RU2803637C1 - METHOD FOR PREDICTING THE RISK OF DEVELOPING TYPE 2 DIABETES IN RESIDENTS OF CENTRAL RUSSIA BASED ON GENOTYPING OF THE rs755892 POLYMORPHISM OF THE DNAJB1 GENE - Google Patents

Abstract

FIELD: medicine, medical diagnostics.

SUBSTANCE: invention can be used to predict the risk of developing type 2 diabetes in residents of Central Russia. A sample of peripheral venous blood is taken and DNA is extracted. Analysis of a polymorphic variant of the gene from the family of heat shock proteins hsp40 DNAJB1 rs755892 (G>A) is carried out. If the rs755892-A allele is detected, an increased risk of developing type 2 diabetes is predicted. If the rs755892-G/G genotype is detected, a low risk of developing type 2 diabetes is predicted.

EFFECT: method enables obtaining new criteria for assessing the risk of developing type 2 diabetes in residents of Central Russia according to the genetic polymorphism rs755892 (G>A).

1 cl, 1 tbl, 3 ex

Description

The invention relates to the field of medical diagnostics and can be used to predict the risk of developing type 2 diabetes mellitus in residents of Central Russia.

Type 2 diabetes mellitus is the most common endocrinological disease, while Russia is in second place among all European countries in terms of the number of people with diabetes, 90% of whom are patients with type 2 diabetes (T2DM) [IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045 / H. Sun, P. Saeedi, S. Karuranga [et al.] // Diabetes research and clinical practice. - 2022. - Vol. 183. - R. 109119]. One of the key disorders identified in type 2 diabetes mellitus is endoplasmic reticulum (ER) stress and activation of the cellular response to unfolded proteins, which are caused by the accumulation of misfolded proteins and changes in cell protein homeostasis [Pathological β-cell endoplasmic reticulum stress in type 2 diabetes: current evidence / N. Shrestha, E. De Franco, P. Arvan [et al.] // Frontiers in endocrinology. - 2021. - Vol. 12. - R. 650158]. Chronic ER stress leads to progressive dysfunction, reduction and apoptosis of the functioning mass of pancreatic beta cells, which underlies the progression of T2DM during its natural course [Progressive endoplasmic reticulum stress over time due to human insulin gene mutation contributes to pancreatic beta cell dysfunction / NS Amirruddin, WX Tan, YS Tan [et al.] // Diabetologia. - 2021. - Vol. 64,Iss. 11. - P. 2534-2549]. Defects in the synthesis of any insulin precursors (preproinsulin, proinsulin) and insulin itself, as well as disruption of the secretion mechanism can lead to disruption of the folding of this protein hormone - the main cause of β-cell dysfunction [Pathophysiology of type 2 diabetes mellitus / U. Galicia-Garcia, A Benito-Vicente, S. Jebari [et al.] // International journal of molecular sciences. - 2020. - Vol. 21. Iss. 17. - R. 6275]. The protein folding process involves searching for a unique native structure that meets the principle of minimum energy. Once the protein enters the lumen of the ER, it begins the packaging process with the help of unique proteins called chaperones. One of the main regulatory chaperones is the Hsp40 family, the main representative of which is member 1 of the heat shock protein family DNAJB1. The DNAJB1-chaperone complex is required for the identification and delivery of the polypeptide sequence of proteins to the Hsp70 family chaperones to ensure proper folding, refolding or degradation [An Ankyrin-B-Mediated Protein Chaperone Mechanism Modulates Pancreatic β-Cell Susceptibility to Proteotoxicity-Induced ER Stress and Apoptosis / J Tzeng, H. Hohmeier, D. Lorenzo // Diabetes. - 2022. - Vol. 71.]. Regarding the polymorphic variant rs755892 of DNAJB1, according to the atSNP search bioinformatics tool, it was found that the presence of the risk allele rs755892-A is associated with the acquisition of binding sites for transcription factors such as FOXO1, SPDEF, XBP1 and FOXO3, which are involved in the activation of apoptosis in response to various stimuli, including ER stress, oxidative stress, cytokines and growth factors [atSNP: transcription factor binding affinity testing for regulatory SNP detection / C. Zuo, S. Shin, S. Keleş // Bioinformatics. - 2015. - Vol. 31. Iss. 20. - R. 3353-3355].

There is a known method for predicting type 2 diabetes using daily fasting glucose level measurements in patients with hypertension (RU 2521202 C1, 06.27.2014). DNA is isolated from peripheral venous blood and the polymorphic variant of the lymphotoxin α gene (+250G/A Ltα) is analyzed. If the +250G Ltα allele is detected, an increased risk of developing diabetes mellitus against the background of hypertension is predicted; if the +250AA Ltα genotype is detected, a low risk of developing type 2 diabetes mellitus is predicted in natives of the Central Black Earth Region with hypertension.

The disadvantage of the method is that it is aimed only at patients with hypertension and cannot be used for people without this pathology.

There is a known method for predicting the risk of T2DM in people with metabolic syndrome (RU 2580632 C1, 10/14/2014), which includes determining the content of aspartate aminotransferase (x1), according to echocardiography, determining the end-systolic volume of the left ventricle (x2) and the end-diastolic volume of the left ventricle (x3) , alanine aminotransferase content (x4), systolic blood pressure (x5), left atrium size (x6), triglyceride content (x7), cortisol (x8), blood sugar two hours after a meal (x9), patient age (x ), the patient’s body mass index (x11), the presence or absence of a family history of type 2 diabetes mellitus (x12), followed by calculation of the stratification risk indicator using the formula: G(x)=0.27×x1+0.28×x2 +5.03×x3+0.25×x4+0.1×x5+1.93×x6-3.13×x7+0.28×x8++1.05×x9+0.17×x10+ 0.06×x11+0.59×x12. If G(x) exceeds 88.1, then the risk of developing diabetes mellitus is assessed as high, otherwise as insignificant.

However, this method is typical only for patients with metabolic syndrome. In addition, a significant disadvantage of this method is the inability to take into account a number of informative indicators: family history, immunobiochemical blood parameters, echocardiography results.

There is a known method for predicting the risk of developing type 2 diabetes in patients of different ages, according to patent RU 2611900 C1 (publication: 03/01/2017), including the collection of clinical and anamnestic data: body mass index, waist circumference, the presence of arterial hypertension, the presence of diabetes mellitus in relatives 1 and 2 degrees of relationship, as well as laboratory parameters: triglycerides > 1.7 mmol/l, high-density cholesterol > 1.0 mmol/l; SBP > 140 and/or DBP > 90 mmHg. Art.; blood glucose level > 5.6 mmol/l. Next, the obtained indicators were assessed quantitatively (in points), summing them up, and if the final value is less than 8 points - a low risk of T2DM, if more than 8 points - a high risk of T2DM.

The disadvantage of the method is that to calculate the degree of disease risk, it is necessary to determine a large number of laboratory parameters, which is a labor-intensive process. In addition, an important indicator is knowledge about the presence/absence of type 2 diabetes in 1st and 2nd degree relatives, which is not always possible. The absence of this information makes the risk scale subjective.

The closest research result is the method for predicting the risk of developing type 2 diabetes mellitus according to patent for invention RU 2655635 (publication date 05/29/2018), including sampling of the patient’s peripheral venous blood, DNA extraction followed by real-time polymerase chain reaction and analysis of gene polymorphism incretin receptor GLP-1R, the results of which predict a reduced risk of developing T2DM in case of detection of the GG genotype of the rs6923761 polymorphism of the GLP-1R gene.

The disadvantage of the method is that it is typical only for people with metabolic syndrome (BMI from 30 to 48.8 kg/ ^m2 ) and the relatively small sample size for the statistical significance of the experiment (87 patients with T2DM and 109 relatively healthy volunteers). In addition, the patent does not indicate the ethnicity of the population.

The technical result consists in obtaining criteria for assessing the risk of developing type 2 diabetes mellitus in residents of Central Russia based on data on the genetic polymorphism rs755892 (G>A).

The technical result is achieved by the fact that after DNA extraction, an analysis of the polymorphic variant of the gene from the family of heat shock proteins DNAJB1 rs755892 (G>A) is carried out and an increased risk of developing type 2 diabetes is predicted if the rs755892-A allele is detected, and if the rs755892-G genotype is detected /G - low risk of developing type 2 diabetes mellitus in the population of Central Russia.

The method is carried out as follows:

1. Isolation of DNA from peripheral venous blood. At the first stage, 0.5 ml of PBS was added to 0.5 ml of blood and centrifuged for 10 min at 12 thousand rpm. The supernatant was discarded, 1 ml of PBS was added and centrifuged again under the same conditions. The supernatant was discarded, 200 μl of TE buffer was added, pipetted until the precipitate dissolved, and then 10 μl of 1% sodium dodecyl sulfate SDS and 5 μl of proteinase K were sequentially added. The tubes were incubated in a thermostat at t=37°C for 12 hours. During the second stage Four successive centrifugations with phenol and chloroform were performed according to the protocol (10 min, 8 thousand rpm), after which the DNA was precipitated with an ice-cold solution of 95% ethyl alcohol and centrifuged for 10 min at 14.3 thousand rpm. After the alcohol had evaporated, the DNA was dissolved in 100 μl of deionized distilled water. The resulting DNA solution in water had a purity in the range A260/280=1.5-2.0 and an average concentration of about 180-200 ng/μl.

Extraction of genomic DNA from whole blood by the column method was carried out using the QIAamp DNA blood mini kit (QIAGEN, Germany) on a QiaCube automatic station (QIAGEN, Germany). The robotic protocol lasting 58 minutes included cell lysis of 0.2 ml of whole blood using lysis buffer and QIAGEN Proteinase K, incubation, transfer of lysate to the column, binding of DNA to the column membrane, centrifugation, washing the column twice with buffer AW1 and AW2, centrifugation of the column and finally eluting the purified DNA. The resulting DNA solution in water had ideal purity A260/280 = 1.7-1.9 and an average concentration of about 40-50 ng/μl. DNA samples extracted from blood were stored in Thermo Fisher Scientific (USA) freezers at -20°C.

2. Preparation of DNA samples for mass spectrometric analysis. The quality of the isolated DNA was assessed by the degree of purity and concentration of the solution using a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). All analyzed DNA samples were diluted with deionized water to a concentration of 10 ng/μl at A260/280=1.5-2.0.

3. Analysis of DNAJB1 gene polymorphism - genotyping using matrix-activated laser desorption-ionization mass spectrometry MALDI-TOF. The following primer sequences were used: forward F: 5'- ACGTTGGATGGTTTTAGGGCTAATGGTGCG -3', reverse R: 5'- ACGTTGGATGGGTGGCAGTGAATGCTAATG -3', extension primer E: 5'- CTAATGGTGCGTAGGAA -3'. To prepare the PCR mix (per spectral chip), 80.6 µl ddH2O, 50.4 µl 10x buffer, 40.3 µl MgCl2 (concentration 25 mmol/l), 10.1 µl dNTP mixture ( concentration 25 mmol/l), 100.8 μl of PCR primer mixture (concentration 0.5 μmol/l) and 20.16 μl HotStartTaq polymerase (concentration 5 U/μl). The mixture was vortexed and pipetted into a 96-well PCR plate (3 μl per well), after which 2 μl of DNA (concentration 10 ng/μl) was added using an eight-channel dispenser. The plate was sealed, centrifuged for 20 sec at 1000 rpm and loaded into a CFX96 Bio-Rad thermal cycler for 125 min under the following regime: denaturation 2 min at 95°C, amplification 44 cycles, consisting of denaturation 30 sec at 95°C, annealing 30 sec at 56°C and elongation 60 sec at 72°C. Then the samples were incubated for 5 min at 72°C. The dNTPs that did not react during PCR were removed using the SAP (shrimp alkaline phosphatase) reaction, during which shrimp alkaline phosphatase hydrolyzed the dNTPs to nucleosides and phosphates. To prepare the SAP mix, 161.6 μl of ddH2O, 18 μl of 10xTS buffer and 31.7 μl of SAP enzyme were mixed in a microtube. Next, 2 μl of the SAP mixture was added to each well, the plate was sealed, centrifuged for 20 sec at 1000 rpm and loaded into a CFX96 Bio-Rad thermal cycler for 55 min in the following mode: 45 min at 37°C and 10 min at 85°C WITH. To carry out the third iPLEX reaction, an E-primer mix was prepared at the rate of 8.8 μl of primers E1-E9, 11.7 μl of primers E10-E18, 14.6 μl of primers E19-E27, 17.5 μl of primers E28-E35 and 45 .1 µl ddH2O. After mass spectrometric assessment of the intensity of the E-primer peaks in the resulting mixture, E-primers were added to the mix in the quantities necessary to achieve the same signal intensity. To prepare the iPLEX mix, 65.4 μl of ddH2O, 21.2 μl of iPLEX buffer, 21.2 μl of termination mixture, 99.3 μl of E-primer mix and 4.33 μl of iPLEX enzyme were mixed in a microtube, vortexed and dispensed into wells 2 µl. The plate was sealed, centrifuged for 20 seconds at 1000 rpm and loaded into a CFX96 Bio-Rad thermal cycler for 135 minutes under the following conditions: denaturation for 30 seconds at 94°C, then 40 cycles consisting of denaturation for 5 seconds at 94°C, annealing for 5 sec at 52°C, elongation for 5 sec at 80°C, followed by incubation for 3 min at 72°C. Upon completion of the iPLEX reaction, the plate was cooled to +4°C, 30 μl of water was added to all wells, centrifuged for 1 min at 1000 rpm and loaded into the mass spectrometer. Because small polar molecules and positively charged sodium and potassium cations can form adducts with oligonucleotides and create a series of contaminant peaks, the amplicons were robotically desalted by treating them with SpectroCLEAN resin (Agena Bioscience). The transfer of samples to a spectral chip with a matrix for ionization was carried out automatically on a Nanodispenser workstation. Statistical calculations were performed using the SNPStats program (Solé, X., Guinó, E., Valls, J., Iniesta, R., & Moreno, V. (2006). SNPStats: a web tool for the analysis of association studies. Bioinformatics , 22(15), 1928-1929).

4. Prediction of an increased risk of developing type 2 diabetes mellitus if the rs755892-A allele is identified and a reduced risk of developing type 2 diabetes mellitus if the rs755892-G/G genotype is identified.

The possibility of using the proposed method to determine the risk of developing type 2 diabetes mellitus is confirmed by an analysis of the results of observations of 1457 patients with type 2 diabetes mellitus, of which 251 were diagnosed with newly diagnosed type 2 diabetes mellitus. The study included persons of Slavic nationality in Central Russia. The diagnosis of T2DM was established by endocrinologists of the Regional Clinical Hospital of the Emergency Hospital on the basis of clinical and laboratory-instrumental examination. It was found that carriage of the rs755892-G/A and rs755892-A/A DNAJB1 genotypes was associated with an increased risk of developing type 2 diabetes mellitus in residents of central Russia, regardless of gender, age and BMI: OR=1.79, 95% CI 1.40 -2.30, P<0.0001 (Table 1).

Table 1
Association of the rs755892 polymorphic variant of the DNAJB1 gene with an increased risk of developing type 2 diabetes mellitus in residents of Central Russia Gene
(SNP ID) Genotype, allele Patients with T2DM
(n=1428) Control
(n=1456) P ¹ OR (95% CI) ² DNAJB1
G>A rs755892 G/G 589 (41.2%) 492 (33.8%) <0.0001 1.00 G/A 656 (45.9%) 694 (47.7%) 1.40 (1.17-1.68) A/A 183 (12.8%) 270 (18.5%) 1.79 (1.40-2.30) A 3.6% 4.2% <0.0001 0.76 (0.68-0.84) ¹ Level of significance of association adjusted for covariates - gender, age and body mass index;
² Odds ratios and 95% confidence intervals adjusted for covariates sex, age and body mass index.

As examples of a specific application of the developed method, a genetic examination of Russian patients in Central Russia and those who are not related to each other at the rs755892 (G>A) locus of the DNAJB1 gene is given.

Patient P., a 39-year-old man, during a preventive examination at the clinic of the Kursk City Clinical Emergency Hospital on May 17, 2016, was asked to undergo testing for a predisposition to type 2 diabetes mellitus due to existing risk factors - obesity III degree, burdened by heredity of diabetes (father suffers from type 2 diabetes), sedentary lifestyle, high-calorie diet. Venous blood was taken from the man; genotyping of the polymorphic variant rs755892 (G>A) revealed the DNAJB1 genotype A/A, which allowed the patient to be classified as a group of people at high risk of developing type 2 diabetes. However, preventive measures to reduce body weight and correct lifestyle were not carried out. With complaints of dry mouth, thirst up to 5 liters per day, polyuria with nocturia, severe weakness and dizziness, patient P. was taken by an ambulance team to the endocrinology department on 10/27/2017, where she received inpatient treatment until 11/01/2017. On admission, the blood glucose concentration was 15 mmol/l, glycated hemoglobin 10.4%. Diagnosis: diabetes mellitus, type 2, newly diagnosed, decompensation phase from 10/27/2017, compensation phase from 11/09/2017. Individual target HbA1c level <7.0%, target fasting plasma glycemic level <7.0 mmol/l, 2 hours after meals <9.0 mmol/l.

Volunteer donor P., a 56-year-old woman, contacted the Kursk Regional Clinical Blood Transfusion Station of the Kursk Region Health Committee on September 7, 2017 to donate blood. The patient was asked to participate in a research study to identify a genetic predisposition to type 2 diabetes mellitus. Venous blood was taken from the woman, and genotyping of the polymorphic variant rs755892 (G>A) revealed the G/G DNAJB1 genotype, which allowed the woman to be included in the group of people at low risk of developing type 2 diabetes mellitus. A blood test confirmed the absence of carbohydrate metabolism disorders: fasting blood glucose concentration 3.7 mmol/l, glycated hemoglobin 4.9%, which is normal. Further observation did not reveal a diagnosis of type 2 diabetes mellitus.

Patient B., 46 years old, underwent a medical examination at the clinic of the Kursk City Clinical Hospital of Emergency Medical Care on February 14, 2016. A fasting blood test revealed hyperglycemia of 6.2 mmol/l, and therefore the man was referred for consultation to endocrinologist. Due to the presence of risk factors for type 2 diabetes mellitus: stage III obesity, a sedentary lifestyle, maternal family history (the mother and aunt suffer from T2DM), the patient was recommended to undergo testing to assess the genetic risk of developing the disease. Venous blood was taken from patient B., genotyping the rs755892 (G>A) polymorphism revealed the DNAJB1 genotype A/A, which made it possible to classify the patient into a group of people at high risk of developing type 2 diabetes mellitus. However, preventive measures to reduce body weight and lifestyle adjustments were not carried out by the patient. After 1.5 years, patient B. was hospitalized with complaints of dry mouth, thirst, nocturia, decreased visual acuity and severe general weakness in the endocrinology department of the Regional Clinical Hospital for Emergency Medicine, where he was hospitalized from 09/08/2017 to 09/14/2017. Diagnosis: diabetes mellitus, type 2, newly diagnosed, decompensation phase from 09/08/2017, ketonuria from 09/11/2017, compensation phase from 09/14/2017. Individual target HbA1c <6.5%. The target level of plasma glycemia on an empty stomach is <6.5 mmol/l, 2 hours after a meal <8.0 mmol/l. A biochemical blood test confirmed the presence of type 2 diabetes mellitus: fasting hyperglycemia 14.4 mmol/l and an increased level of glycated hemoglobin 10.3%.

The use of this method will make it possible at the preclinical stage to form risk groups among residents of Central Russia and timely implement in these groups the necessary treatment and preventive measures to prevent the development of type 2 diabetes.

Summary

Thus, the data obtained indicate that the rs755892-A allele of the DNAJB1 gene is a genetic risk factor for the development of type 2 diabetes mellitus (OR=2.30).

The use of the proposed method will make it possible to predict a predisposition to type 2 diabetes mellitus, which will make it possible to implement measures to prevent this disease in a group of high-risk individuals - clinical observation, regular monitoring of blood glucose levels, normalization of body weight, sufficient physical activity, proper nutrition with daily inclusion in the diet of fresh vegetables and fruits and limiting refined carbohydrates and fats.

Claims (1)

A method for predicting the risk of developing type 2 diabetes mellitus in residents of Central Russia, including taking a sample of peripheral venous blood, characterized in that after DNA extraction, an analysis of a polymorphic variant of the gene from the family of heat shock proteins hsp40 DNAJB1 rs755892 (G>A) is carried out and an increased risk of development is predicted type 2 diabetes mellitus if the rs755892-A allele is detected, and if the rs755892-G/G genotype is detected, there is a low risk of developing type 2 diabetes mellitus.