RU2760835C2 - Agent inducing cell death for cells having braf gene mutations, agent suppressing growth of such cells, and pharmaceutical composition for the therapy of diseases caused by growth defect of such cells - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: method for inducing cell death of a cell having BRAF gene mutation, a method for suppressing cell growth of a cell having BRAF gene mutation, the application of a drug suppressing GST-π production for the treatment of cancer caused by cell growth defect, and the application of a drug suppressing GST-π production and BRAF inhibitor for the treatment of cancer caused by growth defect of a cell having BRAF gene mutation are proposed. A method for screening a drug for inducing cell death of a cell having BRAF gene mutation, and a method for screening a drug for suppressing cell growth of a cell having BRAF gene mutation are proposed.

EFFECT: proposed group of inventions provides for inducing cell death and suppressing cell growth of a cell having BRAF gene mutation.

10 cl, 6 dwg, 3 ex

Description

Technology area

The present invention relates to an agent for inducing cell death for a cell having a mutation in the BRAF gene (for example, a type of cancer cell), an agent that inhibits the growth of such a cell, and a pharmaceutical composition for treating a disease caused by a growth defect in such a cell, and in addition, refers to a method for screening a cell death inducing agent and / or a cell growth inhibiting agent.

State of the art

The BRAF gene is a gene encoding a type of serine-threonine kinase constituting the RAS-RAF-MAPK pathway. Mutations in the BRAF gene have been reported in various tumors. For example, a mutation in which the amino acid valine is replaced by glutamic acid at position 600 (V600E) has been found in many cancer cells. It is known that BRAF with the V600E mutation always activates the downstream signaling pathway and induces cell growth without extracellular stimulation.

For example, the BRAF gene with the V600E mutation is found in many colorectal cancers (5 to 15%) and melanoma (about 60%). Note that in many cancers, such as pancreatic cancer and colorectal cancer, mutations in the KRAS gene are found with a high frequency. The KRAS protein is a G-protein that is locally present on the inner surface of the cell membrane. RASs like KRAS activate RAFs like CRAF and BRAF, RAF sequentially activates MEK, and MEK activates MAPK, thereby forming a cascade (Non-Patent Literatures 1 and 2). A rare case includes a BRAF mutation and a KRAS mutation because the BRAF mutation and the KRAS mutation are mutually exclusive (Non-Patent Literature 3).

Currently, in cancers with BRAF with the V600E mutation, it is considered effective therapy with an inhibitor against BRAF with the V600E mutation. Vemurafenib (PLX4032) and PLX4720 are known to be such inhibitors. However, cancer cells can acquire resistance to these inhibitors when administered continuously, which makes therapeutic effects limited. Thus, for cancer cells with a mutation in the BRAF gene, more effective agents that induce cell death and agents that suppress growth that replace these inhibitors are in demand.

Glutathione S-transferase (GST), one of the enzymes that catalyzes the conjugation of glutathione, is known to conjugate a substance such as a glutathione drug (GSH) into a water-based substance. GST, based on amino acid sequence, is classified into 6 types of isoenzymes: α, μ, ω, π, θ, and ξ. Of these, the expression of GST-π (glutathione S-transferase pi, also called GSTP1), in particular, is increased in various cancer cells and, as indicated, is a possible factor of resistance to some anti-cancer agents. In fact, it is known that when an antisense DNA or GST-π inhibitor against GST-π is allowed to target a drug-resistant cancer cell system overexpressing GST-π, drug resistance is suppressed (Non-Patent Literature 4-6). In addition, in a recent report, when anti-GST-π siRNAs are allowed to target a GST-overexpressing androgen-independent prostate cancer cell line, its growth is suppressed and apoptosis is increased (Non-Patent Literature 7).

In addition, GST-π is known to complex with c-Jun-N-terminal kinase (JNK) and inhibit JNK activity (Non-Patent Literature 8). In addition, GST-π is known to be involved in S-glutathionylation of proteins associated with cellular stress responses (Non-Patent Literature 9). In addition, GST-π is known to promote a protective effect against cell death induced by reactive oxygen species (ROS) (Non-Patent Literature 10). As described above, the GST-π is understood to have various features and functions among the GSTs.

It is reported that when the anti-GST-π siRNA is allowed to affect the cancer cell system having the KRAS mutation, Akt activation is suppressed and autophagy is increased, but the induction of apoptosis is approximately moderate (Non-Patent Literature 11). Patent Literature 1 discloses that apoptosis of cancer cells can be induced by using a GST-π suppressing drug and an autophagy inhibitor such as 3-methyladenine as active ingredients. Patent Literature 2 further discloses that when GST-π and Akt expression is simultaneously inhibited, cell growth is suppressed and cell death is induced, and autophagy induced by inhibition of GST-π expression is markedly suppressed by simultaneous inhibition of Akt expression and the like.

However, in a cell having a mutation in the BRAF gene described above, no relationship was found between GST-π expression and cell growth or cell death, or a role for GST-π in signal transduction.

Citation list

Patent Literature

Patent Literature 1: WO2012 / 176282

Patent Literature 2: WO2014 / 098210

Non-patent literature

Non-Patent Literature 1: Curr Top Microbiol Immunol. 2012; 355: 83-98

Non-Patent Literature 2: Curr Opin Pharmacol. 2008 Aug; 8 (4): 419-26

Non-Patent Literature 3: British Journal of Cancer (2013) 108, 1757-1764

Non-Patent Literature 4: Takahashi and Niitsu, Gan To Kagaku Ryoho. 1994; 21 (7): 945-51

Non-patent Literature 5: Ban et al., Cancer Res. 1996; 56 (15): 3577-82

Non-Patent Literature 6: Nakajima et al., J Pharmacol Exp Ther. 2003; 306 (3): 861-9

Non-patent Literature 7: Hokaiwado et al., Carcinogenesis. 2008; 29 (6): 1134-8

Non-patent Literature 8: Adler et. al, EMBO J. 1999, 18, 1321-1334

Non-Patent Literature 9: Townsend, et al, J. Biol. Chem. 2009, 284, 436-445

Non-Patent Literature 10: Yin et al, Cancer Res. 2000 60, 4053-4057

Non-patent Literature 11: Nishita et al., AACR 102nd Annual Meeting, Abstract No. 1065

The essence of the present invention

Technical challenge

In this situation, the present invention aims to provide an agent having a cell death inducing and / or growth inhibitory action for a cell having a mutation in the BRAF gene, to provide a pharmaceutical composition for the treatment of a disease caused by a cell growth defect, and to provide a screening method a cell death inducing agent and / or a cell growth inhibitory agent.

The solution of the problem

The inventors of the present invention conducted detailed studies with the above objective in mind, and found that cell growth is intensely suppressed when GST-π is suppressed in a cell having a mutation in the BRAF gene, and cell growth is also intensely suppressed when GST-π is suppressed even in a cell having a BRAF gene mutation. mutation of the BRAF gene and resistant to conventionally known BRAF inhibitors, as a result of which the present invention has been completed. The present invention includes the following.

(1) A cell death inducing agent for a cell having a mutation in the BRAF gene, including a GST-π suppressing drug as an active ingredient.

(2) A cell growth inhibiting agent for a cell having a mutation in the BRAF gene, including a GST-π inhibiting drug as an active ingredient.

(3) The agent according to (1) or (2), wherein the mutation is a V600E mutation.

(4) The agent according to (1) or (2), wherein the cell having a mutation in the BRAF gene is a BRAF inhibitor resistant cell.

(5) An agent according to (1) or (2), wherein the drug is a substance selected from the group consisting of RNA interference molecules, ribozymes, antisense nucleic acids, DNA / RNA chimeric polynucleotides and vectors expressing at least one of them.

(6) The agent according to (1) or (2), wherein the cell having a mutation in the BRAF gene is a cancer cell highly expressing GST-π.

(7) A pharmaceutical composition for treating a disease caused by a growth defect of a cell having a mutation in the BRAF gene, comprising an agent according to any of the above (1) to (6).

(8) The pharmaceutical composition according to (7), wherein the disease is cancer.

(9) The pharmaceutical composition according to (8), wherein the cancer is a cancer highly expressing GST-π.

(10) The pharmaceutical composition according to (8), wherein the cancer is colorectal cancer or melanoma.

(11) A method for screening a cell death inducing agent and / or a cell growth inhibiting agent for a cell having a mutation in the BRAF gene, comprising selecting a GST-π inhibiting drug.

(12) The method for screening according to (11), comprising the step of contacting a test substance with a cancer cell, the step of measuring the expression level of GST-π in the cell, and the step of selecting the test substance as a drug that suppresses GST-π when the expression level is reduced compared to with a case measured in the absence of a test substance.

The present description covers the disclosed content described in JP Patent Application No. 2015-84286 and JP Patent Application No. 2016-78710, which are the basis of the priority of this application.

Beneficial Effects of the Present Invention

According to the cell death inducing agent of the present invention, cell death can be induced very intensely for a cell having a mutation in the BRAF gene. Accordingly, the cell death inducing agent of the present invention can be very effective as a pharmaceutical composition for the treatment of a disease caused by a growth defect of a cell having a mutation in the BRAF gene.

In addition, according to the cell growth suppressing agent of the present invention, cell growth can be suppressed very intensely for a cell having a mutation in the BRAF gene. Accordingly, the cell growth inhibitory agent of the present invention can be very effective as a pharmaceutical composition for the treatment of a disease caused by a growth defect of a cell having a mutation in the BRAF gene.

In addition, according to the screening method according to the present invention, a drug can be selected to induce cell death and / or to suppress cell growth very vigorously for a cell having a mutation in the BRAF gene.

Brief Description of Drawings

[Figure 1] FIG. 1 is a representative graph showing the results of a study of the inhibitory effect of cell growth caused by knockdown of GST-π in a colorectal cancer cell line having a mutation in the BRAF gene (cell count, Western blot).

[Figure 2] FIG. 2 is a representative diagram showing the results of a study of the inhibitory effect of cell growth caused by knockdown of GST-π in a melanoma cell line having a mutation in the BRAF gene (cell count, Western blot).

[Figure 3] FIG. 3 is a representative diagram showing the results of a study of the effect of inhibiting cell growth when GST-π siRNA and a BRAF inhibitor were used in combination in a colorectal cancer cell line having a mutation in the BRAF gene.

[Figure 4] FIG. 4 are representative diagrams showing the results of investigating the effects of cell growth suppression when GST-π siRNA and a BRAF inhibitor were used in combination in a melanoma cell line having a mutation in the BRAF gene.

[Figure 5] FIG. 5 is a representative graph showing the results of a study of the inhibitory effect of cell growth caused by knockdown of GST-π in a melanoma cell line having a mutation in the BRAF gene and resistant to a BRAF inhibitor.

[Figure 6] FIG. 6 is an electrophoresis photograph showing the results of a Western blot analysis of GST-π expression when GST-π was knocked out in a melanoma cell line having a mutation in the BRAF gene and resistant to a BRAF inhibitor.

Description of embodiments

The cell death inducing agent and the cell growth inhibiting agent of the present invention contains a GST-π inhibiting drug as an active ingredient. The cell death inducing agent and the cell growth inhibiting agent of the present invention exhibit a cell death inducing effect and a cell growth inhibiting effect for a cell having a mutation in the BRAF gene.

GST-π, as used herein, refers to an enzyme that is encoded by the GSTP1 genome and catalyzes the conjugation of glutathione. GST-π is present in various animals, including humans, and its sequence information is known (for example, human: NM_000852 (NP_000843), rat: NM_012577 (NP_036709), mouse: NM_013541 (NP_038569), etc. The numbers represent base numbers of the NCBI data, the numbers outside the parentheses are the nucleotide sequences and the numbers in the parentheses are the amino acid sequences). By way of example, the nucleotide sequence in the coding region of the human GST-π gene listed in the database is shown in SEQ ID NO: 1 and the amino acid sequence in the human GST-π protein encoded by the human GST-π gene is shown in SEQ ID NO: 2.

It should be noted that GST-π can be determined by a specific nucleotide sequence and amino acid sequence as described above, but it is necessary to consider a mutation in the nucleotide sequence and amino acid sequence (including polymorphisms), which may need to be considered caused between biological individuals. Namely, GST-π is not limited to proteins having an identical sequence to the amino acid sequence recorded in the database, but includes those having an equal function to GST-π and having a sequence with 1 or 2 or more, usually 1 or several, for, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 different amino acids from the above sequence. In addition, GST-π also includes those consisting of a nucleotide sequence having 70% or more, 80% or more, 90% or more, 95% or more, or 97% or more identity with the specified specific nucleotide sequence, and a coding protein having equal function with GST-π. It should be noted that the specific function of GST-π, as described above, refers to the activity of an enzyme that catalyzes the conjugation of glutathione.

It should be noted that in the present description, phrases such as "when used in the present description", "used in the present description", "in the present description" and "described in the present description" mean that the following descriptions of these phrases apply to all inventions. described in the present description, unless otherwise indicated. In addition, unless otherwise indicated, all technical and scientific terms used herein have the same meaning as those commonly understood by those of ordinary skill in the art. All patents, patent publications, and other publications cited in this document are to be incorporated in their entirety in this description.

Examples of "GST-π suppressing drug" used herein include, but are not limited to, drugs that inhibit the production and / or activity of GST-π, and drugs that promote the degradation and / or inactivation of GST- π. Examples of drugs that suppress GST-π production include, but are not limited to, RNA interference molecules, ribozymes, antisense nucleic acids, DNA / RNA chimeric polynucleotides to DNA encoding GST-π, and vectors expressing them.

In addition, any compound that acts on GST-π can be used for the GST-π suppressing drug. Examples of such suitable compounds include organic compounds (amino acids, polypeptides or derivatives thereof, low molecular weight compounds, carbohydrates and high molecular weight compounds) and inorganic compounds. In addition, these compounds can be natural or unnatural substances. Examples of the derived polypeptide include modified polypeptides obtained by adding a modifying group and variant polypeptides obtained by altering an amino acid residue. In addition, these compounds can be a single compound or chemical library, gene library expression products, cell extracts, cell culture supernatants, microbial fermentation products, marine extracts, and plant extracts. Namely, the "GST-π suppressing drug" is not limited to nucleic acids such as RNA interference molecules, but includes any compounds.

Specific examples of a drug that inhibit GST-π activity include, but are not limited to, GST-π conjugating agents such as glutathione, glutathione analogs (for example, patent documents WO 95/08563, WO 96/40205, WO 99/54346 and those described in Non-Patent Literature 4, etc.), ketoprofen (Non-Patent Literature 2), indomethacin (Hall et al., Cancer Res. 1989; 49 (22): 6265-8), ethacrynic acid, piriprost (Tew et al., Cancer Res. 1988; 48 (13): 3622-), anti-GST-π antibodies and dominant negative GST-π mutants. These drugs are commercially available or can be suitably manufactured using known technologies.

A drug that inhibits the production or activity of GST-π is preferably RNA interference molecules, ribozymes, antisense nucleic acids, DNA / RNA chimeric polynucleotides to DNA encoding GST-π, or vectors expressing them due to their high specificity and low likelihood of side effects.

Suppression of GST-π can be determined based on the expression of GST-π or activity suppressed in the cell as compared to the case where the GST-π inhibitor was not allowed to act. Expression of GST-π can be assessed using any known methods, such as, without any limitation, immune precipitation method using anti-GST-π antibodies, ELISA, ELISA, IRA, IRMA, Western blot method, immunohistochemical method, immunocytochemical method, flow cytometry method, various hybridization methods, Northern blotting method, Southern blotting method and various PCR methods in which a nucleic acid is capable of specifically hybridizing with a nucleic acid encoding GST-π, or its unique fragment, or transcript (for example , mRNA), or a spliced nucleic acid product.

GST-π activity can be assessed by assaying known GST-π activities such as, without limitation, binding to proteins such as Raf-1 (in particular, phosphorylated Raf-1) and EGFR (in particular, phosphorylated EGFR ) by any known methods such as immune precipitation method, Western blotting method, mass spectrometry, affinity adsorption method or surface plasmon resonance (SPR) method.

RNA interference molecule, as used herein, refers to any molecules presenting RNA interference and includes, but not limited to, double-stranded RNAs such as siRNA (small interfering RNA), miRNA (microRNA), shRNA (small RNA forming hairpins), ddRNA (DNA directed RNA), piRNA (Piwi interacting RNA) and rasiRNA (associated with siRNA repeats), and their variants. These RNA interference molecules are commercially available or can be designed and made based on known sequence information, namely, the nucleotide sequence as set forth in SEQ ID NO: 1 and / or the amino acid sequence as set forth in SEQ ID NO: 2. In addition, antisense nucleic acid as used herein includes RNA, DNA, PNA, and complexes thereof.

A DNA / RNA chimeric polynucleotide as used herein includes, but is not limited to, double-stranded polynucleotides composed of DNA and RNA that inhibit the expression of a target gene, as described in JP (Kokai) Patent Publication No. 2003-219893 A.

The amount of active ingredient added to the agent or composition of the present invention can be an amount that induces cell death such as apoptosis and / or suppression of cell growth when the agent or composition is administered. In addition, an amount that does not cause harmful effects is preferable, which outweighs the benefits obtained from the administration. This amount is known or appropriately determined by an in vitro assay using cultured cells or an assay in a model animal such as a mouse, rat, dog or pig, and these test methods are well known to those skilled in the art. Induction of apoptosis can be assessed by various known methods using the detection of a feature characteristic of apoptosis, such as DNA fragmentation, binding of annexin V to the cell membrane, changes in mitochondrial membrane potential or caspase activation, or terminal deoxyuridine end-labeling (TUNEL). In addition, the inhibition of cell growth can be assessed using various known methods such as counting the number of viable cells over time, measuring the size, volume and mass of the tumor, measuring the amount of DNA synthesis, WST-1 method, BrdU (bromodeoxyuridine) method or inclusion method 3H-thymidine. The amount of active ingredient added will vary depending on the dosage form of the agent and the composition. For example, when multiple composition units are used for a single administration, the amount of active ingredient added to a single composition may be one of several equal units of the amount of active ingredient required for a single administration. The amount to be added can be appropriately adjusted by those skilled in the art.

In addition, the addition of a GST-π inhibiting drug as an active ingredient allows the production of a cell death inducing agent, a cell growth inhibiting agent, a cell death inducing composition or a cell growth inhibiting composition.

In addition, a drug that inhibits GST-π is used to induce cell death or suppress cell growth. In addition, a method for inducing cell death or a method for inhibiting cell growth may be provided, comprising administering an effective amount of a GST-π suppressing drug.

It should be noted that both of the above methods for inducing cell death, such as apoptosis or suppression of cell growth, can be in vitro or in vivo methods. In addition, the drug for these methods is described above, and the effective amount of the drug may be an amount that induces cell death or suppresses cell growth in a cell into which the drug is administered. In addition, an amount that does not cause harmful effects is preferable, which outweighs the benefits obtained from the administration. Such an amount is known or can be determined appropriately, for example, by an in vitro assay using cultured cells and the like, and the assay method is well known to those skilled in the art. The induction of cell death or inhibition of cell growth can be assessed by various known methods, including those described above. The above effective amount, when a drug is administered to a specific group of cancer cells, need not be an amount that always causes cell death or growth suppression for all cells in the cell group. For example, the above effective amount may be an amount that induces apoptosis or growth inhibition up to 1% or more, 2% or more, 3% or more, 4% or more, 5% or more, 6% or more, 8% or more, 10% or more, 12% or more, 15% or more, 20% or more, or more than 25% or more cells in the above group of cells.

The cell death inducing agent and the cell growth inhibiting agent of the present invention act on a cell having a mutation in the BRAF gene. A cell with a mutation in the BRAF gene is a cell showing a growth defect due to a mutation in the BRAF gene (usually cancer cells).

In particular, the cell death inducing agent and the cell growth suppressing agent of the present invention are preferably applied to a cell highly expressing GST-π (typically a cancer cell highly expressing GST-π) among cells showing a growth defect from - for mutations in the BRAF gene. As used herein, a GST-π expressing cancer cell means a cell having a significantly higher level of GST-π expression as compared to a normal cell among cells having a mutation in the BRAF gene and exhibiting a cell growth defect. It should be noted that the expression level of GST-π can be measured according to a conventional method such as RT-PCR or microchip.

A mutation in the BRAF gene means a mutation such as deletion, substitution, addition, insertion in the amino acid sequence of wild-type BRAF and a mutation in the control region of the BRAF gene. It should be noted that the mutation in the BRAF gene here is a so-called gain-of-function mutation. Namely, the BRAF gene having a mutation (sometimes referred to as a mutant BRAF gene) includes genes encoding a mutant BRAF with increased serine-threonine kinase activity caused by the mutation. In addition, the mutant BRAF gene also includes those having a mutation in the expression control region and an increased expression level compared to the wild-type BRAF gene. Namely, a cell expressing a mutant BRAF gene has the property of constantly maintaining a downstream signaling pathway (eg, a signaling pathway to MEK) from BRAF by expressing mutant BRAF or increasing the level of BRAF expression.

Examples of a mutant BRAF gene include genes encoding a mutant BRAF where valine encoded by codon 600 in the wild-type BRAF gene is replaced with glutamic acid (referred to as V600E. Hereinafter referred to as the same), including V600D, V600G, V600K, V600M, V600R , V600L, G469A, G469V, D594N, and V600insT (inset T).

The cell death inducing agent and the cell growth inhibiting agent of the present invention are capable of effectively inducing cell death or suppressing cell growth even for a cancer cell having a mutation in the BRAF gene, thus, are effective as components of a pharmaceutical composition for a disease caused by a defect. growth of a cancer cell with a mutation in the BRAF gene. In addition, the dosage form of the GST-π suppressing agent as an active ingredient makes it possible to obtain a pharmaceutical composition for a disease caused by a growth defect in a cancer cell having a mutation in the BRAF gene. In addition, the disease caused by a defect in cell growth can be treated and treated by administering an effective amount of the resulting pharmaceutical composition to a subject in need thereof.

The pharmaceutical composition is effective for treating the cause of a disease caused by a growth defect in a cancer cell having a mutation in the BRAF gene. Disease caused by a cancer cell having a mutation in the BRAF gene is not limited to and includes cancers highly expressing GST-π, and in many cases, cancers having a mutation in the BRAF gene are included in cancers highly expressing GST-π.

Examples include, but are not limited to, sarcomas such as fibrosarcoma, malignant fibrous histiocytoma, liposarcoma, rhabdomyosarcoma, leiomyosarcoma, angiosarcoma, Kaposi's sarcoma, lymphangiosarcoma, synovial sarcoma, carcinoma cancer), cancer of the lining of the brain, brain tumor, pituitary cancer, salivary gland cancer, head and neck cancer, breast cancer, lung cancer (non-small cell cancer), esophageal cancer, stomach cancer, duodenal cancer, appendix cancer, colorectal cancer , rectal cancer, liver cancer, pancreatic cancer, gallbladder cancer, bile duct cancer, anal cancer, kidney cancer, ureter cancer, bladder cancer, prostate cancer, penile cancer, testicular cancer, uterine cancer (endometrial cancer ), ovarian cancer (serous ovarian cancer), vulvar cancer, vaginal cancer and skin cancer (malignant melanoma), and then leukemia and malignant lymphoma. It should be noted that "cancer" in the present invention includes epithelial cancer and non-epithelial cancer. The cancer in the present invention can be present in any part of the body, including the brain, head and neck, chest, limb, lungs, heart, thymus, esophagus, stomach, small intestine (duodenum, jejunum, ileum), colon (colon intestine, cecum, appendix, rectum), liver, pancreas, gallbladder, anus, kidneys, ureter, bladder, prostate gland, penis, testicle, uterus, ovary, vulva, vagina, skin, striated muscle, smooth muscle , synovial membrane, cartilage, bone, thyroid, adrenal, peritoneum, mesentery, bone marrow, blood, vascular system, lymphatic system such as lymph node and lymphatic fluid.

In particular, the cell death inducing agent and the cell growth inhibiting agent of the present invention can effectively induce cell death or suppress cell growth even for a cell that has acquired resistance to a BRAF inhibitor among cells having a mutation in the BRAF gene. Accordingly, a cell death inducing agent or a cell growth suppressing agent of the present invention is effective as a component of a pharmaceutical composition for a disease caused by a growth defect in a cancer cell having a mutation in the BRAF gene and resistance to a BRAF inhibitor. In addition, the dosage form of the GST-π suppressing agent as an active component makes it possible to obtain a pharmaceutical composition for a disease caused by a growth defect in a cancer cell having a mutation in the BRAF gene and resistance to a BRAF inhibitor. In addition, a disease caused by a defect in cell growth can be treated and treated by administering an effective amount of the resulting pharmaceutical composition to a subject in need thereof, that is, a patient with a reduced therapeutic effect with a BRAF inhibitor.

As used herein, a BRAF inhibitor means a substance that inhibits signal transduction from BRAF to the downstream pathway, in particular a substance that specifically inhibits signal transduction caused by a BRAF mutation, having the acquisition of function mutation described above. Examples of a known BRAF inhibitor include vemurafenib ((PLX4032), Cas No .: 918504-65-1, N- [3- [5- (4-chlorophenyl) -1H-pyrrolo [2,3-b] pyridine-3-carbonyl ] -2,4-difluorophenyl] propane-1-sulfonamide) and PLX4720 (Cas No .: 918505-84-7, N- [3- (5-chloro-1H-pyrrolo [2,3-b] pyridine-3 -carbonyl) -2,4-difluorophenyl] propane-1-sulfonamide).

In addition, examples of the BRAF inhibitor include regorafenib, dasatinib, PLX-8394, BeiGene-283, PLX-3603, RG-7304 (CAS NO .: 213406-50-9), LY-3009120 (CAS NO .: 1454682-72- 4), rebastinib (Cas.No .: 1020172-07-9), analogs of 1H-pyrazolo [3,4-b] pyridine-5-carboxamide, ASN-003, prodrug vemurafenib, N- (thiophen-2-yl) benzamide derivatives, DCB-R0237, REDX-04988, EBI-907, EBI-945, gossypine, nanolipolee-007, TEW-0201, miRNA-3157 and thiazole derivative (NMS-P186, NMS-P285, NMS-P349, NMS- P383, NMS-P396 and NMS-P730).

In addition, examples of the BRAF inhibitor include, in addition to the above, SB590885 (Cas No .: 405554-55-4, N, N-dimethyl-2- [4 - [(4Z) -4- (1-nitroso-2,3- dihydroinden-5-ylidene) -5- (1H-pyridin-4-ylidene) -1H-imidazol-2-yl] phenoxy] ethanamine), B-Raf 1 inhibitor (Cas No .: 1093100-40-3, 1- N- (4-chlorophenyl) -6-methyl-5-N- [3- (7H-purin-6-yl) pyridin-2-yl] isoquinoline-1,5-diamine), B-Raf inhibitor 1 dihydrochloride ( Cas No .: 1191385-19-9, 1-N- (4-chlorophenyl) -6-methyl-5-N- [3- (7H-purin-6-yl) pyridin-2-yl] isoquinoline-1, 5-diamine; dihydrochloride), dabrafenib (Cas No .: 1195765-45-7, N- [3- [5- (2-aminopyrimidin-4-yl) -2-tert-butyl-1,3-thiazole-4 -yl] -2-fluorophenyl] -2,6-difluorobenzenesulfonamide), LGX818 (Cas No .: 1269440-17-6, methyl N - [(2S) -1 - [[4- [3- [5-chloro- 2-fluoro-3- (methanesulfonamido) phenyl] -1-propan-2-ylpyrazol-4-yl] pyrimidin-2-yl] amino] propan-2-yl] carbamate), HG6-64-1 (Cas No. : 1315329-43-1, see patent document WO 2011/090738.), PF-04880594 (Cas No .: 1111636-35-1, 3 - [[4- [1- (2,2-difluoroethyl) -3 - (1H-pyrrolo [2,3-b] pyridin-5-yl) pyrazol-4-yl] pi rimidin-2-yl] amino] propanenitrile), BRAF inhibitor (Cas No .: 918505-61-0, N- [2,4-difluoro-3- (5-pyridin-3-yl-1H-pyrrolo [2, 3-b] pyridine-3-carbonyl) phenyl] propane-2-sulfonamide), B-Raf inhibitor (Cas No .: 1315330-11-0, N- [4 - [(4-ethylpiperazin-1-yl) methyl ] -3- (trifluoromethyl) phenyl] -4-methyl-3 - [(6-methyl-7H-pyrrolo [2,3-d] pyrimidin-4-yl) oxy] benzamide), TAK-632 (Cas No. : 1228591-30-7), N- [7-cyano-6- [4-fluoro-3 - [[2- [3- (trifluoromethyl) phenyl] acetyl] amino] phenoxy] -1,3-benzothiazole-2 -yl] cyclopropanecarboxamide, AZ 628 (Cas No .: 878739-06-1, 3- (2-cyanopropan-2-yl) -N- [4-methyl-3 - [(3-methyl-4-oxoquinazoline-6 -yl) amino] phenyl] benzamide), RAF265 (Cas No .: 927880-90-8, 1-methyl-5- [2- [5- (trifluoromethyl) -1H-imidazol-2-yl] pyridin-4- yl] oxy-N- [4- (trifluoromethyl) phenyl] benzimidazol-2-amine), CEP-32496 (Cas No .: 1188910-76-0, 1- [3- (6,7-dimethoxyquinazolin-4-yl ) oxyphenyl] -3- [5- (1,1,1-trifluoro-2-methylpropan-2-yl) -1,2-oxazol-3-yl] urea), GDC-0879 (Cas No .: 905281- 76-7, 2- [4 - [(1E) -1-hydroxyimino-2,3-dihydroinden-5-yl] -3-pyridin-4-ylpyrazole-1 -yl] ethanol), sorafenib tosylate (Cas No .: 475207-59-1, 4- [4 - [[4-chloro-3- (trifluoromethyl) phenyl] carbamoylamino] phenoxy] -N-methylpyridine-2-carboxamide; 4-methylbenzenesulfonic acid), dabrafenib mesylate (Cas No .: 1195768-06-9, N- [3- [5- (2-aminopyrimidin-4-yl) -2-tert-butyl-1,3-thiazole-4- yl] -2 fluorophenyl] -2,6-difluorobenzenesulfonamide; methanesulfonic acid), CEP-32496 hydrochloride (Cas No .: 1227678-26-3, 1- [3- (6,7-dimethoxyquinazolin-4-yl) oxyphenyl] - 3- [5- (1,1,1-trifluoro-2-methylpropan-2-yl) -1,2-oxazol-3-yl] urea; hydrochloride) and sorafenib (Cas No .: 284461-73-0, 4- [4 - [[4-chloro-3- (trifluoromethyl) phenyl] carbamoylamino] phenoxy] -N-methylpyridine-2-carboxamide).

The pharmaceutical composition of the present invention can be used in combination with other active ingredients other than the GST-π suppressant drug. Used in combination herein include, for example, administering other active ingredients as separate pharmaceutical preparations and administering other active ingredients in the form of a combined agent with at least one of the other drugs. When other active ingredients are administered as separate pharmaceutical preparations, the preparation containing the other active ingredients can be administered before the other preparations, together with other preparations, or after other preparations.

The above BRAF inhibitors can be suitably used for such other active ingredients. In addition, other active ingredients also include those that are effective for treating a given disease. For example, when the disease to be treated is cancer, the anticancer agent can be used in combination. Examples of an anticancer agent include alkylating agents such as ifosfamide, nimustine hydrochloride, cyclophosphamide, dacarbazine, melphalan and ranimustine, antimetabolites such as gemcitabine hydrochloride, enocitabine, cytarabine octophosphate, cytarabine preparations, teglafur-uracil (e.g. TS-1), doxifluridine, hydroxycarbamide, fluorouracil, methotrexate and mercaptopurine, antineoplastic antibiotics such as idarubicin hydrochloride, epirubicin hydrochloride, daunorubicin hydrochloride, doxorubicin pyronemicin hydrochloride and mitochloride hydrochloride hydrochloride alkaloids such as etoposide, irinotecan hydrochloride, vinorelbine dinarrate, docetaxel hydrate, paclitaxel, vincristine sulfate, vindesine sulfate and vinblastine sulfate, hormone therapy agents such as anastrozole, tamoxifen citrate, toremidine citrate, phosphates and bicalutamistramine complexes platinum such as carboplatin, cisplatin (CDDP) and nedaplatin, angiogenic inhibitors such as thalidomide, neovastat and bevacizumab, and L-asparaginase.

When the active component in each of the agents, compositions and method of treatment of the present invention described herein is a nucleic acid such as an RNA interference molecule, a ribozyme, an antisense nucleic acid, or a DNA / RNA chimeric polynucleotide that can be used directly in the form of naked nucleic acid, or can also be supported by various vectors. For the vector, you can use any of the known vectors, such as plasmid vectors, phage vectors, phagemid vectors, cosmid vectors, viral vectors. The vector to be supported preferably contains at least a promoter that enhances the expression of the nucleic acid, and the nucleic acid in this case is preferably operatively ligated to the promoter. A nucleic acid operably ligated with a promoter means that the nucleic acid and the promoter are positioned so that the protein encoded by the nucleic acid can be appropriately produced by the action of the promoter. The vector may or may not be replicable in the host cell, and transcription of the gene may be carried out outside or inside the nucleus in the host cell. In the latter case, the nucleic acid can be incorporated into the genome of the host cell.

In addition, the active ingredient can also be supported by various non-viral lipids or protein carriers. Such a carrier is not limited, and examples include cholesterols, liposomes, antibody promoters, cyclodextrin nanoparticles, fusion peptides, aptamers, biodegradable copolymers and polylactic acid polymers, which can increase the efficiency of intracellular administration (for example, see Pirollo and Chang, Cancer Res. 2008 ; 68 (5): 1247-50, etc.). Cationic liposomes and polymers (eg polyethyleneimine, etc.) are particularly useful. Other examples of a polymer suitable as such a carrier include those described in US 2008/0207553 and US 2008/0312174.

For each pharmaceutical composition of the present invention described in the present description, the active ingredient can be combined with other auxiliary ingredients, provided that the effects of the active ingredient are not affected. Examples of the adjuvant include other chemotherapeutic agents, pharmacologically acceptable carriers, excipients, and solvents. In addition, depending on the route of administration and the mode of drug release, the above composition may also be coated with a suitable material, for example, an enteric coating or a temporary disintegrating material, or incorporated into a suitable drug release system.

Each agent and composition (including each pharmaceutical composition) of the present invention described herein can be administered by a variety of routes, including both oral and parenteral, and examples of the route of administration include, but are not limited to, oral, intravenous, intramuscular, subcutaneous , local, intratumoral, intrauterine, rectal, intraarterial, intraportal, intraventricular, transmucosal, transdermal, intranasal, intraperitoneal, intrapulmonary and intrauterine, or can be prepared in a dosage form suitable for each route of administration. You can use any known dosage form and method of preparation (for example, see "Hyojun Yakuzaigaku" ("Standard Pharmaceutics" in English), edited by Yoshiteru Watanabe et al., Nankodo, 2003, etc.).

A dosage form suitable for oral administration is not limited, and examples include powders, granules, tablets, capsules, solutions, suspensions, emulsions, gels and syrups, and examples of a dosage form suitable for parenteral administration include injections such as solution injections, suspension injections, emulsion injections and injections prepared for immediate use. A preparation for parenteral administration can be in the form of an aqueous or non-aqueous isotonic sterile solution or suspension.

Each agent or composition (including each pharmaceutical composition) of the present invention described herein can also target a specific tissue or cell. Targeting can be achieved using any known method. When it is intended for delivery to cancer, examples of methods used include, but are not limited to, passive targeting, in which the drug preferably has a size of 50 to 200 nm, in particular 75 to 150 nm, to obtain EPR effects (increased permeability and retention) and active targeting in which a ligand such as CD19, HER2, transferrin receptor, folate receptor, VIP receptor, EGFR (Torchilin, AAPS J. 2007; 9 (2): E128-47), RAAG10 (JP (Kohyo) No. 2005-532050), PIPA (JP (Kohyo) No. 2006-506071) or KID3 (JP (Kohyo) No. 2007-529197), a peptide having an RGD motif or motif NGR, F3 or LyP-1 (Ruoslahti et al., J Cell Biol. 2010; 188 (6): 759-68) is used as a targeting agent. In addition, it is known that the retinoid and its derivative are useful as a targeting agent in a cancer cell (patent document WO 2008/120815), and thus a carrier containing the retinoid as a targeting agent can also be used. Carriers are described in patent documents WO2009 / 036368, WO 2010/014117 and WO 2012/170952, in addition to the above literature.

Each agent or composition (including each pharmaceutical composition) of the present invention described herein can be supplied in any form and, in terms of storage stability, can be provided in the form of a preparation for immediate use in a medical area or near a physician, and / or a pharmacist, nurse or other healthcare professional. This form is especially useful when the agent or composition of the present invention contains components that are difficult to store stably, such as lipids, proteins, and nucleic acids. In this case, the agent or composition of the present invention is provided in 1 or 2 or more containers containing at least one essential element and prepared before use, for example, within 24 hours, preferably up to 3 hours, more preferably just before using. Preparation can be suitably used with a reagent, solvent, and preparation equipment usually available at the preparation site.

Thus, the present invention relates to a kit for preparing a composition containing 1 or 2 or more containers containing active components that may be contained in each agent or composition according to the present invention separately or in combination, as well as the necessary elements of each agent or composition for providing in the form of such a set. The kit of the present invention may include, in addition to the above, instructions describing the method of preparation and the method of administration of each agent or composition of the present invention, such as written information and digital storage media such as a CD or DVD. In addition, the kit of the present invention may include all of the elements necessary to complete each agent or composition of the present invention, but does not need to include all of the elements. Thus, the kit of the present invention may not include the reagent and solvent commonly available in the medical area and experimental means such as sterilized water, saline and glucose solution.

An effective amount in each method of treatment of the present invention described herein is, for example, an amount that alleviates a symptom of a disease or delays or stops the progression of a disease, preferably an amount that suppresses or cures the disease. In addition, an amount that does not cause harmful effects is preferable and outweighs the benefits obtained from administration. Such an amount is appropriately determined by in vitro testing using cultured cells or testing in a model animal such as a mouse, rat, dog or pig, and these test methods are well known to those skilled in the art. The dosage of the medicament used in the method of treatment of the present invention is known to those skilled in the art, or can be appropriately determined by the aforementioned tests.

The specific dose of the active ingredient administered in the method of treatment of the present invention described herein can be determined taking into account the various conditions of the subject in need of treatment, such as the severity of the symptoms, the general health of the subject, age, body weight, sex of the subject, diet, timing and frequency of administration, co-administered drugs, response to therapy, dosage form and appropriateness of therapy.

The route of administration includes various routes, including oral and parenteral, such as oral, intravenous, intramuscular, subcutaneous, local, intratumoral, rectal, intraarterial, intraportal, intraventricular, transmucosal, transdermal, intranasal, intraperitoneal, intrapulmonary, and intrauterine.

The frequency of administration will vary depending on the property of the agent or composition used and the conditions of the subject, including the above, but can be, for example, several times a day (more specifically, twice, 3, 4 or 5 times, or more times a day), once a day, every few days (more precisely, every 2, 3, 4, 5, 6 or 7 days), every week, every few weeks (more precisely, every 2, 3 or 4 weeks).

The term "subject" as used herein means any biological individual, preferably animals, even more preferably mammals, and also, more preferably, humans. In the present invention, a subject may be healthy or affected by a disease, but when a particular disease is intended to be treated, the subject usually means a subject that is affected or affected by the disease.

In addition, the term "treatment" as used herein includes all medically acceptable prophylactic and / or therapeutic interventions for the purpose of recovery, temporary remission, or prevention of disease. For example, the term "treatment" includes medically acceptable interventions for various purposes, including delaying or arresting the progression of a disease, regressing or resolving a lesion, preventing the onset or prevention of recurrence.

A drug that inhibits GST-π demonstrates the induction of cell death and / or suppression of cell growth for a cell having a mutation in the BRAF gene, as described above. Thus, by using suppression of GST-π as an indicator, a cell death inducing agent and / or a cell growth suppression agent can be screened for a cell having a mutation in the BRAF gene. Namely, a substance capable of inhibiting GST-π may be a candidate substance for a cell death inducing agent and / or a cell growth inhibiting agent for a cell having a mutation in the BRAF gene (usually cancer cells).

For example, a test substance is contacted with a cancer cell having a mutation in the BRAF gene, as an example of a cancer cell, to measure the expression level of GST-π in the cell. When the expression level upon contact with the test substance decreases compared to the expression level measured in the absence of the test substance, the test substance can be selected as a candidate substance for a GST-π suppressant drug.

The test substance is not limited here and can be any substance. The test substance can be a single substance or a mixture of many constituent components. The test substance may contain a composition containing unidentified substances, such as an extract from a microorganism or culture fluid, or a composition containing known compositions in a predetermined ratio of components. In addition, the test substance can be any of proteins, nucleic acids, lipids, polysaccharides, organic compounds, and inorganic compounds.

Example

Hereinafter, the present invention is described in more detail with reference to examples, but the technical scope of the present invention is not limited thereto.

[Example 1]

In the present example, the effect of suppressing cell growth was studied when a GST-π suppressing drug was allowed to act on a cell having a mutation in the BRAF gene. First, type 1 colorectal cancer cell line (CACO-2) and 4 types of melanoma cell lines (A375, SK-MEL-28, A2058, Malme-3M ) were cultured at 37 ° C in an atmosphere containing 5% CO ₂ . The media used were MEM + 20%, FBS + 0.1 mM and NEAA for CACO-2, DMEM + 15% and FBS for A375, EMEM + 10% and FBS for SK-MEL-28, DMEM + 10% and FBS for A2058, and IMDM + 20% and FBS for Malme-3M, all of which had antibiotic added.

The day before transfection, each cell was plated into a 100 mm Petri dish using antibiotic-free medium so that 10-20% monolayer was achieved. 600 pmol GST-π siRNA (GGGAGGCAAGACCUUCAUUTT, siRNA ID # 2385, Ambion (SEQ ID NO: 3)) was added to 1 ml of Opti-MEM I Reduced Serum Medium (GIBCO) and mixed gently. Then 35 μl of Lipofectamine RNAi MAX reagent (Invitrogen) was diluted with 1 ml of Opti-MEM I Reduced Serum Medium (GIBCO) and gently mixed. The diluted GST-π siRNA and Lipofectamine RNAi MAX were carefully mixed and then incubated at room temperature for 10 min. In the meantime, the medium was replaced with 10 ml of Opti-MEM I Reduced Serum Medium. After 10 min incubation, the GST-π siRNA and Lipofectamine RNAi MAX complex was added to the cells and incubated at 37 ° C in an atmosphere containing 5% CO ₂ . After a 5-hour incubation, the medium was replaced with 10 ml of antibiotic-free medium. The medium was washed with PBS for 1 h after replacement, the cells were harvested using 0.25% trypsin-EDTA (SIGMA) and suspended in the medium containing the antibiotic. The cells were suspended in 5 ml of medium and plated in a 60 mm Petri dish (CACO-2: 0.4 × 10 ⁵ cells, A375: 1.0 × 10 ⁵ cells, SK-MEL-28: 0.2 × 10 ⁵ cells , A2058: 0.8 × 10 ⁵ cells, Malme-3M: 0.6 × 10 ⁵ cells).

The same operation was performed as control experiments using the Scramble siRNA reagent (CGAUUCGCUAGACCGGCUUCAUUGCAG, Hokkaido System Science Co., Ltd. (SEQ ID NO: 4)) or AllStars Negative Control siRNA (siControl) (QIAGEN). After transfection with GST-π siRNA, cell numbers were counted on Day 0 and Day 5, respectively.

Additionally, in the present example, expression of GST-π was confirmed by Western blotting, respectively, when GST-π siRNA was allowed to act on CACO-2 cells, A375 cells, SK-MEL-28 cells, A2058 cells, and Malme-3M cells. Namely, using cells harvested 3 days after transfection with GST-π siRNA, a Western blot analysis for GST-π knockdown was performed. The harvested cells were first washed with cold PBS, to which was added cold lysis buffer (1% NP-40, 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, supplemented with Mini EDTA-free reagent (Roche ) and "PhosSTOP" (Roche)), cooled on ice and incubated for 30 min to solubilize. Then, centrifugation was performed at 4 ° C, 15000 rpm for 15 minutes, thereby obtaining a cell extract. In the obtained cell extract, proteins were quantified using the Micro BCA Protein Assay Kit (Thermo SCIENTIFIC). Then 20 μg of the cell extract was denatured under the condition of recovery, and SDS-PAGE-electrophoresis was performed using MULTIGEL II mini 4/20 (13 W) (Cosmo Bio) for protein separation. After completion of SDS-PAGE electrophoresis, proteins were transcribed onto a PVDF membrane using a blotting device. The blotting membrane was incubated in PBS with 5% skimmed latex / 0.05% Tween 20 (abbreviated as PBS-T) at 4 ° C for 16 h to block. Then the membrane was reacted with anti-GST-π (MBL) diluted in Membrane blocking Solution (Invitrogen) at 4 ° C for 16 h. The secondary antibody was reacted at room temperature for 1 h using rabbit antibody labeled with horseradish peroxidase (HRP). The detection of the signal band was carried out on X-ray film by chemiluminescence using ECL Western Blocking Detection Reagents (GE Healthcare). Washing between each of the operations was carried out by shaking for 5 minutes, 4 times, using PBS-T.

The results on a colorectal cancer cell line are shown in FIG. 1 and the results on a melanoma cell line are shown in FIG. 2. It should be noted that in FIG. 1 and 2 show the results of cell counts and the results of Western blot analysis. As shown in FIG. 1 and 2, in both the colorectal cancer cell line and the melanoma cell line, the ability to grow cells was markedly suppressed due to the knockdown of GST-π GST-π siRNA, which is a GST-π suppressor drug, in cancer cells having mutation in the BRAF gene. A mutation in the BRAF gene has been found in highly malignant tumors and, as is known, in colorectal cancers, as a factor of poor prognosis in unchanged colorectal cancers. Half of melanoma patients have mutations in the BRAF gene, and when the metastatic potential is high, mortality and malignancy are highest. The results of this example show that a GST-π suppressing drug is effective in suppressing the cell growth of cancer cells having a mutation in the BRAF gene, raising expectations for a new therapy for these intractable cancers.

[Example 2]

In the present example, the effect of suppressing cell growth was studied when a GST-π suppressing drug and a BRAF inhibitor were allowed to act on a cell having a mutation in the BRAF gene.

First, type 1 colorectal cancer cell line (CACO-2) and type 2 melanoma cell lines (SK-MEL-28 and A2058), respectively, were cultured in the same manner as in Example 1, and the day before transfection, were plated into a 100 mm Petri dish using antibiotic-free media so that 10-20% monolayer is achieved. 600 pmol GST-π siRNA (GGGAGGCAAGACCUUCAUUTT, siRNA ID # 2385, Ambion (SEQ ID NO: 3)) was added to 1 ml of Opti-MEM I Reduced Serum Medium (GIBCO) and mixed gently. Then 35 μl of Lipofectamine RNAi MAX reagent (Invitrogen) was diluted with 1 ml of Opti-MEM I Reduced Serum Medium (GIBCO) and gently mixed. The diluted GST-π siRNA and Lipofectamine RNAi MAX were carefully mixed and then incubated at room temperature for 10 min. In the meantime, the medium was replaced with 10 ml of Opti-MEM I Reduced Serum Medium. After 10 min incubation, the GST-π siRNA and Lipofectamine RNAi MAX complex was added to the cells and incubated at 37 ° C in an atmosphere containing 5% CO ₂ . After a 5-hour incubation, the medium was replaced with 10 ml of antibiotic-free medium. The medium was washed with PBS for 1 h after replacement, the cells were harvested using 0.25% trypsin-EDTA (SIGMA) and suspended in the medium containing the antibiotic. The cells were suspended in 5 ml of medium and plated in a 60 mm Petri dish (CACO-2: 0.4 x 10 ⁵ cells, SK-MEL-28: 0.2 x 10 ⁵ cells and A2058: 0.8 x 10 ⁵ cells ). The same operation was performed as a control experiment using the "AllStars Negative Control siRNA" (siControl) (QIAGEN). On Day 1 after transfection, PLX4720 (Selleck), a BRAF inhibitor, was added to the medium to reach a concentration of 40 μM for CACO-2, 0.7 μM for SK-MEL-28, and 10 μM for A2058, and culture continued until Day 5. Control treated with PLX4720 was cultured by adding DMSO solvent (Wako Pure Chemical Industries, Ltd.). Growth analysis was performed by counting the number of cells from Day 0 to Day 5 after transfection.

FIG. 3 shows the result of counting the number of CACO-2 cells, FIG. 4 shows the results of cell counts for SK-MEL-28 and A2058. As seen in FIG. 3, it has been suggested that, compared with the case where GST-π siRNA is allowed to act on its own on a colorectal cancer cell line (line CACO-2 with a mutation in the BRAF gene), or when PLX4720 is allowed to act on a cell line colorectal cancer together with siControl, the cell growth inhibitory effect was significant when GST-π siRNA and PLX4720 were allowed to act in combination on such a cell line. In addition, as shown in FIG. 4, it has been suggested that, compared with the case where GST-π siRNA is allowed to act independently on melanoma cell lines (SK-MEL-28 and A2058, which have a mutation in the BRAF gene) or the case where PLX4720 is allowed to act on cell melanoma lines together with siControl, the cell growth inhibitory effect was significant when GST-π siRNA and PLX4720 were allowed to act in combination on such melanoma cell lines.

[Example 3]

In the present example, the effect of suppressing cell growth was studied when a GST-π suppressing drug was allowed to act on a cell having a mutation in the BRAF gene and resistance to a BRAF inhibitor (a cell resistant to a BRAF inhibitor).

<Counting the number of cells>

The BRAF inhibitor resistant cells used in the present example were prepared as follows. The A375 melanoma cell line used in Example 1 was incubated in antibiotic-containing DMEM to which 1-5 μM PLX4720 (Selleck) and 15% FBS were added at 37 ° C in an atmosphere containing 5% CO ₂ for 1 month. The cell line that survived after 1 month of incubation was defined as PLX4720 resistant A375 cells and was used in the present example.

In the present example, the day before transfection, PLX4720-resistant A375 cells were plated into a 100 mm Petri dish using antibiotic-free DMEM containing 15% FBS so that a concentration of 0.5 x 10 ⁶ cells / 10 ml was achieved. 600 pmol GST-π siRNA (GGGAGGCAAGACCUUCAUUTT, siRNA ID # 2385, Ambion (SEQ ID NO: 3)) was added to 1 ml of Opti-MEM I Reduced Serum Medium (GIBCO) and mixed gently. Then 35 μl of Lipofectamine RNAi MAX reagent (Invitrogen) was diluted with 1 ml of Opti-MEM I Reduced Serum Medium (GIBCO) and gently mixed. The diluted GST-π siRNA and Lipofectamine RNAi MAX were carefully mixed and then incubated at room temperature for 10 min. In the meantime, the medium was replaced with 10 ml of Opti-MEM I Reduced Serum Medium. After 10 min incubation, the GST-π siRNA and Lipofectamine RNAi MAX complex was added to the cells and incubated at 37 ° C in an atmosphere containing 5% CO ₂ . After a 5 hour incubation, the medium was replaced with 10 ml of antibiotic-free DMEM medium containing 15% FBS. The medium was washed with PBS 2 h after replacement, the cells were harvested using 0.25% trypsin-EDTA (SIGMA) and suspended in DMEM medium containing the antibiotic and 15% FBS. The cells in suspension were plated in a 60 mm Petri dish, so that a concentration of 1.0 × 10 ⁵ cells / 5 ml was achieved. The same operation was performed as a control experiment using a "Scramble siRNA" reagent (CGAUUCGCUAGACCGGCUUCAUUGCAG, Hokkaido System Science Co., Ltd. (SEQ ID NO: 4)) or "AllStars Negative Control siRNA" (QIAGEN). After transfection with GST-π siRNA, cell numbers were counted on Day 0, 1, 2, 3, 4 and 5, respectively.

<Confirmation of GST-π expression>

Expression of GST-π was confirmed by Western blotting when GST-π siRNA was allowed to target PLX4720 resistant A375 cells as described above. Namely, using cells harvested at each of the above-mentioned periods after transfection with GST-π siRNA, a Western blot analysis for GST-π knockdown was performed.

The harvested cells were first washed with cold PBS, to which was added cold lysis buffer (1% NP-40, 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, supplemented with Mini EDTA-free reagent (Roche ) and "PhosSTOP" (Roche)), cooled on ice and incubated for 30 min to solubilize. Centrifugation was carried out at 4 ° C, 15000 rpm for 15 minutes, thus obtaining a cell extract. In the obtained cell extract, proteins were quantified using the Micro BCA Protein Assay Kit (Thermo SCIENTIFIC). Then 20 μg of the cell extract was denatured under the condition of reduction and SDS-PAGE-electrophoresis was performed using MULTIGEL II mini 4/20 (13 W) (Cosmo Bio) for protein separation. After completion of SDS-PAGE electrophoresis, proteins were transcribed onto a PVDF membrane using a blotting device. The blotting membrane was incubated in PBS with 5% skimmed latex / 0.05% Tween 20 (abbreviated as PBS-T) at 4 ° C for 16 h to block. Then the membrane was reacted with anti-GST-π (MBL) diluted in Membrane blocking Solution (Invitrogen) at 4 ° C for 16 h. The secondary antibody was reacted at room temperature for 1 h using rabbit antibody labeled with horseradish peroxidase (HRP). The signal band was detected on X-ray film by chemiluminescence using ECL Western Blocking Detection Reagents (GE Healthcare). Washing between each of the operations was carried out by shaking for 5 minutes, 4 times, using PBS-T.

<Result>

In recent years, a melanoma cell line with acquired resistance to a BRAF inhibitor has been understood to be associated with melanoma recurrence. Accordingly, GST-π was knocked out using PLX4720-resistant A375 to investigate whether GST-π contributes to CRAF dependence in BRAF inhibitor-resistant melanoma. Measurement of cell growth of cells revealed a marked growth inhibitory effect (Fig. 5). When GST-π knockdown was confirmed, GST-π expression was suppressed on Day 2 and Day 3 (Fig. 6).

This example shows that the growth of cells having a mutation in the BRAF gene and resistance to a BRAF inhibitor (a cell resistant to a BRAF inhibitor) was effectively suppressed. According to the results, an effect can be expected to prevent or reduce diseases in which a BRAF-resistant cell is a factor, such as recurrence of melanoma.

All publications, patents, and patent applications cited herein are to be incorporated by themselves into this description by reference.

Claims (16)

1. A method of inducing cell death of a cell having a mutation in the BRAF gene, comprising the step of administering a drug that suppresses the production of GST-π, where the cell having a mutation in the BRAF gene is a cell resistant to a BRAF inhibitor, and where the drug is a substance selected from the group consisting of RNA interference molecules, ribozymes, antisense nucleic acids, DNA / RNA chimeric polynucleotides to DNA encoding GST-π, and vectors expressing at least one of them. 2. A method of inhibiting cell growth of a cell having a mutation in the BRAF gene, comprising the step of administering a drug that suppresses GST-π, where the cell having a mutation in the BRAF gene is a BRAF inhibitor-resistant cell, and where the drug is a substance selected from the group consisting of RNA interference molecules, ribozymes, antisense nucleic acids, DNA / RNA chimeric polynucleotides to DNA encoding GST-π, and vectors expressing at least one of them. 3. The method of claim 1 or 2, wherein the mutation is a V600E mutation. 4. The method according to claim 1 or 2, wherein the cell having the mutation in the BRAF gene is a cancer cell highly expressing GST-π. 5. The use of a drug that suppresses the production of GST-π for the treatment of cancer caused by a growth defect of a cell having a mutation in the BRAF gene, where the cell having the mutation in the BRAF gene is a BRAF inhibitor resistant cell, and where the drug is is a substance selected from the group consisting of RNA interference molecules, ribozymes, antisense nucleic acids, DNA / RNA chimeric polynucleotides to DNA encoding GST-π, and vectors expressing at least one of them. 6. Use according to claim 5, wherein the cancer is a cancer highly expressing GST-π. 7. Use according to claim 5, wherein the cancer is colorectal cancer or melanoma. 8. A method for screening a drug for inducing cell death of a cell having a mutation in the BRAF gene, comprising the stage of contacting the test substance with a cancer cell that has a mutation in the BRAF gene and is resistant to a BRAF inhibitor, the step of measuring the expression level of GST-π production in the cell, and a step of selecting a test substance as a drug that suppresses the production of GST-π, when the expression level is reduced compared to the case measured in the absence of the test substance, where the drug is a substance selected from the group consisting of RNA interference molecules, ribozymes, antisense nucleic acids, DNA / RNA chimeric polynucleotides to DNA encoding GST-π, and vectors expressing at least one of them. 9. A method for screening a drug for suppressing cell growth of a cell having a mutation in the BRAF gene, comprising the stage of contacting the test substance with a cancer cell that has a mutation in the BRAF gene and is resistant to a BRAF inhibitor, the step of measuring the expression level of GST-π production in the cell, and a step of selecting a test substance as a drug that suppresses the production of GST-π, when the expression level is reduced compared to the case measured in the absence of the test substance, and where the drug is a substance selected from the group consisting of RNA interference molecules, ribozymes , antisense nucleic acids, DNA / RNA chimeric polynucleotides to DNA encoding GST-π, and vectors expressing at least one of them. 10. The use of a drug that suppresses the production of GST-π, and a BRAF inhibitor, where the drug is a substance selected from the group consisting of RNA interference molecules, ribozymes, antisense nucleic acids, DNA / RNA chimeric polynucleotides to DNA encoding GST-π, and vectors expressing at least one of them, for the treatment of cancer caused by a defect in the growth of a cell having a mutation in the BRAF gene.

Images