RU2800071C1 - Sorafenib-based combination therapy for hepatocellular carcinoma - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: group of inventions including a lipid nanoparticle for the treatment of liver tumor diseases in a patient, a pharmaceutical composition for the treatment of a liver tumor disease in a patient, and the use of a pharmaceutical composition for the production of a drug for the treatment of a liver tumor disease in a patient are described.

EFFECT: invention expands the arsenal of agents for the treatment of tumor diseases of the liver in a patient.

7 cl, 3 dwg, 4 tbl, 3 ex

Description

Technical field

The present invention relates to the field of medicine, namely to oncology, and can be used for the treatment of oncological diseases.

State of the art

Diagnosis of hepatocellular carcinoma (HCC) is mainly based on non-invasive criteria, which greatly complicates the early recognition of the disease. Liver resection and transplantation are still the main treatments for HCC (J. Bruix et al. Management of hepatocellular carcinoma. 2005). However, over the past 5 years, significant progress has been made in the development of systemic therapies based on the use of inhibitors of immune response checkpoints (antibodies to PD-1, PD-L1, CTLA-4, for example, Nivolumab, Pembrolizumab), intracellular kinases (serine/threonine kinase c-CRAF, BRAF) and tyrosine kinases (Sorafenib, Sunitinib, Orantinib, Brivanib, Linifanib, Re gorafenib), monoclonal antibodies that are starting to replace traditional HCC treatments (J. Llovet et al. Molecular therapies and precision medicine for hepatocellular carcinoma. 2018). Sorafenib and lenvatinib are the most effective single-component therapeutic drugs (M. Kudo et al. Lenvatinib versus sorafenib in first-line treatment of patients with unresectable hepatocellular carcinoma: a randomized phase 3 non-inferiority trial. 2018).

Sorafenib (BAY 43-9006, Nexavar®; Bayer Healthcare Pharmaceuticals Inc.; Leverkusen, Germany) was the first systemic drug approved by the US Food and Drug Administration (FDA) for the treatment of inoperable liver cancer (https://www.accessdata.fda.gov/drugsatfda_docs/label/2010/021923s008s009 lbl.pdf).

Sorafenib acts as a multikinase inhibitor of cell cycle regulatory proteins and thus blocks the proliferation of tumor cells. However, many patients develop resistance to the drug due to the genetic heterogeneity of HCC. Side effects of sorafenib, such as rash, diarrhea, high blood pressure, and hand-and-foot syndrome, should also be considered, which limits the therapeutic window for the drug. Due to the heterogeneous nature of HCC, it is promising to combine sorafenib with other anticancer agents. Studies are currently underway to study the combination of sorafenib and transarterial chemoembolization (TACE), but the effectiveness of this treatment has not yet been demonstrated (R. Lencioni. Sorafenib or placebo plus TACE with doxorubicin-eluting beads for intermediate stage HCC: The SPACE trial. 2016). Adjuvant treatment with sorafenib in combination with ECOG1208 (NCT01004978), TACE-2 (NCT01324076) and TACTICS (NCT01217034) is at the stage of clinical trials (Y. Zhu et al. New knowledge of the mechanisms of sorafenib resistance in liver cancer. 2017). Both scientific and clinical studies show that the combination of sorafenib with other drugs has a beneficial effect and provides a new approach to treatment.

However, existing therapeutic agents and approaches to the treatment of HCC have a number of disadvantages, including resistance, a limited therapeutic window, side effects, and a low median patient survival, which determines the need to develop new combination drugs and therapies.

One of the new therapeutic approaches to the treatment of various diseases is therapy based on RNA interference, a process of selective suppression of gene expression due to mRNA degradation, mediated by small interfering RNAs (siRNAs, siRNAs). The first siRNA-based drug, Patisiran (A. Mullard. FDA approves landmark RNAi drug. 2018), was approved for clinical use in 2018. And in 2019, another siRNA-based drug, Givosiran (Givlaari, Alnylam Pharmaceuticals), received Food and Drug Administration (FDA) approval for the treatment of acute liver porphyria (Givlaari. https://www.givlaari.com. 2020), and many others are in development. Traditional approaches to therapy using small molecule drugs are based on their interaction with the active sites of proteins in such a way as to suppress or change their function. However, only 1.5% of the human genome encodes proteins (I. Ezkurdia et al. Multiple evidence strands suggest that there may be as few as 19,000 human protein-coding genes. 2014) and only 10-14% of proteins have active binding sites that are potential selective targets for small molecules (A. Hopkins, C. Groom. The druggable genome. 2002). The use of recombinant proteins as medicinal agents has solved some of the problems and expanded approaches to therapy. However, recombinant proteins have their limitations related to their size and stability and the need for post-translational modifications that complicate the synthesis process (Z. Antosova et al. Therapeutic application of peptides and proteins: parenteral forever? 2009). At the same time, nucleic acid-based approaches do not fall under many of these restrictions because they regulate target expression prior to the translation step. RNA interference is a promising approach for the treatment of cancer, for example, by turning off genes that are overexpressed in cancer cells or genes involved in cell division. In addition, today an important area of research in the field of RNA interference for clinical use is the development of methods for the safe and effective delivery of small RNAs (Haussecker D. Current issues of RNAi therapeutics delivery and development // Journal of Controlled Release. 2014. V.195, pp. 49-54; Mansoori B. et al. RNA Interference and its role in cancer therapy // Adv. Pharm. Bull. 2014. V4(4), pp .313-321).

All currently known siRNA delivery systems can be divided into two types: viral and non-viral vectors. The use of viral systems has a number of limitations, such as high cost and immune response (R. Tomar et al. Use of adeno-associated viral vector for delivery of small interfering RNA. 2003). Lipid nanoparticles (LNPs) are non-viral siRNA delivery systems and have a number of advantages: low toxicity, high efficiency of internalization, low cost, easy synthesis scaling (Y. Xin et al. Nano-based delivery of RNAi in cancer therapy. 2017). Encapsulation of therapeutic siRNA into lipid nanoparticles for targeted delivery was used in the drug Patisiran for the treatment of transthyretin-mediated hereditary amyloid polyneuropathy, approved by the Food and Drug Administration (FDA) in 2018 (J. Kulkarni et al. Lipid nanoparticle technology for clinical translation of siRNA therapeutics. 2019; D. Adams et al Patisiran, an RNAi therapeutic, for hereditary transthyretin amyloidosis, 2018).

One of the promising targets for cancer therapy is gankirin (PSMD10). The protein was originally identified as a component of the 26S proteasome (S. Dawson et al. Gankyrin is an ankyrin-repeat oncoprotein that interacts with CDK4 kinase and the S6 ATPase of the 26 S proteasome. 2002). Gankirin is involved in various biological processes, including cell growth, proliferation, invasion, and liver regeneration (Y. Shan et al. The role of p28GANK in rat oval cells activation and proliferation. 2006). Through interaction with the retinoblastoma protein (Rb) and cyclin-dependent kinase 4 (CDK4), gankyrin promotes phosphorylation and inactivation of Rb, which in turn leads to the activation of the transcription factor E2F and movement through the cell cycle (S. Dawson et al. Gankyrin: a new oncoprotein and regulator of pRb and p53. 2006; R. Mayer et al. G ankyrin, the 26 S proteasome, the cell cycle and cancer, 2006). Gankyrin also promotes ubiquitinylation and degradation of p53 by binding to the PRC2-Mdm2 complex protein (H. Higashitsuji et al. The oncoprotein gankyrin binds to MDM2/HDM2, enhancing ubiquitylation and degradation of p53.2005). Gankyrin plays an essential role in Ras-induced tumorigenesis through regulation of the RhoA/ROCK pathway in mammalian cells. 2010. Gankyrin has recently been shown to be involved in the regulation of PI3K/AKT, IL-6/STAT3, IL-1β/IRAK-1, and β-catenin signaling pathways (J. Zhang et al. Gankyrin plays an essential role in estrogen-driven and GPR30-mediated endometrial carcinoma cell proliferation via the PTEN/PI3K/AKT signaling pathway. 2013; T. Zheng 2014; L. Dong et al. The oncoprotein p28GANK establishes a positive feedback loop in beta-catenin signaling. 2011; B. Su et al. Interleukin-1β/Iinterleukin-1 receptor-associated kinase 1 inflammatory signaling contribute s to persistent Gankyrin activation during hepatocarcinogenesis, 2015). Gankyrin is involved in the regulation of NF-κB/RelA at the transcriptional level by binding to RelA and modulating the efficiency of its acylation (H. Higashitsuji et al. The oncoprotein gankyrin interacts with RelA and suppresses NF-kappaB activity. 2007).

Numerous data confirm the oncogenic functions of gankirin in the development of HCC and other types of cancer: glioma, liposarcoma, and cancer of the lung, esophagus, stomach, colon, pancreas, cervix, ovaries, endometrium, and breast (J. Fu et al. p28GANK overexpression accelerates hepatocellular carcinoma invasiveness and metastasis via phosphoinositol 3-kin ase/AKT/hypoxia-inducible factor-1α pathways 2011 Y Yang et al Up-regulated oncoprotein P28GANK correlates with proliferation and poor prognosis of human glioma 2012 W Wang et al Clinicopathologic features and prognostic implications of Gankyrin protein expression in non-small cell lung cancer 2015 Y Liu et al Association between functional PSMD10 Rs111638916 variant regulated by MiR-505 and gastric cancer risk in a Chinese population. 2015; S. Tang et al. Overexpression of a novel gene gankyrin correlates with the malignant phenotype of colorectal cancer. 2010; Y. Meng et al. Gankyrin promotes the proliferation of human pancreatic cancer. 2010).

It should be noted that the expression of gankirin is practically absent in normal hepatocytes, is weakly expressed in cirrhosis and paracarcinoma of the liver, and is most clearly expressed in the liver in HCC. It has also been shown that gankyrin can promote the progression and metastasis of HCC, which makes this protein a tumor marker and a promising target for therapy (Y. Fu et al. Overexpression of p28/gankyrin in human hepatocellular carcinoma and its clinical significance. 2002). Recently, it was shown that gankyrin promotes autophagy activation in cells in response to HCC chemotherapy (T. Luo et al. PSMD10/gankyrin induces autophagy to promote tumor progression through cytoplasmic interaction with ATG7 and nuclear transactivation of ATG7 expression. 2016).

To regulate the level of gankyrin, a low-molecular histone deacetylase inhibitor, panobinostat, is used (X. Song et al. LBH589 inhibits proliferation and metastasis of hepatocellular carcinoma via inhibition of gankyrin/STAT3/Akt pathway. 2013). It has also been shown that arctigenin (a component of burdock) reduces the level of gankyrin in hepatocytes, which leads to the arrest of cell growth (Y. Sun et al. Arctigenin inhibits liver cancer tumorigenesis by inhibiting Gankyrin expression via C/EBPα and PPARα. 2018).

Animal studies have shown that a decrease in the level of gankirin in non-parenchymal cells suppresses the activity of the transcription factor Stat3, the synthesis of interleukin IL-6 and cancer stem cell markers (Bmi1, EpCAM), thereby reducing metastasis. Moreover, the study showed that the amount of gankyrin in the tumor is inversely proportional to the median survival of patients with HCC treated with sorafenib (T. Sakurai et al. Gankyrin induces STAT3 activation in tumor microenvironment and sorafenib resistance in hepatocellular carcinoma. 2017).

Despite numerous studies in search of various approaches to the treatment of liver tumors, the development of an effective drug for the treatment of patients with such diseases, which can increase the median survival of patients, is still very relevant.

Disclosure of invention

The objective of the invention is the development of hepatotropic lipid nanoparticles and a new drug based on these nanoparticles, effective for the treatment of tumor diseases of the liver, as well as the development of a method for the treatment of these diseases using such a drug.

The proposed approach is fundamentally different from the already existing agents and methods for the treatment of liver tumors, since it is a combination of two approaches - classical chemotherapy with sorafenib with a fundamentally new type of therapy using RNA interference, which suppresses the expression of gankirin, which regulates the proliferation of tumor cells.

This problem is solved by developing a new drug that includes miRNAs that inhibit the expression of gankirin and sorafenib encapsulated together in lipid nanoparticles. Moreover, the structure of miRNAs, their modification, as well as the structure of nanoparticles are designed in such a way as to ensure maximum efficiency and bioavailability of the proposed drug.

More specifically, the solution to this problem is achieved by developing lipid nanoparticles (LNP) for the treatment of liver tumor diseases, containing:

(1) small interfering RNA (siRNA) capable of inhibiting the expression of gankyrin, where the siRNA is a duplex containing

a) GccGGGAuGAGAuuGuAAATsT sense strand (SEQ ID NO: 1) and UUuAcAAUCUcAUCCCGGCTsT antisense strand (SEQ ID NO: 2), or

b) sense strand cAAucAAAAuGGcuGuAcuTsT (SEQ ID NO: 5) and antisense strand AGuAcAGCcAUUUUGAUUGTsT (SEQ ID NO: 6),

where the lower case nucleotides are 2'-O-methylribonucleotides; s is a thiophosphate bond,

and (2) 4-[4-({[4-chloro-3-(trifluoromethyl)phenyl]carbamoyl}amino)phenoxy]-N-methyl-pyridine-2-carboxamide (sorafenib) or a pharmaceutically acceptable salt thereof,

co-encapsulated in lipid nanoparticles (LNP) based on C12-200 lipidoid.

More specifically, the lipid nanoparticles contain 45-50% C12-200 lipidoid, 10-20% distearoylphosphatidylcholine, 35-38.5% cholesterol, and 0.4-1.5% PEG2000-C14 polyethylene glycol. In particular embodiments, the lipid nanoparticles contain 50% C12-200 lipidoid, 10% distearoylphosphatidylcholine, 38.5% cholesterol, and 1.5% PEG2000-C14 polyethylene glycol.

In some embodiments of the invention, the content of component (1) in lipid nanoparticles relative to component (2) is 5-8 mol.%.

The solution of this problem is also achieved by developing a pharmaceutical composition for the treatment of tumor diseases of the liver in a patient, in the form of hepatotropic lipid nanoparticles for parenteral (in the preferred embodiments, intravenous) administration, containing as a therapeutically active ingredient the lipid nanoparticles defined above in an effective amount and a pharmaceutically acceptable carrier, which is water.

In some particular embodiments, the water is deionized water or water for injection.

More specifically, the pharmaceutical composition according to the invention is a composition containing as a therapeutically active ingredient:

(1) small interfering RNA (siRNA) capable of inhibiting the expression of gankyrin, where the siRNA is a duplex containing

a) a sense strand having the sequence of SEQ ID NO: 1 and an antisense strand having the sequence of SEQ ID NO: 2, or

b) a sense strand having the sequence of SEQ ID NO: 5 and an antisense strand having the sequence of SEQ ID NO: 6,

and (2) 4-[4-({[4-chloro-3-(trifluoromethyl)phenyl]carbamoyl}amino)phenoxy]-N-methyl-pyridine-2-carboxamide or a pharmaceutically acceptable salt thereof,

in therapeutically effective amounts, co-encapsulated in lipid nanoparticles (LNP) made on the basis of lipidoid C12-200.

According to the invention, the lipid nanoparticles in the pharmaceutical composition are in the aqueous phase.

In some embodiments of the invention, the pharmaceutical composition is formulated into a liposomal (lipid) formulation.

The solution of this problem is also achieved by developing a method for obtaining lipid nanoparticles according to the invention, which includes the following steps:

obtaining the first solution, which is an aqueous phase containing 0.1-0.4 mg/ml siRNA (having a sense strand characterized by the sequence SEQ ID NO: 1 and an antisense strand characterized by the sequence SEQ ID NO: 2 or a sense strand characterized by the sequence SEQ ID NO: 5 and an antisense strand characterized by the sequence SEQ ID NO: 6) and 10 mM citrate buffer (buffered aqueous solution ) at pH 3.0;

and a second solution, which is an ethanol phase containing 4-[4-({[4-Chloro-3-(trifluoromethyl)phenyl]carbamoyl}amino)phenoxy]-N-methyl-pyridine-2-carboxamide or a pharmaceutically acceptable salt thereof and a lipid mixture (consisting of C12-200 ionizable lipidoid, distearoylphosphatidylcholine, cholesterol, polyethylene glycol PEG20 00_C14 in a molar ratio (%) 45-50 : 10-20 : 35-38.5 : 0.4-1.5), dissolved in ethanol;

mixing the aqueous and ethanol phases in a ratio of 3:1 by volume with a mixing speed of 10 ml/min to obtain lipid nanoparticles having a mass ratio of miRNA to ionizable lipidoid C12-200 - 1:5;

removal of ethanol from the mixture by diafiltration against phosphate-buffered saline at pH 7.4;

sterilization by filtration.

In some embodiments of the invention, sterilization is carried out by filtration through a PES filter with a pore size of 0.22 μm. The resulting aqueous solution of lipid nanoparticles is preferably sterilized before storage or use.

In preferred embodiments of the invention, the molar ratio (%) of the components of the lipid mixture: lipidoid C12-200, distearoylphosphatidylcholine, cholesterol and polyethylene glycol PEG2000_C14 is 50:10:38.5:1.5.

The solution to this problem is also achieved by using the proposed pharmaceutical composition for the treatment of tumor diseases of the liver.

The solution of this problem is also achieved by using the proposed pharmaceutical composition for the production of a drug for the treatment of tumor diseases of the liver.

The problem is also solved by developing a method for the treatment of liver tumors in a patient, including the introduction of the proposed pharmaceutical composition to the patient in therapeutically effective doses and regimens.

In some embodiments, the neoplastic disease is hepatocellular carcinoma or hepatoblastoma.

As a result of the invention, the following technical results are achieved:

- developed hepatotropic lipid nanoparticles containing both miRNAs to gankirin and sorafenib, and providing an increase in the effectiveness of sorafenib by several (about nine (!)) times, while the developed hepatotropic lipid nanoparticles provide highly efficient encapsulation of active components in lipid nanoparticles and have an optimal size, sufficient for their effective delivery and impact on action targets;

- a fundamentally new medicinal (pharmaceutical) composition has been developed for the treatment of tumor diseases of the liver in a patient (such as, for example, hepatocellular carcinoma (HCC) and hepatoblastoma), the nanostructure of which is a hepatotropic lipid nanoparticles containing both miRNAs to gankirin and sorafenib, and which is a combination of the classical approach of chemotherapy and a new clinically proven technology of RNA interference;

- the structure of miRNAs included in the composition ensures their effective achievement of the target of action due to the increased stability of miRNAs to the action of intracellular nucleases, as well as reliable blocking of the synthesis of gankirin due to the structure that ensures effective induction of RNA interference of gankirin mRNA; this allows the use of siRNA at low concentrations, which further reduces the likelihood of side effects for patients;

- the proposed pharmaceutical composition provides a number of advantages compared to other options for combined treatment using a combination of known anticancer drugs or a combination of anticancer drugs with palliative therapy. Firstly, the effect on tumor cells occurs at different molecular levels: sorafenib interacts with proteins of the tumor cell cell cycle, causing it to stop, and also regulates many signaling pathways in the tumor cell, stimulating the initiation of apoptosis, while inhibition of gankirin at the level of RNA interference leads to the almost complete absence of this protein in the tumor cell, which additionally stops cell division and enhances the action of sorafenib. . Also, due to the heterogeneous nature of liver tumors, the proposed medicinal composition allows for both complex and independent therapeutic action of its active components, which allows overcoming the problems of emerging resistance to sorafenib, reducing the therapeutic dose of the chemotherapy drug and increasing the effectiveness of therapy. It is also worth noting that gankirin is a selective protein for liver tumor cells, and is practically absent in normal hepatocytes, thus, the proposed combination therapy reduces the side effects of sorafenib by reducing its effective dose and increases the specificity of the effect on liver cancer cells.

Brief description of the drawings

Fig. 1. Verification of miRNA efficiency in in vitro experiments. ( A ) - Estimation of mRNA level in Huh7 cell culture after transfection with 10 nM siRNA specific for gankyrin. The mRNA level was analyzed 24 hours after transfection. ( B ) and ( C ) - Curves of dependence of the level of mRNA of gankirin in Huh7 cell culture on the concentration of miRNA #1 and #3, respectively. The mRNA level was analyzed 24 hours after transfection (mean ± SD). P-test was determined by one-way analysis of variance compared with control (*P<0.05, **P<0.005, ***P<0.0005). ( D ) Estimation of the amount of gankirin protein in Huh7 cells 2, 4, and 7 days after #1 siRNA transfection by Western blot. The assessment of the amount of tubulin was used as a reference for assessing the amount of material applied to the gel.

Fig. 2 Mean size curves for siRNA-containing LNPs with or without sorafenib. Designations: LNP1 - particles containing miRNA No. 1, LNP3 - particles containing miRNA No. 3; LNP(1+soraf) - particles containing miRNA No. 1 encapsulated together with sorafenib; LNP(3+soraf) - particles containing miRNA No. 3 encapsulated together with sorafenib.

Fig. 3. Determination of the half-maximal inhibition concentration of sorafenib (IC50) using the MTT assay on human carcinoma (Huh7) and hepatoma (HepG2) cell lines. ( A ) - Determination of IC50 with sorafenib therapy alone. ( B ) - Determination of IC50 in Huh7 cells during co-therapy with sorafenib and lipid nanoparticles (LNP) containing siRNA. ( B ) - Determination of IC50 in HepG2 cells during co-therapy with sorafenib and lipid nanoparticles (LNP) containing siRNA; ( D ) Determination of IC50 in Huh7 cells during therapy with sorafenib co-encapsulated in LNP with siRNA. The designations in Fig. 3 correspond to those in Figs. 2.

Terms and Definitions

Unless otherwise specified, all technical and scientific terms used in this application have the same meaning as understood by those skilled in the art. References to techniques used in the description of this invention refer to well-known methods, including modifications of these methods and replacing them with equivalent methods known to those skilled in the art.

In the documents of this invention, the terms "comprises", "comprising", and the like, as well as "comprises", "comprising", etc. are interpreted to mean "includes, among other things" (or "contains, among other things"). These terms are not intended to be construed as "consisting only of".

The term "and/or" means one, more or all of the listed elements.

Also here, the enumeration of numeric ranges by endpoints includes all numbers within that range.

The terms "treatment", "therapy" encompass the treatment of pathological conditions in a subject, preferably a human, and include: a) blocking (suspension) of the course of the disease, b) alleviating the severity of the disease, i.e. induction of disease regression.

The terms "subject" and "patient" encompass all mammalian species, preferably human.

The term "prevention", "prevention" covers cases of prevention of recurrence of a mammalian condition characterized by a malignant tumor or metastasis of a malignant tumor. Preventive therapy refers to a) primary prevention and b) secondary prevention. Primary prevention is defined as prophylactic treatment in patients (subjects) who have not yet reached the clinical stage of the disease. Secondary prevention is the prevention of the recurrence (relapse) of the same or a close clinical condition of the disease.

By "effective amount" ("therapeutically effective amount") of the active substance in a pharmaceutical composition is meant the quantitative content of the active substance in the composition sufficient to achieve a therapeutic (and/or prophylactic) effect in a patient. Since the pharmaceutical compositions of the invention contain two therapeutically active ingredients, the effective amount of active ingredients in the composition can be calculated both by the amount of sorafenib required to achieve a therapeutic (or prophylactic) effect, and by the amount of siRNA required to achieve an effect. In one embodiment, but not limited to, the calculation can be made, for example, based on the known recommended dose of sorafenib, taking into account its unexpectedly increased (about 9 times) the effectiveness of the effect on tumor cells in the composition of the invention. Data on the effective amount of active ingredients in the composition can also be obtained from the results of the experiments detailed below, as well as on the basis of additional experiments.

By "therapeutically effective dose" is meant the amount of drug administered to a patient that is most likely to produce the expected therapeutic effect. The exact amount required may vary from subject to subject depending on numerous factors, such as the severity of the disease, age, body weight, general condition of the body, combination treatment with other drugs, etc. Administration of the medicinal product (pharmaceutical composition) according to the invention to a subject in need of treatment and / or prevention of a disease or condition is carried out at a dose sufficient to achieve a therapeutic effect. When carrying out treatment and / or prophylaxis, the administration can be carried out both once and several times, for example, several times a week, several times a month, more often in the form of a course administration for a period of time sufficient to achieve a therapeutic effect (from several days to a week, several weeks and up to months), while the courses of drug administration can be repeated. In particular, in moderate forms of the disease, a single dose, frequency and/or duration of administration of the drug according to the invention can be increased. The treatment regimen, as well as the duration of treatment, may also vary from patient to patient, ranging from a minimal course of treatment to lifelong treatment courses. During treatment, the dosage regimen may be adjusted based on observed results, using standard efficacy criteria known in the art.

The pharmaceutical composition (drug) according to the invention can be introduced into the patient's body by parenteral route (including intravenously, by drip infusion) in an amount effective for the treatment or prevention of the disease.

The compositions of the invention may also be administered in combination with other known agents used in patients with liver tumors.

The term "lipid nanoparticles" ("particles", "LNP")) refers to nanoparticles having the following composition: ionizable lipidoid C12-200 )), distearoylphosphatidylcholine (DSPC) (1,2-distearoyl-sn-glycero-3-phosphocholine), cholesterol, polyethylene glycol PEG2000-C14 (ammonium salt of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)-2000]) in a molar ratio (%) 45-50: 1 0-20 : 35-38.5 : 0.4-1.5, more preferably in the ratio 50 : 10 : 38.5 : 1.5. C12-200 lipidoid LNPs are well known in the art for siRNA delivery (see, for example, Love K.T et al. Lipid-like materials for low-dose, in vivo gene silencing // Proc Natl Acad Sci U S A . 2010 Feb 2;107(5):1864-9). Experiments have shown that the lipid nanoparticles of the invention have an average diameter of about 60-130 nm, more often about 70-110 nm, most often about 70-90 nm.

The pharmaceutical compositions of the invention are a sterile composition of siRNA and sorafenib co-encapsulated in LNP in an aqueous phase (water). The amount of water is chosen to be sufficient to form the lipid nanoparticles of the invention.

"Water" ("water phase") in the framework of the present invention is "prepared water" - deionized, distilled, purified, conditioned water, including water for injection, obtained by technological water treatment during the manufacture of medicines, medical devices, cosmetics.

"Encapsulated"("fullyencapsulated") when used in the context of the invention means that the siRNA molecules in the lipid nanoparticles do not undergo significant degradation after exposure to blood serum or during analysis using nucleases, which would cause significant degradation of free RNA. In a fully encapsulated system, preferably less than 25% of the siRNA in the particle is degraded under processing conditions that would normally degrade 100% of the free nucleic acid, more preferably less than 10% and most preferably less than 5% of the nucleic acid in the particle is degraded. Complete encapsulation also implies that the particles are serum resistant, ie. that they do not rapidly break down into their components after in vivo administration.

Sorafenib (4-[4-[[4-chloro-3-(trifluoromethyl)phenyl]carbamoylamino]phenoxy]-N-methylpyridine-2-carboxamide) is a multikinase inhibitor. It has been shown that sorafenib inhibits at least numerous intracellular kinases c-CRAF, BRAF and mutant BRAF, and kinases located on the cell surface KIT, FLT-3, RET, VEGFR-1, VEGFR-2, VEGFR-3 and PDGFR-β, at least partially involved in the signaling systems of the tumor cell, in the processes of angiogenesis and apoptosis. For the purposes of the present invention, sorafenib is used in the form of a free base or in the form of a pharmaceutically acceptable salt. As used herein, the term "pharmaceutically acceptable" refers to those compounds which, within the limits of medical judgment, are suitable for use in contact with human tissues without undue toxicity, irritation, allergic reaction, etc., and meet a reasonable balance of benefit and risk. Wherein, "pharmaceutically acceptable salt" refers to conventional non-toxic salts formed by the reaction of the sorafenib molecule with inorganic or organic acids. Wherein, inorganic acids include, for example, hydrochloric acid, hydrobromic acid, aminosulfonic acid, etc., organic acids include tartaric acid, lactic acid, benzenesulfonic acid, p-toluenesulfonic acid, methanesulfonic acid, naphthalenesulfonic acid, ethanesulfonic acid, naphthalenedisulfonic acid, maleic acid, hydroxymaleic acid, etc. In particular embodiments of the invention, the pharmaceutically acceptable salt of sorafenib is the p-toluenesulfonic acid salt (tosylate or hemitosylate monohydrate). In preferred embodiments, the pharmaceutically acceptable salt of sorafenib is sorafenib tosylate (4-[4-[[4-chloro-3-(trifluoromethyl)phenyl]carbamoylamino]phenoxy]-N-methylpyridine-2-carboxamide, 4-methylbenzenesulfonic acid) having the following structural formula:

.

Unless otherwise defined, the technical and scientific terms in this application have the standard meanings generally accepted in the scientific and technical literature.

Detailed description of the invention

The present invention is directed to the development of a new drug effective for the treatment of tumor diseases of the liver, as well as to the development of a method for the treatment of these diseases using such a drug.

The high efficiency of the developed drug is based on a combination of two approaches to the treatment of liver tumors: classical chemotherapy with sorafenib and a fundamentally new type of therapy using RNA interference, which suppresses the expression of gankirin, which regulates the proliferation of tumor cells.

As already noted, the expression of gankirin is practically absent in normal hepatocytes, is weakly expressed in cirrhosis and porocarcinoma of the liver, and is most clearly expressed in the liver in tumor diseases of the liver, including HCC. It is known that gankirin can promote the progression and metastasis of liver tumors. Therefore, reducing the level of gankirin in tumor cells is a promising method for the treatment of tumor diseases of the liver.

One of the new effective methods for reducing the production of a target protein synthesized by a cell is the RNA interference method based on the selective suppression of gene expression due to mRNA degradation mediated by small interfering RNAs (miRNAs).

The following examples are given for the purpose of disclosing the characteristics of the present invention and should not be construed as limiting the scope of the invention in any way.

Cell lines and transfection

Human Huh7 (carcinoma) and HepG2 (hepatoma) cell lines (ATCC, Manassas, VA) were grown in DMEM/F12 medium supplemented with 10% fetal bovine serum (FBS) (Gibco, Waltham, MA), 2 mM L-glutamine (Gibco), and 1% penicillin-streptomycin at 37°C and 5% CO ₂ . The work with cells was carried out at a confluence of 80%. siRNA (10 nM or 1 nM) to gankirin and anti-luciferase siRNA (control) were transfected using Lipofectamine RNAimax (Invitrogen, Waltham, MA) according to the manufacturer's instructions.

Statistical analysis

Prism 7 (GraphPad Software, La Jolla, CA) was used for statistical analysis. Two-sided unpaired Mann-Whitney tests with 95% confidence limits were used for statistical analysis. A p value <0.05 was considered significant.

Example 1 Development and Selection of miRNAs

Within the framework of the present invention, to suppress the expression of human gankirin mRNA, an siRNA was designed based on the sequence of human gankirin mRNA (NCBI GenBank number: NM_002814.4) and known selection criteria, excluding possible binding sites for endogenous miRNAs, as well as sequences found in other RNAs of the human transcriptome. The 19-bp candidate sequences were matched against the mRNA database (RefSeq) and evaluated for their ability to bind outside the target target. In particular, miRNAs were ranked based on the number/positions of mismatches in different parts and mismatches in the position of the cleavage site. The resulting sequences were further checked to exclude the presence of known miRNA motifs and immunostimulatory sequence motifs.

To increase the stability of miRNAs to the action of intracellular nucleases during synthesis, 2'-O-methyl pyrimidine nucleotides were used and thiophosphate groups were introduced between the last two nucleotides from the 3'-end. The introduction of 2'-O-methyl (2'-OMe) pyrimidine nucleotides into miRNAs additionally reduces the immune response and the possibility of nonspecific action, and, together with the use of 3'-internucleotide thiophosphates, increases stability against nucleases.

As a result of the studies, a design of six siRNAs was developed that are potentially active in suppressing the expression of gankirin mRNA (see Table 1).

Table 1. Design of synthesized miRNAs miRNA semantic chain Antisense strand #1 GccGGGAuGAGAuuGuAAATsT UUuAcAAUCUcAUCCCGGCTsT #2 cccAAGGAGcAAGuAuuuATsT uAAAuACUUGCUCCUUGGGTsT No. 3 cAAucAAAAuGGcuGuAcuTsT AGuAcAGCcAUUUUGAUUGTsT #4 GAGuGccAGuGAAuGAuAATsT UuAUcAUUcACUGGcACUCTsT #5 cuAAccuAAuGGucuGcAATsT UUGcAGACcAUuAGGUuAGTsT #6 cAGAuGcuAAGGAccAuuATsT uAAUGGUCCCUuAGcAUCUGTsT Control cuUaCgCuGaGuAcUuCgATsT UCgAaGuAcUcAgCgUaAgTsT

Note: roman capital letters are ribonucleotides; capital italic letters - deoxyribonucleotides; lowercase letters - 2'-O-methylribonucleotides; s - thiophosphate bond.

Control miRNA - miRNA to firefly luciferase gene.

Below is the correspondence of the nucleotide sequences presented in Table 1, their numbers in the Sequence Listing according to the ST.26 standard, which is part of the present description of the invention. In the event of a sequence structure discrepancy between Table 1 and the corresponding sequence in the ST.26 Sequence Listing, the data in Table 1 takes precedence.

Table 2. Correspondence of the nucleotide sequences presented in Table 1 to their numbers in the Sequence Listing according to the ST.26 standard Sequence number in the ST.26 Sequence Listing Subsequence,
as it is presented in Table 1 SEQ ID NO: 1 GccGGGAuGAGAuuGuAAATsT SEQ ID NO: 2 UUuAcAAUCUcAUCCCGGCTsT SEQ ID NO: 3 cccAAGGAGcAAGuAuuuATsT SEQ ID NO: 4 uAAAuACUUGCUCCUUGGGTsT SEQ ID NO: 5 cAAucAAAAuGGcuGuAcuTsT SEQ ID NO: 6 AGuAcAGCcAUUUUGAUUGTsT SEQ ID NO: 7 GAGuGccAGuGAAuGAuAATsT SEQ ID NO: 8 UuAUcAUUcACUGGcACUCTsT SEQ ID NO: 9 cuAAccuAAuGGucuGcAATsT SEQ ID NO: 10 UUGcAGACcAUuAGGUuAGTsT SEQ ID NO: 11 cAGAuGcuAAGGAccAuuATsT SEQ ID NO: 12 uAAUGGUCCCUuAGcAUCUGTsT SEQ ID NO: 13 cuUaCgCuGaGuAcUuCgATsT SEQ ID NO: 14 UCgAaGuAcUcAgCgUaAgTsT

miRNAs were synthesized according to the amidophosphite scheme (MerMade 12, BioAutomation, USA), purified by ion exchange chromatography, and their purity was confirmed by HPLC-MS. MiRNA to the firefly luciferase gene was used as a control miRNA. The activity of the synthesized siRNAs was tested in the Huh7 liver carcinoma cell line by reverse transcription PCR (RT-PCR) (see Fig. 1A).

To isolate total RNA, cells were lysed using the TRIzol reagent (Invitrogen) followed by precipitation with isopropanol according to the manufacturer's instructions. cDNA was obtained using the cDNA reverse transcription kit Maxima First Strand kit (Thermo Scientific). Gankyrin mRNA levels were assessed using RT-PCR kits using SYBR Green (Thermo Fisher Scientific) in a CFX96 thermal cycler (Bio-rad). mRNA amounts were normalized using human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. The list of primers is shown in Table 3.

Table 3. Primer sequences used in the study. Name Sequence, 5'→3' Sequence number in the ST.26 Sequence Listing hGAPDH F TGCACCACCAACTGCTTAG SEQ ID NO: 15 hGAPDHR GGCATGGACTGTGGTCATGAG SEQ ID NO: 16 hGank F CACTGGCACTCCAAGTTGC SEQ ID NO: 17 hGank R TCTGGCCGATAAATCCCTGG SEQ ID NO: 18

Despite the fact that the design of the synthesized miRNAs was carefully worked out and, theoretically, all six miRNAs (No. 1 - No. 6) should effectively suppress the synthesis of gunkirin, the experiments performed showed that only miRNAs No. 1 and No. 3 are able to almost completely suppress the expression of mRNA, and, consequently, block the synthesis of gunkirin. As can be seen in Fig. 1A, the residual amount of gankirin mRNA in the case of using siRNA #1 and #3, unlike other siRNAs, was less than 15%.

Thus, as a result of the studies, the two most active miRNAs (No. 1 and No. 3) were developed, for which the concentrations of half-maximal inhibition (IC50) were subsequently determined. To do this, Huh7 cells were treated with different concentrations of miRNA No. 1 and No. 3 in the range from 0.00017 to 20 nM, after which the total RNA was isolated and the efficiency of reducing the level of gankirin mRNA was analyzed by PCR-RT (see Fig. 1B and 1C). As shown by the experiments, the values of the half-maximal inhibition concentration (IC50) are 1.89±0.12 pM (for miRNA No. 1) and 9.49±0.02 pM (for miRNA No. 3). Such picomolar IC50 concentrations indicate an unexpectedly high efficiency of the obtained siRNAs. This allows the use of the developed siRNAs at low concentrations, which further reduces the likelihood of side effects for patients.

Additionally, the dynamics of the decrease in the concentration of the gankyrin protein in Huh7 cells was studied by the RNA interference method over time. For this, cells were transfected with 1 nM concentration of siRNA No. 1 and the amount of gankirin protein was analyzed on the 2nd, 4th and 7th day after transfection (see Fig. 1D). Cells were lysed in RIPA buffer containing a complete set of protease inhibitors (Roche). The extracts were incubated for 30 minutes on ice and centrifuged at 12000 g for 20 minutes at 4°C. Total protein concentrations in supernatants were determined using bicinchoninic acid (BCA reagent kit, Pierce) according to the manufacturer's protocol. Next, the samples were analyzed by Laemmli denaturing gel electrophoresis (10%), with a total amount of protein of 20 mg per lane. Separated proteins were analyzed by Western blotting using the following antibodies: anti-tubulin (Cell Signaling) (for control analysis), anti-Gankyrin (Abcam) (for gankyrin analysis). Western blots were visualized using Clarity Max Western ECL Substrate (Bio-rad) according to the manufacturer's instructions. The studies performed have shown that already on the second day after the addition of siRNA, the amount of gankirin protein is poorly detected, and the inhibition efficiency is more than 80%.

Example 2 Preparation of lipid nanoparticles containing only siRNA or siRNA in combination with sorafenib

The particles were prepared on a microfluidic chip by mixing the aqueous and ethanol phases. As the aqueous phase, a solution of siRNA (No. 1 or No. 3 from example 1) (0.1 mg/ml) in 10 mm citrate buffer solution (pH 3.0) was used; as an ethanol solution - a solution of lipids, respectively, with or without the addition of sorafenib tosylate. The lipid mixture contained the following components: ionizable lipidoid C12-200, distearoylphosphatidylcholine (DSPC) (Avanti Polar Lipids, USA), cholesterol (SigmaAldrich, USA), polyethylene glycol PEG2000_C14 (Avanti Polar Lipids, USA) in a molar ratio (%) 45-50:10-20:35-38.5:0.4-1.5. To add sorafenib tosylate, its alcohol solution (5 mg/ml) was preliminarily prepared; 40.3 μl of the resulting solution was added to the ethanol phase.

To form particles of the required size, the aqueous and ethanol phases were mixed in a ratio of 3 : 1 by volume with a total mixing rate of 10 ml/min using a NanoAssemblr™ Benchtop microfluidic device (Precision Nanosystems, USA). The amount of lipids per miRNA unit was calculated from the mass ratio of miRNA to ionizable lipidoid C12-200 - 1:5.

The obtained water-alcohol suspension of particles was diluted with standard phosphate-buffered saline, then dialysis was performed in 500 volumes of standard phosphate-buffered saline at pH 7.4 in dialysis cassettes with a membrane separating compounds with a molecular weight of 20000 Da (MW) (66012; Thermo Fisher Scientific) for 18 hours to remove ethanol and replace the buffer. After dialysis, the particles were sterile filtered through a polyethersulfone (PES) membrane syringe filter (pore size 0.22 μm) (3915; Corning) and stored at +4°C.

After dialysis, particle loading was determined by siRNA and sorafenib, and the sizes of the resulting particles were measured.

Determination of siRNA loading. The concentration of miRNA loaded into lipid nanoparticles was determined by the difference in the level of the fluorescent signal when staining with the RiboGreen reagent (R11491; Thermo Fischer Scientific, USA) a suspension of particles before and after their destruction. The particles were destroyed using Triton X-100 detergent (Sigma-Aldrich, USA).

Sorafenib loading determination. The content of sorafenib in the particles was determined using a calibration curve for absorbance at 266 nm in ethanol. Since the presence of siRNA interferes with the loading of sorafenib at the wavelength used, the siRNA contained in the particles was pre-precipitated when determining the loading. To do this, 96% alcohol was added to an aliquot of particles and left at -80°C overnight. Then the siRNA precipitate was centrifuged at 13,000 rpm at +4°C, the supernatant was carefully removed and the optical density was measured at 266 nm.

Particle size measurements were performed using the Zetasizer Nano ZSP (Malvern Panalytical) according to the manufacturer's protocol (Table 4). Zeta potential measurements were carried out under neutral pH conditions. The indicated values are the average value for 10-25 repetitions.

Table 4. Parameters of lipid nanoparticles (LNPs) used for siRNA delivery. LNP miRNA Particle size, nm miRNA concentration in LNP, ng/µl Sorafenib tosylate concentration
in LLF, µM LNCH1 77.5±0.5 95 - LNCH3 76.5±1.5 111 - Control 72.1 ± 0.7 137 - LNCH(1+soraf) 61±0.8 20.7 20.8 LNCH(3+soraf) 81±±1.3 23.5 21.2

Data on the size of the resulting LNP containing lipidoid C12-200, distearoylphosphatidylcholine, cholesterol and PEG2000-C14 in a molar ratio (%) of 50 : 10 : 38.5 : 1.5 are shown in Fig.2. The control is a lipid nanoparticle containing siRNA to firefly luciferase mRNA used to compare particle size and loading. All obtained particles have a size distribution within 100 nm, which is optimal for use as drug delivery containers, since larger particles activate the lymphatic system and are more quickly removed from the circulation (see, for example, Drug delivery nanoparticles formulation and characterization, edited by Y. Pathak, D. Thassu, 2009). Measurements showed that the efficiency of miRNA loading into LNPs is 65-85%, which indicates highly efficient encapsulation. With the combined inclusion of sorafenib and siRNA into LNPs, the efficiency of siRNA loading into LNPs was about 55%, while the content of siRNAs in lipid nanoparticles relative to sorafenib was 5–8 mol.%. The data obtained indicate a highly effective encapsulation of the active components, sufficient for their effective delivery and impact on the target.

Example 3. Study of the activity of the combination of siRNA with sorafenib on cell lines

As a characteristic of activity for sorafenib, the concentration of half-maximal inhibition in two human cell lines - Huh7 (carcinoma) and HepG2 (hepatoma) was investigated by the MTT test. To do this, an increasing concentration of sorafenib tosylate from 0 to 20 μM was added to the cells and cell viability was analyzed after 48 hours. The half-maximal inhibition concentrations (IC50) for sorafenib tosylate in human carcinoma and hepatoma cell lines were similar and equal to 2.23 ± 0.34 and 2.41 ± 0.38 μM (see Fig. 3A).

In the next experiment, human hepatoma (HepG2) and carcinoma (Huh7) cells were transfected with 1 nM LNP, including miRNA to gankirin, according to the invention, and incubated for two days (it was shown that during this time there was a significant decrease in the amount of gankirin in the cells). To determine the IC50 of sorafenib during combined exposure, an increasing concentration of sorafenib tosylate from 0 to 20 μM was added to the transfected cells and cell viability was analyzed after 48 hours by the MTT test.

The measurements showed that the combined use of sorafenib together with LNPs containing siRNA leads to a two-fold decrease in the concentration of half-maximal inhibition in both cell lines (and amounted to 1.24±0.12 µM for carcinoma and 1.16±0.13 µM for hepatoma in the case of siRNA No. 1; 1.54±0.21 µM for carcinoma and 1 .64 ± 0.31 μM for hepatoma in the case of miRNA No. 3 - see Fig. 3B and Fig. 3C). Thus, as can be seen from the results of the study, in the case of combination therapy, tumor cell proliferation is inhibited at a lower concentration of sorafenib, which indicates that the use of sorafenib in combination with siRNA to gankirin according to the invention significantly increases the effectiveness of its effect on tumor cells. This combination allows the use of sorafenib at significantly lower doses, which in turn reduces the risk of side effects for patients.

However, even more unexpected results were obtained in the next experiment, when the efficacy of combination therapy with sorafenib and anti-gankirin siRNA co-encapsulated in lipid nanoparticles was investigated. For this, human carcinoma cells (Huh7) were transfected with 0 to 5 μM LNP according to the invention and cell viability was analyzed after 3 days by the MTT test. The measurements performed showed (see Fig. 3D) that the combined use of sorafenib together with miRNAs co-encapsulated in LNP leads to a decrease in the concentration of half-maximal inhibition not by two, but by nine times (0.262±0.015 μM for LNP(1+soraf) and 0.323±0.057 μM for LNP(3+soraf)) compared with pure sorafenib (2 .41 ± 0.28 μM), which means that the inclusion of sorafenib in the composition of LNP increases the effectiveness of the effect on liver tumor cells by almost five times.

Thus, as a result of the studies, it was found that the inclusion of sorafenib in LNP together with siRNA to gankyrin No. 1 or No. 3 according to the invention leads to a much more significant increase in the effectiveness of inhibition of tumor cell proliferation than its use outside LNP with miRNA. This significant increase in the effectiveness of therapy allows the use of sorafenib at significantly lower concentrations, which reduces the toxic load of the chemotherapeutic agent and the risk of side effects for patients.

Thus, the present invention is a combination of the classical approach of chemotherapy and a new clinically proven technology of RNA interference. The developed pharmaceutical composition effectively suppresses the proliferation of liver tumor cells, contributing to the treatment of cancer. The use of the new approach several times enhances the effect of the chemotherapeutic drug sorafenib in the treatment of tumor diseases, which allows the use of sorafenib at significantly lower concentrations and thereby significantly reduces the toxic load and the risk of side effects in patients.

While the invention has been described with reference to the disclosed embodiments, it should be apparent to those skilled in the art that the specific experiments described in detail are for the purpose of illustrating the present invention only and should not be construed as limiting the scope of the invention in any way. It should be clear that various modifications are possible without departing from the essence of the present invention.

--->

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.3//EN" "ST26SequenceListing_V1_3.dtd">

<ST26SequenceListing dtdVersion="V1_3" fileName="siRNA-18(3).xml"

softwareName="WIPO Sequence" softwareVersion="2.0.0"

productionDate="2022-08-30">

<ApplicantFileReference>474750</ApplicantFileReference>

<ApplicantName languageCode="en">STANDALONE NON-PROFIT

EDUCATIONAL ORGANIZATION OF HIGHER EDUCATION "SKOLKOVO INSTITUTE

SCIENCE AND TECHNOLOGY”</ApplicantName>

<ApplicantNameLatin>SKOLKOVO INSTITUTE OF SCIENCE AND TECHNOLOGY

(SKOLTECH))</ApplicantNameLatin>

<InventionTitle languageCode="en">COMBINATION THERAPY

SORAFENIB-BASED HEPATOCELLULAR CARCINOMA</InventionTitle>

<SequenceTotalQuantity>18</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q1">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q2">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>2..3</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>8</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>13..14</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q4">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>16</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gccgggatgagattgtaaatt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q5">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q6">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q7">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>3</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>5</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>11</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>tttacaatctcatcccggctt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="3">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q8">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q10">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q54">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>1..3</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>10</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>14</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>16..18</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cccaaggagcaagtatttatt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="4">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q13">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q14">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q15">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>1</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>5</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>taaatacttgctccttgggtt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="5">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q16">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q17">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q18">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>1</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>4</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>5</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>10</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>13</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>14</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>16</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>18</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>19</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>caatcaaaatggctgtacttt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="6">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q19">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q20">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q21">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>3</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>5</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>9</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>agtacagccattttgattgtt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="7">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q22">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q23">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q24">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>4</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>6..7</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>10</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>14</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>17</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>gagtgccagtgaatgataatt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="8">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q25">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q26">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q27">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>2</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>5</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>9</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>15</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ttatcattcactggcactctt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="9">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q28">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q29">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q30">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>1</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>2</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>5..6</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>7</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>10</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>13</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>14</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>15</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>17</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ctaacctaatggtctgcaatt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="10">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q31">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q32">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q33">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>4</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>9</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>12</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>17</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ttgcagaccattaggttagtt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="11">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q34">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q35">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q36">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>1</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>5</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>7</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>8</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>14..15</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>17..18</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cagatgctaaggaccattatt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="12">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q37">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q38">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q39">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>1</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>11</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>14</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>taatggtccttagcatctgtt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="13">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q40">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q41">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q42">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>1</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>2</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>4</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q43">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>2&apos;-O-methyladenosine</INSDQualifier_v

alue>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>6</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>gm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>8</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>10</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q44">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>2&apos;-O-methyladenosine</INSDQualifier_v

alue>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>12</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>14</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>16</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>18</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>gm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cttacgctgagtacttcgatt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="14">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>RNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other RNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q45">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>misc_feature</INSDFeature_key>

<INSDFeature_location>20^21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier id="q46">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thiophosphate bond</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>20..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q47">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>thymidine</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>3</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>gm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>5</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q48">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>2&apos;-O-methyladenosine</INSDQualifier_v

alue>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>7</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>um</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>9</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>11</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>cm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>13</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>gm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>15</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>gm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>17</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>OTHER</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q49">

<INSDQualifier_name>note</INSDQualifier_name>

<INSDQualifier_value>2&apos;-O-methyladenosine</INSDQualifier_v

alue>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

<INSDFeature>

<INSDFeature_key>modified_base</INSDFeature_key>

<INSDFeature_location>19</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mod_base</INSDQualifier_name>

<INSDQualifier_value>gm</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>tcgaagtactcagcgtaagtt</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="15">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q50">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>tgcaccaccaactgcttagc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="16">

<INSDSeq>

<INSDSeq_length>21</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..21</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q51">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>ggcatggactgtggtcatgag</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="17">

<INSDSeq>

<INSDSeq_length>19</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..19</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q52">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>cactggcactccaagttgc</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="18">

<INSDSeq>

<INSDSeq_length>20</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..20</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q53">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>tctggccgataaatccctgg</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (13)

1. Lipid nanoparticle for the treatment of tumor diseases of the liver in a patient, containing (1) small interfering RNA (siRNA) capable of inhibiting the expression of gankyrin, where the siRNA is a duplex containing a) a sense strand having the sequence of SEQ ID NO: 1 and an antisense strand having the sequence of SEQ ID NO: 2; or b) a sense strand having the sequence of SEQ ID NO: 5 and an antisense strand having the sequence of SEQ ID NO: 6, And (2) 4-[4-({[4-Chloro-3-(trifluoromethyl)phenyl]carbamoyl}amino)phenoxy]-N-methyl-pyridine-2-carboxamide or a pharmaceutically acceptable salt thereof, encapsulated together in the above lipid nanoparticles, while the above lipid nanoparticles contain in a molar ratio: 50% lipidoid C12-200, 10% distearoylphosphatidylcholine, 38.5% cholesterol and 1.5% polyethylene glycol PEG2000-C14. 2. Lipid nanoparticle according to claim 1, in which the content of component (1) in relation to component (2) is 5-8 mol.%. 3. The lipid nanoparticle of claim 1, wherein the pharmaceutically acceptable 4-[4-({[4-chloro-3-(trifluoromethyl)phenyl]carbamoyl}amino)phenoxy]-N-methyl-pyridine-2-carboxamide salt is a tosylate. 4. A pharmaceutical composition for the treatment of a liver tumor in a patient, comprising a lipid nanoparticle according to any one of claims 1 to 3 in an effective amount and a pharmaceutically acceptable carrier, which is water. 5. The pharmaceutical composition of claim 4, wherein the water is deionized water or water for injection. 6. The use of a pharmaceutical composition according to any one of claims 4, 5 for the manufacture of a medicament for the treatment of a liver tumor disease in a patient. 7. Use according to claim 7, wherein said neoplastic disease is hepatocellular carcinoma or hepatoblastoma.