CD3 / PMA, there will be a dramatic increase in the level of all three cytokines produced by these T cells (Figures 5A, 6A and 7A). Figures 5, 6 and 7 show the effects of phosphothioate (B) and phosphothioate-3 'amine forms of CD28-specific oligonucleotides and of control for the production of IL-2, interferon fa and IL-8 in activated T-cells obtained from the same representative donors . Mitogen-induced production of IL-2, interferon pa and IL-8 in activated T-cells, was inhibited by CD28 (concentration-dependent concentration-dependent) oligonucleotides RT03 (SEQ ID NO: 3) and RT04 (SEQ ID NO: 4). ) but was not inhibited by the control oligonucleotides RTC01 (SEQ ID NO: 5) to RTC06 (SEQ ID NO: 10) (data not shown). Both phosphothioate (IC50 5 μΜ) and phosphothioate-3'amine (IC50 10 μΜ) forms of CD28-specific oligonucleotides were equally active over a concentration range of 2 to 10 μΜ. Similar results for all three cytokines were observed in 4 or more different donors. These observations demonstrate that CD28-specific oligonucleotides were also able to regulate the number of effector molecules involved in T cell activation by the CD28-activated signaling pathway.

Specificity of inhibition of CD28 expression by oligonucleotides

The specificity of CD28-specific RT03 and RT04 oligonucleotides was determined using three methods.

(1) CD28-independent T-cell activation markers

The first method was used to determine if these CD28-specific oligonucleotides were able to inhibit the expression of other T-cell activation markers that function independently of the costimulatory signaling pathway of activated CD28. Following activation of T cells at quiescent state, both IL-2 receptor (CD25) and the intercellular adhesion molecule ICAM-1 (CD54) are significantly enhanced. However, both of these helper molecules are regulated independently of the signaling pathway activated by CD28 (June et al., Mol. Cell. Biol., 7: 4472-4481, 1987, Damle et al., J. Immunol., 149: 2541, 1992).

Figure 8 shows the effects of CD28-specific oligonucleotides and oligonucleotides controlling CD25 expression (Figure 8A) and CD54 (Figure 8B) in mitogen-activated T cells. After exposure of activated T cells to both CD28-specific oligonucleotides and control oligonucleotides (in the concentration range of 2 to 10 μΜ), no significant decrease in expression of both CD25 and CD54 was observed in these cells. This clearly demonstrates the existence of the specificity of oligonucleotides specific for

CD28 in inhibiting their target protein.

(2) HUT 78 T cell line, CD28 negative

The second oligonucleotide signaling pathway method was used to determine if activated CD28 was indeed a CD28 specific target, compared to mitogen-induced IL-2 production in the Jurkat E6-1 leukemia T cell line and the CD28 T cell lymphoma line. HUT 78 cells. Figure 9A confirms the absence of CD28 expression in both quiescent and activated T-cells, but activation of Jurkat E6-1 cells increases the level of constitutive expression of CD28 (Figure 9B). In CD28 * Jurkat E6-1 cells, CD28-specific oligonucleotides (but not control oligonucleotides) were able to inhibit mitogen-induced CD28 expression (Figure 9C) and also were able to inhibit mitogen-induced IL-2 production (Figure 10B). In contrast, in CD28 "HUT 78 cells, mitogen-induced IL-2 production was unaffected by either CD28-specific oligonucleotides or control oligonucleotides (Figure 10A). This clearly demonstrates the existence of the specificity of these oligonucleotides to inhibit only CD28-regulated IL-2 production.

(3) Specific activation of the CD28 activated signaling pathway

The aim of the third method was to activate T cells at quiescence specifically via the CD28 activated signaling pathway using a monoclonal antibody directed against CD28 in combination with mitogens using the same protocols used to activate T cells by mitogens alone. It has previously been shown that a CD28-targeted mAb, in combination with PMA or in combination with a CD3-targeted mAb, provides a costimulatory signal to T cells at rest and induces only CD28-dependent (but not TCR-dependent) enhancement of T- cells and cytokine production (June et al., Mol. Cell. Biol., 7: 4472-4481, 1987). Phosphothioate and phosphothioate-3 'amine forms of CD28-specific oligonucleotides (but not control oligonucleotides) were able to inhibit T-cell proliferation as well as IL-2, interferon-7 production in quiescent T-cells activated by a monoclonal antibody directed against CD28 / mitogen. and CD28 dependent IL-8 (data not shown). This clearly shows that only CD28-specific oligonucleotides only act on the signaling pathway activated by CD28 T cell activation.

DETAILED DESCRIPTION OF THE INVENTION 2

oligonucleotides

Oligonucleotides were synthesized using an Applied Biosystems 394 DNA synthesizer.

In order to introduce phosphorothioate linkages, the oxidizing agent vessel used as standard was replaced with a tetraethylthioramide disulfide / acetonitrile vessel. The purity of the oligonucleotides was determined by analytical HPLC. All oligonucleotides with a purity greater than 90% were freeze-dried and dissolved in water (400 μΜ). At least three batches of each oligonucleotide listed in Tables 3 and 5 were used. The polynucleotide kinase T4 and ³³ Ρ-τΑΤΡ were used to mark the 5 'end of the oligonucleotides.

T cell activation study

Peripheral blood circulation mononuclear cells (PBMCs) were isolated from healthy donors by density gradient centrifugation followed by T-cell enrichment of the obtained fraction using Lymphokwik (One Lambda).

Contaminating monocytes were removed by utilizing their adherence to plastic. Purified T cells were> 99% CD2 *, <1% HLA-DR * and <5% CD25 *, Jurkat E6-1 (CD28 * / CD4 *) T cells and HUT78 (CD28 "/ CD4 *) T- lymphocytes and monocytic cell line

THPs were obtained from ATCC. Cells were cultured at a concentration of 0.2 to 0.3 x 10 * cells per well and were activated with immobilized anti-CD3 monoclonal antibody (HIT3A 0.25 pg / ml, Pharmigen) and 2 ng phorbol-12-myristate-13-acetate (PMA). , Calbiochem).

Immunofluorescence studies

Cells were stained with monoclonal antibodies labeled with a pair of fluorescent markers of either PE-CD28 / FITC-CD24 or PE-CD54 / FITC-CD25, or control antibodies with the same IgG _x isotope (Becton Dickinson). The density of cell surface antigens (CD28, CD54, CD25) was confirmed by flow cytometry (FACScan, Becton Dickinson). Viability was determined from impermeability to propldium chloride (5 µg / ml) in both untreated and treated CD4? Cells from several donors. This viability was typically greater than 90% (ranging from 90 to 99%) after 48 hours incubation with 1 to 10 μΜ with each of the oligonucleotides.

Determination of proliferation and cytokine production

Proliferative responses were measured by incorporating ³ H-thymidine (1 µCi, ICN) over the last 16 hours of each assay. The cells were then transferred to filters and DNA synthesis and scintillation counting measured on a pulse counter.

Wallac Betaplate. the supernatants were IL-8 (R&D System) assay (ATCC).

Cytokine concentrations in culture determined by ELISA kit for IL-2, and IFN β (Endogen) or biological IL-2 dependent cell line CTLL-1

RT-PCR and Southern blot analysis

Total cellular RNA was isolated with Trizol reagent (Gibco / BRL). Oligonucleotide primers (dT) _xs and reverse transcriptase AMV (HC) were used to synthesize the cDNA strand (Promega). 50 μΐ PCR reaction mixture (GeneAmp PCR kit,

Perkin-Elmer Cetus) consisted of 3 μΐ cDNA, dNTP mixtures containing 200 μΜ each, 0.5 μΜ each of the primers and one Taq polymerase unit.

The following primers were used:

CD28, 5'-CTGCTCTTGGCTCTCAACTT-3 '(anti-sense, positive) and 5'-AAGCTATAGCAAGCCAGGAC-3' (sense, negative), p55 α-chain primers for interleukin 2 (Stratagene) and ribosomal pHE7 gene, see Kao , HT, Nevins, JR (1983) Mol. Cell. Biol. 3, pages 2058 to 2065.

The reaction conditions were as follows: 45 seconds at 94 ° C, 1 minute at 57 ° C and 2 minutes at 72 ° C. The total number of cycles was 35. Finally, the reaction mixture was incubated at 72 ° C for 8 minutes. The PCR products were resolved by 2% agarose gel electrophoresis, transferred to a Hybond N + membrane (Amersham) in 20xSSC buffers. Transfer was performed overnight. The transferred DNA was then immobilized with 0.4 M NaOH. The blots were then hybridized with oligonucleotide probes labeled with ^3α P-rATP. After washing, the blots were analyzed using a Phosphorlager.

Testing of MLR and alloantigen specific T cells

To test the MLR response, PBMCs were cultured at a ratio of 1: 1 together with PBMCs treated with mitomicin C (50 µg / ml) from an individual with heterogeneous HLA. For testing of alloantigen-specific T cells, cultured T cells were isolated from PBMCs of healthy donors activated by tetanus toxoid. These lymphocytes were cultured 1: 1 with autologous PBMC cells treated with mitomicin C in the presence of tetanus toxoid (2 μΐ / ml, List Biologicals). Both assays were cultured ^with 2xlO cells per well for 6 days at 37 ^e C. The cells were then transferred for further analysis.

In vitro stability of oligonucleotides

Determination of the stability of temporary oligonucleotides was performed according to Tam, R. C., Li, Y., Noonberg, S., Hwang, D. G., Hunt, C. A., Garovoy, M. R. (1994), Nucleic Acids Res. 22, pages 977-986. The degradation profiles of these oligonucleotides were measured electrophoretically and then quantified using Nickspin columns.

Inhibition of CD28 expression by phosphothioate oligonucleotides is specific and affects the function of activated T cells

Figure 11 includes the effect of the phosphothioate oligonucleotides of Table 3 on surface expression of helper molecules and on cytokine secretion by activated T cells. The oligonucleotides used were designed to hybridize to the 5 'untranslated region of the CD28 gene and be either positive (AS, anti-sense) or rich in G-pairs. Control oligomers were either negative (SS, sense strand) or complementary sequences (CS). Resting T-lymphocytes were incubated for 48 hours with anti-CD-3 and PMA, increasing expression of helper molecules (Ac) CD28 (A), CD25 (B) and CD54 (C) and cytokines IL-2 (D), IFN t (E) and IL-8 (F). Data are presented as standard deviation from triplicate. The cumulative effect of two doses (at 0 and 24 h) of 2 μΜ (|), 5 μΜ ι (Π) and 10 μΜ (ΡΠ) of the phosphothioate oligonucleotides according to Table 3 on activated T-lymphocyte function was determined by immunofluorescence analysis (complementary molecules); determination of secreted cytokines by bioassay of CTLL-2 (IL-2) and by ELISA (IFN 7, IL-8). The surface antigen density (MCS) in living CD4 * cells was measured from the increase in fluorescence in the middle channels relative to IgG _x controls. IL-2 dependent cellular incorporation of ³ H-thymidine was measured by decay per minute (cpm), while immunoreactive IFN 7 and IL-8 were expressed in pg / ml. The data shown relates to experiments with T cells derived from a single donor. These experiments represent a representative selection of data obtained in τ-lymphocyte experiments from 9 different donors.

Table 3 Phosphothioate oligonucleotides

Id. no.

oligo Sequences (from 5 'to 3') description sequence RT01S TTGTGGTGAGGATGGGCIA AS5'UT79-97 42 RT02S AGCAGCCTGAGCATCiTiGT AS5'OT94-113 43 RT03S TTGGAGGGGGIGGTGGGG G-bchacýS'GT53-75 44 RT04S GGGTTGGAGGGGGTGGTGGGG G-fcohacýS'UT53-78 45 RTC01S TAGCCCATCGTCAGGACAA SS to RT01 46 RTC02S ACAAAGATGCTCAGGCTGCT SS to RT02 47 RTC06S AACCTCCCCCÄCCACCCC CS to RTO3 48

The data demonstrates that selected phosphothioate oligonucleotides (see Table 3) can specifically block activation-induced expression of CD28 in CD4 + T cells. In representative donor cells (see Figure 11), expression by activation of induced CD28 glycoprotein was inhibited, but no longer by expression of IL-2 receptor (CD25) or intracellular adhesive molecule 1 (ICAM-1 or CD54). Phosphothioate oligonucleotides RT03S (SEQ ID NO.

44) and RT04S (SEQ ID NO. 45). IC 50 was below 5 μ 5. In contrast, the antisense oligonucleotides RT01S (SEQ ID NO: 42) or RT02S (SEQ ID NO: 43) or control oligomers, RTCO1S (SEQ ID NO: 46), RTCO2S (SEQ ID NO: 47) and TCO6S (SEQ ID NO: 48) did not show similar inhibition. Furthermore, evidence was obtained that active oligomers modulated activation-induced expression of CD28 by blocking transcription in activated human T cells. At a concentration of 10 μΜ, the oligonucleotides RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 2) were reduced.

45) expression of activation-induced CD28, but did not reduce IL-2 receptor mRNA concentrations. The representative control oligonucleotide RTCO6S (SEQ ID NO: 48) was not capable of such reduction (see Figure 12).

Figure 12 shows the effect of 10 μΜ phosphothioate oligonucleotides on CD28 and CD25 mRNA concentrations. Concentration of resting (curve 1) and anti-CD3 / PMA activation (6h) induced mRNA for CD28 and CD25 in the absence (curve 2) or in the presence of single oligonucleotides (RT03S - curve 4, RTC06 - curve 6) were determined by RT -PCR of total cellular RNA and Southern blot with specific radioactive probes. The CD28 probe was derived from the second exon (5'ACGGGGTTC AACTGTGATGGGAAATTGGGCAA-3 ') and the IL-2 receptor probe prepared from the original primer mix. RNA from CD28 deficient HUT (7) and THP (8) cell lines was used as a control. The data shown represent 3 independent experiments.

The results indicated that specific inhibition of CD28 mRNA concentration by biologically active phosphothioates is concomitant with their effect on CD28 surface proteins. In addition, the active oligomers were able to abrogate those T-cell functions that were induced by activation. Such an effect had the oligomers RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) but not the oligonucleotides RT01S (SEQ ID NO: 42) or RT02S (SEQ ID NO: 43). or control oligomers RTCO1S (SEQ ID NO: 46), RTCO2S (SEQ ID NO: 47), and RTCO6S (SEQ ID NO: 48). These oligomers also significantly inhibit the synthesis of IL-2, IFN f, and IL-8 induced by anti-CD3 and PMA antibodies (IC50 is less than or equal to 5 μΜ, range 2 to 10 μΜ, Figure 11).

Since there are co-stimulatory pathways inducing lymphokine synthesis in T-lymphocytes (see Damle, NK, Klussman, K., Linsley, PS, Aruffo, A. (1992) J. Immunol. 148, 1985-1992) , it was important to determine whether the biological activity of the RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) oligomers is limited to CD28 expression only. Therefore, the effect of phosphothioates on IL-2 production induced by anti-CD3 / PMA antibodies in the 0028 ^-1- leukemia T-cell lineage, Jurkat E6-1, and the CD28-lymphoma T-cell HUT 78 was compared. that after 48 hours treatment of resting cells (R) with anti-CD3 and PMA antibodies, Jurkat cells (A, right) show overexpression of CD28 proteins (Ac). Conversely, there is no increase in HUT 78 cells (A, left). However, activation increased IL-2 production in both Jurkat cells (C, right) and HUT 78 cells (D, left). Active oligonucleotides RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) at concentrations of 1 μΜ (Q), μΜ (B), 5 μΜ (EI) and 10 μΜ (Π) inhibit the expression of CD28 (B) and secreted IL-2 (C, right) concentrations in activated Jurkat cells but had no effect on CD28-independent IL-2 secretion in activated HUT 78 cells (D, right). The data presented represent three independent experiments.

From Figure 13A, the absence of CD28 expression in both resting and activated HUT 78 cells is confirmed immunocytofluorometrically, while a significant increase in CD28 concentration is visible in Jurkat E6-1 cells upon activation. Furthermore, it is evident that the RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) oligonucleotides at concentrations of 1 to 10 μΜ significantly inhibit both the expression of the activation-induced CD28 glucoprotein (Figure 13B) and production. IL-2 (Figure 13C). In contrast, activated HUT 78 cells, although producing a comparable amount of IL-2, show no similar inhibition by these oligonucleotides (Figure 13D).

It has also been shown that T cell activation (CD28, IL-2, IL-8 and IFN? Expression) induced by a specific anti-CD 28 monoclonal antibody together with an anti-CD3 antibody is blocked by biologically active oligonucleotides (data not shown). Direct linking of CD28 molecules is known to induce only CD-28 dependent and never TCR-dependent enhancement of T cell proliferation and cytokine production, see June, c.

H., Ledbetter, J.A., Gillespie, M.M., Lindstein, T., Thompson, C. B. (1987) Mol. Cell. Biol. 7, pp. 4472-4481. From these and our data, the biological activity of active oligomers in T cells is specifically targeted against the CD28 activation pathway.

Inhibition of T-cell proliferative response in testing of alloantigen-dependent T-cells and determination of primary allogeneic mixed lymphocyte population using phosphothioate oligonucleotides

Furthermore, the efficacy of CD28 pathway-specific oligonucleotides (RT03S, SEQ ID NO: 44 and RT04S, SEQ ID NO: 45) in blocking the antigen-specific primary immune response in vitro was compared. Figure 14 shows resting (A, B) and activated (E, F) concentrations of CD28 in a T-cell specific tetanus toxoid response assay (upper, A and B) and mixed lymphocyte population responses (lower, E and F) ). The percentage of CD4 · *, CD28hi cells is indicated in Figures A, B, E and F at the right marker. Oligomer activity was determined after two additions of phosphothioate oligonucleotides according to Table 1. Additions were made at 0 and 96 hours and were 1 μΜ (□ b 2 μΜ (H), 5 μΜ (Fl) and 10 μΜ (0) ^. These additions were determined to reduce the percentage of CD28 (C, G) -expressing T cells and the proliferation of activated T lymphocytes using tetanus toxoid induction (top) or T-cell stimulation (X) by PBMC stimulating cells. (Y) treated with mitomicin-C. The data are representative of three independent experiments.

In Figure 14, where both the tetanus toxoid assay (14B) and the mixed lymphocyte population (14F) reaction are utilized, the behavior of the T cell subpopulation that upon activation expressed a large amount of CD28 after 6 days of testing was observed. Addition of 2 to 10 μΜ of the RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) oligonucleotides reduced CD28 expression, see Figures 14C and 14G, and a corresponding decrease in tetanus-specific T cell proliferation toxoid (Figure 14D), respectively, with antigen specificity (Figure 14H). Similar effect after addition of RT01S oligonucleotide (SEQ ID NO: 42) or control oligonucleotides RTCO1S (SEQ ID NO: 46), RTCO2S (SEQ ID NO: 47) or RTCO6S (SEQ ID NO: 42).

48) was not observed.

In vitro stability of oligonucleotides prolongs the biological activity of phosphothioate oligonucleotides

Modification of oligonucleotides by phosphothioate internucleotide linkages can confer resistance to nuclease action and thereby prolong their biological activity in vitro from 1-2 hours to 24 hours, see Stein, CA, Cheng, YC (1993) Science 261, pages 1004-1012. Table 4 shows the effect of the phosphorothioate oligonucleotides RT03S (SEQ ID NO: 44) and RTCO6S (SEQ ID NO: 48) on the expression of the CD28 surface antigen by removing oligonucleotides from day 2 (D). The assay was performed by immunocytofluorometry. The results are expressed as the difference in surface antigen expression in activated T cells (MCF ^), and activated T cells treated with bioactive oligonucleotides (MCF _x). CD28 antigen expression ranged from 191 to 121 on resting T-lymphocytes on days 2-4. The ND mark indicates that no significant difference was measured.

presence (C) or after extracellular environment

Table 4: Time course of phosphothioate oligonucleotide activity after continuous and discontinuous treatment

Differential expression of CD28 antigen (MCF _and -MCF _x )

RT03S (SEQ ID NO RTCO6S 44) SEQ ID NO 47)

Day MCF A 0 5 10 0 5 10 2 144.8 18.4 8.9 9.3 1.9 1.7 ND 3 C 135.6 21.9 15.9 5.1 ND ND 3.2 3 D 136.8 18.3 11.8 7.1 1.7 3.8 1 4 C 128.9 18.2 9.7 6.1 ND ND ND 4 D 130.1 2.3 ND ND ND ND ND

Table 4 demonstrates that the duration of action of RT03S (SEQ ID NO: 44) exceeded 24 hours and the effect was still visible on days 2, 3 and 4 relative to the initial dose of oligonucleotide. However, after removal of the RT03S oligonucleotide (SEQ ID NO: 44) from the extracellular environment during the second day, its inhibitory activity was maintained after 24 hours and then completely disappeared within the next 24 hours. No activity was observed at the same time in a representative control oligonucleotide RTCO6S (SEQ ID NO: 48). A similar phenomenon was observed in inhibiting the proliferation of activated T-lymphocytes caused by oligonucleotides (data not shown). However, the increased availability due to the phosphothioate modification cannot explain in itself the significantly increased biological activity of RT03S oligonucleotide (SEQ ID NO: 44). Therefore, the prolongation of the effect was shown to be due to an increase in stability in vitro due to the altered secondary structure of the RT03S oligonucleotide (SEQ ID NO: 44).

Figure 15 summarizes the results of the in vitro stability assays of ^3α -labeled phosphorothioates RT03S (SEQ ID NO: 44) and RTCO6S (SEQ ID NO: 48) in extracellular supernatants (top) and Jurkat cell lysates (bottom) section). The time dependence of degradation (A) of individual oligonucleotides (2000 cpm) over 96 hours was determined after electrophoretic separation on a 20% denaturing polyacrylamide gel using a Phosphorimager. The percentage of intact, non-truncated oligonucleotides ^3a P-RT03S (SEQ ID NO: 44) (o) and ^3a P-RTC06S (SEQ ID NO: 48) (·) at each time point were determined from eluates from samples (10,000 cpm) of extracellular supernatants and cell lysates, respectively, applied to Nickspin columns (Pharmacia). At the same time, molecular weight standards (Std), ^3α β-dNTP (N) and free ^3α β-orthophosphates (β) were analyzed.

Figure 15A shows electrophoretograms clearly indicating that both in extracellular supernatants (S) and in cell lysates (L), after 96 hours incubation in Jurkat cells, there is a significantly higher amount of intact ³³ P-labeled RT03S oligonucleotide (SEQ ID NO. than control RTC06S (SEQ ID NO: 48). The results from the Nickspin columns are also consistent with these results (Figure 15B). The percentage of intact oligonucleotide RT03S (SEQ ID NO: 44) after a 96 hour incubation was 54% (S) and 59% (L), respectively, while the percentage of intact control oligonucleotide RTCO6S (SEQ ID NO: 48) was 10% (S) and 34% (L). It appears that even the secondary structure itself cannot be considered as a major cause of increased nuclease resistance and long duration of RT03S oligonucleotide biological activity (SEQ ID NO: 44), since its phosphodiester counterpart RT03D has very little biological activity and in vitro stability measurement results indicate a half-life of 24 hours (data not shown).

Table 5: Identification of the oligonucleotide sequences responsible for inhibiting the expression of CD28 antigen and this expression-dependent production of IL-2.

T

I »

Relative inhibition of expression

oligo sequence CD28 IL-2 Id. no. sequence RL03S (D) TTG GAG GGG 100 (3) 100 (44) 44 (49) RTT11S GGG GAG GAG GGS C'G SA 100 100 50 RT04S GGG TTG GAG GGG 123 100 45 ΕΓ053 SC GAG GGG 136 100 52nd RT09S TTG GAG GGG 126 100 52 hxios TIG GAG GQ5 31 38 53 RT24S TIG GAG CCG 40 57 54 RT25S TTG GAG GGG CIC CTC QGG 44 25 5 = RT23S TIG GHG CCS GIG GTG_ £ 38 57 55 RT18S GGG GTG úTď GGS 103 120 57 RT19S G GGG TTG GGG 30 89 58 RTCQ7S TC? SOS 2 2 55 RTCOSS G GGG 2 2 60 RT20S CAC TCC GGS®G G3C TGS GG the 76 6i RT21S ATG GGG TGC ACA AAC TG3 GG Are you 63 62 RT1SS AAC GTT GAG GGG OT 26 52 63 RT06S TTC CAG CCC 29 22 64 RTC06S AAC CTC CCC 4 2 48

The in vitro activity of the phosphothioate oligonucleotides in Table 5 was determined from their ability to inhibit CD28 antigen expression in activated human peripheral T cells. These lymphocytes were activated with anti-CD3 / PMA antibody. Their effect on IL-2 production in Jurkat T lymphocytes was also measured. Results are expressed relative to the effect of 5 μΜ RT03S (SEQ ID NO: 44). This oligonucleotide inhibited CD28 expression by 52-79% and IL-2 production by 76-89% over 7 experiments. Values for the phosphodiester equivalent of RT03D (SEQ ID NO: 49) are shown in brackets.

Identification of minimal sequence that causes biological activity in vitro

The active phosphorothioate oligonucleotide RT03S (SEQ ID NO: 44) is an 18-mer originally designed to hybridize to the 5 'untranslated region of the human CD28 gene and its sequence.

I comprises two sections consisting of four consecutive gvanidines. In order to reveal critical factors for inhibiting activating-induced CD28 expression in human T cells and derived IL-2 production in Jurkat T cells, individual bases were selectively added, removed or substituted from RT03S oligonucleotide, and relative activity relative to the original activity was measured. oligonucleotide (see Table 5). The addition of three G's at the 5 'end (RT04S) after A (SEQ ID NO: 51), RT09S (SEQ ID NO: 52)) did not reduce the inhibitory effect with respect to RT03S (SEQ ID NO: 44). Interestingly, the positive (anti-sense) sequence (RT11S (SEQ ID NO: 50)) also exhibited an unchanged inhibitory effect. However, deletion or replacement of one or more gvanins with cytosine in any of the four-fold RT10S repeats

RT24S (SEQ ID NO: 54), RT25S

RT23S (SEQ ID NO: 56) resulted in a significant loss of activity relative to the original oligonucleotide RT03S. Deletion of six residues at the 5 'end from the first quadruple or quadruple, or in the region between the two multiple T exchanges, quadruple G (RT05S (SEQ ID NO.

Again, G in oligonucleotide RT03S had no effect on the inhibitory activity of RT18S oligonucleotide (SEQ ID NO: 57). In contrast, reducing the number of RT19S (SEQ ID NO: 58) or, conversely, adding nucleotides RT20S (SEQ ID NO: 61), RT21S (SEQ ID NO: 62) between both quadruple gvanidines dramatically reduced the inhibitory activity of these nucleotides. TGGGG, GGGG, or sequences containing 4 consecutive Gs as RT15S (SEQ ID NO: 63) have little or no inhibitory effect compared to the oligonucleotide RT03S (SEQ ID NO: 44). These effect and biological activity data are a sequential motif consisting of two quadruple guanidines separated by 3-5 nucleotide residues.

show that inhibitory bound to specific

With regard to inducing tolerance due to CD28 antigen disruption (see Boussiotis, V.A., Freeman, G.J., Gray,

G., Gribben, J., Nadier, L. M. (1993) J. Exp. Med. 178, pages 1753 to 1763), it is important to determine whether oligonucleotides caused by inhibition of CD28 antigen expression is a more effective strategy for inducing T cell anergy and alloantigenic tolerance in vitro. Phosphothioate oligomers RT03S (SEQ ID NO: 44) and RT04S have been shown to inhibit expression of CD28 antigen induced in human CD4 * T cells by anti-CD3 / PMA antibodies. This inhibition reduces both the mRNA and the finished protein in a dose-dependent manner. In addition, the effect of oligonucleotides on the IL-2 receptor and expression of ICAM-1 was studied to demonstrate target specificity. These two are known to be regulated independently of the CD28 pathway (see Damle, NK, et al., (1992) J. Immunol. 148, 1985-1992, June, CH et al., (1987) Mol. Cell. Biol., 7, pp. 4472-441, Stein, CA, et al., (1993) Science 261, pp. 1004-1012, Boussiotis, VA, et al., (1993) J. Exp. Med. Accordingly, the activated concentration of mRNA or CD25 proteins in the surface expression of CD54 was not affected in cells after oligonucleotide treatment.

Co-stimulation via the CD28 receptor pathway directly induces the expression of immunomodulatory cytokines such as IL-2, IFN and IL-8 in activated T cells (see Fraser, JD, et al., (1991) Science 251, 313-316, Jenkins, MK, et al., (1991) J. Immunol 147, pages 2461-2466, Seder, RA, et al., (1994) J. Exp Med 179, pages 299-304, Wechsler,

A.S., et al., (1994) J. Immunol 153, 2515-2523). For tolerogenicity to be sufficient, active CD-28 specific oligonucleotides must abolish this function. Administration of active oligonucleotides results in concomitant modulation of actively induced production of IL-2, IFN f, and IL-8. The unique specificity of the oligonucleotides used was confirmed by their inability to block activation-induced IL-2 production in the CD28 deficient HUT 78 cell line. Further evidence is that the maximum suppression rate of IL-8 production caused by activated oligonucleotides according to the invention does not exceed 50%. evidence of yet another CD28 independent regulatory pathway that is maintained. Oligomer activity is not limited to polyclonal activated T lymphocytes, since inhibition of activating-induced C028 antigen expression resulted in dramatic suppression of cell proliferation in specific assays with both MLR and tetanus toxoid. Accordingly, the active oligonucleotides of the invention induce alloantigen specific tolerance in vitro and are thus a promising alternative for a ligand-capture strategy to induce reduced T-cell sensitivity, similar to that of CTLA4 Ig, which is known for high affinity binding to B7 ( see Tan, P., Anasetti, C., Hansen, JA, Melrose, J., Brunvand, M., Bradshaw, J., Ledbetter, JA, Linsley, PS (1993) J. Exp. to 173).

While determining the potency of the active pharmacophore, it was observed that the RT03S oligonucleotide (SEQ ID NO: 44) showed a surprisingly durable inhibition of both expression of CD28 antigen in activated cells and inhibition of the respective cell proliferation. This inhibitory effect was observed for 96 h after oligonucleotide treatment. Biological activity is not directly associated with toxicity, since after the removal of the oligonucleotide after 53 complete inhibition activity disappeared within 24 hours. Further, in vitro stability of RT03S (SEQ ID NO: 44) and RTC06S (SEQ ID NO: 48), it was found that the secondary structure of RT03S given by two G-rich sequences increases two to four times the nuclease resistance in compared to other known phosphothioate oligonucleotides, see Stein, CA, Cheng, YC (1993) Science 261, pages 1004-1012. The other half life (96 hr) of 32P-RT03S correlates with the duration of biological activity. In contrast, the phosphodiester analog of the RT03S oligonucleotide oligomer RT03D exhibited both reduced in vitro stability and biological activity. This observation is in accordance with known literature, see Maltese, J. Y., Sharma, H.W., Vassilev, L., Narayanan, R. (1995) Nucleic Acids Res. 23, pages 1146 to 1151. It follows that the contribution of a stable secondary structure is not in itself responsible for the increased biological activity of the RT03S oligonucleotide (SEQ ID NO: 44). Stability against nuclease activity due to both secondary structure and phosphothioate modification is likely to cause long-term inhibitory activity of RT03S (SEQ ID NO: 44).

Replacement of a single base pair in hybridization-dependent, antisense, and antigenic models can result in an overall loss of activity, see Maltese, JY, Sharma, HW, Vassilev, L., Narayanan, R. (1995) Nucleic Acids Res. 23, pages 1146 to 1151. In contrast, the activity of CD28 specific oligomers was dramatically reduced only by a sequential change in the region of both quadruple gvanidines, suggesting that the function of the oligonucleotide is rather due to its structure. Furthermore, after cationic stabilization with 100 mM KCl or NaCl, the secondary structure of the RT03S oligonucleotide in the melting curve was found to exhibit a transition (data not shown) characteristic of the formation of the G-quartet. See Hardin, CC, Watson, T., Corregan, M., Bailey, C., (1992) Biochemistry 31, pp. 833-841. Overall, our data support the hypothesis that CD28 pathway-specific oligonucleotides of the invention work through a hybridization-independent mechanism, and that the secondary structure of the oligomer is highly predetermined by its secondary structure. , probably the formation of a G-quartet. Similarly, Bennett, CF, Chiang, MY, Wilson-Lingardo, L., Wyatt, JR (1994), Nucleic Acids Res. 22, pages 3202 to 3209 show that the activity of their phosphothioate oligomers is based on the possible formation of G-quartets in sequences containing two sets of consecutive three or more gvanidines. Suggest that the regulation of the oligonucleotide of human phospholipase _{A, and} responsible interaction of nucleic acid-protein.

The ability to specifically recognize proteins by a G-quartet-containing structure has been described in telomeres, centromere (see Blackuburn, EH (1990) J. Biol. Chem. 265, 5919-5921), immunoglobulin switch regions, see Shimizu, A., Honjo, T. (1984) Cell 36, pages 801-803) and in the class of regulatory oligomers called aptamers (see Bock, LC, Griffin, LC, Latham, JA, Vermaas, EH, Toole, JJ (1992). Nature 355, page Huizenga, DE Szostak, JW (1995) Biochemistry 34, pp. 656-655, Hergan, R., Connell, Y., Fahmy, B., Kyle, E., Neckers, L. (1994) Nucleic Acids Res., 22, 2150-2154). In our experiments, the expression of CD28 was relatively weakly inhibited by oligomers capable of forming an intermolecular quadruple G-quartet structure derived from several quadruple gvanidines similar to telomeres (see Smith, FW, Feigon, J. (1992) Nature 356, pages 164-167) ). An example of such an oligonucleotide is RT15S (SEQ ID NO: 63), whose G-rich sequence is known to inhibit c-myc expression (sequence 14 in Burgess, TL, Fisher, EF, Ross, SL, Bready, JV, Qian, Y.-X, Bayewitch, LA, Cohen, AM, Herrera, CJ, Hu, S.

S.-F., Kramer, T. B., Lott, F. D., Martin, F. H., Pierce, G. F., Simonet, L., Farrell, C. L. (1995), Proc. Natl. Acad. Sci. 92, pages 4051 to 4055). Another G-rich structure, an intramolecular G-quartet, has been confirmed to mediate aptamer inhibition of thrombin, see Hang, KY, McCurdy, S., Shea, RG, Swaminanthan, S., Bolton, PH (1993) Biochemistry 32, pages 1989- 1994, Macaya, RF, Schultze, P.

Smith, F.W., Roe, J.A., Feigon, J. (1993) Proc. Natl. Acad. Sci. 90, pages 3745-3749. Sequence analysis of the RT03S oligonucleotide (SEQ ID NO: 44) confirms that pairing of guanidines at positions 3-4 7-8, 12-13 and 16-17 can result in the formation of such a G-quartet. On the other hand, removal of residues 1-6 (RT18S, SEQ ID NO: 57), which results in the formation of this intramolecular quartet, has been shown to be ineffective in blocking inhibition of CD28 antigen expression and IL-2 dependent production thereof. It is believed that an alternative G-quartet structure is responsible for the activity of this oligonucleotide.

The sequence of the 12-mer RT03S (SEQ ID NO: 44) is indeed similar to the motif predicted by Smith, FW, Feigon, J. (1993) Biochemistry 32, pages 8682-8692 and is believed to be essential for forming a dimeric one. G-quartet. Dimeric G-quartets may arise from two strands of DNA, which may optionally be parallel and antiparallel. In this case, adjacent fibers contribute four guanidines to form four stacked G-quartets. The origin and stability of this complex is due to the motif consisting of twelve nucleotides on each of the strands, four bases separated by fourfold G. This central 12-mer (RT18S, SEQ ID NO: 57) has been shown to have a similar activity as an oligonucleotide RT03S (SEQ ID NO: 44). Also, substitution of guanidine for cytosine (RT10S (SEQ ID NO: 53), RT23S (SEQ ID NO: 56), RT24S (SEQ ID NO: 54), RT25S (SEQ ID NO: 55) v regions of both quadruple Gs resulted in a 56 to 69% loss of inhibitory activity relative to the RT03S oligonucleotide, as well as RT20S insertion (SEQ ID NO: 61), RT21S (SEQ ID NO: 62), and deletion of RT19S (SEQ ID NO: 61). All these data strongly confirm the hypothesis that a specific sequence motif capable of forming a dimeric G-quartet is critical for inhibiting the functional expression of the CD28 antigen mediated by phosphothioate oligonucleotides.

The mechanism by which dimeric G-quartets of this type are biologically active is unknown. However, some evidence confirms the hypothesis that this motif allows the oligonucleotides of the invention to play the role of misleading targets, presumably in competitively shielding a G-quartet-containing promoter sequence before recognition by a specific transcription factor.

1) The oligomer corresponding to the upstream region of the CD28 RT11S gene (SEQ ID NO: 50) showed similar biological activity to the RT03S oligonucleotide (SEQ ID NO: 44).

2) Active oligomers of the invention other than by an 'anti-sense ¹ ' mechanism.

3) The oligomers of the invention modulate the expression of the mRNA for the CD28 antigen, indicating that their effect is not due to a direct interaction with the target protein.

4) G-rich regions are predominant in promoters, see Evans, T., Schon, E., Grazyna, G. M., Patterson, J., Efstratiadis, A. (1984) Nucleic Acids Res. 12, pages 8043-8050, Kilpatrick, M.W., Torri, A., Kang, D. S., Engler, J. A., Wells, R. D. (1986) J. Biol. Chem. 261, pp. 11350-11354; Clark, S. P., Lewis, C. D., Felsenfeld, G., (1990) Nucleic Acids Res. 18, pages 5119 to 5126, which increases the likelihood that the promoter sequences forming the G-quartet are a general phenomenon.

5) Double-stranded oligomers serve as a misleading target for transcription factor E2F, see Morishita, R., Gibbons, GH, Horuchi, M., Ellison, KE, Nakajima, M., Zhang, L., Kaneda, Y., Ogihara, T. , Dzau, VJ (1995) Proc. Natl. Acad. Sci. USA 92, pp. 5855-5859.

6) G-rich oligonucleotides can mediate the induction of the transcription factor Spi, see Perez, J.R., Li, Y., Stein,

C. A., Majumder, S., van Oorschot, A., Narayanan, R. (1994), Proc. Natl. Acad. Sci. USA 91, pp. 5957-5961.

Claims (26)

What is claimed is: 1. An oligomer which is capable of reducing CD28 gene expression in T cells. The oligomer of claim 1, wherein said oligomer is capable of hybridizing to a CD28 gene transcript. 3. The oligomer of claim 2, wherein said oligomer hybridizes to a CD28 initiation codon. 4. The oligomer of claim 1, wherein said oligomer is capable of hybridizing to a CD28 gene. 5. The oligomer of claim 4, wherein said oligomer hybridizes to a transcriptional initiator CD28 transcript. 6. The oligomer of claim 1 comprising at least 11 nucleic acid bases and no more than 50 nucleic acid bases. 7. The oligomer of claim 1 which is a DNA or RNA molecule. The oligomer according to claim 1, characterized in that it consists of less than 22 bases and comprises the sequence 5 'TTGTCCTGACGATGGGCTA 3' (SEQ ID NO. D The oligomer according to claim 1, characterized in that it consists of less than 22 bases and comprises the sequence 5 'AGCAGCCTGAGCATCTTTGT 3' (SEQ ID NO 2). 10. The oligomer of claim 1 comprising less than 22 bases and comprising the sequence 5 'TTGGAGGGGGTGGTGGGG 3' (SEQ ID NO: 3). The oligomer according to claim 1, characterized in that it consists of less than 22 bases and comprises the sequence 5 'GGGTTGGAGGGGGTGGTGGGG 3' (SEQ ID NO. 4) · 12. The oligonucleotide of claim 1 having a phosphorothioate backbone of 11 to 50 bases and comprising at least two GGGG sequences separated by 3-5 bases. 13. A method of treating a disease that is at least partially mediated by CD28, comprising administering to the patient an effective amount of the oligomer of claim 1. 14. A method of treating a disease that is at least partially mediated by CD28, comprising administering an effective amount of an oligomer having 11 to 50 bases, which comprises at least two GGGG sequences separated by 3-5 bases. The method of claim 13, wherein the oligomer comprises the sequence 5 'TTGGAGGGGGTGGTGGGG 3' (SEQ ID NO: 3). The method of claim 13, wherein the oligomer comprises the sequence 5 'GGGTTGGAGGGGGTGGTGGGG 3' (SEQ ID NO: 4). 17. The method of any one of claims 13 to 16, wherein the administration further comprises the steps of: * exposing CD28-expressing cells from the patient's body, * introducing the oligomer into these cells to produce cells transformed with the oligomer, and * returning the transformed cells to the patient's body. The method of any one of claims 13 to 16, wherein the administration further comprises the following steps: * maturing CD28-expressing cells from the donor, * introducing the oligomer into these cells to produce cells transformed with the oligomer, and * returning the transformed cells to the patient. The method of any one of claims 13 to 16, wherein the oligomer is produced by transcription in an expression vector. 20. A recombinant expression vector comprising, in a functional combination, a promoter and a polynucleotide sequence encoding an oligomer capable of inhibiting the inducible expression of the CD28 antigen in T cells. 21. A pharmaceutical composition comprising the oligomer of claim 1. 22. The pharmaceutical composition of claim 21, wherein the oligomer is 11 to 50 bases in length and comprises at least two GGGG sequences separated by 3-5 bases. The pharmaceutical composition of claim 21, wherein the oligomer is 18 to 50 bases in length and comprises the sequence 5 'TTGGAGGGGGTGGTGGGG 3' (SEQ ID NO: 3). The pharmaceutical composition of claim 21, wherein the oligomer is 18 to 50 bases in length and comprises the sequence 5 'GGGTTGGAGGGGGTGGTGGGG 3' (SEQ ID NO: 4). 25. A pharmaceutical composition comprising at least two different oligomers according to claims 21 to 24. A pharmaceutical composition according to any one of claims 21 to 21 25, characterized in that it is adapted for parenteral use.