RU2839373C1 - RECOMBINANT PLASMID pVEAL3-XBB.1.5, WHICH PROVIDES SYNTHESIS AND SECRETION OF RECEPTOR-BINDING DOMAIN RBD S OF SARS-CoV-2 PROTEIN OF VARIANT XBB.1.5, AND RECOMBINANT STRAIN CHO-XBB.1.5 - PRODUCER OF RECEPTOR-BINDING DOMAIN RBD S PROTEIN SARS-CoV-2 VERSION XBB.1.5 INTENDED FOR PRODUCING IMMUNOBIOLOGICAL PREPARATIONS - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: what is described is a recombinant plasmid genetic construct pVEAL3-XBB.1.5 providing synthesis and secretion of the receptor-binding domain RBD S protein of SARS-CoV-2 variant XBB.1.5 in CHO-K1 cells having the nucleotide sequence SEQ ID NO: 1, comprising elements in accordance with the physical and genetic map presented in Fig. 1. Recombinant strain of cells of Chinese hamster ovary CHO-XBB.1.5 – producer of receptor-binding domain RBD S protein of SARS-CoV-2 variant XBB.1.5 – is obtained by co-transfection of said cells with recombinant plasmid pVEAL3-XBB.1.5 according to cl. 1 and plasmid pCMV(CAT)T7-SB100, encoding transposase SB 100.

EFFECT: what is described is a recombinant plasmid genetic construct pVEAL3-XBB.1.5 providing synthesis and secretion of the receptor-binding domain RBD S protein of SARS-CoV-2 variant XBB.1.5 in CHO-K1 cells.

2 cl, 2 dwg, 1 tbl

Description

The invention relates to the recombinant plasmid pVEAL3-XBB.1.5, which provides the synthesis and secretion of the receptor-binding domain of the RBD S protein of SARS-CoV-2 variant XBB.1.5, and the recombinant strain CHO-XBB.1.5, a producer of the receptor-binding domain of the RBD S protein of SARS-CoV-2 variant XBB.1.5, and can be used in biotechnology and genetic engineering to create immunobiological preparations, which include diagnostic tools and prophylactic vaccines against SARS-CoV-2 variant XBB.1.5.

State of the art. The SARS-CoV-2 variant XVB.1.5 is an example of interlineage recombination of subvariants of the Omicron BA.2 lineage. It has high contagiousness due to a large number of mutations in the XVB.1.5 S protein. The primary structures of the S protein of the Wuhan variant and the XVB.1.5 variant differ in approximately 45 amino acids [1]. Due to a large number of mutations in the spike protein, the Omicron variant and its descendants, in particular XVB. 1.5, are antigenically different from other SARS-CoV-2 variants, which requires updating the existing vaccines [1, 2].

Most effective and broadly neutralizing antibodies target the receptor-binding domain (RBD), which mediates binding to human angiotensin-converting enzyme 2 (ACE2), the SARS-CoV-2 receptor on human cells. Therefore, RBD-based subunit vaccines are highly immunogenic. It is worth noting that RBD-based vaccines are safer than full-length spike protein-based vaccines or inactivated vaccines [3], are relatively simple and inexpensive to produce, and are stable during storage. From the above, it follows that the RBD of the corresponding SARS-CoV-2 variant can be used to create new vaccine preparations that induce immunity against new SARS-CoV-2 variants.

Closest analogues

Patent RU 2723008 C1 [5] describes a method for obtaining a strain of Chinese hamster ovary cells CHO-S-RBD-producing RBD, culturing the CHO-S-RBD strain and a method for purifying RBD, as well as a test system for enzyme immunoassay of human blood serum or plasma. The said invention uses a plasmid vector for episomal expression in mammalian cell lines, and the producer strain allows obtaining RBD protein in an amount from 5 mg/l to 10 mg/l.

Patent RU 2802825 C2 [6] describes an antigen composition that can induce a specific humoral and cellular immune response to SARS-CoV-2. The antigen composition contains betulin as an adjuvant, and the active component is recombinant RBD protein of different variants conjugated with the Fc fragment of IgG. Biosynthesis of recombinant RBD-SD1-Fc proteins was carried out in CHO cells in the transient expression mode. The production of this protein ranged from 5 mg/l to 10 mg/l.

Patent RU 2772904 C1 [7] describes the production of an expression genetic construct containing the nucleotide sequence of the RBDdelta domain with optimized codons and providing expression of the RBD protein of the B. 1.617.2 SARS-CoV-2 line in mammalian cells. The authors of the invention have developed a method for producing the RBD protein, including culturing eukaryotic cells and expressing the target protein, isolating the protein using affinity chromatography and screening for expression. The protein concentration in the culture fluid ranged from 5 mg/l to 10 mg/l.

The disadvantages of the above-mentioned inventions include a relatively low level of expression of the target protein (up to 10 mg/l), which is associated primarily with the features of the design of the molecular genetic vector constructs, and also, in the case of RU 2772904 C1, with the features of culturing the producer.

The closest analogue (prototype) in purpose and essence to the claimed invention is patent RU 2816175 [4], which describes the integrative plasmid vector pVEAL3-RBDdel, which provides the synthesis and secretion of the recombinant RBDdelta protein of SARS-CoV-2 in mammalian cells, and the recombinant strain of the CHO-K1-RBDdelta cell line. In this patent, the CHO-K1-RBDdelta producer allows obtaining the RBD protein of the delta variant, which has immunogenicity.

However, the known analogues and prototype do not provide the RBD protein of the XBB.1.5 variant, which is one of the latest variants of SARS-CoV-2, which is one of the more pressing issues at the moment.

The technical result of the claimed invention is the creation of such a plasmid vector and a strain of protein-producing cells that provide a higher and more stable expression of the recombinant RBD protein of the SARS-CoV-2 virus variant XVB.1.5.

The specified technical result is achieved by the creation of a recombinant plasmid genetic construct pVEAL3-ХВВ.1.5, which ensures the synthesis and secretion of the receptor-binding domain of the RBD S protein of the SARS-CoV-2 variant ХВВ.1.5 in mammalian cells CHO-K1, having the nucleotide sequence SEQ ID NO: 1 and containing, in accordance with the physical and genetic map presented in Fig. 2, the following elements:

- 5'ITR_SB, having coordinates 88-317 bp; 3'ITR_SB, having coordinates 3229-3458 bp and being inverted terminal repeats that ensure binding to the SB transposase;

- 5'IFR, having coordinates 318-368 bp; 3'IFR, having coordinates 3181-3228 bp and being regions flanking the ITR;

- CMV enhancer, having coordinates 369-733 bp, CMV promoter, having coordinates 734-937 bp and being a strong promoter, providing a high yield of recombinant protein in mammalian cells;

- XBB.1.5 is a sequence encoding the receptor-binding domain of the S protein of SARS-CoV-2 variant XBB.1.5 and having coordinates 1065-1766 bp;

- 10 his-sequence, necessary for purification of the recombinant protein and having coordinates 1767-1796 bp;

- EMCV IRES-site of internal ribosome entry, having coordinates from 1818 to 2392 bp;

- Puro R is a gene of resistance to the antibiotic puromycin, with coordinates (2405-3004 bp);

- SV40 poly(A) signal sequence, which ensures stabilization of mRNA transcripts, has coordinates 3039-3160 bp;

- KanR is a gene of resistance to the antibiotic kanamycin, with coordinates 3645-4460 bp;

- the site of the origin of replication ori, having coordinates 4523-5110 bp.

The specified technical result is also achieved by the fact that a recombinant strain CHO-ХВВ.1.5 is created, obtained by joint transfection of the recombinant plasmid genetic construct pVEAL3-ХВВ.1.5 according to item 1 and the plasmid pCMV(CAT)T7-SB100 encoding the SB100 transposase and being the producer of the receptor-binding domain RBD S protein of the SARS-CoV-2 variant ХВВ.1.5, intended for the creation of immunobiological preparations.

The method for obtaining the Chinese hamster ovary cell strain CHO-HVV.1.5 includes:

- obtaining a genetic construct having the nucleotide sequence SEQ ID NO: 1;

- introduction of the specified genetic construct into animal cells by transfection with PEI;

- selection of cells on the antibiotic puromycin.

The method for producing the recombinant RBD protein of the SARS-CoV-2 virus XVV.1.5 contains:

- cultivation of the Chinese hamster ovary cell strain CHO-HVB.1.5;

- chromatographic purification of the recombinant RBD protein of the SARS-CoV-2 virus XVB.1.5 from the culture medium of the Chinese hamster ovary cell strain CHO-XVB.1.5;

- confirmation of obtaining the recombinant RBD protein of the SARS-CoV-2 virus.1.5.

The invention is illustrated by the following graphic materials. Fig. 1 shows the nucleotide sequence of the recombinant plasmid pVEAL3-ХВВ.1.5. Fig. 2 shows the physical and genetic map of the plasmid pVEAL3-ХВВ.1.5. For a better understanding of the essence of the proposed invention, examples (1-4) of its implementation are given below.

Example 1. Obtaining recombinant plasmid pVEAL3-XBB.1.5

To construct the pVEAL3-ХВВ.1.5 vector (Fig. 2) containing the nucleotide sequence of the receptor-binding domain of the RBD S protein of the SARS-CoV-2 variant ХВВ.1.5, we used the pVEAL3-10H10 full plasmid obtained by the employees of the Bioengineering Department of the Federal Research Center of Virology and Biotechnology Vector of Rospotrebnadzor. Previously, the plasmid based on the pVEAL3 vector demonstrated its effectiveness (RU Patent No. 2816175). The gene of the receptor-binding domain of the RBD S protein of the SARS-CoV-2 variant ХВВ.1.5 was synthesized by DNA-Synthesis LLC. For the amplification of the specified gene, primers (Table 1) F_XBB.1.5_AsuNHI_1, R_XBB.1.5_SalI_1 (DNA-Synthesis LLC) were also synthesized, which contain the AsuNHI, Sail hydrolysis sites.

For amplification of the RBD gene of XBB.1.5, Q5 Hot Start HF DNA polymerase (New England Biolabs Inc.) was used. The temperature profile of the PCR reaction and the composition of the reaction mixture were selected in accordance with the manufacturer's instructions. The 804 bp RBD XBB.1.5 PCR product was isolated from agarose gel using the Cleanup Mini kit (ZAO Evrogen) in accordance with the manufacturer's instructions. The PCR product of RBD XBB. 1.5 and the pVEAL3-10H10 full plasmid were subjected to enzymatic hydrolysis with restriction endonucleases AsuNHI, SalI (NPO SibEnzyme) in accordance with the manufacturer's instructions. The pVEAL3 vector fragment 4345 bp and the RBD XBB.1.5 786 bp were purified using the following plasmids: were isolated from agarose gel using the Cleanup Mini kit (ZAO Evrogen) in accordance with the manufacturer's instructions. Ligation of the fragments was performed with T4 phage ligase (NPO SibEnzyme) in accordance with the manufacturer's instructions. Then, using the Heat Shock method, Escherichia coli cells of the Neb Stable strain were transformed with the ligase mixture and plated on an agar nutrient medium in a Petri dish. The next day, the clones from the Petri dish were inoculated into LB nutrient medium and cultured at 37°C in a shaker overnight. Then, using the QIAprep Spin Miniprep Kit (QIAGEN), plasmid DNA was isolated in accordance with the manufacturer's instructions. The nucleotide sequence of SEQ ID NO: 1 (Fig. 1) of the pVEAL3-ХВВ.1.5 plasmid was confirmed by Sanger sequencing.

Example 2. Obtaining a recombinant strain CHO-HVV.1.5

To obtain the producer strain, a pure suspension culture of Chinese hamster ovary cells CH0-K1 was co-transfected with plasmids pVEAL3-XBB.1.5 and pCMV(CAT)T7-SB 100 (Addgene). For this purpose, the volume of the suspension culture CHO-K1 containing 5x10 ⁶ living cells was centrifuged at 800 rpm for 5 min. After centrifugation, the growth nutrient medium was removed, the cell pellet was resuspended in 1 ml of the transfection medium HyClone HyCell TransFx-C transfection media (Cytiva). Plasmids pVEAL3-XBB.1.5 and pCMV(CAT)T7-SB100 were added to the cell suspension in a ratio of 10:1 and mixed. 10 μg of PEI (PEI 25K, Polysciences, Inc.) were added and mixed. The culture was continued for 6 hours on a shaker at 200 rpm, (37±1)°C in a humidified atmosphere of 5% CO ₂ . After this time, 4 ml of warm growth medium for suspension cultivation HyClone HyCell CHO cell culture media (Cytiva) were added to the tube. The culture was continued for 48 hours after transfection on a shaker at 200 rpm, (37±1)°C in a humidified atmosphere of 5% CO ₂ . After 48 hours, the cell concentration in the suspension culture was calculated. A culture volume containing 2×10 ⁶ living cells was collected, growth medium for suspension cultivation was added to 2 ml, and the selective antibiotic puromycin (InvivoGen) was added in a ratio of 0.25 μl puromycin per 1 ml of cell suspension. Cultivation of transformed cells was continued for 2 weeks under the same conditions, gradually increasing the concentration of puromycin to 1 μl per 1 ml of cell suspension. Cell reseeding was performed when the cell density reached ≈ 6-8×10 ⁶ living cells/ml.

The most productive CHO-HBV.1.5-producing clones were then selected from the resulting cell suspension. For this purpose, the cells were seeded into the wells of a 96-well plate using the limiting dilution method at a concentration of 1 cell/well in the presence of puromycin. Clones were selected on DMEM F12 medium (Gibco) with the addition of fetal bovine serum (Gibco) in an amount of 10% of the total volume. The plate was placed in a CO ₂ incubator. The cultured cells were cultured at a temperature of (37±1)°C in a humidified atmosphere of 5% CO ₂ for 14 days. After 14 days, the presence of cell growth in the wells was analyzed under a microscope. The conditioned medium was collected from the "positive" wells and analyzed for the presence of the HBV.1.5 RBD protein in it using the enzyme-linked immunosorbent assay (ELISA). The cells from the wells with the highest signal in the ELISA were transplanted into 6-well plates, and after the monolayer had closed, into falcons for further suspension cultivation. Thus, 10 most productive clones were selected from the entire pool of CHO-XBB.1.5 producer cells.

The selected clones of CHO-XBB.1.5 were cultured on a shaker at 200 rpm, (37±1)°C in a humidified atmosphere of 5% CO ₂ . The initial cell concentration during cultivation was 0.3×10 ⁶ living cells/ml. After 2-4 days of cultivation in suspension, the cell concentration was calculated. The suspension volume corresponding to a concentration of 2×10 ⁶ living cells/ml was collected in microcentrifuge tubes. The cells were centrifuged at 800 rpm for 5 min, the supernatant was removed, the cell pellet was resuspended in 2 ml of fresh growth medium for suspension cultivation and transferred to a falcon. The cells were cultured on a shaker at 200 rpm, (31±1)°C in a humidified atmosphere of 5% CO ₂ for 10 days. After the time had elapsed, the cell suspension was centrifuged to separate the culture fluid from the cell debris at 4000 rpm, 15 min, +4°C. The culture fluid from each CHO-XBB.1.5 monoclone was analyzed by protein electrophoresis in polyacrylamide gel (SDS-PAGE) for the presence of the target protein RBD XBB.1.5. The monoclones were compared by productivity and 3 monoclones were left for further work.

Example 3. Cultivation of the recombinant strain CHO-HVV.1.5

The CHO-XVB.1.5 strain was cultured in HyClone HyCell CHO cell culture media (Cytiva) with periodic feeding of 40% glucose solution. The glucose concentration in the medium was maintained at 40 mM. The initial cell concentration was 0.35×10 ⁶ living cells/ml. Cultivation was carried out on a shaker at 200 rpm, (37±1)°C in a humidified atmosphere of 5% CO ₂ until a density of ≈ 8×10 ⁶ living cells/ml and a viability of ≥95% were achieved. Upon reaching the specified density, the required volume of culture was taken for the next passage, and the remaining volume of culture was cultured on a shaker at 200 rpm, (31±1)°C in a humidified atmosphere of 5% CO ₂ for 14 days.

Example 4. Isolation and purification of RBD HVV.1.5

After 14 days, the cell suspension was centrifuged to separate the culture fluid from the cell debris at 15,000 rpm, 15 min, +4°C.

Protein purification was performed on Ni-Sepharose 6FF. Application rate was 5 ml/min, washing rate was 3 ml/min, elution rate was 1.5 ml/min. The column was equilibrated with 5 volumes of buffer A (20 mM Tris-HCl, pH 8.0, 200 mM KCl, 5 mM imidazole). The culture liquid was applied to the column. The column was washed with 5 volumes of buffer C (20 mM Tris-HCl, pH 8.0, 1 M Kl, 5 mM imidazole). Elution was performed with buffer B (20 mM Tris-HCl, pH 8.0, 20 mM KCl, 0.5 M imidazole).

Purified RBD protein XBB.1.5 was dialyzed using 20 mM TrisHCl, pH 8.0, 150 mM KCl buffer.

The RBD protein preparation XBB.1.5 was analyzed by SDS-PAGE.

Sources of scientific, technical and patent information

1. Kharchenko E. P. Coronavirus HVB.1.5 as an indicator of a long-term continuation of the Covid-19 pandemic. What's next with vaccination? Epidemiology and Vaccine Prevention. 2023;22(2): 12-22. https://doi: 10.31631/2073-3046-2023-22-2-12-22

2. Holmes E. S. The emergence and evolution of SARS-CoV-2 // Annual review of virology. - 2024. - T. 11.

3. Sun Y. et al. Development of an RBD-Fc fusion vaccine for COVID-19 // Vaccine: X. - 2024. - T. 16. - P. 100444.

4. Russian Federation Patent No. 2816175. Integrative plasmid vector pVEAL3-RBDdel providing synthesis and secretion of recombinant protein of the receptor-binding domain RBDdelta of the SARS-CoV-2 coronavirus in mammalian cells, recombinant cell line strain CHO-Kl-RBDdelta and recombinant protein RBDdelta SARS-CoV-2 produced by the cell line strain / Nesmeyanova V.S., Merkulyeva Yu.A., Isaeva A.A., Shcherbakov D.N., Volkova N.V., Belenkaya S.V., Borgoyakova M.B., Volosnikova E.A., Esina T.I., Zaykovskaya A.V., Pyankov O.V., Ilyichev A.A. Bulletin No. 2, 03.26.2024.

5. Patent of the Russian Federation No. 2723008 C1 Method for obtaining a strain of Chinese hamster ovary cells, a producer of recombinant RBD protein of the SARS-CoV-2 virus, a strain of Chinese hamster ovary cells, a producer of recombinant RBD protein of the SARS-CoV-2 virus, a method for obtaining a recombinant RBD protein of the SARS-CoV-2 virus, a test system for enzyme-linked immunosorbent assay of human blood serum or plasma and its use / Shcheblyakov D.V., Esmagambetov I.B., Logunov D.Yu., Derkaev A.A., Simakin P.V., Izhaeva F.M., Dzharullaeva A.Sh., Zubkova O.V., Ozharovskaya T.A., Dolzhikova I.V., Tukhvatulin A., Tukhvatulina N.M., Favorskaya I.A., Naroditsky B.S., Ginzburg A.L. Bull. No. 16, 06/08/2020.

6. Russian Federation Patent No. 2802825 C2. Gene construct for expression of recombinant proteins based on the SARS-CoV-2 S protein region, including RBD and SD1, fused with the Fc fragment of IgG, a method for producing recombinant proteins, antigens and antigen compositions for inducing long-term antibody and cellular immunity against the SARS-CoV-2 virus / Isaev A.A., Kudryavtsev A.V., Frolova M.E., Vakhrusheva A.V., Ivanov A.V., Dzhonovich M, Ivanishin T.V., Krasilnikov I.V. Bulletin No. 19, 30.06.2023.

7. Russian Federation Patent No. 2772904 C1. Recombinant plasmid pVBL-RBDdelta providing the synthesis and secretion of the recombinant receptor-binding domain (RBD) of the SARS-CoV-2 coronavirus line B. 1.617.2 in mammalian cells / Toropovsky A. N., Viktorov D. A., Shcherbakov D. N., Nikitin A. G. Bulletin No. 15, 05.26.2022.

8. Kulemzin S.V., Sergeeva M.V., Baranov K.O., et al. VH3-53/66-Class RBD-Specific Human Monoclonal Antibody iB20 Displays Cross-Neutralizing Activity against Emerging SARS-CoV-2 Lineages // Journal of personalized medicine. - 2022. - V. 12. - No. 6. - P. 895.

--->

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.3//EN" "ST26SequenceListing_V1_3.dtd">

<ST26SequenceListing dtdVersion="V1_3" fileName="Application.

Sequence of plasmid pVEAL3-XBB.1.5 for synthesis of RBD S protein

SARS-CoV-2.xml" softwareName="WIPO Sequence" softwareVersion="2.3.0"

productionDate="2024-10-31">

<ApplicationIdentification>

<IPOfficeCode>RU</IPOfficeCode>

<ApplicationNumberText>123456</ApplicationNumberText>

<FilingDate>2024-10-31</FilingDate>

</ApplicationIdentification>

<ApplicantFileReference>1234</ApplicantFileReference>

<EarliestPriorityApplicationIdentification>

<IPOfficeCode>RU</IPOfficeCode>

<ApplicationNumberText>1234567</ApplicationNumberText>

<FilingDate>2024-10-19</FilingDate>

</EarliestPriorityApplicationIdentification>

<ApplicantName languageCode="ru">Federal budgetary institution

science "State Research Center of Virology and Biotechnology

"Vector" of the Federal Service for Supervision of Human Rights Protection

consumers and human well-being (Federal Budgetary Institution of Science State Research Center of Virology and Biotechnology "Vector"

Rospotrebnadzor)</ApplicantName>

<ApplicantNameLatin>Federal Scientific Research Institute

&quot;State Scientific Center of Virology and Biotechnology

&quot;Vector&quot; Federal Service for Supervision in the Sphere of Protection

consumer rights and the goodness of man (FBUN GNTS VB

&quot;Vektor&quot; Rospotrebnadzora) (RU)</ApplicantNameLatin>

<InventionTitle languageCode="en">Recombinant plasmid

pVEAL3-XBB.1.5, providing synthesis and secretion

receptor-binding domain of the RBD S protein of SARS-CoV-2 variant XBB.1.5,

and the recombinant strain CHO-XBB.1.5, a producer of the receptor-binding

RBD domain of the SARS-CoV-2 S protein variant XBB.1.5, intended for

creation of immunobiological preparations </InventionTitle>

<SequenceTotalQuantity>1</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>5131</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..5131</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q2">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cgaagaaaggcccacccgtgaaggtgagccagtgagttgattgcagtcc

agttacgctggagtctgaggctcgtcctgaatggatccctatacagttgaagtcggaagtttacatacac

ttaagttggagtcattaaaactcgtttttcaactactccacaaatttcttgttaacaaacaatagttttg

gcaagtcagttaggacatctactttgtgcatgacacaagtcatttttccaacaattgtttacagacagat

tatttcacttataattcactgtatcacaattccagtgggtcagaagtttacatacactaagttcgactcc

tctgcagaatgcggcgatgtttcggtaaggggtccgctactagttattaatagtaatcaattacggggtc

attagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccg

cccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttcc

attgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgcc

aagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgacctta

tgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggc

agtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaa

tgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacg

caaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaaccca

ctgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagcatgtttgttt

ttcttgttttattgccactagtctctagtcagtgtgtggaaaagggcatctaccagaccagcaacttccg

ggtgcagcccaccgaatccatcgtgcggttccccaatatcaccaatctgtgccccttccacgaggtgttc

aatgccaccacattcgcctctgtgtacgcctggaaccggaagcggatcagcaattgcgtggccgactact

ccgtgatctacaactttgcccccttcttcgccttcaagtgctacggcgtgtcccctaccaagctgaacga

cctgtgcttcacaaacgtgtacgccgacagcttcgtgatccggggaaacgaagtgagccagattgcccct

ggacagacaggcaacatcgccgactacaactacaagctgcccgacgacttcaccggctgtgtgattgcct

ggaacagcaacaagctggactccaaaccctccggcaactacaattacctgtaccggctgttccggaagtc

caagctgaagcccttcgagcgggacatctccaccgagatctatcaggccggcaacaagccttgtaacggc

gtggccggccccaactgctactccccactgcagtcctacggctttcggcccacatacggcgtgggccacc

agccctacagagtggtggtgctgagcttcgaactgctgcatgcccctgccacagtgtgcggccctaagaa

aagcaccaatctcgtgaagaacaaatgcgtgaacttccatcaccaccatcatcaccatcaccaccactaa

gtcgaccgagcggttcccgcccctctccctcccccccccctaacgttactggccgaagccgcttggaata

aggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccgg

aaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtc

tgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccct

ttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagataca

cctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctca

cctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggg

gcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaacgtctaggccccccgaaccacgggg

acgtggttttcctttgaaaaacacgatgataatatggccacaaccatgaccgagtacaagcccacggtgc

gcctcgccacccgcgacgacgtccccaggggccgtacgcaccctcgccgccgcgttcgccgactaccccgc

cacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctcacg

cgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgc

cggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccg

gctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctg

gccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtgg

aggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacga

gcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgc

aagcccggtgcctgattcgcatatgggttaatgcttcgagcagacatgataagatacattgatgagtttg

gacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatt

tgtaaccattataagctgcaataaacaagttcctcgacctctagctagagctactcgggaccccttaccg

aaacatcgccgcattctgcagaggagtcgagtgtatgtaaacttctgacccactgggaatgtgatgaaag

aaataaaagctgaaatgaatcattctctactattattctctgatatttcacattcttaaaataaagtggt

gatcctaactgacctaagacagggaatttttactaggattaaatgtcaggaattgtgaaaaagtgagttt

aaatgtatttggctaaggtgtatgtaaacttccgacttcaactgtatagggatccgctcaatactgacca

tttaaatcatacctgacctccatagcagaaagtcaaaagcctccgaccggaggcttttgacttgatcggc

acgtaagaggttccaactttcaccataatgaaataagatcactaccgggcgtattttttgagttatcgag

attttcaggagctaaggaagctaaaatgagccatattcaacgggaaacgtcttgctcgaggccgcgatta

aattccaacatggatgctgatttatatgggtataaatgggctcgcgataatgtcgggcaatcaggtgcga

caatctatcgattgtatgggaagcccgatgcgccagagttgtttctgaaacatggcaaaggtagcgttgc

caatgatgttacagatgagatggtcaggctaaactggctgacggaatttatgcctcttccgaccatcaag

cattttatccgtactcctgatgatgcatggttactcaccactgcgatcccagggaaaacagcattccagg

tattagaagaatatcctgattcaggtgaaaatattgttgatgcgctggcagtgttcctgcgccggttgca

ttcgattcctgtttgtaattgtccttttaacggcgatcgcgtatttcgtctggctcaggcgcaatcacga

atgaataacggtttggttggtgcgagtgattttgatgacgagcgtaatggctggcctgttgaacaagtct

ggaaagaaatgcataagcttttgccattctcaccggattcagtcgtcactcatggtgatttctcacttga

taaccttatttttgacgaggggaaattaataggttgtattgatgttggacgagtcggaatcgcagaccga

taccaggatcttgccatcctatggaactgcctcggtgagttttctccttcattacagaaacggctttttc

aaaaatatggtattgataatcctgatatgaataaattgcagtttcacttgatgctcgatgagtttttcta

atgagggcccaaatgtaatcacctggctcaccttcgggtgggcctttctgcgttgctggcgtttttccat

aggctccgcccccctgacgagcatcacaaaaatcgatgctcaagtcagaggtggcgaaacccgacaggac

tataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttac

cggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctc

agttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcg

ccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccac

tggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactac

ggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttacctcggaaaaagagttgg

tagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacg

cgcagaaaaaaaggatctcaagaagatcctttgattttctac</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (12)

1. Recombinant plasmid pVEAL3-XBB.1.5, providing the synthesis and secretion of the receptor-binding domain of the RBD S protein of the SARS-CoV-2 variant XBB.1.5 in mammalian cells CHO-K1, having the nucleotide sequence SEQ ID NO:l and containing the following elements in accordance with the physical and genetic map: - 5'ITR_SB, having coordinates 88-317 bp; 3TTR_SB, having coordinates 3229-3458 bp and being inverted terminal repeats that ensure binding to the SB transposase; - 5'IFR, having coordinates 318-368 bp; 3'IFR, having coordinates 3181-3228 bp and being regions flanking the ITR; - CMV enhancer, having coordinates 369-733 bp, CMV promoter, having coordinates 734-937 bp and being a strong promoter, providing a high yield of recombinant protein in mammalian cells; - XBB.1.5 is a sequence encoding the receptor-binding domain of the S protein of SARS-CoV-2 variant XBB.1.5 and having coordinates 1065-1766 bp; - 10 his - a sequence necessary for purification of the recombinant protein and having coordinates 1767-1796 bp; - EMCV IRES - internal ribosome entry site, with coordinates from 1818 to 2392 bp; - Puro R - a gene of resistance to the antibiotic puromycin, having coordinates 2405-3004 bp; - SV40 poly(A) signal - a sequence that ensures stabilization of mRNA transcripts, having coordinates 3039-3160 bp; - KanR is a gene of resistance to the antibiotic kanamycin, with coordinates 3645-4460 bp; - the site of the origin of replication ori, having coordinates 4523-5110 bp. 2. A recombinant strain of Chinese hamster ovary cells CHO-XBB.1.5 obtained by co-transfection of the said cells with the recombinant plasmid pVEAL3-XBB.1.5 according to item 1 and the plasmid pCMV(CAT)T7-SB 100 encoding the SB 100 transposase, and which is a producer of the receptor-binding domain of the RBD S protein of the SARS-CoV-2 variant XBB.1.5, intended for the creation of immunobiological preparations.