MXPA97005963A - Methods and compositions for the regulation of the expression of c - Google Patents

Abstract

Methods and compositions for the treatment of diseases mediated by the immune system are provided. The compositions of the invention have the property of reducing the expression of CD28 in the cells of interest to moderate the pathogenic effects on the immune system in a disease mediated by the immune system. The compositions of the invention include one or more different oligomers capable of reducing the expression of CD28. One aspect of the invention provides oligomers capable of reducing the expression of CD28 by interfering with the expression of CD28. Oligomers of the invention may be DNA, RNA, or various analogs thereof, and may include 14-50 basic phosphorothiotates having at least two GGGG sequences separated by 3 to 5 bases. Another aspect of the invention provides genetically engineered vectors for the intracellular expression of the oligomers of the invention in the cells of interest. Another aspect of the invention is to provide pharmaceutical formulations comprising one or more different oligomers comprising one or more different oligomers of the invention. The pharmaceutical formulations can be adapted for various forms of administration to the body or administration to the cells to be reintroduced to the body. Other aspects of the invention is to provide methods for the treatment of diseases mediated by the immune system. The methods of the invention involve modulating CD28 expression by administering an effective amount of the oligomers of the invention. Methods of the invention include methods for treating autoimmune diseases, methods for reducing inflammation, response, methods for reducing the production of selected cytokines, methods for inactivating T cells, and methods of immunosuppression of a transplanting patient. Another aspect of the invention provides formulations comprising one or more other oligomers of the invention. The formulations can be adapted for various forms of administration to the body or administration to the cells to be reintroduced into the body. Another aspect of the invention provides methods for the treatment of diseases mediated by the immune system. The methods of the invention involve modulating the expression of CD28 through the use of the oligomers of the invention. The methods of the invention can be used to treat diseases mediated by the immune system. Methods of the invention include methods for treating autoimmune diseases, methods for reducing an inflammatory response, methods for reducing the production of selected cytokines, methods for inactivating T cells, and methods for immunosuppressing a transplant patient.

Description

METHOD AND COMPOSITIONS FOR THE REGULATION OF THE EXPRESSION OF CD28 FIELD OF THE INVENTION The invention is in the field of the modulation of gene expression through the use of oligomers, particularly those oligomers effective to treat diseases mediated by the immune system.

BACKGROUND OF THE INVENTION Although the iir-une system plays a crucial role in protecting higher organisms against life-threatening infections, the immune system also plays a crucial part in the pathogenesis of numerous diseases. Those diseases in which the immune system plays a part include autoimmune diseases in which the immune system reacts against an autologous antigen, for example, systemic lupus erythematosus, or diseases associated with the associated immunoregulation by reaction to a foreign antigen, by example, the graft-versus-host disease observed in the transplant rejection. The pathogenesis and exacerbation of many diseases mediated by common T cells results from RI-F: 25295 an inappropriate immune response and directed by the abnormal activation of T cells. The presence of activated T cells has been reported in many skin diseases mediated by T cells (Simón et al., (1994) J. Invest. Derm., 103: 539-543). For example, psoriasis, which affects 2% of the western population including millions of Americans, is a skin condition characterized by keratinocytic hyperproliferation and abnormal dermal and epidermal infiltration of activated T cells. Many reports suggest the main role of these activated T cells in the pathogenesis of psoriasis (Baadsgaard et al., (1990) J. Invest. Derm., 95: 275-282, Chang et al., (1992) Arch. Derm. ., 128: 1479-1485, Schlaak et al., (1994) J. Invest. Derm., 102: 145-149) and in psoriasis exacerbated by AIDS (Duvic (1990) J. Invest. Derm., 90 : 38S-40S In psoriasis, the predominantly activated lesion T cells release Thl cytokines (IL-2, interferon gamma) (Schlaak et al., (1994) J. Invest. Derm., 102: 145-149). Secreted cytokines induce normal keratinocytes to express the same phenotype (HLA DR + / ICAM-1 +) found in proriasis lesions (Baadsgard et al., (1990) J. Invest. Derm., _95: 275-282) Also, by virtue of its proinflammatory properties in vi tro and in vi ve and because it is secreted in large quantities by both activated T cells and keratinocytes of psoriatic lesions, IL-8 is considered the most important contributor. and principal to the pathological changes observed in psoriatic skin such as keratinocytic hyperproliferation. In addition, one of the receptors of the B7 family (the natural ligands for CD28 found on activated APC), BB1, has been shown to be expressed in psoriatic but unaffected skin keratinocytes, ickoloff, et al. , (1993) Am. J. Pathology, 142: 1029-1040). It is thought that numerous other diseases are caused by the aberrant activation of T cells, including Type I diabetes mellitus. (insulin-dependent), thyroiditis, sarcoidosis, multiple sclerosis, autoimmune uveitis, rheumatoid arthritis, systemic lupus erythematosus, inflammatory bowel disease (Crohn's disease and ulcerative colitis) and autoimmune hepatitis. In addition, a variety of syndromes, including septic shock and tumor-induced cachexia, may involve T cell activation and increased production of potentially toxic levels of lymphokines. The normal activation of the T cells also mediates the rejection of transplanted cells and tissues providing the signals necessary for the effective destruction of the "foreign" donor tissue. The activation of T lymphocytes that leads to the proliferation of T cells and the genetic expression and secretion of specific immunomodulatory cytokines requires two independent signals. The first signal implies recognition, by the specific T cell / CD3 receptor complex, of the antigen presented by the main histocompatibility complex molecules on the surface of antigen-presenting cells (APC). Nonspecific intercellular interactions for the antigen between T cells and APCs provide the second signal that serves to regulate the response of T cells to the antigen. These secondary or costimulatory signals determine the magnitude of the response of the T cells to the antigen. The costimulated cells react by increasing the levels of genetic transcription of the specific cytokine and stabilizing the selected mRNAs. In the absence of costimulation, stimulation of the T cells results in an aborted or allergic T cell response. A key costimulatory signal is provided by the receptor surface interaction of CD28 T cells with molecules related to B7 on APC (Linsley and Ledbetter (1993) Ann. Rev. Immunol., U.191-212). CD28 is constitutively expressed on 95% of CD4 + T cells (which provide helper functions for the production of antibodies from B cells) and 50% of CD8 + T cells (which have cytotoxic functions) (Yamada et al. al., (1985) Eur. J. Immunol., 15: 1164-1168). After antigenic or mitogenic stimulation in vi tro, additional induction of CD28 levels on the surface occurs, as well as the production of certain immunomodulatory cytokines. These include interleukin 2 (IL-2), required for the cell cycle progress of T cells, interferon gamma, which has a wide variety of antiviral and antitumor effects and interleukin 8 (IL-8), known as a potent chemotactic factor for neutrophils and lymphocytes. These cytokines are shown and regulated by the CD28 pathway of T cell activation (Fraser et al., (1991) Science, 251: 313-316, Seder et al., (1994) J. Exp. Med., L79 : 299-304, Wechsler et al., (1994) J ^ Imuno1., 153: 2515-2523). IL-2, interferon gamma, and IL-8 are essential to promote a wide range of immune responses and have been shown to be overexpressed in many disease states mediated by T cells. In some skin conditions mediated by T cells, such as contact allergic dermatitis and lichen planus, CD28 was expressed at high levels in most skin and epidermal CD3 + cells but in normal skin and from basal cell carcinoma (a non-cell-mediated skin disease). T), CD28 was expressed only in perivascular T cells. Similarly, in both allergic contact dermatitis and lichen planus, B7 expression was found on dermal dendritic cells, skin APCs and on keratinocytes but not on normal skin or basal cell carcinoma (Simón). et al., (1994) J. Invest. Derm., 103: 539-543). Therefore this suggests that the CD28 / B7 pathway is an important mediator for skin diseases mediated by T cells. The aberrant activation of T cells associated with certain autoimmune diseases caused by the loss of self-tolerance is characterized predominantly by the presence of CD28 + T cells and the expression of its ligand, B7 on the activated professional APCs (monocyte, macrophages or dendritic cells). These include Graves' autoimmune thyroiditis (Garcia-Cozar et al., (1993) Immunol., 12:32), sarcoidosis (Vandenbergh et al., (1993) Int. Immunol., 5: 317-321), rheumatoid arthritis. (Verwilghen et al. (1994) J _ ^ _ Im unol., 153: 1378-1385) and systemic lupus erythematosus (Sfikakis et al., (1994) Clin. Exp. Immunol., 96: 8-14). In the normal activation of T cells, which mediate the rejection of transplanted organ cells, the binding of CD28 by its own B7 ligand during the coupling of the T cell receptor is critical for the appropriate allogeneic response of foreign antigens, for example, on the donor tissue (Azuma et al., (1992) J. Exp. Med. l_75: 353-360, Turka et al., (1992) Proc. Nat. Acad. Sci. USA, 89: 11102 -11105).

Traditional therapies for autoimmune diseases do not prevent the activation of T cells; the effector step in the autoreactive immune response to a self antigen. Drugs are commonly used, such as steroids and nonsteroidal anti-inflammatory drugs. NSAIDS), to relieve symptoms, but do not prevent the progress of the disease. In addition, steroids can have side effects such as the induction of osteoporosis, organ toxicity and diabetes, which can accelerate the process of cartilage degeneration and cause so-called rashes after injection for 2 to 8 hours. NSAIDs may have gastrointestinal side effects and increase the risk of agranulocytosis and iatrogenic hepatitis. Immunosuppressant drugs are also used as another form of therapy, especially in advanced stages of the disease. However, these drugs suppress the entire immune system and often the treatment has severe side effects including hypertension and nephrotoxicity. Also established immunosuppressants such as cyclosporin and FK506 can not inhibit the CD28-dependent activation pathway of CD28 (June et al., (1987) Mol Cell. Biol., 7: 4472-4481). Given the disadvantages of currently available pharmaceutical forms and methods for treating diseases mediated by the immune system, it is of interest to provide novel methods and compositions for treating various diseases.

BRIEF DESCRIPTION OF THE INVENTION The subject invention provides methods and compositions for the treatment of diseases mediated by the immune system. The compositions of the invention have the property of reducing the expression of CD28 of cells of interest, which in turn moderates the pathogenic effects of the immune system in a disease mediated by the immune system. The methods aimed at reducing the expression of CD28 can serve as methods to reduce the effects of antigenic stimulation of CD28 + T cells, thereby decreasing the level of activation of CD28 + T cells and the release of cytokines associated with activation. of T cells, including interleukin 2, interferon gamma, and interleukin 8. The compositions of the invention include many different oligomers capable of reducing the expression of CD28. One aspect of the invention is to provide oligomers capable of reducing the expression of CD28 by interfering with the expression of CD28. Oligomers of the invention may have base sequence homology of the nucleic acid with a CD28 gene or a transcript of the CD28 gene, or a portion thereof, wherein the homology is sufficient to allow the formation of a double helix strand or a triple-stranded nucleic acid strand under intracellular conditions. The oligomers of the invention may be of DNA, RNA, or various synthetic analogs thereof. In particular embodiments, oligomers having 11 to 50 bases comprise at least two GGGG sequences separated by 3 to 5 bases. Another aspect of the invention is to provide genetically engineered vectors for the intracellular expression of the oligomers of the invention in the cells of interest, preferably in cells that naturally express CD28. Another aspect of the invention is to provide pharmaceutical formulations comprising one or more other oligomers of the invention. The pharmaceutical formulations can be adapted for various forms of administration to the body or administration to the cells to be reintroduced to the body. Another aspect of the invention is to provide methods for the treatment of diseases mediated by the immune system. The methods of the invention involve modulating CD28 expression by administering an effective amount of the oligomers of the invention. Methods of the invention include methods for treating autoimmune diseases, methods for reducing inflammation, response, methods for reducing the production of selected cytokines, methods for inactivating T cells, and methods of immunosuppression of a transplanted patient.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a sequence of the 5 'untranslated region of the CD28 gene (IA) and the sequence of the human CD28 mRNA (IB, IC). Figures IB and IC represent contiguous portions of a polynucleotide sequence. Figure 2 is a graphical representation of the percentage of viable (live) T cells after treatment with various phosphorothioate and phosphorothioate 3 'hydroxypropylamine oligonucleotides specific for CD28 and control. Figure 3 is a graphic representation of the anti-CD3 monoclonal antibody / CD28 expression induced by PMA in the human T cells of the donors (GVOlO and JC011), (A) and the effect of the phosphorothioate specific for CD28 and control (B , lots 1 and 2) and phosphorothioate-3 'hydroxypropylamine oligonucleotides (C) oligonucleotides on anti-CD3 monoclonal antibody / CD28 expression induced by PMA in peripheral blood T cells of the same 2 donors.

Figure 4 is a graphic representation of A) the induction of proliferation of T cells by mitogens in human T cells of the donor KS006 and B) the effect of the phosphorothioate oligonucleotides specific for CD28 and control over the anti-monoclonal antibody. CD3 / proliferation of human T cells induced by PMA. Figure 5 is a graphic representation of the induction of the production of interleukin-2 (IL-2) by the anti-CD3 monoclonal antibody and PMA in human T cells (A) and the effect of the phosphorothioate specific for CD28 and control (B) and phosphorothioate-3 'hydroxypropylamine (C) oligonucleotides on the anti-CD3 monoclonal antibody / production of IL-2 induced by PMA in human peripheral T cells. Figure 6 is a graphical representation of the induction of interferon gamma (IFNα) production by the anti-CD3 monoclonal antibody on human T cells (A) and the effect of phosphorothioate specific for CD28 and control (B) and phosphorothioate- 3'-hydroxypropylamine (C) oligonucleotides on the anti-CD3 monoclonal antibody / production of PMA-induced interferon gamma in human peripheral T cells. Figure 7 is a graphic representation of the induction of the production of interleukin 8 (IL-8) by the anti-CD3 monoclonal antibody and the PMA in human T cells (A) and (B) and phosphorothioate-3'-hydroxypropylamine (C) ) on the anti-CD3 monoclonal antibody / production of IL-8 induced by PMA in human peripheral T cells. Figure 8 is a graphic representation of the induction of the interleukin 2 receptor (IL-2R, otherwise known as CD25) (A) and the expression of the intracellular adhesion molecules 1 (ICAM-1 otherwise known as CD54 ) (B) by the monoclonal antibody anti-CD3 and PMA in human peripheral T cells treated with or without 3'-idroxypropylamine phosphorothioate oligonucleotides specific for CD28 and control. Figure 9 is a graphic representation of the expression of CD28 in the human T cell lineages HUT 78 (A) and Jurkat (B) before and after the PMA treatment and the anti-CD3 monoclonal antibody, and the effect of the oligonucleotides of phosphorothioate specific for CD28 in anti-CD3 monoclonal antibodies and Jurkat cells treated with PMA (C). Figure 10 is a graphical representation of the effect of the phosphorothioate oligonucleotides specific for CD28 on the production of interleukin 2 in the anti-CD3 monoclonal antibody and in human T cell lineages treated with PMA HUT 78 (A) and Jurkat ( B).

Figure 11 is a graphical representation of the effect of phosphorothioate oligonucleotides on the expression on the surface of accessory molecules and on the secretion of cytokine in activated T cells. Figure 12 is ur. graphic representation of the effect of the phosphorothioate oligonucleotides on the mRNA levels of CD28 and CD25. Figure 13 is a graphical representation of the specificity in the oligonucleotides RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) with respect to the inhibitory effect on the expression of functional CD28. Figure 14 is a graphical representation of the induction of in vitro tolerance by the oligonucleotides specific for CD28, RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45). Figure 15 is a graphical representation of the stability in vi tro of phosphorothioates labeled with 12P, RT03S (SEQ ID NO: 44) and RTC06S (SEQ ID NO: 48) in extracellular supernatants (upper panel) and used on Jurkat cells (lower panel).

DETAILED DESCRIPTION OF THE SPECIFIC MODALITIES Here methods and compositions for treating diseases mediated by the immune system are described, wherein the desired therapeutic effect is achieved by decreasing the expression of CD28, thereby approving the function of the more activated CD28 T cells and decreasing the activity of other cells. of the immune system. The inventor has discovered that T-cell activation dependent on the antigen can be inhibited by decreasing CD28 expression in CD28 + T cells. The invention provides numerous compounds that can be used to decrease the expression of CD28 in T cells. The invention described herein involves the discovery that the decrease of CD28 expression in T cells can interfere with the activation of T cells. specific for the antigen. The discovery can be used to provide numerous methods for treating diseases mediated by the immune system with oligomers directed to CD28 and with non-oligomeric compounds that disinfine the expression of CD28. Using the discoveries of the biological effects of lowering the expression of CD28 as described in this application, numerous methods of treatment of diseases mediated by the immune system are provided, such methods can employ non-oligomeric compounds that have not yet been synthesized or purified . One aspect of the invention is to provide the oligomers that can be used to inhibit the gene expression of certain genes, which is an established technique frequently referred to as the use of "anti-sense" or "anti-sense" oligonucleotides. Numerous publications on the construction and use of anti-sense are available. Copies of such publications are: Stein et al. , Science, 26 ^: 1004-1012 (1993); Milligan, et al. , J. Med. Chem., 36: 1923-1937 (1993); Helene, et al. , J ^ Biochim. Biophys. Acta, 1049: 99-125 (1990); Agner, Nature., 372: 333-335 (1994); and Crooke and Lableu, Anti-sense Research and Applications, CRC Press, Boca Raton (1993). The term "anti-sense" as used herein, unless otherwise indicated, refers to oligomers (including oligonucleotides) capable of forming either double-stranded or triple-stranded (triplet) helices with polynucleotides to interfere with the genetic expression. The principles of the design and use of the antisense described in the publications, and other similar publications, can be used by one skilled in the art to design, make and use the different modalities of the specific oligomers of the CD28 of the invention. The oligomers of the invention are capable of modulating the expression of the CD28 gene. Oligomers of the invention include those oligomers that have the property of being able to form either a double-stranded polynucleotide helix by hybridizing with CD28 transcripts (or portions thereof), or a double-stranded polynucleotide helix hybridizing with a portion or portions of a CD28 gene, wherein helix formation can occur under intracellular conditions. The oligomers of the invention also include those oligomers that are capable of affecting the regulation of gene expression by acting as molecular decoys and preventing the protein-nucleic acid interaction of the transcription factors with the regulatory elements of the untranslated regions of the gene. CD28. Additionally, the oligomers of the invention include those oligomers that are capable of forming a triple stranded polynucleotide helix with a portion or portions of a CD28 gene, where helix formation can occur under intracellular conditions. double-stranded helix bases and triple-stranded helix between nucleic acid bases (eg, adenine, thymine, cytosine-guanine, uracil-ti-ina) are known to those skilled in the art and can be used in the design of oligomers of the invention The regions of the CD28 gene or transcripts of the CD28 gene in which the formation of double-stranded helix or triple-stranded helix with given oligomer of the invention may appear to be "directed" by these oligomers.

Human CD28 is a 90-kDa homodimeric transmembrane glycoprotein present on the surface of a subset of T cells. CD28 is present in most CD4 + T cells and approximately 50% of CD8 T cells. The DNA sequence encoding human CD28 has been resolved as can be found, among other places, in Lee et al. • Journal of I munology, 145: 344-352 (1990) and in databases of genes accessible to the public such as GenBank. The human CD28 gene comprises four exons, each of which defines a functional domain of the predicted protein. Transcription products of various sizes produced by the human CD28 gene have been observed. The oligomers of the invention can be designated by reference to the published nucleotide sequence of the CD28 gene or the sequence of the cDNAs derived from the CD28 gene. The compositions and methods of the invention can be easily adapted for use in mammals other than humans by reference to the CD28 gene sequence of non-human mammals. The sequence of the non-human CD28 gene can be obtained by, among other methods, using sequences of the previously identified CD28 gene from humans (or other mammals) as hybridization probes of the gene library and / or PCR amplification primers (chain reaction) of the polymerase). It is believed that the published nucleotide sequences of the CD28 gene are accurate, the subject invention can be practiced by one skilled in the art even if the published nucleotide base sequence of CD28 contains sequencing errors. Errors of the appropriate nucleotide base sequence in the published sequences can be detected by, among other means, sequence of CD28 gene regions (or CD28 gene transcripts) driven by the oligomers of the invention. Resequencing can be done by conventional means of DNA sequencing technology. The oligomers of the invention preferably comprise from about 11 to about 50 units of nucleic acid bases. It should be readily appreciated by one skilled in the art that the oligomers of the invention can be significantly longer than 50 units of nucleic acid bases. In a more preferred embodiment of the invention, the oligomers comprise from about 8 to about 25 units of nucleic acid bases; more preferably from about 14 units of nucleic acid bases to about 22 units of nucleic acid bases. Preferred size limitations for the oligomers of the invention pertain only to those oligomers that are to be delivered extracellularly to a cell and are not applicable to the specific oligomers of the CD28 produced intracellularly, for example, as those produced from vectors for the genetic manipulation of target host cells. Oligomers of the invention may have numerous different nucleic acid base sequences. The oligomers of the invention can be selected to reduce the expression of CD28 by hybridization (through the nucleic acid-nucleic acid interaction) for virtually any region of a CD28 transcript of the CD28 gene to reduce the expression of CD28, or by hybridization ( through the nucleic acid-protein interaction) to non-nucleic acid molecules that recognize untranslated sequences of the CD28 gene. For example, the oligomers of the invention can be selected to be capable of hybridizing to the translated regions of a CD28 transcript, untranslated regions of a CD28 transcript, non-spliced regions of a CD28 transcript, introns of the CD28 gene, sequences CD28 promoters, and CD28 regulatory sequences, the 5 'end region of a CD28 transcript, coding regions of the CD28 gene and the like (including combinations of several distinct regions). Preferred embodiments of the CD28 gene and transcripts of the CD28 gene by the oligomers of the invention are in the translational and / or transcriptional initiation regions of the CD28 gene (and transcripts thereof). By varying the location of the CD28 or the transcript of the CD28 gene in which the formation of the helix can occur through the selection of the oligomer nucleic acid base pair sequence, the potency of the oligomer, that is, the amount required to produce the desired biological effect will vary. Preferred embodiments of the oligomers of the invention have the highest possible potency. The potency of the different oligomers of the invention can be measured by several in vitro assays known to those skilled in the art. Examples of such tests can be found in the experiments section of this application. One skilled in the art will appreciate that it is not desirable to produce oligomers that are directed to the polynucleotide sequences that are also present in genetic locations different from those of the CD28 gene. For example, it may be desirable to produce an oligomer directed to the Alu sequence in the 5 'untranslated region of the CD28 transcript (the Alu region of CD28 is described in Lee et al., Journal of Immunology, 145: 344-352 (1990) ). The use of oligomers that form double-stranded or triple-stranded helices with the gene or transcripts of other genes than CD28 can be minimized by performing homology searches of the nucleotide base sequences of the oligomer against the information of the polynucleotide sequences present in the oligonucleotide. databases accessible to the public such as GenBank.

In a preferred embodiment of the invention, the subject oligomers exhibit complementarity of the bases of the perfect nucleic acid with the selected target sequence, i.e., that each base of the nucleic acid in the oligomer can enter a base-pairing ratio with a second (or third) base of nucleic acid on another strand of a double (or triple) helix. However, one skilled in the art will appreciate that several oligomers specific for a CD28 gene target and / or capable of inhibiting the expression of CD28 may have nucleotide base sequences lacking perfect hybridization with the CD28 gene (any strand), transcripts of the CD28 gene, or specific regulatory proteins of CD28. In preferred embodiments oligomers of the invention oligomer solution having the following nucleotide base sequences: 'TTGTCCTGACGATGGGCTA3 '(SEQ ID NO: 1) RT01 5"GCAGCCTGAGCATCTTTGT3' (SEQ ID NO: 2) RT02 5'TTGGAGGGGGTGGTGGGG3 '(SEQ ID NO: 3) RT03 5'GGGTTGGAGGGGGTGGTGGGG3' (SEQ ID NO: 4) RT04 In the particularly preferred embodiments of the invention, oligomers having the nucleotide base sequences indicated in RT01, RT02, RT03, and RT04, are phosphorothioates. Particularly preferred oligomers are phosphorothioate-3 'hydroxypropylamine, as described in Tam et al. , Nucí. Acid Res. 22: 977-986 (1994). The oligomers of the invention can be designed to decrease the expression of CD28 in T cells that have extracellularly applied, internomed oligomers of the invention. Additionally, the oligomers of the invention can be designed to decrease the expression of CD28 when the oligomers are produced intracellularly through the use of gene expression vectors. The inhibition of CD28 expression can be effected through (I) interference with CD28 gene transcription, (ii) interference with transcription of CD28 gene transcripts, (iii) interference with the processing of CD28 gene transcripts , or any combination of (I), (ii), and (iii). The precise degree and mechanism of the interference of CD28 expression will depend on such factors as the structure of the particular oligomer, the nucleotide base sequence of the oligomer, the dose of oligomer, the means of administration of the subject oligomer and the like. The term "oligomer" as used herein refers to both polynucleotides that are found in nature, eg, DNA, RNA, as well as to various artificial analogs of the nucleic acids found in nature that have the ability to form either a double-stranded or triple-stranded helix with DNA or RNA. Many oligomers that are artificial analogs of the polynucleotides found in nature have properties that make them superior to DNA or RNA for use in the methods of the invention. These properties include enhanced affinity for DNA / RNA, endonuclease resistance, exonuclease resistance, lipid solubility, activation of RNAse H, and the like. For example, the improved lipid solubility and / or resistance to nuclease digestion results in the substitution of an alkyl group or alkoxy group for a phosphate oxygen in the internucleotide phosphodiester linkage to form an alkyl phosphonate oligonucleotide or an alkyl phosphotriester oligonucleotide. . Nonionic oligomers such as these are characterized by increased resistance to nuclease hydrolysis and / or increased cell uptake, while retaining the ability to form stable complexes with complementary nucleic acid sequences. Although numerous oligomers that are analogues of naturally occurring nucleic acids are explicitly described herein, and / or are otherwise known to those skilled in the art, it should be appreciated that numerous oligomers that are nucleic acid analogs that can be developed in the future they can be easily adapted by those skilled in the art to inhibit the expression of the CD28 genes. A brief review of the various currently available DNA / RNA analogues that can be used as oligomers of the invention is given below by selecting the appropriate nucleic acid base sequence for targeting CD28 genes (and transcripts thereof). . The different oligomers described in these publications are examples, not limitations, of the different possible oligomeric modalities that can be adapted for the inhibition of CD28 expression in the methods and compositions of the invention. Oligomers of methylphosphonate (and other alkyl phosphonate) can be prepared by a variety of methods, both in solution and in insoluble polymeric supports (Agra al and Fiftina, Nucí Acids. Res., 6: 3009: 3024 (1979)).; Miller et al. Biochemistry, 18: 5134-5142 (1979); Miller et al. , J-_ Biol. Chem., 255: 9659-9665 (1980) Miller et al. , Nucí. Acids Res., 11: 5189-5204 (1983); Miller et al. , Nucí.

Acids Res., 11_: 6225-6242 (1983); Miller et al. , Biochemistry., 25: 5092-5097 (1986); Sinha et al. , Tetrahedron Lett. 24: 877-880 (1983); Dorman et al. , Tetrahedron, 40: 95-102 (1984); Jager and Engels, Tetrahedron Lett., 25: 1437-1440 (1984); Noble et al. , Nucí. Acids Res., 12: 3387-3404 (1984) Callahan et al. , Proc. Nati Acad. Sci. USA, 83: 1617-1621 (1986); Koziolkiewicz et al. , Chemica Scripta, 26: 251-260 (1986); Agrawal and Goodchild, Tetrahedron Lett., 38: 3539-3542 (1987); Lesnikowski et al. , Tetrahedron Lett., 28: 5535-5538 (1987); Sarin et al. , Proc. Nati Acad. Sci. USA, 85: 7448-7451 (1988). Additional oligoribonucleotide analogs for use as oligomers are described in Inova et al. , Nucleic Acids Res., 15: 6131 (1987) (2'-O-methylribo-nucleotides), Inova et al. , FEBS Lett., 215: 327 (1987). Descriptions of how to make and use phosphorothioates and phosphorodithioates can enontrarse in, among other places, in the following publications: U.S. Patent No. 5,292,875, U.S. Patent No. 5,286,717, U.S. Patent No. 5,276,019, U.S. Patent No. 5,264,423, US Patent No . 5,218,103, U.S. Patent No. 5,194,428, U.S. Patent No. 5,183,885, U.S. Patent No. 5,166,387, U.S. Patent No. 5,151,510, U.S. Patent No. 5,120,846, U.S. Patent No. 4,814,448, U.S. Patent No. 4,814,451, U.S. Patent No. 4,096,210 , U.S. Patent No. 4,094,873, U.S. Patent No. 4,092,312, U.S. Patent No. 4,016,225, U.S. Patent No. 4,007,197, U.S. Patent No. 3,972,887, U.S. Patent No. 3,917,621, and U.S. Patent No. 3,907,815, Dagle et al. , Nucí. Acids Res. 18: 4751-4757 (1990), Loke et al. , Proc. Nati Acad. Sci, USA, 8_6: 3474-3478 (1989), LaPlanche, et al. , Nucleic Acids Res., 14: 9081 (1986) and by Stec, et al. , J. Am. Chem. Soc. 1_06: 6077 (1984), and Stein et al. , Nucí. Acids Res. 16: 3209-3221 (1988). Descriptions of how to make and use phosphoramidites can be found among other places in the following publications: Agrawal et al. , Proc. Nati Acad. Sci., 85: 7079-7083 (1988), Dagle et al. , Nucí. Acids Res. 18 (6) 4751-4757 (1990), Dagle et al. , Nucí. Acids Res. 19 (8): 1805-1810 (1991). Other polynucleotide analogs of interest include those compounds that have acetals or thioacetals in the structure of their backbone. Examples of how to make and use such compounds can be found, inter alia, in Gao et al. , Biochemistry 31: 6228-6236 (1992), Quaedflieg et al. , Tetrahedron Lett. 33 (21): 3081-3084 (1992), Jones et al. , J. Org. Chem. 58: 2983-2991 (1993). Other polynucleotide analogs of interest include compounds having silyl and silyloxy bridges in the structure of their backbone. Examples of how to make and use such compounds can be found, inter alia, in Ogilvie and Cormier, Tetrahedron Lett., 26 (35): 4159-4162 (1985), Cormier and Ogilvie, Nuci. Acids Res. 16 (10): 4583-4594 (1988), PCT publication WO 94/06811. Other polynucleotide analogs of interest include the compounds having silyl and acetamidate bridges in the structure of their backbone. Examples of how to make and use such compounds can be found, among other places, in Gait et al., J. Chem. Soc., Perkin Trans. 1_: 1684 (1974), Mungall and Kaiser, J. Org. Chem. 42 (4): 703-706 (1977), and Coull et al. , and Tetrahedron Lett. _28 (7): 745-748 (1987). Polynucleotide analogs having morpholino-based backbones have been described. Information such as making and using nucleotide analogs can be found in, among other places, US patents Nos. 5,034,506, 5,235,033, 5,034,506, 5,185,444. Polynucleotide analogs having several amine, peptide and other achiral and / or neutral bonds have been described: Caulfield et al. , Bioorganic & Medicinal Chem. Lett., 3 (12): 2771-2776 (1993), Mesamaeker et al. , Bioorganic & Medicinal Chem. Lett., 4 (3): 395-398 (1994); Angew, Chem. Int. De. Engl. , 33 (2): 226-229 (1994), U.S. Patent No. 5,166,315, and U.S. Patent No. 5,142,047. Polynucleotides having thioether bonds and other sulfurs between the subunits are described in, inter alia, Schneider and Brenner, Tetrahedron Lett., 31 (3): 335-338 (1990), Huang et al. , J. Org. Chem., 5_6: 3869-3882 (1991); Musicki and Widlanski, Tetrahedron Lett., 32 (10): 1267-1270 (1991); Huang and Widlanski, Tetrahedron Lett., 33 (19): 2657-2660 (1992); and Reynolds et al. , J. Org. Chem. 57: 2983-2985 (1992), and PCT publication WO 91/15500. Other polynucleotide analogs of interest include peptide nucleic acids, (PNA) and related polynucleotide analogues. A description of how to make and use the peptide nucleic acids can be found, among other places, Buchardt et al. , Trends in Biotech., 11 (1993) and PCT publication WO 93/12129. Other oligomers for use in antisense inhibition have been described in Thuong et al. , Proc. Nati Acad. Sci., Sj4: 5129-5133 (1987), North American Patent No. ,217,866, Lamond, Biochem. Soc. Transactions, 21 ^: 1-8 (1993) (2'-O-alkyloligorribonucleotides), Ono et al. , Bioconjugate Chemistry, 4: 499-508 (1993) (2'-deoxyuridine analogs containing an amino linker and in the V position of deoxyribose), Kawasai et al. , J. Med. Chem., 36: 831-841 (1993) (2'-deoxy-2'-fluoro phosphorothioate oligonucleotides), PCT publication WO 93/23570, Augustyns et al. , Nucí. Acids Res., 21 (20): 4670-4676 (1993). Additionally, the oligomers can be further modified to increase doublet stability, and / or increase cell uptake. Examples of such modifications can be found in PCT publication WO 93/24507 entitled "Conformationally Restricted Oligomers Containing Amide or Carbamate Linkages for Sequence Specific Union", Nielsen et al. , Science, 2_54: 1497-1500 (1991), PCT publication WO 92/05186 entitled "Modified Internucleoside Linkages", PCT publication WO 91/06629, filed October 24, 1990 and US Patent No. 5,264,562 filed on 24 of April 1991, both of which were entitled "Oligonucleotide Analogs with Novel Links", PCT publication WO 91/13080 entitled "Pseudonucleosides and Pseudonucleotides and their Polymers", PCT publication WO 91/06556 entitled "Oligonucleotides Modified in Position 2 ' ", PCT publication WO 90/15065 filed June 5, 1990 entitled" Exonuclease Resistant Oligonucleotides and Methods for Preparing the Same ", and US Patent No. 5,256,775. The oligomers of the invention comprise several nucleic acid bases. In addition to the nucleic acid bases naturally found in the DNA or RNA, eg, cytokine, adenine, guanine, thymidine, uracil, and hypoxanthine, the oligomers of the invention may comprise one or more nucleic acid bases that are analogues. synthetics of the acid bases found in nature. Such heterocyclic bases which are not found in nature include, but are not limited to, analogs of the aza and desaza pyrimidine, analogs of the aza and desaza purine, as well as other analogs of heterocyclic bases, wherein one or more of the atoms of carbon and nitrogen from the purine rings and pyrimidine have been replaced by heteroatoms, for example, oxygen, sulfur, selenium, phosphorus, and the like. Preferred base portions are those bases that can be incorporated into a strand of double-stranded polynucleotides to maintain a structural base-pairing relationship with a base found in nature on the complementary strand and the double-stranded polynucleotide. The invention provides many methods for treating a variety of immune conditions. The terms "treatment" or "treating" as used herein with reference to a disease refers to both prophylaxis and alleviation of symptoms already present in an individual. It should be appreciated by those skilled in the art that a treatment need not be completely effective in preventing the onset of a disease or in reducing the symptoms associated with the disease. Any reduction in the severity of symptoms, delay in the onset of symptoms, or delay in the progression of the severity of symptoms is desirable for a patient. Immune conditions that can be treated by the methods of the invention include diseases in which T cells that express CD28 mediate or contribute to an undesired idiopathic effect. Inhibition of CD28 expression results in decreased expression of the cytokines normally produced by appropriate CD28 + T cells, such cytokines include interleukin 2, interferon gamma, and interleukin 8. Accordingly, the methods of the invention, include but are not limited to, methods for treating diseases in which the pathogenesis is mediated at the same time interleukin 2, interferon gamma, interleukin 8 , or a combination thereof, whereby an immune response mediated by the T cell is interrupted or reduced. Examples of immune conditions that can be treated by administering the subject oligomers to a patient include rejection of organ transplantation, septic shock, tumor-induced cachexia, and numerous autoimmune diseases. Autoimmune diseases that can be treated by target methods that include diseases that are mediated by aberrant activation of T cells, including Type I diabetes (insulin-dependent), thyroiditis, sarcoidosis, multiple sclerosis, autoimmune uveitis, ulcerative colitis, aplastic anemia, systemic lupus erythematosus, rheumatoid arthritis, inflammation induced by parasites and granulomas, Crohn's disease, psoriasis, polymyositis, dermatomyositis, scleroderma, vasculitides, psoriatic arthritis , Graves' diseases, myasthenia gravis, autoimmune hepatobiliary disease, and the like. Additionally, the methods and compositions of the invention provide for the treatment of a variety of syndromes, including septic shock and tumor-induced cachexia, in which the pathogenic effects are mediated, at least in part, by the secreted lymphokine of the cells T CD28 activated. The methods of treating diseases of the invention comprise the step of administering an effective amount of the subject oligomers to a patient. The precise dose, i.e. the effective amount, of the oligomer specific for CD28 when administered to a patient will damage with numerous factors such as the specific disease to be treated, the precise oligomer (or oligomers) in the therapeutic composition, the age and condition of the patient and the like. Protocols for determining appropriate pharmaceutical doses are well known to those skilled in the art and can be found, inter alia, in Remington's Pharmaceutical Science (latest edition), Mack Publishing Company, Easton, Pa., And the like. In addition to administering oligomers directed to CD28 directly to a patient, the invention contemplates methods of treatment in which CD28 + cells (or cells having the potential to express CD28) are removed from the patient (with or without other cells) and transform with one or more different oligomers of the invention. The transformation can be by any of a variety of means well known to those skilled in the art, for example, electroporation, cationic liquids such as DOTMA or DOSTA, and the like. The transformed cells can then be reintroduced into the body. Another aspect of the invention is to provide methods for treating immune disorders by administration of CD28 specific oligomers, wherein the oligomers are produced intracellularly through recombinant polynucleotide expression vectors. The oligomers specific for CD28 produced intracellularly are necessarily RNA or DNA molecules. Recombinant polynucleotide vectors for expression of the sequences of interest are well known to those skilled in the art of molecular biology. Detailed descriptions of recombinant vectors for the expression of the polynucleotides of interest can be found in, inter alia, "Somatic Gene Therapy," ed. P. L. Chang, CRC Press, Boca Raton (1995), R. C. Mulligan, Science, 260: 923-932 (1993), F. W. Anderson, Science, 256: 808-873 (1992), Culver et al. , Hum. Gene Ther., 2: 107-109 (1991), and the like. Recombinant vectors suitable for use in the methods and object of treating immune diseases through genetic engineering are capable of integrating into the genome of T cells or duplicating themselves in the cytoplasm of T cells. The oligomers specific for CD28 to be used in intracellular administration they are preferably significantly larger than the oligomers specific for CD28 for extracellular administration. In a preferred embodiment of the methods subject to intracellular CD28 administration, the oligomer specific for CD28 is complemented to one or more complete CD28 transcripts, or the entire CD28 gene; however, the oligonucleotides specific for CD28 produced intracellularly suitable can be cut considerably in length. Unlike the oligomers specific for CD28 administered extracellularly, the oligomers specific for CD28 do not present problems with intracellular absorption or hydrolysis by extracellular enzymes. The methods for using intracellular CD28-specific oligomers involve administering the recombinant vectors encoding the specific oligomer of CD28 directly to a patient. Alternatively, the vectors that produce oligomer specific for CD28 can be administered directly to cells that have been removed from a patient (ie, mast cells, T cells, whole blood, marrow, etc.), so transformed cells are produced. The transformed cells can then be reintroduced into a patient.

The invention is also specifically provided for expression vectors capable of expressing one or more of the oligomers of the invention. Generally, such expression vectors comprise, in operable combination, a promoter and a polynucleotide sequence which codes for an oligomer capable of inhibiting the expression of CD28 in a T cell. Although many different promoters can be used in the vectors of the invention, the promoters Preferred are able to direct expression at high level in T cells. The expression vectors of the invention may also comprise several regulatory sequences. The currently available expression vectors, especially those vectors explicitly designed for gene therapy, can be easily adapted for the expression of the oligomers directed to the CD28 of the invention. Vectors can be adapted for the expression of oligomers targeted to CD28 using conventional genetic engineering techniques such as those described in Sambrook et al., Molecular Cloning, 2nd Ed., Cold Spring Harbor Press, Cold Spring Harbor, NY (1989) . Another aspect of the invention is to provide the pharmaceutical formulations for the administration of the oligomers to effect the treatment of diseases mediated by the immune system. These pharmaceutical formulations can be easily produced by a person skilled in the art of pharmaceutical science. Such formulations comprise one or more oligomers of the invention; however, the embodiments of the invention comprise more than one different type of oligomer, the oligomers are preferably selected so that they are not capable of hybridizing to each other. The pharmaceutical formulations of the invention may be adapted to be administered to the body in a number of ways suitable for the method of administration selected, including oral, intravenous, intramuscular, intraperitoneal, topically and the like. In addition to comprising one or more different oligomers of the invention, the subject pharmaceutical compositions may comprise one or more biologically inactive compounds, i.e., excipients, such as stabilizers (to promote long-term storage), emulsifiers, binding agents, thickening agents, salts, preservatives and the like. Formulations for parenteral administration may include sterile aqueous solutions, which may also contain buffers, diluents and other suitable additives. The pharmaceutical formulations of the invention can be designed to promote cellular uptake of the oligomers in the composition, for example, the oligomers can be encapsulated in suitable liposomes.

Pharmaceutical formulations for topical administration are especially useful for localized treatment. Formulations for topical treatment include ointments, sprays, gels, suspensions, lotions, creams and the like. Formulations for topical administration may include, in addition to the subject oligomers, known carrier materials such as isopropanol, glycerol, paraffin, stearyl alcohol, polyethylene glycol, etc. The pharmaceutically acceptable carrier can also include a known chemical absorption promoter. Examples of absorption promoters are, for example, dimethylacetamide (U.S. Patent No. 3,472,931), trichloroethanol or trifluoroethanol (U.S. Patent No. 3,891,757), certain alcohols and mixtures thereof (British Patent No. 1,001,949), and the specification of British Patent No. 1,464,975. In addition to the therapeutic uses of the subject oligomers, oligomers can also be used as a laboratory analytical tool for the study of T cell activation. T cells have several surface receptors in addition to CD28 and T cell receptors specific for the antigen. The difficulties arise in the study of the individual biological properties of the selected receptors due to the potential and actual interactions between the multiple pathways mediated by the receptor. Providing a mechanism to decrease the expression of CD28 in T cells, the oligomers and methods of the invention also provide useful laboratory methods for studying the behavior of T cells independently of the CD28 activation pathway. The invention can be better understood by reference to the following examples. The following examples are offered for the purpose of illustrating the invention and should not be construed as limiting the invention.

SAW. EXAMPLES - SERIES 1 Oligonucleotides The oligodeoxynucleotides were synthesized in an automated DNA synthesizer (Applied Biosystems model 394) using the standard phosphoramidite chemistry. The β-cyanoethylphosphoramidites, synthesis reagents and CPG polystyrene columns were obtained from Applied Biosysstems (ABI, Foster City, CA). The CPG columns of 3 '-aminoModifier C3 were obtained from Glen Research (Sterling, VA). For the phosphorothioate oligonucleotides, the standard oxidation vessel was replaced with tetraethylthiuram / acetonitrile disulfide, and the standard ABI phosphorothioate program was used for the gradual addition of phosphorothioate linkages. After cleavage of the controlled pore glass column, the protecting groups were removed by treating the oligonucleotides with concentrated ammonium hydroxide at 55 ° C for 8 hours. The oligonucleotides were purified by CLAP using an inverted phase semipreparative C8 column (ABI). After cleavage of the DMT protecting group, treatment with 80% acetic acid and ethanol precipitation, the purity of the product was evaluated by CLAP using an analytical C18 column (Beckman, Fullerton, CA). All oligonucleotides of > 90% purity was lyophilized to dryness. Oligonucleotides were reconstructed in sterile deionized water (ICN, Costa Mesa), adjusted to 400 μM after evaluation of OD260nm, aliquots were taken and stored at -20 ° C prior to experimentation. In all cases, at least three batches of each of the oligonucleotides listed in Table 1 were used.

Cell lineages and purification of T cells Peripheral blood mononuclear cells (PBMC) were isolated from the velvety coating after Ficoll-Hypaque density gradient centrifugation of 60 ml of blood from healthy donors. The T cells were then purified from the PBMCs using a Lympholwik lymphocyte isolation reagent specific for T cells (LK-25T, One Lambda, Canoga Park CA). An average yield of 40-60 x 10 6 T cells was then incubated overnight at 37 ° C in 20-30 ml of RPMI-AP5 (RPMI-1640 medium (ICN, Costa Mesa, CA) with a content of 20 μl of HEPES buffer, pH 7.4, 5% autologous plasma, 1% L-glutamide, 1% penicillin / streptomycin and 0.05% 2-mercaptoethanol) to remove any contaminating adherent cells. In all experiments, T cells were washed with RPMI-AP5 and then cultured in 96-well microtiter plates at a cell concentration of 2-3 x 106 cells / ml.

TABLE 1 AS: Antisense TF: Formation of triplet SS: Sense RO: Random oligo TABLE 2 AS: Antisense TF: Triplet formation SEQUENCE ID SEQ ID TYPE OBJECTIVE RESIDUE NO. OLIGO No: RT05 AGT TGA GAG CCA AGA GCA GC 11 AS codon AUG 108-127 RT06 GCT AAG GTT GAC CGC ATT GT 12 AS codon AUG 197-216 RT07 AGC CCT TTG TGA AGG GAT GC 13 AS coding region 256-275 RT08 ACC TGA AGC TGC TGG GAG TA 14 AS coding region 313-332 RT09 CCC AAT TTC CCA TCA CAG TT 15 AS coding region 352-371 RT10 GCA AGC TAT AGC AAG CCA GG 16 AS coding region 585-604 RT11 CAG GAG CCT GCT CCT CTT AC 17 AS coding region 641-660 RT12 GTG TCA GGA GCG ATA GGC TG 18 AS coding region 746-765 RT13 GGC CTG TCA CAG GAA ATC TC 19 AS coding region 949-968 RT14 AGC CGG CTG GCT TCT G 20 AS high codon 777-792 RT15 AAA TTG GCA TTG GTG GGC C 21 AS 3 'untranslated region 873-890 RTI 6 TAA GTT GGA ATG TGG GCC AT 22 AS 3 'untranslated region 984-1003 SEQUENCE ID SEQ ID TYPE OBJECTIVE RESIDUE NO. OLIGO No: RT17 CTC CCA GAA TCC ACT CCC TT 23 AS 3 'untranslated region 1049-1068 RTI 8 GCT TGA CTG AGA TGT GCA GG 24 AS 3 'untranslated region 1089-1108 RTI 9 TCC TAG CCT TTC TTC TGC AA 25 AS 3 'untranslated region 1136-1155 RT20 CGT ACG CTA CAG GCA TGG G 26 AS coding region 178-196 RT21 TGA GAA AGG GAA GAG GCT CC 27 AS 3 'untranslated region 1065-1088 RT22 GAA GTC GCG TGG TGG G 28 AS coding region 729-744 RT23 AAA TTA GCC AGG CAT CAT GG 29 AS 5 'untranslated region -325 to -306 RT24 AGT GGG TGG ATC ATT TGA GG 30 AS 5 'untranslated region -244 to -225 RT25 TGC TTG AAA TCC AGC AGA GA 31 AS region 5 * untranslated -139 to -120 RT26 CAT GAT GGG CTT ATG GGA AT 32 AS similar element AP-1 51 -60 to -79 RT27 CAG TGG CTG ACG CCT GTA 33 AS 5 'untranslated region -201 to -184 RT28 GGG GTT GGT TGG TTG TTT GG 34 TF similar item AP-1 5'-518 to -499 RT29 GTG TTT GTG TGG GGT TT 35 TF similar item AP-1 5 '-158 to -142 RT30 GGG GTT TTT TGT GTG GT 36 TF similar item AP-1 5 '-148 to -132 The cell lineages of T-cell lymphoma, Jurkat E6-1 cells (CD28 + / CD4 +) (152-TIB) and HUT cells 78 (CD28- / CD4 +) (TIB-161) (ATCC, Rockville, MD) were maintained in RPMI-10 (RPMI-1640 medium containing 20 μM of HEPES buffer, pH 7.4, 10% fetal sheep serum (FCS) (Hyclone, Logan, UT), 1% L-glutamine and 1% penicillin / streptomycin.

Activation of T cells induced by mitogen and oligonucleotide treatment Prior to the addition of human peripheral T cells or T-cell lymphoma cell lineages (0.2-0.3 x 10b), 96-well microtiter plates were pre-coated with purified anti-CD3 monoclonal antibody (mAb) (6.25-200) ng / well) (clone HIT 3a, Pharmigen, San Diego, CA) and washed twice with buffered saline with cold phosphate, pH 7.4 (PBS). Cells treated with anti-CD3 mAbs were additionally activated by the addition of 2 ng of phorbol 12-myristate 13-acetate (PMA) (Calbiochem, La Jolla, CA) and incubated for 48 h at 37 ° C. Cells activated with anti-CD3 / _MA were treated with 1-20 μM of oligonucleotides specific for CD28 and control immediately after activation and treated again 24 h later. The cells of a duplicate plate were used for the immunofluorescence analysis and the supernatants were used for the cytokine study and the second plate was used for the T cell proliferation assays.

Immunofluorescence studies After activation, 150 ml of cell supernatant from the first duplicate microplate were transferred to another microplate for the analysis of cytokine production derived from the cell. The remaining cells were washed twice with isotonic saline, pH 7.4 (Becton Dickinson, Manfield, MA) and resuspended in 50 ml of isotonic saline and pooled in two samples. An aliquot of sample was cotiñó with either Acm PE-CD28 / FITC-CD4 or PE-CD54 / FITC-CD25 and the non-specific fluorescence was evaluated by dyeing the second aliquot with control monoclonal antibody equated with the isotype labeled with PE / FITC. All monoclonal antibodies labeled with fluorescence were obtained from Becton Dickinson (San José, CA). Incubations were carried out in the dark at 4 ° C for 45 minutes using concentrations of saturating mAbs. The unincorporated label was removed by washing in PBS before analysis with a FACScan flow cytometer (Becton Dickinson). Antigen density was determined indirectly in mixed live cells and expressed as the fluorescence media channel (MCF). The expression on the surface of specific antigens (CD54, CD25) was represented as the mean channel deviation (MCS) obtained by subtracting the MCF from cells stained with control mAb (IgG1) equated with the FITC or PE labeled isotype of the MCF of the cells stained with mAb specific for the antigen labeled with FITC or PE. Alternatively, surface expression of the subset of CD4 * cells stained with CD28 mAb was determined by subtracting the MCF of CD28 * CD4 * from the MCF of CD28"CD4" cells. The viability of the control untreated and oligonucleotide-treated cells was determined in each batch of all the oligonucleotides in multiple donors by staining with vital dye, propidium iodide (final concentration of 5 μg / ml). The percentage of living cells that excluded propidium iodide was determined by flow cytometry and was > 90% (range 90-99%) after treatment with all batches of all oligonucleotides at a dose range of 1-20 μM (Figure 2).

Cytokine analysis The concentrations of human cytokine derived from the cells were determined in the cell supernatants of the first duplicated microplate. The mitogen-induced changes in interleukin-2 (IL-2) levels were determined using a commercially available ELISA kit (R &D systems Quantikine kit, Minneapolis, MN) or by bioassays using the IL-dependent cell lineages. -2, CTLL-2 (ATCC, Rocville, MD). The changes induced by the mitogen in the levels of interferon gamma and interleukin 8 (IL-8) were determined by ELISA using equipment from Endogen (Cambridge, MA) and R & D systems (Quantikine kit, Minneapolis, MN) respectively. All ELISA results were expressed as pg / ml and the CTLL-2 bioassay as counts per minute representing the cellular incorporation of 3H-thymidine IL-2.

(ICN, Costa Mesa, CA) by CTLL ^ 2 cells.

T cell proliferation assay The second duplicate of the microplate in all the experiments was analyzed for changes in the proliferation of T cells induced by the mitogen. 72 h after activation with anti-CD3 / PMA and in the absence or presence of oligonucleotides, the cells were pulsed with 1 μCi of 3 H-thymidine (ICN, Costa Mesa, CA) and incubated overnight at 37 ° C. the cellular growth induced by the mitogen, according to what was evaluated by the incorporation of the radioactive label, was determined by harvesting the cells and counting the flashes with a Wallac Betaplate counter (Wallac, Gaithersburg, MD).

Inhibition of CD28 expression in human T cells activated by oligonucleotides specific for CD28 Anti-CD3 / PMA treatment of human T cells increased the expression on the surface of CD28 (using immunofluorescence analysis) of an MCS of 122 ± 7.74 in resting cells at an MCS of 150 ± 9.27 (n = 9). The difference in the expression of CD28 in the resting cells and the activated T cells was defined as the expression of CD28 induced by the mitogen (Figure 3A). 3B and 3C show the treatment of anti-CD3 / PMA activated T cells with the forms of phosphorothioate (denoted as S oligomers, FIG. 3B) and phosphorothioate-3 'amine (denoted as oligomers A, FIG. 3C) of the oligonucleotides specific for CD28 and control in two donors and with two separate batches of each oligonucleotide. Of the four candidate oligonucleotides, RT01 RT04, (Table 1), in the dose range of 2-10 μM, both phosphorothioate and phosphorothioate-3 'amine forms of RT03 and RT04 were the most active inhibitors of CD28 expression induced by mitogen, both inhibited the expression of CD28 induced by more than 50% (CI </>) at 5 μM or less. Those two oligonucleotides, which differ in length, were designed to hybridize with a projection of double-stranded DNA, 5 'upstream of the transcription start site of the CD28 gene. No similar dose-dependent inhibition of CD28 expression induced by the mitogen was observed with the control oligonucleotides, RTC01 (SEQ ID NO: 5) - RTC06 (SEQ ID NO: 10) (Table 1). All experiments were carried out on at least three batches of each of the oligonucleotides using the T cells of 7 donors. The fact that oligonucleotide regulation of CD28 expression was demonstrable in human T cells is critical because peripheral, epidermal and dermal lymphocytes are the intended target of the oligonucleotides specific for CD28.

Inhibition of T cell proliferation induced by mitogen by oligonucleotides specific for CD28 The mitogenic effect of anti-CD3 / PMA treatment was demonstrated by the increase in proliferation observed after activation of resting T cells. The incorporation of 3H-thymidine, represented as counts per minute, was 301641 ± 47856 (n = 9) in the activated T cells and 650 ± 566 (n = 9) in the resting cells. The effect of anti-CD3 and PMA on the proliferation of T cells is synergistic as shown in Figure 4A. Figure 4B shows an experiment representative of the effect of the phosphorothioate oligonucleotides specific for CD28 and control on the proliferation of T cells activated with anti-CD3 / PMA. In at least 7 experiments separately, all in the dose range of 2-10 μM, both forms of phosphorothioate (data not shown) and phosphorothioate-3 'amine (Figure 4B) of RT03 and RT04 were the most active inhibitors of T cell proliferation induced by mitogen, inhibiting the proliferation of T cells by up to 45%. No similar dose-dependent inhibition of T-cell proliferation induced by the mitogen was observed with the control oligonucleotides, RTC01 (SEQ ID NO: 6) -RTC06 (SEQ ID NO: 10). Here, the treatment with specific oligonucleotides for CD28, RT03 and RT04, could reverse the hyperproliferation of activated T cells demonstrating in this way that the regulation of the CD28 pathway has a significant effect on the vital biological function of the activation of T cells, proliferation of T cells Inhibition of the production of cytokine derived from T cells activated by oligonucleotides specific for CD28 Activated T cells produce a variety of immunomodulatory cytokines including IL-2, interferon gamma and IL-8. The restriction elements inducible by CD28 for IL-2 and IL-8 have been demonstrated in promoter sequences for both genes and subsequently shown to be regulated via CD28 (Fraser et al., (1991) Science 251: 313-316, Seder et al., (1994) J Exp Med 179: 299-304). Gamma interferon has also been shown to be regulated by the CD28 pathway (Wechsler et al., J. Immunol., 1 ^ 3: 2515-2523 (1994)). Anti-CD3 / PMA treatment of resting T cells dramatically increases T-cell derived levels of all three other cytokines (Figures 5A, 6A and 7A). Figures 5, 6 and 7 respectively describe the effect of the phosphorothioate versions (B) and 3 'amine phosphorothioate of the oligonucleotides specific for CD28 and control on the production of IL-2, interferon gamma, and IL-8 in the activated T cells of the same representative donor. The oligonucleotides specific for CD28, RT03 (SEQ ID NO: 3) and RT04 (SEQ ID NO: 4) but not the control oligonucleotides, RTC01 (SEQ ID NO: 5) - RTC06 (SEQ ID NO: 10) (no data shown), inhibited the production of IL-2, interferon gamma, and IL-8 induced by the mitogen in activated T cells in a dose-dependent manner. Both forms of phosphorothioate (CI => 5 μM) and phosphorothioate-3 'amine (CI_0 10 μM) of the oligonucleotides specific for CD28 were equally active in the dose range 2-10 μM. Similar results were observed for the three cytokines with 4 or more different donors. These observations demonstrate that oligonucleotides specific for CD28 were also able to regulate the multiple effector molecules of the CD28 pathway of T cell activation.

Specificity of oligonucleotide inhibition of CD28 expression The specificity of the oligonucleotides specific for CD28, RT03 and RT04 was evaluated by the methods. (1) Markers of T-cell activation independent of CD28 The first method was to determine if those oligonucleotides specific for CD28 were capable of inhibiting the expression of other markers of activation of human T cells is that they act independently of the usual pathway of CD28. Activation of resting T cells significantly increases the expression of both the IL-2 receptor (CD25) and the intracellular adhesion molecule, ICAM-1 (CD54). However, both accessory molecules are regulated independently of the CD28 pathway (June et al., Mol Cell Biol., 7: 4472-4481 (1987), Damle et al., J. Immunol., 1_49: 2541 (1992 )). Figure 8 shows the effect of oligonucleotides specific for CD28 and control on the expression of CD25 (Figure 8A) and CD54 (Figure 8B) in mitogen-activated T cells. No significant decrease in the decrease of activated T cells of both CD25 and CD54 was observed after treatment with all oligonucleotides specific for CD28 and control in the dose range of 2-10 μM. This clearly demonstrates the specificity of the oligonucleotides specific for CD28 in the inhibition of target protein expression. (2) Lineage of negative CD28 T cells, HUT 78 The second method was to demonstrate that the path of CD28 was indeed the target for the oligonucleotides specific for CD28 by comparing IL-2 production induced by the mitogen in a cell line of T-cell leukemia in CD28 +, E6-1 of Jurkat and a cell lineage of T-cell lymphoma , CD28-, HUT 78. Figure 9A confirms the absence of the expression of CD28 in ar'-as resting and activated HUT 78 cells, while the constitutive levels of CD28 increase after activation in E6-1 cells of Jurkat (Figure 9B). Jurkat E6-1 cells of CD28 +, the oligonucleotides specific for CD28 but not for control were able to inhibit the expression of CD28 induced by mitogen Figure 9C) and also the production of IL-2 induced by mitogen (Figure 10B). In contrast, in the CD28-HUT 78 cells, the production of IL-2 induced by the mitogen was not affected by the oligonucleotides specific for CD28 and control (Figure 10A). This clearly shows the specificity of these oligonucleotides to only inhibit the production of IL-2 regulated by CD28. (3) Specific activation of the CD28 path The third method was to activate resting T cells specifically via the CD28 pathway using anti-CD28 monoclonal antibody in combination with mitogens (anti-CD3 / PMA) using identical protocols to those used in the activation of T cells with mitogens alone. The anti-CD28 mAb in combination with PMA or the anti-CD3 mAb had previously shown to provide the costimulatory signal for resting T cells and only promote the CD28-dependent and non-TCR-dependent increase of T cell proliferation and Cytokine production (June et al., (1987) Mol Cell Biol., 7: 4472-4481). The phosphorothioate and phosphorothioate-3'-amine versions of the oligonucleotides specific for CD28 but not the control ones were able to inhibit the activation dependent on the production of IL-2, IL-8 and interferon gamma dependent on CD28 and the proliferation of the T cells, in resting T cells activated by anti-CD28 / mitogen (data not shown). This clearly demonstrates that only oligonucleotides specific for CD28 act alone on the CD28 pathway of T cell activation.

EXAMPLES - SERIES 2 Oligonucleotides The oligonucleotides were synthesized with an Applied Biosystems 394 DNA synthesizer. The phosphorothioate linkages were introduced after the standard oxidation vessel was replaced with tetraethyluram / acetonitrile disulfide. The purity of the oligonucleotides was evaluated by analytical CLAP. All oligonucleotides with a purity of > 90% were lyophilized to dryness and reconstituted in water (400 μM). At least three batches of each of the oligomers listed in Tables 3 and 5 were used. The 5 'label of the oligonucleotides was made using T4 polynucleotide kinase and? 2P-? ATP.

Activation studies of T cells Peripheral blood mononuclear cells (PBMC) were isolated from healthy donors by density gradient centrifugation followed by enrichment of the T cells using Lymphokwik (One Lambda). The contaminating monocytes were removed by adhesion to the plastic. Purified T cells were > 99% CD2 +, < 1% HLA-DR + and < 5% CD25 \ Jurkat E6-1 T cells (CD28 + / CD4f) and cells T HUT 78 (CD28"/ CD4t) and the lineage of monocytic cells, THP were obtained from the ATCC.The cells were cultured at a concentration of 0.2 - 0.3 x 106 / well and activated with anti-CD3 monoclonal antibody immobilized on plate (Acm) (HIT3A 0.25 μg / ml) (Phar ingen) and 2 ng of phorbol 13-acetate 12-myristate (PMA) (Calbiochem).

Immunofluorescence studies The cells were cotiñeron with either Acm PE-CD28 / FITC-CD4 or PE-CD54 / FITC-CD25 or with controls isotype-labeled PE / FITC (Becton Dickinson). The density of the antigen on the surface of the cell (CD28, CD54, CD25) was confirmed with flow cytometry (FACScan, Becton Dickinson). Viability was assessed by exclusion of propyl iodide (5 μg / ml) in control untreated CD4 + cells and treated with multiple donor oligo and were typically > 90% (90-99% range) after 48 h incubation with 1 -10 μM of each of the batches of all the oligonucleotides.

Proliferation and cytokine assays The proliferative responses were evaluated by measuring the incorporation of 3H-thymidine (lμCi, ICN) during the last 16 h of each assay. Cells were harvested on filters and DNA synthesis was measured by following the flashing count on a Wallac Betaplate counter. Cytokine concentrations in the culture supernatants were tested using ELISA kits for IL-2, IL-8 (R & D Systems) and IFN-? (Endogen) or by bioassays using the IL-2-dependent cell lineage, CTLL-2 (ATCC).

RT-PCR and Southern Analysis The total cellular RNA was extracted using the Trizol reagent (GIBCO / BRL). The cDNA synthesis reaction (Promega) was carried out using an oligomeric (dT) ll primer; and inverted AMV transcriptase (H.C.). The PCR reaction kit (GeneAmp PCR kit, Perkin-Elmer Cetus) consisted of 50 μl of the mixture containing 3 μl of cDNA, dNTPs (each at 200 μM), 0.5 μM of each primer and 1 unit of Taq polymerase. . The primers used were the following: CD28, 5'-CTGCTCTTGGCTCTCAACTT-3 '(sense) and 5' AAGCTATAGCAA GCCAGGAC-3 '(antisense), alpha chain primers of the p55 receptor of interleukin 2 (Stratagene) and ribosomal gene pHE7 . Kao, H. T., Nevins, J.R. (1983) Mol. Cell. Biol. 3, 2058-2065. The amplification conditions were 45 seconds at 94 ° C, 1 minute at 57 ° C and 2 minutes at 72 ° C for 35 cycles, followed by 8 minutes at 72 ° C. The PCR products were separated on 2% agarose, transferred to a Hybond N + membrane (Amersham) in 20 X SSC overnight and immobilized using 0.4 M NaOH. The spots were hybridized with 32 P-labeled oligonucleotide probes. ATP. The spots 1 j.das were then analyzed using a Phosphorlmager.

MLR assay and T cells specific for alloantigen For MLR responses, they were cultured (1: 1) with PBMC treated with mitomycin C (50 μg / ml) of an individual shot in HLA. In assays of T cells specific for alloantigens, T cells isolated from PBMC from healthy donors primed with tetanus toxoid were cultured (1: 1) with PBMC treated with autologous mitomycin C in the presence of tetanus toxoid (2 μg / ml, List Biologicals). In both assays, 2 x 10 5 cells / well were cultured 6 days at 37CC before further analysis.

In vitro oligonucleotide stability studies Temporal oligonucleotide stability analyzes were performed as described previously (Tam, RC, Li, Y., Noonberg, S., H ang, DG, Lui, G. Hunt, CA, Garovoy, MR (1994) Nucleic Acids Res. 22, 977-986). The oligonucleotide degradation profiles were evaluated by electrophoresis and quantified using Nixprim columns.

Inhibition of CD28 expression by phosphorothioate oligonucleotides is specific and affects the function of activated T cells Figure 11 summarizes the effect of the phosphorothioate oligonucleotides of Table 3 on the surface expression of the accessory molecules and on the secretion of the cytokine in the activated T cells. The oligomers used were designed to hybridize to the 5 'untranslated region (UT) of the CD28 gene, and were either antisense (AS) or G-rich sequences. The control oligomers were either sequences of sense strands (SS ) or complementary thread (CS). After 48 hours treatment of resting T cells (R) with anti-CD3 antibody and PMA increased the expression (Ac) of the accessory molecules, CD28 (A), CD25 (B) and CD54® and the cytokines, IL-2 (D), IFN? (E) and IL-8 (F). The data was represented as the mean standard deviation of samples in triplicate. The cumulative effect of two additions (0 and 24h) of 2 μM (B), 5 μM (H) and 10 μM (BD) of the phosphorothioates in Table 3 on the T cell function induced by the activation was verified by immunofluorescence analysis (accessory molecules) and by the determination of secreted cytokine levels using the CTLL-2 (IL-2) and ELISA (IFN ?, IL-8) bioassay. The density of surface antigen (MCS) in living CD4 cells was measured as the increase in mean fluorescence size compared to the control IgGl. The 3 H-thymidine IL-2-dependent cellular incorporation was measured as counts per minute (cpm) and IFN? and immunoreactive IL-8 as pg / ml. The data shown, all derived from experiments performed on T cells isolated from a single donor, are representative of experiments from 9 separate donors.

Table 3. Phosphorothioate Oligonucleotides oligo Sequence (5 'to 3') Description SEQ ID NO RT01S TTG TGG TGA CGA TGG GCT AS 5 'UT 79-97 47 RT02S AGC AGC CTG AGC ATC TTT GT AS 5 'UT 94-113 43 RT03S TTG GAG GGG GTG GTG GGG 5 'UT 58-75 rich in G 44 RT04S GGG TTG GAG GGG GTG GTG GGG 5 'UT 58-75 rich in G 45 RTC01S TAG CCC ATC GTC AGG ACÁ A SS a RTOl 46 RTC02S ACÁ AAG ATG CTC AGG CTG CT SS to RT02 47 RTC06S AAC CTC CCC CAC CAC CCC CS to RT03 48 The data demonstrate that the selected phosphorothioate oligomers (Table 3) can specifically block the expression of CD28 induced by activation in CD4 T cells. "In a representative donor (Figure HA), CD28 expression induced by activation but not Expression of the IL-2 receptor (CD25) or the intracellular adhesion molecule 1 (ICAM-1 or CD54) was inhibited in a dose-dependent manner by the phosphorothioate oligomers, RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) (CIW <5 μM) NO similar inhibition was observed with the antisense oligomers, RT01S (SEQ ID NO: 42) or RT02S (SEQ ID NO: 43) or the control oligomers, RTCOIS (SEQ ID NO: 46), RTC02S (SEQ ID NO: 47) and RTC06S (SEQ ID NO: 48)., evidence was provided that active oligomers modulated CD28 induced activation by blocking the transcription of activated human T cells. At 10 μM, the RT03S (SEQ ID NO: 44) and the RT04S (SEQ ID NO: 45) but not the representative control oligo, RTC06S (SEQ ID NO: 48), reduced the expression of the CD28 levels induced by the activation but not of the 11-2 receptor mRNA (Figure 12). Figure 12 shows the effect of 10 μM phosphorothioate oligonucleotides on CD28 and CD25 mRNA levels. The CD28 and CD24 mRNA levels at rest (lane 1) and activated with anti-CD3 / PMA (6h), in the absence (lane 2) or presence of the oligonucleotides, RT03S (SEQ ID NO: 44) (lane 4) , RTC06S (SEQ ID NO: 64) (lane 5) and RT03D (SEQ ID NO: 49) (lane 6) were detected after RT-PCR of total cellular RNA and Southern analysis using radioactively specific labeled probes. The CD28 probe was derived from exon 2 (5'ACGGGGTTC AACTGTGATGGGAAATTGGGCAA-3 ') and for the IL-2 receptor, the probe was generated from the original primer mix. The equivalent charge was evaluated after hybridization with a probe generated from the sense primer pHE7. RNA from cell lines HUT (7) and T? P (8) deficient in CD28 were used as control. The data shown are representative of three separate experiments. Thus, the specific inhibition of CD28 mRNA levels by biologically active phosphorothioates parallels their effect on the CD28 surface protein. In addition, active oligomers abrogated the function of T cells induced by activation, such as RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) but not RT01S (SEQ ID NO: 42) or RT02S (SEQ ID NO: 43) or the control oligomers, RTCOIS (SEQ ID NO: 46), RTC02S (SEQ ID NO: 47) and RTC06S (SEQ ID NO: 48), did not significantly inhibit the synthesis induced by anti-CD3 / PMA of the cytokines, IL-2, IFN? and IL-8 by activated T cells (CI_ = 5 μM, range of 2 - 10 μM) (Figure 11B). Alternatively, costimulation pathways can also induce the synthesis of lymphokine in activated T cells (Damle, NK, Klussman, K., Linsley, PS, Aruffo, AJ Immunol., 148, 1985-1992), it was important to determine if the biological activity of RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) was specific for the expression of functional CD28. Accordingly, the effect of phosphorothioates on IL-2 production induced by anti-CD3 / PMA was compared in a cell lineage of T-cell leukemia, CD28f, T-cell lymphoma cell line E6-1 of Jurkat and a CD28 ~, HUT 78. As demonstrated in Figure 13, 48 h of treatment of resting cells (R) with anti-CD3 antibody and OMA increased the expression of CD28 (Ac) in Jurkat cells (A, right) but not in HUT 78 (To the left) . However, activation increased IL-2 production in Jurkat cells, (C, left), and HUT (D, left). The active oligonucleotides, RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45), at 1 μM (D), 2 μM (•), 5 μM (E_J) and 10 μM (D) inhibited the expression of the CD28 (B) and IL-2 levels (C, right) in activated Jurkat cells but had no effect on IL-2 secretion independent of CD28 in activated HUT 78 cells (D, right). The data shown are representative of these three experiments separately. In Figure 13A, immunocytofluorometric analysis confirmed the absence of CD28 expression in both resting and activated HUT 78 cells, whereas the constitutive levels of CD28 were increased by activation in Jurkat E6-1 cells. In addition, in the E6-1 cells of Jurkat, the RT03S (SEQ ID NO: 44) and the RT04S (SEQ ID NO: 45) (1 lOμM range) significantly inhibited CD28 expression induced by activation (Figure 13B) and the production of IL-2 (Figure 13C). in contrast, although activated HUT 78 cells produced similar levels of IL-2, no comparable oligo-dependent inhibition of this lymphokine was observed (Fig. 13D). It was also shown that activation of T cells (expression of CD28, IL-2, IL8 and IFNα) directed by a specific anti-CD28 mAb in combination with anti-CD3 was blocked by the biologically active phosphorothioate oligomers ( the data is not shown). It has previously been shown that direct cross-linking of CD28 molecules promotes only CD28-dependent and non-TCR-dependent increase of T cell proliferation and cytokine production (June, C.H., Ledbetter, J.A., Gillespie, M.M., Lindsten, T., Thompson, C.B. (1987) Mol. Cell. Biol. 7, 4472-4481). Taken together, the data strongly suggest that the bioactivity of the active oligomers was specific to the CD28 pathway of T cell activation.

Inhibition of T cell proliferative responses in alloantigen-dependent T-cell assay and reaction of primary allogeneic mixed lymphocytes by phosphorothioate oligonucleotides The effectiveness of the oligonucleotides specific for CD28, RT035 (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) in blocking the primary immune responses specific for the in vi tro antigen was then compared. In Figure 14, the resting (A, B) and activating (E, F) levels of CD28 are indicated for the test of T cells specific for tetanus toxoid (upper panel, A and B) and the lymphocyte reaction. mixed (lower panel, E and F). The percentages of CD4 + T cells, CD28-hi, are shown in the right marker for A, B, E and F. The activity of the oligomer was evaluated by the potential of two additions (0 and 96h) of 1 μM (D ) 2 μM (_.), 5 μM (9) and 10 μM (O) of phosphorothioate oligonucleotide from Table 1 to reduce the percentage of T cells expressing CD28-hi (C, G) and cell proliferation T activated (D, H) in each trial. Activation of T cells was induced in response to tetanus toxoid (upper panel) or after stimulation of responding T cells (X) by stimulatory PBMC treated with mitomycin s (Y) (lower panel).

These data are representative of three separate experiments. In Figure 14, using both T-cell assays specific for tetanus toxoid (Figure 14B) and reaction of primary mixed lymphocytes (Figure 14F), the appearance of a subpopulation of T cells expressing CD28-hi-induced activation was observed. after a period of 6 days of testing. The addition of RT03S (SEQ ID NO: 44) and RT04S (SEQ ID NO: 45) (2-10 μM) resulted in a dose-related decrease in CD28-hi expression (Figures 14C, 14G) and a corresponding decrease in the proliferation of T cells specific for tetanus toxoid (Figure 14D) and specific for the antigen of the responding T cells (Figure 14H). No similar effect was observed with RT01S (SEQ ID NO: 42) or the control oligomers, RTCOIS (SEQ ID NO: 46), RTC02S (SEQ ID NO: 47) or RTC06S (SEQ ID NO: 48).

In vitro oligonucleotide stability extends the biological activity of phosphorothioate oligonucleotides It is known that modification of the oligonucleotides with phosphorothioate internucleotide linkages can impart nuclease resistance and thus extend bioactivity within 1-2 hours to 24 hours (Stein, CA, Cheng, YC (1993) Science 261, 1004 -1012). Table 4 shows the temporal effect of the phosphorothioates, RT03S (SEQ ID NO: 44) and RTC06S (SEQ ID NO: 48) on the expression on the surface of CD28 in the continuous presence ® or after the removal of the oligonucleotide from the extracellular medium day 2 (D). Verification was carried out by immunofluorocytometry. The results were expressed as the difference in the expression of antigen on the surface of activated T cells (MCFA) and activated T cells treated with oligonucleotide (MCF). Expression of CD28 in resting T cells on days 2 to 4 was in the range of 119-121. "ND" represents non-distinguishable differences.

Table 4. Temporal activity of phosphorothioates after treatment with continuous or discontinuous oligonucleotide Difference of CD28 expression (MCFA-MCFX) RT03S (SEQ ID RT06S 8SEQ ID NO: 44) NO: 47) MCFA Day 0 5 10 0 5 10 2 144.8 18.4 9. 3 1. 9 1. 7 ND 3 C 135.6 21.9 15.9 5. 1 ND ND 3. 2 3 D 136.8 18.3 11.8 7. eleven . 7 3. 8 1 4 C 128.9 18.2 9.7 6. 1 ND ND ND 4 D 130.1 2.3 ND ND ND ND ND As shown in Table 4, the duration of the effect of RT03S (SEQ ID NO: 44) exceeded 24 h and persisted through days 2, 3 and 4, in relation to the dose of oligomer. However, after the removal of RT03S (SEQ ID NO: 44), from the extracellular medium on day 2, the inhibitory activity remained for 24 h and was completely abolished within the following 24 h. No oligomer activity was observed with a representative oligocontrol RTC06S (SEQ ID NO: 48) during the same time course. A similar phenomenon was observed with oligo-mediated inhibition of the proliferation of activated T cells (data not shown). The increased bioavailability provided by the modification with phosphorothioate alone can not contribute to the remarkably prolonged bioactivity of RT03S (SEQ ID NO: 44). Therefore, it was demonstrated that the prolonged duration of the effect was associated with the additional stability in vi tro provided by the secondary structure of the RT03S (SEQ ID NO: 44). Figure 15 summarizes the test results on the stability in vi tro of the 32P labeled phosphorothioates, RT03S (SEQ ID NO: 44) and RTC06S (SEQ ID NO: 48) in extracellular supernatants (upper panel) and used cell Jurkat (lower panel). (A) Time-dependent degradation (0-96 h) of each oligonucleotide (2000 cpm) was evaluated by electrophoresis on a 20% polyacrylamide denaturing gel followed by visualization using Phosphorlmager. (B) The percentage of 32P-RT03S (SEQ ID NO: 44) (O) and 32P-RTC06S (SEQ ID NO: 48) (•) intact full length remaining at each time point, relative to t = 0, it was determined in the eluates of 10000 cpm of extracellular supernatants and the cellular ones were applied through Nickspin columns (Pharmacia). The molecular weight (Std), 32P-dNTP (N) free standards of "P-orthophosphate (P) were analyzed simultaneously." In Figure 15A, the electrophoregrams clearly show that, for both extracellular (S) and cellular ( L), there remained considerably more RT03S labeled with 32P (SEQ ID NO: 44) than RTC06S (SEQ ID NO: 48) after a 96h incubation with Jurkat cells, Consistent with this observation are the data from the Nickspin column (FIG. 15B) Here, the percentage of intact oligomer recovered from RT03S (SEQ ID NO: 44) after 96h was 54% (S) and 59% (L) of RTC06S (SEQ ID NO: 48) was 10% ( S) and 34% (L) In addition, the secondary structure alone is not sufficient to consider the increased nuclease resistance and the duration of the bioactivity of RT03S (SEQ ID NO: 44) since its phosphodiester counterpart, RT03D had little bioactivity (Table 5) and stability studies in vi tro, only had a life average of 24h (data not shown).

Table 5. Identification of the oligonucleotide sequence responsible for the inhibition of CD28 expression and the production of CD28-dependent IL-2 * Relative inhibition of the expression Oligo Sequence CD28 IL-2 SEQ ID NO: RT03S (D) TTG GAG GGG GTG GTG GGG 100 (3) 100 (44) 44 (49) RT11S GGG GAG GAG GGG CTG GAA 100 100 50 RT04S GGG TTG (GAG GGG GTG GTG GGG 123 100 45 RT05S TTG GAG GGG GAG GAG GGG 136 100 51 RT09S TTG GAG GGG GAG GTG GGG 126 100 52 RT10S TTG GAG GCG GTG GTG GCG 31 38 53 RT24S TTG GAG CCG GTG GTG GCC 40 57 54 RT25S TTG GAG GGG CTC CTC GGG 44 25 55 RT23S TTG GAG CCG GTG GTG G 38 57 56 RT18S GGG GTG GTG GGG 103 120 57 RT19S G GGG TTG GGG 30 89 58 RTC07S TG GGG 2 2 59 RTC08S G GGG 2 2 60 RT20S CAC TGC GGG and GAG GGC TGG GG 58 76 61 RT21S ATG GGG TGC ACA AAC TGG GG 51 63 62 RT15S AAC GTT GAG GGG CAT 26 52 63 RT06S TTC CAG CCC CTC CTC CCC 29 22 64 RTC06S AAC CTC CCC CAC CAC CCC 4 2 48 In the preparation of the data for Table 5, the in vitro activity of the phosphorothioate oligonucleotides was determined by their ability to inhibit the expression of CD28 in peripheral human T cells activated with anti- CD3 / PMA and its effect on the production of activated IL-2 in Jurkin T cells. The results were expressed in relation to the activity of 5 μM of RT03S (SEQ ID NO: 44) (100%) whose inhibition interval in 7 experiments was 52-79% of CD28 expression and 76-89% of the production of IL-2. Values for the phosphodiester form of RT03D (SEQ ID NO: 49) are in parentheses.

Identification of the minimum sequence that confers biological activity in vitro.

The active phosphorothioate, RT03S (SEQ ID NO: 44), is an 18-mer originally designed to hybridize to the 5 'untranslated region of the human CD28 gene, and has a sequence containing two sets of four continuous Gs. To identify the critical sequence-related factors for the inhibition of CD28 expression induced by activation in human T cells and the production of CD28-dependent IL-2 in Jurkat T cells, bases were added, suppressed or selectively substituted. of RT03S (SEQ ID NO: 44) and the activity was evaluated in relation to the oligomer of origin (Table 5). The addition of three G at the 5 'end (RT04S) or one or more changes from T to A in the region between both four G sequences (RT05S (SEQ ID NO: 51), RT09S (SEQ ID NO: 52)) did not reduce the inhibitory effect in relation to RT03S (SEQ ID NO: 44). Interestingly, the sense sequence (RT11S (SEQ ID NO: 50)) also showed no change in activity in relation to RT03S (SEQ ID NO: 44). However, in contrast, the deletion or replacement of one or more G by cytosine (C) within both sets of four G's (RT10S (SEQ ID NO: 53), RT24S (SEQ ID NO: 54), RT25S (SEQ ID NO: 55), (RT23S (SEQ ID NO: 56) (SEQ ID NO: 56)) resulted in a remarkable loss of activity relative to RT03S (SEQ ID NO: 44) .The deletion of six residues 5 'of the first four G's in RT03S (SEQ ID NO: 44) had no effect on the inhibitory activity of the oligonucleotide (RT18S (SEQ ID NO: 57)) In contrast, reducing (RT18S (SEQ ID NO: 58) or increasing (RT20S (SEQ ID NO: 61), RT21S (SEQ ID NO: 62)) the number of residues between both sequences of four G dramatically reduced the inhibitory activity relative to RT03S (SEQ ID NO: 44) .GTGGG, GGGG or sequences that contain 4 consecutive Gs such as RT15S (SEQ ID NO: 63) had little or no inhibitory activity relative to RT03S (SEQ ID NO: 44) .These data demonstrated that the biological activity of RT03S (SEQ ID NO: 44) depends on a specific sequence motif comprised of two sets of 4 G contiguous separated by 3 - 5 residues. In view of the tolerogenicity imparted by disturbance of CD28 function (Boussiotis, VA, Freeman, GJ, Gray, G., Gribben, J., Nadler, LM (1993) J. Exp. Med. 178, 1753-1763 .), it was important to examine whether the inhibition of CD28 expression mediated by oligo could provide a more effective strategy to induce allergy in T cells and specific tolerance to alloantigen in vi tro. It was shown that the phosphorothioate oligomers, RT03S (SEQ ID NO: 4 l) and RT04S, inhibited the expression of CD28 induced by anti-CD3 / PMA in human CD4 T cells by reducing the levels of both mRNA and pure protein in relation to the dose of oligomer . In addition, to demonstrate the specificity of the target, the effects mediated by oligomers on the IL-2 receptor and ICAM-1 expression were examined: two accessory molecules are known that are regulated independently of the CD28 pathway (Damle, N. k., Et. al., (1992) J. Immunol. 148, 1985-1992; June, C.H. et al. , (1987) Mol. Cell Biol. 7, 4472-4481; ptein, C. A., et al. , Y.-C. (1993) Science 261, 1004-1012; Boussiotis, V.A., et al. , (1993) J. Exp. Med. 178, 1753-1763). Correspondingly, the activated message and protein levels of CD25 and the expression on the surface of CD54 were resistant to the action of the oligomer.

Co-stimulation via the CD28 pathway directly induces the expression of immunodulatory cytokines such as IL-2, IFN? and IL-8 in activated T cells (Fraser, J. d., et al., (1991) Science 251, 313-316 Jenkins, MK, et al., (1991) J. Imuno1.147, 2461-2466; Seder, RA, et al., (1994) J. Exp. Med. 179, 299-304; Wechsler, A. S., et al. , (1994) J. Immunol. 153, 2515-2523). For the tolerogenicity to be successful, oligomers specific for active CD28 must abrogate this function. The administration of active oligomers results in the concomitant modulation of the production of IL-2, IFNα. and IL-8 induced by activation. To underline the exquisite specificity of the active oligomers to inhibit the CD28-dependent functions, it was shown that they were able to prevent the production of IL-2 induced by activation in a cell line deficient in CD28, HUT 78. In addition, the inhibition mediated by the maximal oligomer of IL-8 production in activated T cells never exceeded 50%, suggesting that an alternative regulatory pathway that directs the production of IL-8 independently of CD28 was preserved. Oligomer activity was not restricted to polyclonally activated T cells, since inhibition of CD28 levels induced by activation resulted in a dramatic reduction in T cell proliferation in both MLR and specific T cell assays for tetanus toxoid. Thus, the active oligomers mediated the alloantigen specific tolerance in vi tro, and provide a promising alternative to the capture strategy of the ligand to induce a hyperresponse in T cells as observed with CTLA 4 Ig, with high affinity binder B7 (Tan, P., Anasetti, C, Hanen, JA, Melrose, J., Brunvand, M., Bradshaw, J., Ledbetter, JA, Linsley, PS (1993) J. Exp. Med. 177, 165-173 .). In the determination of the duration of the effect of the active acofro far, it was observed that the RT03S (SEQ ID NO: 44) showed a surprisingly persistent inhibition of both the expression of the activated CD28 and the proliferation of the T cells dependent on the CD28, a 96h after the oligomer treatment. The bioactivity was not related to the toxicity since after the oligomer was removed the complete regression of the inhibitory activity occurred within 24 hours. In addition, after comparison of the phosphorothioates, RT03S (SEQ ID NO: 44) and RTC06S (SEQ ID NO: 48), the stability studies, in vi tro showed that the secondary structure, mediated by the G-rich sequence in the RT03S SEQ ID NO: 44), the resistance to the typical nuclease associated with the phosphorothioates was increased two to four times (Stein, CA, Cheng, YC (1993) Science 261, 1004-1012.). The prolonged half-life (96h) of the P-RT03S (SEQ ID NO: 44) correlated with its duration of bioactivity. In addition, RT03D, the phosphodiester counterpart of RT03S (SEQ ID NO: 44), exhibited reduced stability and bioactivity in vi tro, an observation that is consistent with previous reports (Maltese, J.-Y., Sharma, HW , Vassilev, L., Narayanan, R. (1995) Nucleic Acids Res. 23, 1146-1151). Therefore, the stability imparted by the secondary structure is not only responsible for the increased bioactivity of RT03S (SEQ ID NO: 44). Thus, the nuclease stability afforded by both phosphorothioate modifications and the secondary structure may contribute to the prolonged inhibitory activity of RT03S (SEQ ID NO: 44). A single substitution of a base pair in antisense and antigen-dependent hybridization models can virtually abolish activity (Maltese, J.-Y., Sharma, H. W., Vassilev, L., Narayanan, R. (1995) Nucl ei c Acíds Res. 23, 1146-1151.). In contrast, the activity of the oligomers specific for CD28 was only dramatically reduced if the sequential substitution of both sets of four G occurred, which implies defined structural requirements for the formation of the oligomer. In addition, after cationic stabilization (KCl and 100 mM NaCl) of the secondary structure present in RT03S (SEQ ID NO: 44), the melting curve of the oligomer showed a transition profile (data not shown), which suggests the formation of a quadrate of G (Hardin, C. C, Watson, T., Corregan, M., Bailey, C. (1992) Biochemistry 31, 833-841). Taken together, the data provide evidence that this class of oligomers specific for CD28 acts via an independent hybridization mechanism and that the secondary structure of the sequence as possibly through the formation of the G quartet delimits the activity of the oligomer. Similarly, Bennett, CF, Chiang, MY, Wilson-Lingrado, L., Wyatt, JR (1994) Nucleic Acids Res, 22, 3202-3209, demonstrate that the activity of their phosphorothioate oligomers was based on the possible formation of a quartet of G in sequences containing two sets of three or more consecutive Gs and this suggested that the regulation mediated by the oligomer of human phospholipase A2 was through an aciducleic-specific protein interaction. Specific recognition of the protein by a range of quartet structures of G has been demonstrated in telomeres, centromeres (Blackburn, EH (1990) J. Biol, Chem. 265, 5919-5921), immunoglobulin switching regions (Chimizu, A ., Hoonjo, T. (1984) Cell 36, 801-803) and a class of regulatory oligomers called aptamers (Bock, L. C, Griffin, L. C, Latham, JA, Vermaas, EH, Toóle, JJ (1992 ) Nature 355, 564-566; Huizenga, D.E., Szostak, J.W. (1995) Biochemistry 34, 656-665; Bergan, R., Connell, Y., Fahmy, B., Kyle, E., Neckers, L. (1994) Nucleic Acids Res. 22, 2150-2154). In our studies as well as in the oligomers capable of forming the intermolecular four-strand G quartet structure of a set of four contiguous Gs, such as that of the telomeres (Smith, FW, Feigon, J. (1992) Nature 356, 164 -167), slightly inhibited the expression of CD28. An example of this was RT15S (SEQ ID NO: 63, whose G-rich sequence was previously demonstrated by others that inhibit the expression of c-myc (sequence 14 in Burgess, TL, Fisher, EF, Ross, SL, Bready , JV, Qian, Y.-X., Baye itch, LA, Cohen, AM, Herrera, CJ, Hu, SS-F., Kramer, TB, Lott, FD, Martin, FH, Pierce, GF, Simonet, L ., Farrel, CL (1995) Proc. Nati, Acad. Sci. USA 92, 4051-4055) Another G-rich structure, the intramolecular G quartet, has been shown to mediate the aptameric inhibition of thrombin (Wang, KY, McCurdy, S., Shea, RG, Swaminanthan, S., Bolton, PH (1993) Biochemistry 32, 1989-1904; Macaya, RF, Schultze, P., Smith, FW, Roe, JA, Feigon, J. (1993) Proc. Nati, Acad. Sci. USA 90, 3745-3749) The sequential analysis of the RT03S (SEQ ID NO: 44) predicts that the paired G of residues 3 - 4, 7 - 8, 12 - 13 and 16 - 17 can potentially form such a quartet structure of G. However the removal of Residues 1-6 (RT18S (SEQ ID NO: 57)), which disrupts the intramolecular quartet, was not effective in blocking the inhibition of CD28 expression and CD28-dependent production of IL-2. These data suggest that the activity of RT03S (SEQ ID NO: 44) arises from an alternative G quartet structure. The RT03S (SEQ ID NO: 44) actually has a 12 serum sequence similar to that of a motif predicted by others (Smiith, FW, Feigon, J. (1993) Biochemistry 32, 8682-8692) which is essential for training of the quartet of G. The dimeric G quartets can arise from two strands of DNA, alternately parallel and antiparallel. Here, the adjacent strands contribute four G to form four stacked G quatrains. One motif on each female with which it consists of 12 residues with four bases separating two sets of four contiguous Gs, was associated with formation and stability. It has been shown that the core sequence 12 of the nucleus (RT18S (SEQ ID NO: 57)) has an activity similar to that of RT03S (SEQ ID NO: 44). Also the substitutions from G to C (RT10S (SEQ ID NO: 53), RT23S (SEQ ID NO: 56), RT24S (SEQ ID NO: 54), RT25S (SEQ ID NO: 55)) within both regions of four G resulted in a 56-69% loss of inhibitory activity relative to RT03S (SEQ ID NO: 44). Likewise, the insertion (RT20S (SEQ ID NO: 61), RT21S (SEQ ID NO: 62) or deletion (RT19S (SEQ ID NO: 58)) of the bases separating the sets of G reduced the relative bioactivity by 52 - 70% Taken together, these data suggest that the specific sequence motif, as well as the ability to form a dimeric G quartet, is critical for the inhibition mediated by the phosphorothioate oligomer of functional CD28 expression. The mechanism by which this type of dimeric G quartet exerts its biological effect is unknown, however, several lines of evidence support the hypothesis that this motive allows the active oligomers to function as decoys, presumably by competitively preventing the interaction of a promoter sequence of dimeric G quartet with a specific transcription factor 1) An oligomer corresponding to a region upstream of the CD28 gene (RT11S (SEQ ID NO: 50)) exhibited biol activity logic equivalent to that of RT03S (SEQ ID NO: 44). 2) The active oligomers function via a non-antisense mechanism. 3) Those oligomers modulated the expression of CD28 mRNA; consequently its biological activity was not related to the interaction of the direct target protein. 4) The G-rich promoter regions are prevalent (Evans, T., Schon, E., Grazyna, G.M., Patterson, J., Efstratiadis, A. (1984) Nucleic Acids Res, 12, 8043-805; Kilpatrick, M.W., Torri, A., Kang, D.S., Engler, J.A., Wells, R.D. (1986) J. Biol. Chem. 261, 11350-11354; Clarck, S. P., Lewis, C.D., Felsenfeld, G., (1990) Nucleic Acids Res. I89, 5119-5126), increasing the possibility that the promoter sequences that make up the G quartet are a general regulatory phenomenon. 5) The double-stranded oligomers can act as decoys for the transcription factor, E2F (Morishita, R., Gibbons, GH, Horuchi, M., Ellison, KE, Nakajima, M., Zhang, L., Kaneda, Y ., Ogihara, T., Szau, VJ (1995) Proc. Nati, Acad. Sci. USA 92, 5855-5859). 6) G-rich oligomers have been shown to mediate the induction of the transcription factor polynucleotide sequence (Perez, JR, Li, Y., Stein, CA, Maju der, S., van Oorschot, A., Narayanan, R. (1994 ) -roe Nati, Acad. Sci. USA 91, 5959-5961).

INCORPORATION AS A REFERENCE All patents, patent applications, and cited publications are incorporated herein by reference.

EQUIVALENTS It is considered that the above written specification is sufficient to enable one skilled in the art to practice the invention. In fact, several modifications of the above described are made to carry out the invention, which are obvious to those skilled in the art of organic chemistry or related fields within the scope of the following claims.

It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, which is clear from the present description of the invention. Having described the invention as above, property is claimed as contained in the following:

Claims (26)

1. An oligomer capable of reducing the expression of the CD28 gene in a T cell.

2. The oligomer according to claim 1, characterized in that the oligomer is capable of hybridizing to a transcript of the CD28 gene.

3. The oligomer according to claim 2, characterized in that the oligomer is hybridized to the initiation codon of CD28.

4. The oligomer according to claim 1, characterized in that the oligomer is capable of hybridizing to a CD28 gene.

5. The oligomer according to claim 4, characterized in that the oligomer is hybridized to a transcript of the start codon of CD28.

6. The oligomer according to claim 1, characterized in that the oligomer comprises at least 11 nucleic acid bases and no more than 50 nucleic acid bases.

7. The oligomer according to claim 1, characterized in that the oligomer is a DNA or RNA molecule.

8. The oligomer according to claim 1, characterized in that it has less than 22 bases and includes the sequence 5 'TTGTCCTGACGATGGGCTA3', (SEQ ID NO: 1).

9. The oligomer according to claim 1, characterized in that it has less than 22 bases and includes the sequence 5? GCAGCCTGAGCATCTTTGT3 ', (SEQ ID N0: 2).

10. The oligomer according to claim 1, characterized in that it has less than 22 bases and includes the sequence 5 'TTGGAGGGGGTGGTGGGG3', (SEQ ID NO: 3).

11. The oligomer according to claim 1, characterized in that it has less than 22 bases and includes the 5 'sequence GGGTTGGAGGGGGTGGTGGGG3', (SEQ ID NO: 4).

12. The oligomer according to claim 1, characterized in that it has a phosphorothioate skeleton with 11 to 50 bases comprising at least two GGGG sequences separated by 3 to 5 bases.

13. A method for treating a disease which is at least partially mediated by Cd28, the method is characterized in that it comprises the steps of: administering to a patient an effective amount of an oligomer according to claim 1.

14. A method for treating a disease which is at least partially mediated by CD28, the method is characterized in that it comprises the step of: administering to a patient an effective amount of an oligomer of an oligomer having from 11 to 50 bases comprising minus two GGGG sequences separated by 3 to 5 bases.

15. The method according to claim 13, characterized in that the oligomer comprises the sequence 5 'TTGGAGGGGGTGGTGGGG3' (SEQ ID NO: 3).

16. The method according to claim 13, characterized in that the oligomer comprises the sequence 5'GGGTTGGAGGGGGTGGTGGGG3 ', (SEQ ID NO: 4).

17. The method according to claims 12-15, characterized in that the administration step further comprises the following steps: removing cells expressing CD28 from a patient; introducing the oligomer into such cells whereby oligomer-transformed cells are produced, and returning such cells transformed with oligomer to the patient.

18. The method according to claims 12-15, characterized in that the administration step further comprises the following steps: removing cells expressing CD28 from a donor; introducing the oligomer into such cells whereby oligomer-transformed cells are produced, and introducing such oligomer-transformed cells into the patient.

19. The method according to claims 12-15, characterized in that the oligomer is produced by transcription of an expression vector.

20. A vector of recombinant expression, the vector is characterized in that it comprises, in operable combination, a promoter, and a polynucleotide sequence that codes for an oligomer capable of inhibiting the inducible expression of CD28 in a T cell.

21. A pharmaceutical formulation, characterized in that it comprises an oligomer according to claim 1.

22. The pharmaceutical formulation according to claim 17, characterized in that the oligomer is 11 to 50 bases in length and comprises at least two GGGG sequences separated by 3 to 5 bases.

23. The pharmaceutical formulation according to claim 17, characterized in that the oligomer is 18 to 50 bases in length and comprises the sequence 5'TTGGAGGGGGTGGTGGGG3 '(SEQ ID NO: 3).

24. The pharmaceutical formulation according to claim 17, characterized in that the oligomer is 18 to 50 bases in length and comprises the sequence 5'GGGTTGGAGGGGGTGGTGGGG3 \ (SEQ ID NO: 4).

25. A pharmaceutical formulation, characterized in that it comprises at least two different oligomers according to claims 17-20.

26. The pharmaceutical formulation according to claims 17-21, characterized in that the formulation is adapted for parenteral administration. SUMMARY OF THE INVENTION Methods and compositions for the treatment of diseases mediated by the immune system are provided. The compositions of the invention have the property of reducing the expression of CD28 in the cells of interest to moderate the pathogenic effects on the immune system in a disease mediated by the immune system. The compositions of the invention include one or more different oligomers capable of reducing the expression of CD28. One aspect of the invention provides oligomers capable of reducing the expression of CD28 by interfering with the expression of CD28. Oligomers of the invention may be DNA, RNA, or various analogs thereof, and may include 14-50 basic phosphorothioates having at least two GGGG sequences separated by 3 to 5 bases. Another aspect of the invention provides genetically engineered vectors for the intracellular expression of the oligomers of the invention in the cells of interest. Another aspect of the invention is to provide pharmaceutical formulations comprising one or more other oligomers of the invention. The pharmaceutical formulations can be adapted for various forms of administration to the body or administration to the cells to be reintroduced to the body. Another aspect of the invention is to provide methods for the treatment of diseases mediated by the immune system. The methods of the invention involve modulating CD28 expression by administering an effective amount of the oligomers of the invention. Methods of the invention include methods for treating autoimmune diseases, methods for reducing inflammation, response, methods for reducing the production of selected cytokines, methods for inactivating T cells, and methods of immunosuppression of a transplanted patient. Another aspect of the invention provides formulations comprising one or more other oligomers of the invention. The formulations can be adapted for various forms of administration to the body or administration to the cells to be reintroduced into the body. Another aspect of the invention provides methods for the treatment of diseases mediated by the immune system. The methods of the invention involve modulating the expression of CD28 through the use of the oligomers of the invention. The methods of the invention can be used to treat diseases mediated by the immune system. Methods of the invention include methods for treating autoimmune diseases, methods for reducing an inflammatory response, methods for reducing the production of selected cytokines, methods for inactivating T cells, and methods for immunosuppressing a transplanted patient.