RU2839373C1 - RECOMBINANT PLASMID pVEAL3-XBB.1.5, WHICH PROVIDES SYNTHESIS AND SECRETION OF RECEPTOR-BINDING DOMAIN RBD S OF SARS-CoV-2 PROTEIN OF VARIANT XBB.1.5, AND RECOMBINANT STRAIN CHO-XBB.1.5 - PRODUCER OF RECEPTOR-BINDING DOMAIN RBD S PROTEIN SARS-CoV-2 VERSION XBB.1.5 INTENDED FOR PRODUCING IMMUNOBIOLOGICAL PREPARATIONS - Google Patents

RECOMBINANT PLASMID pVEAL3-XBB.1.5, WHICH PROVIDES SYNTHESIS AND SECRETION OF RECEPTOR-BINDING DOMAIN RBD S OF SARS-CoV-2 PROTEIN OF VARIANT XBB.1.5, AND RECOMBINANT STRAIN CHO-XBB.1.5 - PRODUCER OF RECEPTOR-BINDING DOMAIN RBD S PROTEIN SARS-CoV-2 VERSION XBB.1.5 INTENDED FOR PRODUCING IMMUNOBIOLOGICAL PREPARATIONS Download PDF

Info

Publication number
RU2839373C1
RU2839373C1 RU2024134681A RU2024134681A RU2839373C1 RU 2839373 C1 RU2839373 C1 RU 2839373C1 RU 2024134681 A RU2024134681 A RU 2024134681A RU 2024134681 A RU2024134681 A RU 2024134681A RU 2839373 C1 RU2839373 C1 RU 2839373C1
Authority
RU
Russia
Prior art keywords
xbb
protein
cov
sars
coordinates
Prior art date
Application number
RU2024134681A
Other languages
Russian (ru)
Inventor
Анастасия Александровна Исаева
Наталья Вячеславовна Волкова
Дмитрий Николаевич Щербаков
Валентина Сергеевна Несмеянова
Original Assignee
Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФБУН ГНЦ ВБ "Вектор" Роспотребнадзора)
Filing date
Publication date
Application filed by Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФБУН ГНЦ ВБ "Вектор" Роспотребнадзора) filed Critical Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФБУН ГНЦ ВБ "Вектор" Роспотребнадзора)
Application granted granted Critical
Publication of RU2839373C1 publication Critical patent/RU2839373C1/en

Links

Abstract

FIELD: biotechnologies.
SUBSTANCE: what is described is a recombinant plasmid genetic construct pVEAL3-XBB.1.5 providing synthesis and secretion of the receptor-binding domain RBD S protein of SARS-CoV-2 variant XBB.1.5 in CHO-K1 cells having the nucleotide sequence SEQ ID NO: 1, comprising elements in accordance with the physical and genetic map presented in Fig. 1. Recombinant strain of cells of Chinese hamster ovary CHO-XBB.1.5 – producer of receptor-binding domain RBD S protein of SARS-CoV-2 variant XBB.1.5 – is obtained by co-transfection of said cells with recombinant plasmid pVEAL3-XBB.1.5 according to cl. 1 and plasmid pCMV(CAT)T7-SB100, encoding transposase SB 100.
EFFECT: what is described is a recombinant plasmid genetic construct pVEAL3-XBB.1.5 providing synthesis and secretion of the receptor-binding domain RBD S protein of SARS-CoV-2 variant XBB.1.5 in CHO-K1 cells.
2 cl, 2 dwg, 1 tbl

Description

Изобретение относится к рекомбинантной плазмиде pVEAL3-XBB.1.5, обеспечивающей синтез и секрецию рецептор-связывающего домена RBD S белка SARS-CoV-2 вариант ХВВ.1.5, и рекомбинантному штамму СНО-ХВВ.1.5 - продуценту рецептор-связывающего домена RBD S белка SARS-CoV-2 вариант ХВВ.1.5 и может быть использовано в биотехнологии и генетической инженерии для создания иммунобиологических препаратов, к которым относятся средства диагностики и профилактические вакцины против SARS-CoV-2 вариант ХВВ.1.5.The invention relates to the recombinant plasmid pVEAL3-XBB.1.5, which provides the synthesis and secretion of the receptor-binding domain of the RBD S protein of SARS-CoV-2 variant XBB.1.5, and the recombinant strain CHO-XBB.1.5, a producer of the receptor-binding domain of the RBD S protein of SARS-CoV-2 variant XBB.1.5, and can be used in biotechnology and genetic engineering to create immunobiological preparations, which include diagnostic tools and prophylactic vaccines against SARS-CoV-2 variant XBB.1.5.

Уровень техники. Вариант ХВВ.1.5 SARS-CoV-2 является примером межлинейной рекомбинации подвариантов линии ВА.2 Омикрона. Он обладает высокой контагиозностью вследствие большого количества произошедших мутаций в S-белке ХВВ.1.5. Первичные структуры S-белка уханьского варианта и варианат ХВВ.1.5 различаются примерно по 45 аминокислотам [1]. Из-за большого количества мутаций в белке-шипе вариант Омикрон и его потомки, в частности ХВВ. 1.5, антигенно отличаются от других вариантов SARS-CoV-2, что требует обновления существующих вакцин [1, 2].State of the art. The SARS-CoV-2 variant XVB.1.5 is an example of interlineage recombination of subvariants of the Omicron BA.2 lineage. It has high contagiousness due to a large number of mutations in the XVB.1.5 S protein. The primary structures of the S protein of the Wuhan variant and the XVB.1.5 variant differ in approximately 45 amino acids [1]. Due to a large number of mutations in the spike protein, the Omicron variant and its descendants, in particular XVB. 1.5, are antigenically different from other SARS-CoV-2 variants, which requires updating the existing vaccines [1, 2].

Большинство эффективных и широко нейтрализующих антител нацелены на рецептор-связывающий домен (RBD), который опосредует присоединение к человеческому ангиотензинпревращающему ферменту 2 (АСЕ2), рецептору SARS-CoV-2 на клетках человека. Поэтому субъединичные вакцины на основе RBD обладают высокой иммуногенностью. Стоит отметить, что вакцины на основе RBD более безопасны, чем вакцины на основе полноразмерного спайкового белка или инактивированные вакцины [3], относительно просты и недороги в производстве, устойчивы при хранении. Из вышесказанного следует, что для создания новых вакцинных препаратов, индуцирующих иммунитет против новых вариантов SARS-CoV-2, может быть использован RBD соответствующего варианта SARS-CoV-2.Most effective and broadly neutralizing antibodies target the receptor-binding domain (RBD), which mediates binding to human angiotensin-converting enzyme 2 (ACE2), the SARS-CoV-2 receptor on human cells. Therefore, RBD-based subunit vaccines are highly immunogenic. It is worth noting that RBD-based vaccines are safer than full-length spike protein-based vaccines or inactivated vaccines [3], are relatively simple and inexpensive to produce, and are stable during storage. From the above, it follows that the RBD of the corresponding SARS-CoV-2 variant can be used to create new vaccine preparations that induce immunity against new SARS-CoV-2 variants.

Ближайшие аналогиClosest analogues

В патенте RU 2723008 С1 [5] описан способ получения штамма клеток яичника китайского хомячка CHO-S-RBD-продуцента RBD, культивирование штамма CHO-S-RBD и способ очистки RBD, а также тест-система для иммуноферментного анализа сыворотки или плазмы крови человека. В указанном изобретении используется плазмидный вектор для эписомальной экспрессии в клеточных линиях млекопитающих, а штамм-продуцент позволяет получить белок RBD в количестве от 5 мг/л до 10 иг/л.Patent RU 2723008 C1 [5] describes a method for obtaining a strain of Chinese hamster ovary cells CHO-S-RBD-producing RBD, culturing the CHO-S-RBD strain and a method for purifying RBD, as well as a test system for enzyme immunoassay of human blood serum or plasma. The said invention uses a plasmid vector for episomal expression in mammalian cell lines, and the producer strain allows obtaining RBD protein in an amount from 5 mg/l to 10 mg/l.

В патенте RU 2802825 С2 [6] описана антигенная композиция, позволяющая вызвать индукцию специфического гуморального и клеточного иммунного ответа к SARS-CoV-2. В составе антигенной композиции в качестве адъюванта выступил бетулин, в качестве активного компонента -рекомбинантный белок RBD разных вариантов, конъюгированный с Fc фрагментом IgG. В клетках СНО в режиме транзиентной экспрессии осуществлен биосинтез рекомбинантных белков RBD-SD1-Fc. Продукция указанного белка составляла от 5 мг/л до 10 мг/л.Patent RU 2802825 C2 [6] describes an antigen composition that can induce a specific humoral and cellular immune response to SARS-CoV-2. The antigen composition contains betulin as an adjuvant, and the active component is recombinant RBD protein of different variants conjugated with the Fc fragment of IgG. Biosynthesis of recombinant RBD-SD1-Fc proteins was carried out in CHO cells in the transient expression mode. The production of this protein ranged from 5 mg/l to 10 mg/l.

Патент RU 2772904 С1 [7] описывает получение экспрессионной генетической конструкции, содержащей нуклеотидную последовательность домена RBDdelta с оптимизированными кодонами и обеспечивающей экспрессию белка RBD линии В. 1.617.2 SARS-CoV-2 в клетках млекопитающих. Авторами изобретения разработан способ получения белка RBD, включающий культивирование клеток эукариот и экспрессию целевого белка, выделение белка с помощью аффинной хроматографии и скрининг экспрессии. Концентрация белка в культуральной жидкости составила от 5 мг/л до 10 мг/л.Patent RU 2772904 C1 [7] describes the production of an expression genetic construct containing the nucleotide sequence of the RBDdelta domain with optimized codons and providing expression of the RBD protein of the B. 1.617.2 SARS-CoV-2 line in mammalian cells. The authors of the invention have developed a method for producing the RBD protein, including culturing eukaryotic cells and expressing the target protein, isolating the protein using affinity chromatography and screening for expression. The protein concentration in the culture fluid ranged from 5 mg/l to 10 mg/l.

К недостаткам вышеуказанных изобретений следует отнести относительно низкий уровень экспрессии целевого белка (до 10 мг/л), что связано, прежде всего, с особенностями проведенного дизайна молекулярно-генетических векторных конструкций, а также в случае RU 2772904 С1 с особенностями культивирования продуцента.The disadvantages of the above-mentioned inventions include a relatively low level of expression of the target protein (up to 10 mg/l), which is associated primarily with the features of the design of the molecular genetic vector constructs, and also, in the case of RU 2772904 C1, with the features of culturing the producer.

Наиболее близким аналогом (прототипом) по назначению и сущности к заявленному изобретению является патент RU 2816175 [4], в котором описывается интегративный плазмидный вектор pVEAL3-RBDdel, обеспечивающий синтез и секрецию рекомбинантного белка RBDdelta SARS-CoV-2 в клетках млекопитающих, и рекомбинантный штамм клеточной линии СНО-К1-RBDdelta. В этом патенте продуцент СНО-К1-RBDdelta позволяет получить белок RBD варианта delta, обладающий иммуногенностью.The closest analogue (prototype) in purpose and essence to the claimed invention is patent RU 2816175 [4], which describes the integrative plasmid vector pVEAL3-RBDdel, which provides the synthesis and secretion of the recombinant RBDdelta protein of SARS-CoV-2 in mammalian cells, and the recombinant strain of the CHO-K1-RBDdelta cell line. In this patent, the CHO-K1-RBDdelta producer allows obtaining the RBD protein of the delta variant, which has immunogenicity.

Однако известные аналоги и прототип не обеспечивают получение белка RBD варианта ХВВ.1.5, являющимся одним из последних вариантов SARS-CoV-2, что относится к более актуальным в данный момент задачам.However, the known analogues and prototype do not provide the RBD protein of the XBB.1.5 variant, which is one of the latest variants of SARS-CoV-2, which is one of the more pressing issues at the moment.

Техническим результатом заявляемого изобретения является создание такого плазмидного вектора и штамма клеток-продуцента белка, которые обеспечивают более высокую и стабильную экспрессию рекомбинантного белка RBD вируса SARS-CoV-2 варианта ХВВ.1.5.The technical result of the claimed invention is the creation of such a plasmid vector and a strain of protein-producing cells that provide a higher and more stable expression of the recombinant RBD protein of the SARS-CoV-2 virus variant XVB.1.5.

Указанный технический результат достигается тем, что создана рекомбинантная плазмидная генетическая конструкция pVEAL3-ХВВ.1.5, обеспечивающая синтез и секрецию рецептор-связывающего домена RBD S белка SARS-CoV-2 варианта ХВВ.1.5 в клетках млекопитающих СНО-К1, имеющая нуклеотидную последовательность SEQ ID NO: 1 и содержащая в соответствии с физической и генетической картой, представленной на фиг. 2, следующие элементы:The specified technical result is achieved by the creation of a recombinant plasmid genetic construct pVEAL3-ХВВ.1.5, which ensures the synthesis and secretion of the receptor-binding domain of the RBD S protein of the SARS-CoV-2 variant ХВВ.1.5 in mammalian cells CHO-K1, having the nucleotide sequence SEQ ID NO: 1 and containing, in accordance with the physical and genetic map presented in Fig. 2, the following elements:

- 5'ITR_SB, имеющие координаты 88-317 п.н.; 3'ITR_SB, имеющие координаты 3229-3458 п.н. и являющиеся инвертированными концевыми повторами, обеспечивающими связывание с транспозазой SB;- 5'ITR_SB, having coordinates 88-317 bp; 3'ITR_SB, having coordinates 3229-3458 bp and being inverted terminal repeats that ensure binding to the SB transposase;

- 5'IFR, имеющие координаты 318-368 п.н.; 3'IFR, имеющие координаты 3181-3228 п.н. и являющиеся областями, фланкирующими ITR;- 5'IFR, having coordinates 318-368 bp; 3'IFR, having coordinates 3181-3228 bp and being regions flanking the ITR;

- CMV enhancer, имеющий координаты 369-733 п.н., CMV promoter, имеющий координаты 734-937 п.н. и являющийся сильным промотером, обеспечивающим высокий выход рекомбинантного белка в клетках млекопитающих;- CMV enhancer, having coordinates 369-733 bp, CMV promoter, having coordinates 734-937 bp and being a strong promoter, providing a high yield of recombinant protein in mammalian cells;

- ХВВ.1.5-последовательность, кодирующая рецептор-связывающий домен S белка SARS-CoV-2 варианта ХВВ.1.5 и имеющая координаты 1065-1766 п.н.;- XBB.1.5 is a sequence encoding the receptor-binding domain of the S protein of SARS-CoV-2 variant XBB.1.5 and having coordinates 1065-1766 bp;

- 10 his-последовательность, необходимая для очистки рекомбинантного белка и имеющая координаты 1767-1796 п.н.;- 10 his-sequence, necessary for purification of the recombinant protein and having coordinates 1767-1796 bp;

- EMCV IRES-участок внутренней посадки рибосомы, имеющий координаты с 1818 по 2392 п.н.;- EMCV IRES-site of internal ribosome entry, having coordinates from 1818 to 2392 bp;

- Puro R-ген устойчивости к антибиотику пуромицину, имеющий координаты (2405-3004 п.н.);- Puro R is a gene of resistance to the antibiotic puromycin, with coordinates (2405-3004 bp);

- SV40 poly(A) signal-последовательность, обеспечивающая стабилизацию мРНК-транскриптов, имеющая координаты 3039-3160 п.н.;- SV40 poly(A) signal sequence, which ensures stabilization of mRNA transcripts, has coordinates 3039-3160 bp;

- KanR-ген устойчивости к антибиотику канамицину, имеющий координаты 3645-4460 п.н.;- KanR is a gene of resistance to the antibiotic kanamycin, with coordinates 3645-4460 bp;

- участок начала репликации ori, имеющий координаты 4523-5110 п.н.- the site of the origin of replication ori, having coordinates 4523-5110 bp.

Указанный технический результат достигается также тем, что создан рекомбинантный штамм СНО-ХВВ.1.5, полученный совместной трансфекцией рекомбинантной плазмидной генетической конструкции pVEAL3-ХВВ.1.5 по п. 1 и плазмидой pCMV(CAT)T7-SB100, кодирующей транспозазу SB100 и являющийся продуцентом рецептор-связывающего домена RBD S белка SARS-CoV-2 варианта ХВВ.1.5, предназначенного для создания иммунобиологических препаратов.The specified technical result is also achieved by the fact that a recombinant strain CHO-ХВВ.1.5 is created, obtained by joint transfection of the recombinant plasmid genetic construct pVEAL3-ХВВ.1.5 according to item 1 and the plasmid pCMV(CAT)T7-SB100 encoding the SB100 transposase and being the producer of the receptor-binding domain RBD S protein of the SARS-CoV-2 variant ХВВ.1.5, intended for the creation of immunobiological preparations.

Способ получения штамма клеток яичника китайского хомячка СНО-ХВВ.1.5, включает:The method for obtaining the Chinese hamster ovary cell strain CHO-HVV.1.5 includes:

- получение генетической конструкции, имеющей нуклеотидную последовательность SEQ ID NO: 1;- obtaining a genetic construct having the nucleotide sequence SEQ ID NO: 1;

- введение указанной генетической конструкции в клетки животных путем трансфекции PEI;- introduction of the specified genetic construct into animal cells by transfection with PEI;

- селекцию клеток на антибиотике пуромицин (Puromycin).- selection of cells on the antibiotic puromycin.

Способ получения рекомбинантного белка RBD вируса SARS-CoV-2 ХВВ.1.5 содержит:The method for producing the recombinant RBD protein of the SARS-CoV-2 virus XVV.1.5 contains:

- культивирование штамма клеток яичника китайского хомячка СНО-ХВВ.1.5;- cultivation of the Chinese hamster ovary cell strain CHO-HVB.1.5;

- хроматографическую очистку рекомбинантного белка RBD вируса SARS-CoV-2 ХВВ.1.5 из культуральной среды штамма клеток яичника китайского хомячка СНО-ХВВ.1.5;- chromatographic purification of the recombinant RBD protein of the SARS-CoV-2 virus XVB.1.5 from the culture medium of the Chinese hamster ovary cell strain CHO-XVB.1.5;

- подтверждение получения рекомбинантного белка RBD вируса SARS-CoV-2 ХВВ.1.5.- confirmation of obtaining the recombinant RBD protein of the SARS-CoV-2 virus.1.5.

Изобретение иллюстрируется следующими графическими материалами. На фиг. 1 приведена нуклеотидная последовательность рекомбинантной плазмиды pVEAL3-ХВВ.1.5. На фиг. 2 представлена физическая и генетическая карта плазмиды pVEAL3-ХВВ.1.5. Для лучшего понимания сущности предлагаемого изобретения ниже приведены примеры (1-4) его осуществления.The invention is illustrated by the following graphic materials. Fig. 1 shows the nucleotide sequence of the recombinant plasmid pVEAL3-ХВВ.1.5. Fig. 2 shows the physical and genetic map of the plasmid pVEAL3-ХВВ.1.5. For a better understanding of the essence of the proposed invention, examples (1-4) of its implementation are given below.

Пример 1. Получение рекомбинантной плазмиды pVEAL3-XBB.1.5Example 1. Obtaining recombinant plasmid pVEAL3-XBB.1.5

Для конструирования вектора pVEAL3-ХВВ.1.5 (фиг. 2), содержащего нуклеотидную последовательность рецептор-связывающего домена RBD S белка SARS-CoV-2 варианта ХВВ.1.5, брали плазмиду pVEAL3-10H10 full, полученную сотрудниками отдела биоинженерии ФБУН ГНЦ ВБ «Вектор» Роспотребнадзора. Ранее плазмида на основе вектора pVEAL3 показала свою эффективность (патент РФ №2816175). Ген рецептор-связывающего домена RBD S белка SARS-CoV-2 варианта ХВВ.1.5 был синтезирован фирмой ООО «ДНК-Синтез». Для амплификации указанного гена также были синтезированы праймеры (таблица 1) F_XBB.1.5_AsuNHI_1, R_XBB.1.5_SalI_1 (ООО «ДНК-Синтез»), в которых заложены сайты гидролиза AsuNHI, Sail.To construct the pVEAL3-ХВВ.1.5 vector (Fig. 2) containing the nucleotide sequence of the receptor-binding domain of the RBD S protein of the SARS-CoV-2 variant ХВВ.1.5, we used the pVEAL3-10H10 full plasmid obtained by the employees of the Bioengineering Department of the Federal Research Center of Virology and Biotechnology Vector of Rospotrebnadzor. Previously, the plasmid based on the pVEAL3 vector demonstrated its effectiveness (RU Patent No. 2816175). The gene of the receptor-binding domain of the RBD S protein of the SARS-CoV-2 variant ХВВ.1.5 was synthesized by DNA-Synthesis LLC. For the amplification of the specified gene, primers (Table 1) F_XBB.1.5_AsuNHI_1, R_XBB.1.5_SalI_1 (DNA-Synthesis LLC) were also synthesized, which contain the AsuNHI, Sail hydrolysis sites.

Для амплификации гена RBD ХВВ.1.5 использовали ДНК-полимеразу Q5 Hot Start HF (New England Biolabs Inc.) Температурный профиль ПЦР-реакции и состав реакционной смеси подобраны в соответствии с инструкцией производителя. ГЩР-продукт RBD ХВВ.1.5 804 п.н. выделяли из агарозного геля с помощью набора Cleanup Mini (ЗАО Евроген) в соответствии с инструкцией производителя. ПЦР-продукт RBD ХВВ. 1.5 и плазмиду pVEAL3-10Н10 full подвергали ферментативному гидролизу эндонуклеазами рестрикции AsuNHI, SalI (НПО «СибЭнзим») в соответствии с инструкцией производителя. Фрагмент вектора pVEAL3 4345 п.н. и RBD ХВВ.1.5 786 п.н. выделяли из агарозного геля с помощью набора Cleanup Mini (ЗАО Евроген) в соответствии с инструкцией производителя. Лигирование фрагментов проводили лигазой фага Т4 (НПО «СибЭнзим») в соответствии с инструкцией производителя. Далее методом Heat shock трансформировали клетки Escherichia coli штамм Neb Stable лигазной смесью и высевали на агаризованную питательную среду в чашку Петри. На следующий день клоны с чашки Петри инокулировали в питательную среду LB, культивировали при 37°С в качалке в течение ночи. Затем с помощью набора QIAprep Spin Miniprep Kit (QIAGEN) выделяли плазмидную ДНК в соответствии с инструкцией производителя. Подтверждали нуклеотидную последовательность SEQ ID NO: 1 (фиг. 1) плазмиды pVEAL3-ХВВ.1.5 секвенированием по методу Сэнгера.For amplification of the RBD gene of XBB.1.5, Q5 Hot Start HF DNA polymerase (New England Biolabs Inc.) was used. The temperature profile of the PCR reaction and the composition of the reaction mixture were selected in accordance with the manufacturer's instructions. The 804 bp RBD XBB.1.5 PCR product was isolated from agarose gel using the Cleanup Mini kit (ZAO Evrogen) in accordance with the manufacturer's instructions. The PCR product of RBD XBB. 1.5 and the pVEAL3-10H10 full plasmid were subjected to enzymatic hydrolysis with restriction endonucleases AsuNHI, SalI (NPO SibEnzyme) in accordance with the manufacturer's instructions. The pVEAL3 vector fragment 4345 bp and the RBD XBB.1.5 786 bp were purified using the following plasmids: were isolated from agarose gel using the Cleanup Mini kit (ZAO Evrogen) in accordance with the manufacturer's instructions. Ligation of the fragments was performed with T4 phage ligase (NPO SibEnzyme) in accordance with the manufacturer's instructions. Then, using the Heat Shock method, Escherichia coli cells of the Neb Stable strain were transformed with the ligase mixture and plated on an agar nutrient medium in a Petri dish. The next day, the clones from the Petri dish were inoculated into LB nutrient medium and cultured at 37°C in a shaker overnight. Then, using the QIAprep Spin Miniprep Kit (QIAGEN), plasmid DNA was isolated in accordance with the manufacturer's instructions. The nucleotide sequence of SEQ ID NO: 1 (Fig. 1) of the pVEAL3-ХВВ.1.5 plasmid was confirmed by Sanger sequencing.

Пример 2. Получение рекомбинантного штамма СНО-ХВВ.1.5Example 2. Obtaining a recombinant strain CHO-HVV.1.5

Для получения штамма-продуцента чистую суспензионную культуру клеток яичника китайского хомячка СН0-К1 совместно транс фецировали плазмидами pVEAL3-ХВВ.1.5 и pCMV(CAT)T7-SB 100 (Addgene). Для этого объем суспензионной культуры СНО-К1, содержащий 5x106 живых клеток, центрифугировали при 800 об/мин в течение 5 мин. После центрифугирования удаляли ростовую питательную среду, клеточный осадок ресуспендировали в 1 мл среды для трансфекции HyClone HyCell TransFx-C transfec-tion media (Cytiva). Добавляли к суспензии клеток плазмиды pVEAL3-ХВВ.1.5 и pCMV(CAT)T7-SB100 в соотношении 10:1, перемешивали. Добавляли 10 мкг PEI (PEI 25К, Polysciences, Inc.), перемешивали. Культивировали 6 часов на шейкере 200 об/мин, (37±1)°С во влажной атмосфере 5% CO2. По истечении времени добавляли в пробирку 4 мл теплой ростовой среды для суспензионного культивирования HyClone HyCell СНО cell culture media (Cytiva). Культивировали 48 часов после трансфекции на шейкере 200 об/мин, (37±1)°С во влажной атмосфере 5% СО2. По истечении 48 часов считали концентрацию клеток в суспензионной культуре. Отбирали объем культуры, содержащий 2×106 живых клеток, добавляли ростовой среды для суспензионного культивирования до 2 мл, добавляли селективный антибиотик пуромицин (InvivoGen) в соотношении 0,25 мкл пуромицина на 1 мл клеточной суспензии. Продолжали культивирование трансформированных клеток в течение 2х недель при прежних условиях, постепенно повышая концентрацию пуромицина до 1 мкл на 1 мл клеточной суспензии. Пересев клеток проводился при достижении плотности клеток ≈ 6-8×106 живых клеток/мл.To obtain the producer strain, a pure suspension culture of Chinese hamster ovary cells CH0-K1 was co-transfected with plasmids pVEAL3-XBB.1.5 and pCMV(CAT)T7-SB 100 (Addgene). For this purpose, the volume of the suspension culture CHO-K1 containing 5x10 6 living cells was centrifuged at 800 rpm for 5 min. After centrifugation, the growth nutrient medium was removed, the cell pellet was resuspended in 1 ml of the transfection medium HyClone HyCell TransFx-C transfection media (Cytiva). Plasmids pVEAL3-XBB.1.5 and pCMV(CAT)T7-SB100 were added to the cell suspension in a ratio of 10:1 and mixed. 10 μg of PEI (PEI 25K, Polysciences, Inc.) were added and mixed. The culture was continued for 6 hours on a shaker at 200 rpm, (37±1)°C in a humidified atmosphere of 5% CO 2 . After this time, 4 ml of warm growth medium for suspension cultivation HyClone HyCell CHO cell culture media (Cytiva) were added to the tube. The culture was continued for 48 hours after transfection on a shaker at 200 rpm, (37±1)°C in a humidified atmosphere of 5% CO 2 . After 48 hours, the cell concentration in the suspension culture was calculated. A culture volume containing 2×10 6 living cells was collected, growth medium for suspension cultivation was added to 2 ml, and the selective antibiotic puromycin (InvivoGen) was added in a ratio of 0.25 μl puromycin per 1 ml of cell suspension. Cultivation of transformed cells was continued for 2 weeks under the same conditions, gradually increasing the concentration of puromycin to 1 μl per 1 ml of cell suspension. Cell reseeding was performed when the cell density reached ≈ 6-8×10 6 living cells/ml.

Далее из полученной суспензии клеток отбирали наиболее продуктивные клоны-продуценты СНО-ХВВ.1.5. Для этого методом предельного разведения рассаживали клетки в лунки 96-луночного планщета в концентрации 1 клетка/лунка в присутствии пуромицина. Отбор клонов проводили на среде DMEM F12 (Gibco) с добавлением сыворотки крови плодов коровы (Gibco) в количестве 10% от общего объема. Помещали планшет в СО2-инкубатор. Культивировали при температуре (37±1)°С во влажной атмосфере 5% СО2 в течение 14 суток. Через 14 суток под микроскопом анализировали наличие клеточного роста в лунках. Из "положительных" лунок отбирали кондиционированную среду и анализировали наличие белка RBD ХВВ.1.5 в ней методом иммуноферментного анализа (ИФА). Клетки из лунок с наибольшим сигналом в ИФА пересаживали в 6-луночные планшеты, а после смыкания монослоя-в фальконы для дальнейшего суспензионного культивирования. Таким образом из всего пула клеток-продуцентов СНО-ХВВ.1.5 отбирали 10 наиболее продуктивных клонов.The most productive CHO-HBV.1.5-producing clones were then selected from the resulting cell suspension. For this purpose, the cells were seeded into the wells of a 96-well plate using the limiting dilution method at a concentration of 1 cell/well in the presence of puromycin. Clones were selected on DMEM F12 medium (Gibco) with the addition of fetal bovine serum (Gibco) in an amount of 10% of the total volume. The plate was placed in a CO 2 incubator. The cultured cells were cultured at a temperature of (37±1)°C in a humidified atmosphere of 5% CO 2 for 14 days. After 14 days, the presence of cell growth in the wells was analyzed under a microscope. The conditioned medium was collected from the "positive" wells and analyzed for the presence of the HBV.1.5 RBD protein in it using the enzyme-linked immunosorbent assay (ELISA). The cells from the wells with the highest signal in the ELISA were transplanted into 6-well plates, and after the monolayer had closed, into falcons for further suspension cultivation. Thus, 10 most productive clones were selected from the entire pool of CHO-XBB.1.5 producer cells.

Отобранные клоны СНО-ХВВ.1.5 культивировали на шейкере 200 об/мин, (37±1)°С во влажной атмосфере 5% СО2. Начальная концентрация клеток при культивировании составляла 0,3×106 живых клеток/мл. После 2-4 суток культивирования в суспензии считали концентрацию клеток. Отбирали объем суспензии, соответствующий концентрации 2×106 живых клеток/мл в микроцентрифужные пробирки. Центрифугировали 800 об/мин, 5 мин, удаляли супернатант, клеточный осадок ресуспендировали в 2 мл свежей ростовой среды для суспензионного культивирования, переносили в фалькон. Культивировали на шейкере 200 об/мин, (31±1)°С во влажной атмосфере 5% СО2 в течение 10 суток. По истечении времени центрифугировали клеточную суспензию для отделения культуральной жидкости от клеточного дебриса при 4000 об/мин, 15 мин, +4°С. Культуральную жидкость от каждого моноклона СНО-ХВВ.1.5 анализировали с помощью электрофореза белков в полиакриламидном геле (SDS-ПААГ) на наличие целевого белка RBD ХВВ.1.5. Сравнивали моноклоны по продуктивности и оставляли для дальнейшей работы 3 моноклона.The selected clones of CHO-XBB.1.5 were cultured on a shaker at 200 rpm, (37±1)°C in a humidified atmosphere of 5% CO 2 . The initial cell concentration during cultivation was 0.3×10 6 living cells/ml. After 2-4 days of cultivation in suspension, the cell concentration was calculated. The suspension volume corresponding to a concentration of 2×10 6 living cells/ml was collected in microcentrifuge tubes. The cells were centrifuged at 800 rpm for 5 min, the supernatant was removed, the cell pellet was resuspended in 2 ml of fresh growth medium for suspension cultivation and transferred to a falcon. The cells were cultured on a shaker at 200 rpm, (31±1)°C in a humidified atmosphere of 5% CO 2 for 10 days. After the time had elapsed, the cell suspension was centrifuged to separate the culture fluid from the cell debris at 4000 rpm, 15 min, +4°C. The culture fluid from each CHO-XBB.1.5 monoclone was analyzed by protein electrophoresis in polyacrylamide gel (SDS-PAGE) for the presence of the target protein RBD XBB.1.5. The monoclones were compared by productivity and 3 monoclones were left for further work.

Пример 3. Культивирование рекомбинантного штамма СНО-ХВВ.1.5Example 3. Cultivation of the recombinant strain CHO-HVV.1.5

Штамм СНО-ХВВ.1.5 культивировали в среде HyClone HyCell СНО cell culture media (Cytiva) с периодической подпиткой 40%-ным раствором глюкозы. Концентрацию глюкозы в среде поддерживали на уровне 40 мМ. Начальная концентрация клеток 0,35×106 живых клеток/мл. Культивирование проводили на шейкере при скорости вращения 200 об/мин, (37±1)°С во влажной атмосфере 5% СО2 до достижения плотности ≈ 8×106 живых клеток/мл и жизнеспособности ≥95%. При достижении указанной плотности отбирали необходимый объем культуры для следующего пассажа, а оставшийся объем культуры культивировали на шейкере 200 об/мин, (31±1)°С во влажной атмосфере 5% СО2 в течение 14 суток.The CHO-XVB.1.5 strain was cultured in HyClone HyCell CHO cell culture media (Cytiva) with periodic feeding of 40% glucose solution. The glucose concentration in the medium was maintained at 40 mM. The initial cell concentration was 0.35×10 6 living cells/ml. Cultivation was carried out on a shaker at 200 rpm, (37±1)°C in a humidified atmosphere of 5% CO 2 until a density of ≈ 8×10 6 living cells/ml and a viability of ≥95% were achieved. Upon reaching the specified density, the required volume of culture was taken for the next passage, and the remaining volume of culture was cultured on a shaker at 200 rpm, (31±1)°C in a humidified atmosphere of 5% CO 2 for 14 days.

Пример 4. Выделение и очистка RBD ХВВ.1.5Example 4. Isolation and purification of RBD HVV.1.5

По истечении 14 суток центрифугировали клеточную суспензию для отделения культуральной жидкости от клеточного дебриса при 15000 об/мин, 15 мин, +4°С.After 14 days, the cell suspension was centrifuged to separate the culture fluid from the cell debris at 15,000 rpm, 15 min, +4°C.

Очистку белка осуществляли на Ni-сефарозе 6FF. Скорость нанесения 5 мл/мин и промывки 3 мл/мин, скорость элюции - 1,5 мл/мин. Уравновешивали колонку 5 объемами буфера А (20 мМ Tris-HCl, рН 8,0, 200 мМ KCl, 5 мМ имидазол). Наносили культуральную жидкость на колонку. Промывали колонку 5 объемами буфера С (20 мМ Tris-HCl, рН 8,0, 1 М Kl 5 мМ имидазол). Элюцию проводили буфером В (20 мМ Tris-HCl, рН 8,0,20 мМ KCl, 0,5 М имидазол).Protein purification was performed on Ni-Sepharose 6FF. Application rate was 5 ml/min, washing rate was 3 ml/min, elution rate was 1.5 ml/min. The column was equilibrated with 5 volumes of buffer A (20 mM Tris-HCl, pH 8.0, 200 mM KCl, 5 mM imidazole). The culture liquid was applied to the column. The column was washed with 5 volumes of buffer C (20 mM Tris-HCl, pH 8.0, 1 M Kl, 5 mM imidazole). Elution was performed with buffer B (20 mM Tris-HCl, pH 8.0, 20 mM KCl, 0.5 M imidazole).

Проводили диализ очищенного белка RBD ХВВ.1.5, используя буфер 20 мМ TrisHCl, рН 8,0, 150 мМ KCl.Purified RBD protein XBB.1.5 was dialyzed using 20 mM TrisHCl, pH 8.0, 150 mM KCl buffer.

Препарат белка RBD ХВВ.1.5 анализировали с помощью электрофореза белков в SDS-ПААГ. The RBD protein preparation XBB.1.5 was analyzed by SDS-PAGE.

Источники научно-технической и патентной информацииSources of scientific, technical and patent information

1. Харченко Е. П. Коронавирус ХВВ.1.5 как индикатор длительного продолжения пандемии Covid-19. Что дальше с вакцинацией? Эпидемиология и Вакцинопрофилактика. 2023;22(2): 12-22. https://doi: 10.31631/2073-3046-2023-22-2-12-221. Kharchenko E. P. Coronavirus HVB.1.5 as an indicator of a long-term continuation of the Covid-19 pandemic. What's next with vaccination? Epidemiology and Vaccine Prevention. 2023;22(2): 12-22. https://doi: 10.31631/2073-3046-2023-22-2-12-22

2. Holmes Е. С. The emergence and evolution of SARS-CoV-2 // Annual review of virology. - 2024. - Т. 11.2. Holmes E. S. The emergence and evolution of SARS-CoV-2 // Annual review of virology. - 2024. - T. 11.

3. Sun Y. et al. Development of an RBD-Fc fusion vaccine for COVID-19 // Vaccine: X. - 2024. - T. 16. - C. 100444.3. Sun Y. et al. Development of an RBD-Fc fusion vaccine for COVID-19 // Vaccine: X. - 2024. - T. 16. - P. 100444.

4. Патент РФ №2816175. Интегративный плазмидный вектор pVEAL3-RBDdel, обеспечивающий синтез и секрецию рекомбинантного белка рецепторсвязывающего домена RBDdelta коронавируса SARS-CoV-2 в клетках млекопитающих, рекомбинантный штамм клеточной линии CHO-Kl-RBDdelta и рекомбинантный белок RBDdelta SARS-CoV-2, продуцируемый штаммом клеточной линии / Несмеянова B.C., Меркульева Ю.А., Исаева А.А., Щербаков Д.Н., Волкова Н.В., Беленькая С.В., Боргоякова М.Б., Волосникова Е.А., Есина Т.И., Зайковская А.В., Пьянков О.В., Ильичев А.А. Бюл №2, 26.03.2024.4. Russian Federation Patent No. 2816175. Integrative plasmid vector pVEAL3-RBDdel providing synthesis and secretion of recombinant protein of the receptor-binding domain RBDdelta of the SARS-CoV-2 coronavirus in mammalian cells, recombinant cell line strain CHO-Kl-RBDdelta and recombinant protein RBDdelta SARS-CoV-2 produced by the cell line strain / Nesmeyanova V.S., Merkulyeva Yu.A., Isaeva A.A., Shcherbakov D.N., Volkova N.V., Belenkaya S.V., Borgoyakova M.B., Volosnikova E.A., Esina T.I., Zaykovskaya A.V., Pyankov O.V., Ilyichev A.A. Bulletin No. 2, 03.26.2024.

5. Патент РФ №2723008 С1 Способ получения штамма клеток яичника китайского хомячка, продуцента рекомбинантного белка RBD вируса SARS-CoV-2, штамм клеток яичника китайского хомячка, продуцент рекомбинантного белка RBD вируса SARS-CoV-2, способ получения рекомбинантного белка RBD вируса SARS-CoV-2, тест-система для иммуноферментного анализа сыворотки или плазмы крови человека и ее применение / Щебляков Д.В., Есмагамбетов И.Б., Логунов Д.Ю., Деркаев А.А., Симакин П.В., Ижаева Ф.М., Джаруллаева А.Ш., Зубкова О.В., Ожаровская Т.А., Должикова И.В., Тухватулин А., Тухватулина Н.М., Фаворская И.А., Народицкий Б.С., Гинцбург А.Л. Бюл. №16, 08.06.2020.5. Patent of the Russian Federation No. 2723008 C1 Method for obtaining a strain of Chinese hamster ovary cells, a producer of recombinant RBD protein of the SARS-CoV-2 virus, a strain of Chinese hamster ovary cells, a producer of recombinant RBD protein of the SARS-CoV-2 virus, a method for obtaining a recombinant RBD protein of the SARS-CoV-2 virus, a test system for enzyme-linked immunosorbent assay of human blood serum or plasma and its use / Shcheblyakov D.V., Esmagambetov I.B., Logunov D.Yu., Derkaev A.A., Simakin P.V., Izhaeva F.M., Dzharullaeva A.Sh., Zubkova O.V., Ozharovskaya T.A., Dolzhikova I.V., Tukhvatulin A., Tukhvatulina N.M., Favorskaya I.A., Naroditsky B.S., Ginzburg A.L. Bull. No. 16, 06/08/2020.

6. Патент РФ №2802825 С2. Генная конструкция для экспрессии рекомбинантных белков на основе участка S-белка SARS-CoV-2, включающего RBD и SD1, слитого с Fc фрагментом IgG, способ получения рекомбинантных белков, антигены и антигенные композиции для индукции длительного антительного и клеточного иммунитета против вируса SARS-CoV-2 / Исаев А.А., Кудрявцев А.В., Фролова М.Е., Вахрушева А.В., Иванов А.В., Джонович М, Иванишин Т.В., Красильников И.В. Бюл. №19, 30.06.2023.6. Russian Federation Patent No. 2802825 C2. Gene construct for expression of recombinant proteins based on the SARS-CoV-2 S protein region, including RBD and SD1, fused with the Fc fragment of IgG, a method for producing recombinant proteins, antigens and antigen compositions for inducing long-term antibody and cellular immunity against the SARS-CoV-2 virus / Isaev A.A., Kudryavtsev A.V., Frolova M.E., Vakhrusheva A.V., Ivanov A.V., Dzhonovich M, Ivanishin T.V., Krasilnikov I.V. Bulletin No. 19, 30.06.2023.

7. Патент РФ №2772904 С1. Рекомбинантная плазмида pVBL-RBDdelta, обеспечивающая синтез и секрецию рекомбинантного рецептор-связывающего домена (RBD) коронавируса SARS-CoV-2 линии В. 1.617.2 в клетках млекопитающих / Тороповский А. Н., Викторов Д.А., Щербаков Д.Н., Никитин А.Г. Бюл. №15, 26.05.2022.7. Russian Federation Patent No. 2772904 C1. Recombinant plasmid pVBL-RBDdelta providing the synthesis and secretion of the recombinant receptor-binding domain (RBD) of the SARS-CoV-2 coronavirus line B. 1.617.2 in mammalian cells / Toropovsky A. N., Viktorov D. A., Shcherbakov D. N., Nikitin A. G. Bulletin No. 15, 05.26.2022.

8. Kulemzin S.V., Sergeeva M.V., Baranov K.О., et al. VH3-53/66-Class RBD-Specific Human Monoclonal Antibody iB20 Displays Cross-Neutralizing Activity against Emerging SARS-CoV-2 Lineages // Journal of personalized medicine. - 2022. - V. 12. - №6. - P. 895.8. Kulemzin S.V., Sergeeva M.V., Baranov K.O., et al. VH3-53/66-Class RBD-Specific Human Monoclonal Antibody iB20 Displays Cross-Neutralizing Activity against Emerging SARS-CoV-2 Lineages // Journal of personalized medicine. - 2022. - V. 12. - No. 6. - P. 895.

--->--->

<?xml version="1.0" encoding="UTF-8"?><?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing <!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.3//EN" "ST26SequenceListing_V1_3.dtd">1.3//EN" "ST26SequenceListing_V1_3.dtd">

<ST26SequenceListing dtdVersion="V1_3" fileName="Приложение. <ST26SequenceListing dtdVersion="V1_3" fileName="Application.

Последовательность плазмиды pVEAL3-XBB.1.5 для синтеза RBD S белка Sequence of plasmid pVEAL3-XBB.1.5 for synthesis of RBD S protein

SARS-CoV-2.xml" softwareName="WIPO Sequence" softwareVersion="2.3.0" SARS-CoV-2.xml" softwareName="WIPO Sequence" softwareVersion="2.3.0"

productionDate="2024-10-31">productionDate="2024-10-31">

<ApplicationIdentification><ApplicationIdentification>

<IPOfficeCode>RU</IPOfficeCode> <IPOfficeCode>RU</IPOfficeCode>

<ApplicationNumberText>123456</ApplicationNumberText> <ApplicationNumberText>123456</ApplicationNumberText>

<FilingDate>2024-10-31</FilingDate> <FilingDate>2024-10-31</FilingDate>

</ApplicationIdentification></ApplicationIdentification>

<ApplicantFileReference>1234</ApplicantFileReference> <ApplicantFileReference>1234</ApplicantFileReference>

<EarliestPriorityApplicationIdentification> <EarliestPriorityApplicationIdentification>

<IPOfficeCode>RU</IPOfficeCode> <IPOfficeCode>RU</IPOfficeCode>

<ApplicationNumberText>1234567</ApplicationNumberText> <ApplicationNumberText>1234567</ApplicationNumberText>

<FilingDate>2024-10-19</FilingDate> <FilingDate>2024-10-19</FilingDate>

</EarliestPriorityApplicationIdentification> </EarliestPriorityApplicationIdentification>

<ApplicantName languageCode="ru">Федеральное бюджетное учреждение <ApplicantName languageCode="ru">Federal budgetary institution

науки «Государственный научный центр вирусологии и биотехнологии science "State Research Center of Virology and Biotechnology

«Вектор» Федеральной службы по надзору в сфере защиты прав "Vector" of the Federal Service for Supervision of Human Rights Protection

потребителей и благополучия человека (ФБУН ГНЦ ВБ «Вектор» consumers and human well-being (Federal Budgetary Institution of Science State Research Center of Virology and Biotechnology "Vector"

Роспотребнадзора)</ApplicantName>Rospotrebnadzor)</ApplicantName>

<ApplicantNameLatin>Federalnoe byudzhetnoe uchrezhdenie nauki <ApplicantNameLatin>Federal Scientific Research Institute

&quot;Gosudarstvennyj nauchnyj tsentr virusologii i biotekhnologii &quot;State Scientific Center of Virology and Biotechnology

&quot;Vektor&quot; Federalnoj sluzhby po nadzoru v sfere zashchity &quot;Vector&quot; Federal Service for Supervision in the Sphere of Protection

prav potrebitelej i blagopoluchiya cheloveka (FBUN GNTS VB consumer rights and the goodness of man (FBUN GNTS VB

&quot;Vektor&quot; Rospotrebnadzora) (RU)</ApplicantNameLatin>&quot;Vektor&quot; Rospotrebnadzora) (RU)</ApplicantNameLatin>

<InventionTitle languageCode="ru">Рекомбинантная плазмида <InventionTitle languageCode="en">Recombinant plasmid

pVEAL3-XBB.1.5, обеспечивающая синтез и секрецию pVEAL3-XBB.1.5, providing synthesis and secretion

рецептор-связывающего домена RBD S белка SARS-CoV-2 варианта XBB.1.5, receptor-binding domain of the RBD S protein of SARS-CoV-2 variant XBB.1.5,

и рекомбинантный штамм СНО-XBB.1.5 – продуцент рецептор-связывающего and the recombinant strain CHO-XBB.1.5, a producer of the receptor-binding

домена RBD S белка SARS-CoV-2 варианта XBB.1.5, предназначенного для RBD domain of the SARS-CoV-2 S protein variant XBB.1.5, intended for

создания иммунобиологических препаратов </InventionTitle>creation of immunobiological preparations </InventionTitle>

<SequenceTotalQuantity>1</SequenceTotalQuantity> <SequenceTotalQuantity>1</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1"> <SequenceData sequenceIDNumber="1">

<INSDSeq><INSDSeq>

<INSDSeq_length>5131</INSDSeq_length> <INSDSeq_length>5131</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype> <INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division> <INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table><INSDSeq_feature-table>

<INSDFeature><INSDFeature>

<INSDFeature_key>source</INSDFeature_key> <INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..5131</INSDFeature_location> <INSDFeature_location>1..5131</INSDFeature_location>

<INSDFeature_quals><INSDFeature_quals>

<INSDQualifier><INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name> <INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value> <INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier></INSDQualifier>

<INSDQualifier id="q2"><INSDQualifier id="q2">

<INSDQualifier_name>organism</INSDQualifier_name> <INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value> <INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier></INSDQualifier>

</INSDFeature_quals></INSDFeature_quals>

</INSDFeature></INSDFeature>

</INSDSeq_feature-table></INSDSeq_feature-table>

<INSDSeq_sequence>cgaagaaaggcccacccgtgaaggtgagccagtgagttgattgcagtcc <INSDSeq_sequence>cgaagaaaggcccacccgtgaaggtgagccagtgagttgattgcagtcc

agttacgctggagtctgaggctcgtcctgaatggatccctatacagttgaagtcggaagtttacatacacagttacgctggagtctgaggctcgtcctgaatggatccctatacagttgaagtcggaagtttacatacac

ttaagttggagtcattaaaactcgtttttcaactactccacaaatttcttgttaacaaacaatagttttgttaagttggagtcattaaaactcgtttttcaactactccacaaatttcttgttaacaaacaatagttttg

gcaagtcagttaggacatctactttgtgcatgacacaagtcatttttccaacaattgtttacagacagatgcaagtcagttaggacatctactttgtgcatgacacaagtcatttttccaacaattgtttacagacagat

tatttcacttataattcactgtatcacaattccagtgggtcagaagtttacatacactaagttcgactcctatttcacttataattcactgtatcacaattccagtgggtcagaagtttacatacactaagttcgactcc

tctgcagaatgcggcgatgtttcggtaaggggtccgctactagttattaatagtaatcaattacggggtctctgcagaatgcggcgatgtttcggtaaggggtccgctactagttattaatagtaatcaattacggggtc

attagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccg

cccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttcccccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttcc

attgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcc

aagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttaaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgacctta

tgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggctgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggc

agtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaaagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaa

tgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgtgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacg

caaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccacaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaaccca

ctgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagcatgtttgtttctgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagcatgtttgttt

ttcttgttttattgccactagtctctagtcagtgtgtggaaaagggcatctaccagaccagcaacttccgttcttgttttattgccactagtctctagtcagtgtgtggaaaagggcatctaccagaccagcaacttccg

ggtgcagcccaccgaatccatcgtgcggttccccaatatcaccaatctgtgccccttccacgaggtgttcggtgcagcccaccgaatccatcgtgcggttccccaatatcaccaatctgtgccccttccacgaggtgttc

aatgccaccacattcgcctctgtgtacgcctggaaccggaagcggatcagcaattgcgtggccgactactaatgccaccacattcgcctctgtgtacgcctggaaccggaagcggatcagcaattgcgtggccgactact

ccgtgatctacaactttgcccccttcttcgccttcaagtgctacggcgtgtcccctaccaagctgaacgaccgtgatctacaactttgcccccttcttcgccttcaagtgctacggcgtgtcccctaccaagctgaacga

cctgtgcttcacaaacgtgtacgccgacagcttcgtgatccggggaaacgaagtgagccagattgcccctcctgtgcttcacaaacgtgtacgccgacagcttcgtgatccggggaaacgaagtgagccagattgcccct

ggacagacaggcaacatcgccgactacaactacaagctgcccgacgacttcaccggctgtgtgattgcctggacagacaggcaacatcgccgactacaactacaagctgcccgacgacttcaccggctgtgtgattgcct

ggaacagcaacaagctggactccaaaccctccggcaactacaattacctgtaccggctgttccggaagtcggaacagcaacaagctggactccaaaccctccggcaactacaattacctgtaccggctgttccggaagtc

caagctgaagcccttcgagcgggacatctccaccgagatctatcaggccggcaacaagccttgtaacggccaagctgaagcccttcgagcgggacatctccaccgagatctatcaggccggcaacaagccttgtaacggc

gtggccggccccaactgctactccccactgcagtcctacggctttcggcccacatacggcgtgggccaccgtggccggccccaactgctactccccactgcagtcctacggctttcggcccacatacggcgtgggccacc

agccctacagagtggtggtgctgagcttcgaactgctgcatgcccctgccacagtgtgcggccctaagaaagccctacagagtggtggtgctgagcttcgaactgctgcatgcccctgccacagtgtgcggccctaagaa

aagcaccaatctcgtgaagaacaaatgcgtgaacttccatcaccaccatcatcaccatcaccaccactaaaagcaccaatctcgtgaagaacaaatgcgtgaacttccatcaccaccatcatcaccatcaccaccactaa

gtcgaccgagcggttcccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaatagtcgaccgagcggttcccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaata

aggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccgg

aaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtcaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtc

tgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgacccttgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccct

ttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacattgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagataca

cctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctcacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctca

cctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctgggcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggg

gcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaacgtctaggccccccgaaccacgggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaacgtctaggccccccgaaccacgggg

acgtggttttcctttgaaaaacacgatgataatatggccacaaccatgaccgagtacaagcccacggtgcacgtggttttcctttgaaaaacacgatgataatatggccacaaccatgaccgagtacaagcccacggtgc

gcctcgccacccgcgacgacgtccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgcgcctcgccacccgcgacgacgtccccaggggccgtacgcaccctcgccgccgcgttcgccgactaccccgc

cacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacgcacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacg

cgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgc

cggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccgcggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccg

gctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctg

gccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtgggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtgg

aggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgaaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacga

gcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcgcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgc

aagcccggtgcctgattcgcatatgggttaatgcttcgagcagacatgataagatacattgatgagtttgaagcccggtgcctgattcgcatatgggttaatgcttcgagcagacatgataagatacattgatgagtttg

gacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttattgacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatt

tgtaaccattataagctgcaataaacaagttcctcgacctctagctagagctactcgggaccccttaccgtgtaaccattataagctgcaataaacaagttcctcgacctctagctagagctactcgggaccccttaccg

aaacatcgccgcattctgcagaggagtcgagtgtatgtaaacttctgacccactgggaatgtgatgaaagaaacatcgccgcattctgcagaggagtcgagtgtatgtaaacttctgacccactgggaatgtgatgaaag

aaataaaagctgaaatgaatcattctctctactattattctgatatttcacattcttaaaataaagtggtaaataaaagctgaaatgaatcattctctactattattctctgatatttcacattcttaaaataaagtggt

gatcctaactgacctaagacagggaatttttactaggattaaatgtcaggaattgtgaaaaagtgagtttgatcctaactgacctaagacagggaatttttactaggattaaatgtcaggaattgtgaaaaagtgagttt

aaatgtatttggctaaggtgtatgtaaacttccgacttcaactgtatagggatccgctcaatactgaccaaaatgtatttggctaaggtgtatgtaaacttccgacttcaactgtatagggatccgctcaatactgacca

tttaaatcatacctgacctccatagcagaaagtcaaaagcctccgaccggaggcttttgacttgatcggctttaaatcatacctgacctccatagcagaaagtcaaaagcctccgaccggaggcttttgacttgatcggc

acgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgagacgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgag

attttcaggagctaaggaagctaaaatgagccatattcaacgggaaacgtcttgctcgaggccgcgattaattttcaggagctaaggaagctaaaatgagccatattcaacgggaaacgtcttgctcgaggccgcgatta

aattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcgaaattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcga

caatctatcgattgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgccaatctatcgattgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgc

caatgatgttacagatgagatggtcaggctaaactggctgacggaatttatgcctcttccgaccatcaagcaatgatgttacagatgagatggtcaggctaaactggctgacggaatttatgcctcttccgaccatcaag

cattttatccgtactcctgatgatgcatggttactcaccactgcgatcccagggaaaacagcattccaggcattttatccgtactcctgatgatgcatggttactcaccactgcgatcccagggaaaacagcattccagg

tattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgcatattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgca

ttcgattcctgtttgtaattgtccttttaacggcgatcgcgtatttcgtctggctcaggcgcaatcacgattcgattcctgtttgtaattgtccttttaacggcgatcgcgtatttcgtctggctcaggcgcaatcacga

atgaataacggtttggttggtgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtctatgaataacggtttggttggtgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtct

ggaaagaaatgcataagcttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttgaggaaagaaatgcataagcttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttga

taaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccgataaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccga

taccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttctaccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttc

aaaaatatggtattgataatcctgatatgaataaattgcagtttcacttgatgctcgatgagtttttctaaaaaatatggtattgataatcctgatatgaataaattgcagtttcacttgatgctcgatgagtttttcta

atgagggcccaaatgtaatcacctggctcaccttcgggtgggcctttctgcgttgctggcgtttttccatatgagggcccaaatgtaatcacctggctcaccttcgggtgggcctttctgcgttgctggcgtttttccat

aggctccgcccccctgacgagcatcacaaaaatcgatgctcaagtcagaggtggcgaaacccgacaggacaggctccgcccccctgacgagcatcacaaaaatcgatgctcaagtcagaggtggcgaaacccgacaggac

tataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttac

cggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctc

agttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcg

ccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccacccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccac

tggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactac

ggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttacctcggaaaaagagttggggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttacctcggaaaaagagttgg

tagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacg

cgcagaaaaaaaggatctcaagaagatcctttgattttctac</INSDSeq_sequence>cgcagaaaaaaaggatctcaagaagatcctttgattttctac</INSDSeq_sequence>

</INSDSeq></INSDSeq>

</SequenceData></SequenceData>

</ST26SequenceListing></ST26SequenceListing>

<---<---

Claims (12)

1. Рекомбинантная плазмида pVEAL3-XBB.1.5, обеспечивающая синтез и секрецию рецептор-связывающего домена RBD S белка SARS-CoV-2 варианта ХВВ.1.5 в клетках млекопитающих СНО-К1, имеющая нуклеотидную последовательность SEQ ID NO:l и содержащая в соответствии с физической и генетической картой следующие элементы:1. Recombinant plasmid pVEAL3-XBB.1.5, providing the synthesis and secretion of the receptor-binding domain of the RBD S protein of the SARS-CoV-2 variant XBB.1.5 in mammalian cells CHO-K1, having the nucleotide sequence SEQ ID NO:l and containing the following elements in accordance with the physical and genetic map: - 5'ITR_SB, имеющие координаты 88-317 п.н.; 3TTR_SB, имеющие координаты 3229-3458 п.н. и являющиеся инвертированными концевыми повторами, обеспечивающими связывание с транспозазой SB;- 5'ITR_SB, having coordinates 88-317 bp; 3TTR_SB, having coordinates 3229-3458 bp and being inverted terminal repeats that ensure binding to the SB transposase; - 5'IFR, имеющие координаты 318-368 п.н.; 3'IFR, имеющие координаты 3181-3228 п.н. и являющиеся областями, фланкирующими ITR;- 5'IFR, having coordinates 318-368 bp; 3'IFR, having coordinates 3181-3228 bp and being regions flanking the ITR; - CMV enhancer, имеющий координаты 369-733 п.н., CMV promoter, имеющий координаты 734-937 п.н. и являющийся сильным промотером, обеспечивающим высокий выход рекомбинантного белка в клетках млекопитающих;- CMV enhancer, having coordinates 369-733 bp, CMV promoter, having coordinates 734-937 bp and being a strong promoter, providing a high yield of recombinant protein in mammalian cells; - ХВВ.1.5 - последовательность, кодирующая рецептор-связывающий домен S белка SARS-CoV-2 варианта ХВВ.1.5 и имеющая координаты 1065-1766 п.н.;- XBB.1.5 is a sequence encoding the receptor-binding domain of the S protein of SARS-CoV-2 variant XBB.1.5 and having coordinates 1065-1766 bp; - 10 his - последовательность, необходимая для очистки рекомбинантного белка и имеющая координаты 1767-1796 п.н.;- 10 his - a sequence necessary for purification of the recombinant protein and having coordinates 1767-1796 bp; - EMCV IRES - участок внутренней посадки рибосомы, имеющий координаты с 1818 по 2392 п.н.;- EMCV IRES - internal ribosome entry site, with coordinates from 1818 to 2392 bp; - Puro R - ген устойчивости к антибиотику пуромицину, имеющий координаты 2405-3004 п.н.;- Puro R - a gene of resistance to the antibiotic puromycin, having coordinates 2405-3004 bp; - SV40 poly(A) signal - последовательность, обеспечивающая стабилизацию мРНК-транскриптов, имеющая координаты 3039-3160 п.н.;- SV40 poly(A) signal - a sequence that ensures stabilization of mRNA transcripts, having coordinates 3039-3160 bp; - KanR - ген устойчивости к антибиотику канамицину, имеющий координаты 3645-4460 п.н.;- KanR is a gene of resistance to the antibiotic kanamycin, with coordinates 3645-4460 bp; - участок начала репликации ori, имеющий координаты 4523-5110 п.н.- the site of the origin of replication ori, having coordinates 4523-5110 bp. 2. Рекомбинантный штамм клеток яичника китайского хомячка СНО-ХВВ.1.5, полученный совместной трансфекцией указанных клеток рекомбинантной плазмидой pVEAL3-ХВВ.1.5 по п. 1 и плазмидой pCMV(CAT)T7-SB 100, кодирующей транспозазу SB 100, и являющийся продуцентом рецептор-связывающего домена RBD S белка SARS-CoV-2 варианта ХВВ.1.5, предназначенного для создания иммунобиологических препаратов.2. A recombinant strain of Chinese hamster ovary cells CHO-XBB.1.5 obtained by co-transfection of the said cells with the recombinant plasmid pVEAL3-XBB.1.5 according to item 1 and the plasmid pCMV(CAT)T7-SB 100 encoding the SB 100 transposase, and which is a producer of the receptor-binding domain of the RBD S protein of the SARS-CoV-2 variant XBB.1.5, intended for the creation of immunobiological preparations.
RU2024134681A 2024-11-19 RECOMBINANT PLASMID pVEAL3-XBB.1.5, WHICH PROVIDES SYNTHESIS AND SECRETION OF RECEPTOR-BINDING DOMAIN RBD S OF SARS-CoV-2 PROTEIN OF VARIANT XBB.1.5, AND RECOMBINANT STRAIN CHO-XBB.1.5 - PRODUCER OF RECEPTOR-BINDING DOMAIN RBD S PROTEIN SARS-CoV-2 VERSION XBB.1.5 INTENDED FOR PRODUCING IMMUNOBIOLOGICAL PREPARATIONS RU2839373C1 (en)

Publications (1)

Publication Number Publication Date
RU2839373C1 true RU2839373C1 (en) 2025-04-30

Family

ID=

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210347858A1 (en) * 2020-04-03 2021-11-11 Firebreak, Inc. Alimentary and systemic antiviral therapeutics
RU2781294C1 (en) * 2022-07-06 2022-10-11 Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФБУН ГНЦ ВБ "Вектор" Роспотребнадзора) CONJUGATE OF THE RECEPTOR-BINDING DOMAIN (RBD) PROTEIN OF SARS-CoV-2 SURFACE GLYCOPROTEIN S WITH POLYGLUCIN-SPERMIDINE (PGS) POLYMER AND VACCINE COMPLEX AGAINST CORONAVIRUS INFECTION COVID-19 BASED ON THE SPECIFIED CONJUGATE AND PLASMID DNA PVAX-RBD

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210347858A1 (en) * 2020-04-03 2021-11-11 Firebreak, Inc. Alimentary and systemic antiviral therapeutics
RU2781294C1 (en) * 2022-07-06 2022-10-11 Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека (ФБУН ГНЦ ВБ "Вектор" Роспотребнадзора) CONJUGATE OF THE RECEPTOR-BINDING DOMAIN (RBD) PROTEIN OF SARS-CoV-2 SURFACE GLYCOPROTEIN S WITH POLYGLUCIN-SPERMIDINE (PGS) POLYMER AND VACCINE COMPLEX AGAINST CORONAVIRUS INFECTION COVID-19 BASED ON THE SPECIFIED CONJUGATE AND PLASMID DNA PVAX-RBD

Similar Documents

Publication Publication Date Title
US5763192A (en) Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique
CA1341595C (en) Procedure for obtaining dna, rna, peptides, polypeptides, or proteins byrecombinant dna techniques
UA34493C2 (en) PROCESS for PREPARATION OF HOMOLOGICALLY recombinant cell (variants), plasmid for use in the Process (variants), strain of recombinant cells of fibrosarcoma of human (variants), PROCESS for PREPARATION of human erythropoietin (variants)
WO2000058499A1 (en) Process for producing monoclonal antibody
JP2008061650A (en) A plasmid system for multigene expression.
CN112209995B (en) Preparation method of SARS-CoV-2 surface protein receptor binding region
KR20090090924A (en) Development of Optimal Eukaryotic Cell Expression Vectors
CN110079539B (en) Preparation method of prostatic acid phosphatase/granulocyte-macrophage colony stimulating factor
WO2017181920A1 (en) Method for preparing recombinant human granulocyte colony-stimulating factor
EP0244677A2 (en) Method of producing peptides, recombinant plasmid for use in the same and myeloma cells transformed with the same
KR101724614B1 (en) New Catalase Signal Sequences and Expression Method Using The Same
CN104119445A (en) Fusion protein containing leucine-rich repetitive sequence, and preparation method and application thereof
ES2528330T3 (en) Compartmentalization of recombinant polypeptides in host cells
WO2021206587A1 (en) Sars-cov-2 dna vaccine based on gene therapy dna vector gdtt1.8nas12
CN112725380A (en) High-efficiency expression system for stably expressing foreign protein CHO cell, screening method thereof and application of high-efficiency expression system in PCV2Cap protein
KR101803013B1 (en) New Lipase Signal Sequences and Expression Method Using The Same
KR102008407B1 (en) Codon optimized il-21 and uses thereof
CN114854717B (en) Lipase and encoding gene and application thereof
RU2808501C1 (en) RECOMBINANT PLASMID pBU-LipA, PROVIDING SYNTHESIS OF LIPASE A PROTEIN FROM BACILLUS NATTO STRAIN IAN
CN111732667B (en) Peste des petits ruminants virus genetic engineering subunit vaccine
JP2002176979A (en) Transformed yeast presenting cellulose-binding domain on cell surface layer
KR101781327B1 (en) New Lipase Signal Sequences and Expression Method Using The Same
KR101781328B1 (en) New Lipase Signal Sequences and Expression Method Using The Same
EP1352060A2 (en) Methods for expressing endogenous genes by restriction enzyme mediated integration
WO2025066945A1 (en) Method for expressing and purifying human recombinant interleukin-7