RU2809369C1 - Caps marker for selecting barley hybrids that do not accumulate proanthocyanidins in grain - Google Patents

Abstract

FIELD: biochemistry.

SUBSTANCE: invention relates to a CAPS marker for selecting barley hybrids that do not accumulate proanthocyanidins in the grain.

EFFECT: invention makes it possible to effectively select barley plants with grains not accumulating proanthocyanidin compounds.

1 cl, 4 dwg, 2 ex

Description

The invention relates to agriculture and biotechnology and can be used to select barley hybrids that do not accumulate proanthocyanidins in the grain.

Proanthocyanidins, also known as condensed tannins, are oligomeric flavonoid compounds belonging to the class of plant polyphenols. Accumulating in the shells of barley grain (Hordeum vulgare, 2n=2x=14, НН), these compounds, in addition to their important role in maintaining seed dormancy and protecting them from unfavorable environmental conditions, have a significant impact on the quality characteristics of the grain, determining its intended use. Thus, barley grain proanthocyanidins are able to bind proline-rich storage proteins, causing irreversible colloidal turbidity in beer (1). To solve the problem of colloidal turbidity in beer in the 70s. last century, a strategy was proposed to reduce the fraction of proanthocyanidins in the grain of brewing varieties by introducing into the selection mutant alleles of genes that control the synthesis of proanthocyanidins (2). This became possible thanks to the collection of induced barley mutants with impaired synthesis of flavonoid compounds, Anthocyanin-less (Ant), created in Sweden, which currently includes more than 700 individual mutants grouped into 30 complementation groups, or loci, for eight of which have been identified molecular functions (1, 3).

The use of the resulting mutants as donors of recessive alleles of genes that control the biosynthesis of proanthocyanidins made it possible to obtain high-yielding brewing varieties with increased colloidal stability of beer (2). However, as has been shown, mutant alleles of most Ant loci cannot be used in the selection of proanthocyanidin-free varieties, since they lead not only to the absence of proanthocyanidins in the grain, but also to a decrease in the yield and quality characteristics of malt and finished beer (4-6). The most successful experience was the use of mutants at the Ant27, Ant28, Ant29 loci, which specifically control the synthesis of proanthocyanidins and do not affect the synthesis of other flavonoid compounds, including anthocyanins (2, 7, 8). When creating proanthocyanidin-free varieties based on these mutants, a classical breeding approach was used, including crossing mutants with recurrent varieties/lines and subsequent selection in a hybrid population of plants whose grain does not accumulate proanthocyanidins, checking the stability of inheritance of mutant alleles in descendants. The main difficulty in selecting plants whose grain does not contain proanthocyandins is that the shell of the grain, or dough, where these compounds accumulate, is of maternal origin, and therefore the presence of proanthocyandins can only be assessed after harvest. Grain testing for the presence of proanthocyandins is carried out using qualitative tests with p-dimethylaminocinnamaldehyde (4-dimethylaminocinnamaldehyde, DMACA), a solution of vanillin in hydrochloric acid, or alkali (9, 10, 11).

The use of DNA markers developed for target genes, the alleles of which determine the differences between parental forms according to phenotypic characteristics, makes it possible to select the desired genotypes in hybrid populations already at the seedling stage, without waiting for plant grains to ripen, which can significantly reduce time, reduce labor costs and increase selection accuracy. Identification of target genes and development of intragenic markers based on their nucleotide sequences is an urgent task in plant breeding.

The only locus for which mutants have been successfully used in the breeding of proanthocyanidin-free varieties and for which nucleotide sequences have been determined is Ant28, mapped to the long arm of barley chromosome 3H (12). The Hvmyb10 gene, encoding a regulatory factor with an R2R3-MYB domain, was identified as a candidate gene for Ant28.

In fig. Figure 1 shows the structural organization of the Hvmyb10 gene and the localization of single nucleotide substitutions identified in mutant alleles of this gene. Thus, in mutants ant28.484, -493, -494, -495, guanine “G” at position 51 in exon 1, counting from the translation initiation point, was replaced by adenine “A” (G/A substitution), which is at the level protein product resulted in the replacement of the amino acid tryptophan (W) with a premature stop codon, disrupting the protein structure. Another G/A substitution at position 558, identified in mutants ant28.2131 and ant28.2132, led to disruption of splicing and the formation of a deletion of five amino acid residues in the encoded protein in the mutants.

The prototype closest to the claimed marker is the dCAPS (derived Cleaved Amplified Polymorphic Sequences) marker, designed to identify mutant alleles of the Hvmyb10 gene in mutants ant28.484, -493, -494, -495 (12). The marker consists of a set of oligonucleotide primers: forward dCAPS ant28M F2: 5'-TCCAAGGAGGGCCTGAACAGAGGAGCGTT-3' and reverse ant28 R1: 5'-ATGTCGGGGTATGAGCAAAG-3'; and restriction endonuclease MseI, which recognizes the “T↓TAA” site introduced by a forward primer using PCR into the mutant allele of the gene.

When amplifying the DNA of mutants ant28.484, -493, -494, -495 and parental varieties using the described primers, a PNR product 160 nucleotide pairs (bp) long is formed, which is then cleaved in mutant samples using restriction endonuclease into two fragment 132 and 28 bp long. and remains unsplit in the parent varieties.

The disadvantage of the known dCAPS marker is its limited functionality due to the fact that this marker can only be used for the analysis of barley hybrids obtained by crossing barley varieties/lines that accumulate proanthocyanidins in the grain and one of the proanthocyanidin-free mutants ant28.484, - 493, -494, -495, having G/A substitution in position 51.

The objective of the present invention is to develop a CAPS marker that makes it possible to quickly and effectively select barley hybrids that do not accumulate proanthocyanidins in the grain, and that carry homozygous recessive alleles of the Hvmyb10 gene, inherited from mutants ant28.2131 or ant28.2132, carrying a G/A substitution in positions 558.

This task is achieved by developing a CAPS marker consisting of two oligonucleotide primers and the ApaLI restriction endonuclease, which cleaves the PCR product of the dominant allele of the Hvmyb10 gene, which controls the synthesis of proanthocyanidins, obtained using these primers, into two fragments, and does not cleave the recessive allele of the Hvmyb10 gene , present in samples that do not accumulate proanthocyanidins in grain, in a homozygous state.

Technical result: expanding the functionality of the prototype, reducing labor costs, increasing the accuracy and speed of selection of barley hybrids that do not contain proanthocyanidins in the grain.

To accomplish this task, specific oligonucleotide primers were selected. For this purpose, sequencing of the Hvmyb10 gene was carried out, which confirmed the presence of nucleotide “G” at position 558 in the “Alexis” variety and “A” in the ant28.2131 mutant. Next, the obtained sequences of the Hvmyb10 gene alleles, 59 nucleotides long, containing the G/A substitution, were analyzed using the dCAPS Finder 2.0 program (http://helix.wustl.edu/dcaps/) for the presence of polymorphic restriction sites between the compared samples. In the nucleotide sequence of the Hvmyb10 gene of the “Alexis” variety, a restriction site for the endonuclease ApaLI (G↓TGCAC) was identified, which was absent in the ant28.2131 mutant, as shown in Fig. 1. Using the PrimerQuest program (https://www.idtdna.com/pages/tools/primerquest), forward Ant28_F: 5'-TTGTGTGCAGGGCTGAATAG-3' and reverse Ant28_R: 5'-GAAACTCCAACGGAAGGGTTAG-3' primers were selected into the product amplifications of which are 414 bp long. the localization region of the identified restriction site of the ApaLI endonuclease falls, along which the resulting PCR product is split into two fragments of 141 and 273 bp in length. The nucleotide sequence of the developed primers is presented in the sequence list.

In fig. Figure 2 presents the results of electrophoretic analysis of PNR products obtained using a developed pair of primers on the DNA of the mutant ant28.2131, its parent variety “Alexis” and domestic barley varieties “Aley” and “Vorsinsky 2” (Vors.2).

As can be seen in FIG. 2, before treatment with the restriction endonuclease ApaLI, the length of the PCR products of all samples was 414 bp, while after treatment the resulting PCR products of the varieties “Alexis”, “Aley” and “Vorsinsky 2”, which accumulate proanthocyanidins in grain, were split into two fragments of length 141 and 273 bp, while the PCR product of the mutant allele ant28.2131 remained unchanged.

The selection of proanthocyanidin-free barley hybrids using the proposed CAPS marker is carried out as follows. By crossing barley varieties/lines characterized by the presence of proanthocyanidins in the grain with the donor of the recessive allele of the Hvmyb10 gene - mutant ant28.2131 or ant28.2132, and subsequent propagation of the collected grains, second-generation F ₂ hybrid barley plants are obtained. DNA is then isolated from young leaves of parental forms and second generation F ₂ hybrids. To do this, 2-3 pieces of leaf (approximately 0.5x2 cm) are placed in a 1.5 ml Eppendorf tube. Add 200 µl of fresh extraction buffer (100 mM Tris-HCl, pH 7.5-8.0, 500 mM NaCl, 50 mM EDTA, 1.25% SDS, 0.38% Na ₂ S ₂ O ₅ ), heated up to 60°C. The leaves are thoroughly crushed using a homogenizer. Next, add 500 μl of extraction buffer, mix and incubate in a water bath at 60°C for 30-40 minutes. Then add 700 μl of a mixture of chloroform-isoamyl alcohol (24:1) and after stirring, centrifuge for 25 minutes at 10,000-12,000 rpm at room temperature. 1.4 ml of 96% cold ethanol is added to the selected upper fraction (~500 μl), lightly mixed and centrifuged at 10,000-12,000 rpm. The sediment is washed with 70% ethanol at least 3 times, dried and dissolved in 20-25 μl of bidistilled sterile water. The quality and quantity of extracted DNA is assessed by analytical electrophoresis. The DNA concentration in samples is standardized by dilution in sterile double-distilled water to 100 μg/μl.

Diluted DNA in a volume of 5 μl is used as a template in PNR, which is carried out in a reaction mixture with a volume of 20 μl using a BioMaster LR HS-PCR kit (2x) containing 100 mM Tris-HCl, 100 mM KCl, 0.8 mM each deoxynucleoside triphosphate, 4 mM MgSO ₄ , 0.1 units. act./μl of a mixture of enzymes: highly processive recombinant HS-Taq DNA polymerase and Pfu DNA polymerase with corrective activity, 0.2% Tween 20, DNA polymerase stabilizers (Biolabmix, Novosibirsk), with the addition of 1 μM of selected forward and reverse primers. Amplification is carried out under the following conditions: 4 min at 94°C; 10 cycles: 15 sec at 94°C, 30 sec at 55°C, 2 min at 68°C; 20 cycles: 20 sec at 94°C, 30 sec at 55°C, 2 (+10 sec/cycle) min at 68°C; 5 min at 68°C. Add 2 units to 10 µl of the resulting PCR mixture. Act. restriction endonuclease ApaLI and 2 μl of NE buffer compatible with it, the resulting mixture was kept in a thermal cycler at 37°C for 12 hours, after which it was analyzed by electrophoresis in a 2% agarose gel.

The presence of split fragments indicates the presence of nucleotide “G” at position 558, characteristic of dominant alleles of the Hvmyb10 gene, detected in barley samples accumulating proanthocyanidins in grain, while the preservation of the original PCR product indicates the presence of nucleotide “A” in this position, characteristic for the recessive allele of the Hvmyb10 gene, present in mutants ant28.2131 and ant28.2132, which do not accumulate proanthocyanidins in grain. The presence of simultaneously cleaved and uncleaved fragments after treatment of the PCR mixture with restriction endonuclease indicates the presence of alleles in a heterozygous state.

The invention is illustrated by the following examples.

Example 1

The developed CAPS marker was used to select barley hybrids that do not accumulate proanthocyanidins in the grain, obtained after crossing the “Alei” variety, characterized by the presence of proanthocyanidins in the grain, with the ant28.2131 mutant, the grain of which does not contain these compounds. The “Alei” variety was obtained from the GenAgro collection (https://ckp.icgen.ru/plants/, Federal Research Center Institute of Cytology and Genetics SB RAS, Novosibirsk), and the ant28.2131 mutant (cat. number NGB13712) was obtained from the Nordgen collection (https:/ /www.nordgen.org/en/, Alnarp, Sweden). The hybrid seeds of the second generation F ₂ obtained after crossing, as well as the seeds of the parental forms, were planted in the bathtub of the hydroponic greenhouse of the collective use center of plant reproduction of the Institute of Cytology and Genetics SB RAS (Novosibirsk, Russia). DNA was isolated from young leaves and then genotyped using the developed CAPS marker. The results of electrophoretic analysis of PCR products obtained on the DNA of 36 second-generation hybrids F ₂ and varieties “Aley”, “Alexis”, mutant ant28.2131 after treatment with ApaLI restriction endonuclease in a 2% agarose gel are presented in Fig. 3. As can be seen in FIG. 3, the length of the PCR product of the mutant after treatment with restriction endonuclease remained 414 bp, which indicates the presence of nucleotide “A” at position 558 of the Hvmyb10 gene, characteristic of a recessive allele, while the PCR product of the varieties “Aley” and “Alexis” (marked as A1 in Fig. 3) split into two fragments of 141 and 273 bp in length, which indicates the presence of nucleotide “G” at position 558 of the Hvmyb10 gene, characteristic of the dominant allele of the Hvmyb10 gene. Among the hybrids, nine samples were identified that were homozygous for the dominant allele of the Hvmyb10 gene (1, 6, 7, 9, 10, 18, 22, 23, 28), seven samples were homozygous for the recessive allele of the Hvmyb10 gene (4, 5, 24, 25 , 30, 33, 36), and twenty heterozygous samples (2, 3, 8, 11–17, 19–21, 26, 27, 29, 31, 32, 34, 35). Grain collected from the parent samples and the analyzed hybrids was tested using a qualitative reaction for proanthocyanidins. To do this, five grains per plant were soaked for 8 hours in a solution of 1N NaOH with 0.01% Tween20. As a result, grain containing proanthocyanidins turned brown, while grain without proanthocyanidins remained yellow. The grains of all hybrids carrying dominant alleles of the Hvmyb10 gene in a homozygous or heterozygous state acquired a brown color after treatment with sodium hydroxide. Such samples are marked in Fig. 3 as “PA+” (contain proanthocyanidins). Samples with the recessive allele of the Hvmyb10 gene in the homozygous state after soaking in sodium hydroxide had a yellow color, which indicates the absence of proanthocyanidins in the grain of these samples, which are marked in Fig. 3 as “PA-” (does not contain proanthocyanidins). Among the analyzed plants, seven plants were selected under numbers 4, 5, 24, 25, 30, 33, 36, characterized by the presence of a recessive allele of the Hvmyb10 gene in a homozygous state, the absence of proanthocyanidins in the grain of which was confirmed by alkali testing. These samples were selected for further selection of barley varieties that do not accumulate proanthocyanidins in the grain.

Example 2

The selection of barley hybrids, the grain of which does not accumulate proanthocyanidins, using the developed CAPS marker, was carried out similarly to example 1, except that the “Vorsinsky 2” variety was used as the parent variety. Results of electrophoretic analysis of PCR products obtained on the DNA of 36 hybrids of the second generation F2 and varieties “Vorsinsky 2” (in Fig. 4 marked as Vors.2), “Alexis”, mutant ant28.2131 after treatment with ApaLI restriction endonuclease in 2% agarose gel , are presented in Fig. 4.

In hybrids numbered 2, 6, 9, 14, 17, 19, 24, 28, 30, 31, 32, a recessive allele of the Hvmyb10 gene, inherited from the ant28.2131 mutant, was detected in a homozygous state. Testing the grains collected from these hybrids for the presence of proanthocyanidins in a 1N NaOH solution with 0.01% Tween20 confirmed the absence of these compounds. These hybrids were selected for further selection of barley varieties that do not accumulate proanthocyanidins in the grain.

Thus, the developed CAPS marker can be used to select barley hybrids that do not accumulate proanthocyanidins in the grain, obtained by crossing proanthocyanidin-containing barley varieties/lines with the donor of the mutant allele of the Hvmyb10 gene (mutant ant28.2131), the grain of which does not accumulate proanthocyanidins .

The use of the proposed CAPS marker will expand the functionality of the prototype, reduce labor costs, and increase the accuracy and speed of selection of barley hybrids that do not contain proanthocyanidins in the grain.

Information sources

1. Shoeva O.Yu. World experience in creating brewing barley varieties based on proanthocyanidin-free mutants // Letters to the Vavilov Journal of Genetics and Breeding. 2021. T. 7. No. 1. R. 23-33.

2. von Wettstein D. From analysis of mutants to genetic engineering // Annu. Rev. Plant Biol. 2007. V. 58. P. 1-19.

3. Lundqvist U. Scandinavian mutation research in barley - a historical review // Hereditas. 2014. V. 151. P. 123-131.

4. von Wettstein D., Jende-Strid V., Ahrenst-Larsen V., Sorensen J.A. Biochemical mutant in barley renders chemical stabilization of beer superfluous // Carlsberg Res. Commun. 1977. V. 42. P. 341-351.

5. van Harten A.M. Mutation breeding: theory and practical applications. Cambridge: Cambridge University Press, 1998.

6. Fukuda K., Saito W., Arai S., Aida Y. Production of a novel proanthocyanidin-free barley line with high quality // J. Inst. Brew. 1999. V. 105. No. 3.P. 179-183.

7. von Wettstein D. Breeding of value added barley by mutation and protein engineering. Induced mutations and molecular techniques for crop improvement. Proceedings of a symposium. Vienna. 1995;67-76.

8. von Wettstein D., Cochran J.S., Ullrich S.E., Kannangara C.G., Jitkov V.A., Burns J.W., Reisenauer P.E., Chen X., Jones B.L. Registration of 'Radiant' barley. Crop Science. 2004;44:1859-1860.

9. Kohyama N., Chono M., Nakagawa H., Matsuo Y., Ono H., Matsunaka H. Flavonoid compounds related to seed coat color of wheat // Biosci. Biotechnol. Biochem. 2017. V. 81, No. 11. P. 2112-2118.

10. Aastrup S., Outtrup H., Erdal K. Location of the proanthocyanidins in the barley grain // Carlsberg Res. Commun. 1984. V. 49. P. 105-109.

11. Himi E., Taketa S. Barley Ant17, encoding flavanone 3-hydroxylase (F3H), is a promising target locus for achieving anthocyanin/proanthocyanidin-free plants without pleiotropic reduction of grain dormancy // Genome. 2015. V. 58. P. 43-53.

12. Himi E., Yamashita Y., Haruyama N., Yanagisawa T., Maekawa M., Taketa S. Ant28 gene for proanthocyanidin synthesis encoding the R2R3 MYB domain protein (Hvmyb10) highly affects grain dormancy in barley // Euphytica. 2012. V. 188. P. 141-151.

--->

List of sequences

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.3//EN" "ST26SequenceListing_V1_3.dtd">

<ST26SequenceListing dtdVersion="V1_3" fileName="CAPS_Ant28.xml"

softwareName="WIPO Sequence" softwareVersion="2.0.0"

productionDate="2022-08-15">

<ApplicantFileReference>1</ApplicantFileReference>

<ApplicantName languageCode="ru">Federal state

budgetary scientific institution Federal Research Center

"Institute of Cytology and Genetics of the Siberian Branch of the Russian

Academy of Sciences" (ICIG SB RAS)</ApplicantName>

<ApplicantNameLatin>Institute of Cytology and Genetics, Siberian

Branch of Russian Academy of Sciences</ApplicantNameLatin>

<InventionTitle languageCode="ru">CAPS marker for selecting hybrids

barley that does not accumulate proanthocyanidins in grain</InventionTitle>

<SequenceTotalQuantity>2</SequenceTotalQuantity>

SEQID NO 1

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q2">

<INSDQualifier_name>Hordeum vulgare</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ttgtgtgcagggctgaatag</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

SEQID NO 2

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>22</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..22</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q1">

<INSDQualifier_name>Hordeum vulgare</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gaaactccaacggaagggttag</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<---

Claims (1)

CAPS marker for selecting barley hybrids that do not accumulate proanthocyanidins in grain, consisting of oligonucleotide primers having nucleotide sequences SEQ ID NO 1: 5'-TTGTGTGCAGGGCTGAATAG-3' and SEQ ID NO 2: 5'-GAAACTCCAACGGAAGGGTTAG-3', and endonuclease ApaLI restriction, which cleaves the PCR product of the dominant allele of the Hvmyb10 gene, 414 nucleotide pairs (bp) in length, obtained using these primers, which controls the synthesis of proanthocyanidins, into two fragments 141 and 273 bp in length, and does not cleave the recessive allele of the Hvmyb10 gene , present in samples that do not accumulate proanthocyanidins in grain, in a homozygous state.