WO2015178770A1 - Compositions for cancer treatment - Google Patents

Compositions for cancer treatment Download PDF

Info

Publication number
WO2015178770A1
WO2015178770A1 PCT/NL2015/050360 NL2015050360W WO2015178770A1 WO 2015178770 A1 WO2015178770 A1 WO 2015178770A1 NL 2015050360 W NL2015050360 W NL 2015050360W WO 2015178770 A1 WO2015178770 A1 WO 2015178770A1
Authority
WO
WIPO (PCT)
Prior art keywords
inhibitor
cancer
raf
braf
protein
Prior art date
Application number
PCT/NL2015/050360
Other languages
French (fr)
Inventor
Rene Bernards
Sake VAN WAGENINGEN
Gustaaf Josephus Johannes Eugene HEYNEN
Anirudh Cadapa PRAHALLAD
Rodney Rothstein
Original Assignee
Stichting Het Nederlands Kanker Instituut
The Trustees Of Columbia University In The City Of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to NL2012840 priority Critical
Priority to NL2012840 priority
Application filed by Stichting Het Nederlands Kanker Instituut, The Trustees Of Columbia University In The City Of New York filed Critical Stichting Het Nederlands Kanker Instituut
Publication of WO2015178770A1 publication Critical patent/WO2015178770A1/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Abstract

The current disclosure relates to the use of pharmaceuticals and pharmaceutical combinations and compositions useful in the treatment of certain types of cancer. The disclosure also relates to methods for treatment of these types of cancer. In particular, the disclosure relates to the inhibition of ERN1 alone and in combination with an inhibitor of a protein of the RAF-MAPK-ERKpathway in the treatment of a KRAS-mutated, BRAF-mutated or NRAS-mutated cancer.

Description

Compositions for cancer treatment Field of the Invention

[001] The current disclosure relates to the use of pharmaceuticals and

pharmaceutical combinations and compositions useful in the treatment of certain types of cancer. The disclosure also relates to methods for treatment of these types of cancer. In particular, the disclosure relates to the inhibition of ERN1 alone and in combination with an inhibitor of a protein of the RAF-MAPK-ERK pathway in the treatment of a KRAS-mutated, BRAF-mutated or NRAS-mutated cancer.

Prior Art

[002] Cancer is one of the leading causes of death in the Europe and the United States. Despite recent advances in understanding mechanisms involved in cancer and in diagnosis and treatment, drug therapies for metastatic disease are often palliative in nature. Drug therapies seldom offer a long-term cure. There is a constant need for new methods of treatment, either in the form of monotherapy or in the form of combination treatment, combining different new or known drugs, for example as first line therapy.

[003] Cancer cells are by definition heterogeneous. For example, multiple mutational mechanisms may lead to the development of cancer and mutational mechanisms associated with some cancers may differ between one tissue type and another; it is therefore often difficult to predict whether a specific cancer will respond to a specific chemotherapeutic (Cancer Medicine, 5th edition, Bast et al , B. C. Decker Inc., Hamilton, Ontario).

[004] The treatment of cancer is gradually changing from an organ-centered to a pathway-centered approach. Cancer cells often have an addiction to the signals that are generated by the cancer-causing genes. Consequently, targeted cancer drugs that selectively inhibit the products of activated oncogenes can have dramatic effects on cancer cell viability. This approach has yielded significant clinical results for Non Small

Cell Lung Cancer (NSCLC) having activating mutations in EGFR or translocations of the ALK kinase and for melanoma patients having a BRAF mutant tumor. However, this approach has not been successful in all type of cancers, in particular in cancers characterized by oncogenic mutations in one of the members of the RAS gene family (NRAS and KRAS mutated cancers), or in BRAF (BRAF mutated cancers). This limits treatment options for these types of cancers. [005] As an example, melanoma is a malignant tumor of melanocytes. It is one of the rarest forms of skin cancer but accounts for the majority of skin cancer deaths. Despite many years of intensive research, the only effective treatment is surgical resection of the primary tumor before it reaches a thickness of more than 1 mm. According to a WHO report, there are approximately 48,000 melanoma deaths each year, and about 160,000 new cases of melanoma are diagnosed yearly. It occurs more frequent in women than in men and is particularly common among Caucasians living in sunny climates, with high rates of incidence in Australia, New Zealand, North America, Latin America, and northern Europe.

[006] Treatment of melanoma typically includes surgical removal of the melanoma, adjuvant treatment, chemo- and immunotherapy, and/or radiation therapy. The chance of a cure is greatest when the melanoma is discovered while it is still small and thin, and can be removed entirely.

[007] Approximately 40-60% of (cutaneous) melanomas carry a mutation in the protein kinase referred to as BRAF. Approximately 90% of these mutations result in the substitution of glutamic acid for valine at codon 600 (BRAF V600E) although other mutations are also known (e.g. BRAF V600K and BRAF V600R). Such mutations in BRAF typically leads to proliferation and survival of melanoma cells (Davies et al Nature 2002; 417:949-54; Curtin et al N Engl J Med 2005;353:2135-47) through activation of the RAF-MAPK-ERK pathway. This pathway plays a significant role in modulating cellular responses to extracellular stimuli, particularly in response to growth factors, and the pathway controls cellular events including cell proliferation, cell-cycle arrest, terminal differentiation and apoptosis (Peyssonnaux et al., Biol Cell. 93(l-2):53-62 (2001)).

[008] The discovery of the common BRAFV600E mutation in melanoma has resulted in the development of targeted therapies, which are associated with unprecedented clinical benefits. The small molecule inhibitor vemurafinib, specifically targeting the mutant BRAF kinase, for example, had become standard of care for patients diagnosed with mutant BRAF metastatic melanoma. Although this compound initially reduces tumor burden dramatically, eventually melanomas become resistant and patients progress in the disease (Wagle et al. J Clin Oncol. 29(22) :3085-96 (201 1)).

[009] At the same time approximately 15% of BRAF mutant melanoma patients fail to respond to BRAF inhibition in the first place, owing to intrinsic resistance. BRAF- mutations are also found in other types of cancer.

[010] Another example are NRAS mutations or NRAS mutated cancers. Among the first oncogenes discovered in cutaneous melanoma was NRAS, which is mutant in up Despite, being a highly relevant therapeutic target, design of small molecules selectively inhibiting mutant NRAS to date, remains an unresolved challenge. The majority of NRAS mutations are found in codon 61 impairing the enzymatic activity of RAS to cleave GTP to GDP. Other, less frequent mutations are found in codon 12 and 13 preventing the association of GAPase activating proteins (GAP), which accelerate the weak hydrolytic potential of RAS. As a result, NRAS remains in its active, GTP-bound state driving cell proliferation, survival and motility making NRAS an important therapeutic target (Posch, Oncotarget ( 2013) 4(4):494-5). NRAS mutation are found in cancers in tissues including melanoma, lung cancers, hepatocellular carcinoma, myeloid leukemias, and thyroid carcinoma.

[011] The third example are KRAS-mutated cancers. A comprehensive overview of RAS mutations, including KRAS-mutations, in cancer was reported by Prior et al (2012) Cancer Res; 2457 - 67. KRAS-mutant cells promote oncogenesis due to being mutationally activated, in most cases, at codon 12, 13 and 61. In total forty-four separate point mutations have been characterized in RAS isoforms, with 99.2% in codons 12, 13 and 61. The protein product of the normal KRAS gene performs an essential function in normal tissue signaling, and the mutation of a KRAS gene is an essential step in the development of many cancers. KRAS acts as a molecular on/off switch. Once it is turned on, for example as a consequence of the acquired mutations, it recruits and activates proteins necessary for the propagation of growth factor and other receptors' signal, such as c-Raff and PI 3-kinase.

[012] There is therefore constant need for better understanding of the mechanisms that control and drive the development of cancer, of mechanisms that that need to be targeted for successful treatment and/or for treatments directed thereto. It is therefore goal of the current invention to provide for new and improved methods of treatment of cancers, in particular KRAS, BRAF and NRAS-mutated cancers, as well as to provide for products and therapeutically pharmaceutical combinations for use in such (mutant) cancers.

Description

Description of the Drawings

[013] Figure 1 : Selection of siRNAs. BJET fibroblasts were transfected with

individual siRNAs against ERN1. A) ERN1 mRNA was measured using qPCR 24 hours after transfection. B) To test which siRNA increased the sensitivity to an ER stress agent we treated cells 24 hours after transfection with 1.5 mM 2- Mercaptoethanol. Confluency was determined 4 days later using an IncuCyte Zoom.

[014] Figure 2: KRAS mutant colon cancer cells are sensitive to combined ERN1 and MEK inhibition. LoVo, SKCO and SW480 cells were grown in a 384 well format in an IncuCyte Zoom. Growth curves were made by determining confluency every 4 hours for one week. 1500 cells were plated in each well in triplicate. Cells were transfected with RNAiMAX using reverse transfection. Drug was added 24 hours after transfection. /pet

[015] Figure 3: BRAF mutant melanoma cancer cells are sensitive to combined

ERN1 and BRAF or MEK inhibition. Mel888 and A375 cells were grown in a 384 well format in an IncuCyte Zoom. Growth curves were made by determining confluency every 4 hours for one week. 1500 cells were plated in each well in triplicate. Cells were transfected with RNAiMAX using reverse transfection. Drug was added 24 hours after transfection.

[016] Figure 4: BRAF and/or KRAS wild type cancer cells are insensitive to

combined ERN1 and BRAF or MEK inhibition. LoVo and CAC02 cells were grown in a 384 well format in an IncuCyte Zoom. Growth curves were made by determining confluency every 4 hours for one week. 1500 cells were plated in each well in triplicate. Cells were transfected with RNAiMAX using reverse transfection. Drug was added 24 hours after transfection.

[017] Figure 5: KRAS and BRAF mutant cancer cells are sensitive to combined ERN1 and MEK inhibition. WiDr, H358, PANC1 and PANC10.05 cells were grown in a 384 well format in an IncuCyte Zoom. Growth curves were made by determining confluency every 4 hours for one week. 1500 cells were plated in each well in triplicate. Cells were transfected with RNAiMAX using reverse transfection. Drug was added 24 hours after transfection.

[018] Figure 6 KRAS and BRAF mutant Cancer Cells are sensitive to combined ERN1 and MEK inhibition. Growth curves were made from MEL888 cells treated with ERN1 inhibitors (4μ80 or STF083010) and/or PLX4032. Long-term growth assays were performed with MEL888, A375 and WiDr cells by plating 10.000 cells in a 6 well plate format. After 12 days cells were fixed and stained using with 50% Methanol / 10% Acetic acid / 0.1 % Commassie Blue.

[019] Figure 7 ERN1 loss is synthetic lethal with MEK inhibition in KRAS mutant LOVO colon cancer cells. (A) ERN1 and HSP90 (loading control) were detected in

LOVO cell lysates by western blot. (B) XBP1s levels were measured by qPCR. (C) Proliferation assays were performed using the isogenic ERN1 KO and control cells. 10K cells were seeded in a 6 well plate format. MEK inhibitor (AZD6244) was added 24 hours after plating the cells and refreshed every three days. The cells were fixed and stained 18 days after plating.

[020] Figure 8 ERN1 loss is synthetic lethal with MEK inhibition in KRAS mutant SW480 colon cancer cells. (A) ERN1 and HSP90 (loading control) were detected in LOVO cell lysates by western blot. (B) XBP1s levels were measured by qPCR. (C) Proliferation assays were performed using the isogenic ERN1 KO and control cells. 10K cells were seeded in a 6 well plate format. MEK inhibitor (AZD6244) was added 24 hours after plating the cells and refreshed every three days. The cells were fixed and stained 18 days after plating.

Definitions

[021] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. For example, conventional molecular biology, microbiology, pharmaceutical and recombinant DNA techniques are well known among those skilled in the art. Such techniques are explained fully in the literature.

[022] For purposes of the present invention, the following terms are defined below.

[023] As used herein, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, a method for

administrating a drug includes the administrating of a plurality of molecules (e.g. 10's, 100's, 1000's, 10's of thousands, 100's of thousands, millions, or more molecules).

[024] As used herein, the term "and/or" indicates that one or more of the stated

cases may occur, alone or in combination with at least one of the stated cases, up to with all of the stated cases.

[025] As used herein, the term "at least" a particular value means that particular value or more. For example, "at least 2" is understood to be the same as "2 or more" i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, ... .

[026] As used herein "cancer" and "cancerous" refers to or describes the

physiological condition in mammals that is typically characterized by unregulated cell growth. The terms "cancer," "neoplasm," and "tumor," are used interchangeably and refer to cells that have undergone a malignant transformation that makes them pathological to the host organism. Primary cancer cells can be distinguished from noncancerous cells by techniques known to the skilled person. A cancer cell, as used herein, includes not only primary cancer cells, but also cancer cells derived from such primary cancer cell, including metastasized cancer cells, and cell lines derived from cancer cells. Examples include solid tumors and non-solid tumors or blood tumors. Examples of cancers include, without limitation, leukemia, lymphoma .sarcomas and carcinomas (e.g. colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, lung cancer, melanoma, lymphoma, non-Hodgkin lymphoma, colon cancer, (malignant) melanoma, thyroid cancer, papillary thyroid carcinoma, lung cancer, non-small cell lung carcinoma, and adenocarcinoma of lung.

[027] As is well known, tumors may metastasize from a first locus to one or more other body tissues or sites. Reference to treatment for a "neoplasm, "tumors" or "cancer" in a patient includes treatment of the primary cancer, and, where appropriate, treatment of metastases.

[028] As used herein, "in combination with" is intended to refer to all forms of

administration that provide a first drug together with a further (second, third) drug. The drugs may be administered simultaneous, separate or sequential and in any order. Drugs administered in combination have biological activity in the subject to which the drugs are delivered. Within the context of the invention, a combination thus comprises at least two different drugs, and wherein one drug is at least an inhibitor of a protein of the RAF-MAPK-ERK pathway and wherein the other drug is at least an inhibitor of ERN1 , as disclosed herein in detail. In an embodiment, in the combination, the inhibitor of a protein of the RAF-MAPK-ERK pathway is a selective inhibitor, and, within the context of the current invention, does preferably not, or to a lesser extent inhibit ERN1 (e.g. requires 2-fold, 5-fold or more to obtain the same level of inhibition). In an embodiment, in the combination, the inhibitor of ERN1 is a selective inhibitor, and, within the context of the current invention, does preferably not, or to a lesser extent inhibits a protein of the RAF-MAPK-ERK pathway (e.g. requires 2-fold, 5-fold or more to obtain the same level of inhibition). In a further embodiment, in the

combination, both the inhibitor of a protein of the RAF-MAPK-ERK pathway and the inhibitor of ERN1 are selective inhibitors.

[029] A used herein "compositions", "products" or "combinations" useful in the

methods of the present disclosure include those suitable for various routes of administration, including, but not limited to, intravenous, subcutaneous, intradermal, subdermal, intranodal, intratumoral, intramuscular, intraperitoneal, oral, nasal, topical (including buccal and sublingual), rectal, vaginal, aerosol and/or parenteral or mucosal application. The compositions, formulations, and products according to the disclosure invention normally comprise the drugs/compound/inhibitor (alone or in combination) and one or more suitable pharmaceutically acceptable excipients or carriers.

[030] As used herein, "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. It also encompasses the more limiting "to consist of"."

[031] Within the context of the current disclosure, for the combination of the at least one inhibitor of a protein of the RAF-MAPK-ERK pathway and the at least one inhibitor of ERN1 , these are administrated in an effective amount. As used herein, with "an effective amount" is meant the amount of the combination (or in some embodiments, the single compound) required to ameliorate the symptoms of a disease relative to an untreated patient. The effective amount of active agent(s) used to practice the present disclosure for therapeutic treatment of a cancer varies depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician will decide the appropriate amounts and dosage regimen. Such amount is referred to as an "effective" amount. Thus, in connection with the

administration of a drug combination which, in the context of the current disclosure, is "effective against" a disease or condition indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as an improvement of symptoms, a cure, a reduction in at least one disease sign or symptom, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the particular type of disease or condition.

] As used herein, in general the term "inhibitor" of a (defined) protein or enzyme, for example ERK, refers to any compound capable of down-regulating, decreasing, suppressing or otherwise regulating the amount and/or activity of the (defined) protein, for example ERK, for example, to a level of 50%, 30%, 20% or 10% or less compared to the control (without the presence of such inhibitor). Inhibitors may include, but are not limited to small molecules (chemical compound having a molecular weight below 2,500 daltons, more preferably between 300 and 1 ,500 daltons, and still more preferably between 400 and 1000 daltons), antibodies directed to the particular protein or enzyme, compounds that down-regulate gene expression, translation and/or transcription, including such RNA molecules capable of RNA interference including, without limitation, siRNA, shRNA, and miRNA. The inhibitors to be used in accordance with the present invention may be selective inhibitors of said (defined) protein, as already described above; the term "selective" or "selectivity" expresses the biologic fact that at a given compound concentration enzymes (or proteins) are affected to different degrees. In the case of proteins selective inhibition can be defined as preferred inhibition by a compound at a given concentration. In other words, an enzyme is selectively inhibited over another enzyme when there is a concentration which results in inhibition of the first enzyme whereas the second enzyme is not affected. To compare compound effects on different enzymes it is important to employ similar assay formats. For the proteins/enzymes as disclosed herein, such assay formats are readily available in the prior art. Thus, within the context of the current invention the different drugs used in the combination may be drugs that selectively inhibit one of the proteins to be inhibited according to the invention in comparison to the other protein(s), for example when used in a clinical setting.

[033] "Patient", as used herein, refers to human subjects, but also includes non- human primates, and laboratory animals including rodents such as mice, rats and guinea pigs, and the like. The term does not denote a particular age or sex. Thus, adult and newborn subjects, whether male or female, are intended to be included within the scope of this term. Preferably the patient is human.

[034] "Pharmaceutically acceptable" is employed herein to refer to those

combinations of the therapeutic combinations as described herein, and other drugs or therapeutics, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals, without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

[035] The terms "protein" or "polypeptide" are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3 dimensional structure or origin. A "fragment" or "portion" of a protein may thus still be referred to as a "protein".

[036] As used herein "simultaneous" administration refers to administration of more than one drug at the same time, but not necessarily via the same route of

administration or in the form of one combined formulation. For example, one drug may be provided orally whereas the other drug may be provided intravenously during a patients visit to a hospital. "Separate" administration includes the administration of the drugs in separate form and/or at separate moments in time, but again, not necessarily via the same route of administration. "Sequentially" of "sequential administration" indicates that the administration of a first drug if followed, immediately or in time, by the administration of the second drug, but again, not necessarily via the same route of administration.

[037] As used herein, the terms "treat," treating", "treatment," and the like refer to reducing or ameliorating a disorder and/or symptoms associated therewith. It will be appreciated that treating a disorder or condition does not require that the disorder, condition or symptoms associated therewith be completely eliminated.

[038] The term "wild type" as is understood in the art refers to a polypeptide or

polynucleotide sequence that occurs in a native population without genetic

modification. As is also understood in the art, a "mutant" includes a polypeptide or polynucleotide sequence having at least one modification to an amino acid or nucleic acid compared to the corresponding amino acid or nucleic acid found in a wild type polypeptide or polynucleotide, respectively. Cancers that are either wild type or mutant for NRAS, KRAS or BRAF are identified by known methods. For example, wild type or mutant NRAS/BRAF/KRAS cancer cells can be identified by DNA amplification and sequencing techniques, DNA and RNA detection techniques, including, but not limited to Northern and Southern blot, respectively, and/or various biochip and array technologies. Wild type and mutant polypeptides can be detected by a variety of techniques including, but not limited to immunodiagnostic techniques such as ELISA, or Western blot. NRAS mutated cancers, KRAS mutated cancers and BRAF mutated cancers are in general mutationally activated, but may also involve gene amplification of NRAS, KRAS or BRAF.

[039] All patents and publications mentioned in the specification are indicative of the level of those skilled in the art to which the invention pertains. All patents and publications are herein incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[040] Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims. Moreover, the scope of the present application is not intended to be limited to the particular embodiments of the process, machine, manufacture, composition of matter, means, methods and steps described in the specification. As one of ordinary skill in the art will readily appreciate from the disclosure of the present invention, processes, machines, manufacture, compositions of matter, means, methods, or steps, presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention. Accordingly, the appended claims are intended to include within their scope such processes, machines, manufacture, compositions of matter, means, methods, or steps

Detailed description

[041] The current disclosure is based on the surprising finding that an inhibitor of ERN1 may suitable be used in the treatment of a subset of cancer in a mammalian, preferably human, more in particular in patients in which the cancer is selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer, for example, but not limited to NRAS-, KRAS- and BRAF-mutated melanoma, colon cancer, lung cancer or pancreas cancer.

[042] The current disclosure is also based on the surprising finding that a

combination of an inhibitor of the protein (enzyme) ERN1 and at least one inhibitor of a protein of the RAF-MAPK-ERK pathway is co-operative and/or synergistic, i.e.

produces an effect greater than the effect of the individual drugs, or even greater than the sum of the their individual effects, in inhibiting proliferation of or inducing apoptosis in a cancer in a mammal, preferably a human, wherein the cancer is selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer, for example, but not limited to NRAS-, KRAS- and BRAF-mutated melanoma, colon cancer, lung cancer or pancreas cancer.

[043] The inhibitors used in accordance with the current disclosure, for example in the combination may, preferably, be selective inhibitors, or a selective inhibitor.

[044] In addition, the disclosed combination may work particularly well in those cells that are relatively insensitive to inhibition by inhibitors of a protein of the RAF-MAPK- ERK pathway alone (e.g. a RAF-inhibitor alone, an ERK-inhibitor alone, or a MEK- inhibitor alone), either at the beginning of treatment (often called intrinsic resistance), or it may become resistant during treatment (often called acquired resistance ,also called refractory cancer).

[045] However, the disclosed combination works well in those cells that are sensitive to inhibitors of a protein of the RAF-MAPK-ERK pathway alone, as shown in the Examples, but even more sensitive for the combinations disclosed herein.

[046] The inventors of the present invention have demonstrated, via experiments, that inhibition of ERN1 by an ERN1 -inhibitor is useful in the treatment of cancers selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer.

[047] The inventors of the present invention have also demonstrated, via

experiments, the combination of a ERN1 -inhibitor and at least one inhibitor of a protein of the RAF-MAPK-ERK pathway, for example a MEK-inhibitor, a ERK-inhibitor, or a RAF-inhibitor manifests an unexpected and strong co-operative and/or synergistic, therapeutic effect on the treatment of NRAS-, KRAS- and BRAF-mutated cancer. In other words, it was found that lowering the activity of ERN1 , or lowering the activity of ERN1 and of at least one protein of the RAF-MAPK-ERK pathway in a cancer that is NRAS-, KRAS, and/or BRAF-mutated is beneficial in the treatment of such cancer. It will be understood by the skilled person that different means or combinations of means to lower the activity of ERN1 and/or of a protein of the RAF- MAPK-ERK pathway may be used as long as the activity of ERN1 and/or of a protein of the RAF-MAPK-ERK pathway is lowered to such extent that it lead to effective treatment of the NRAS-, KRAS- or BRAF-mutated cancer in the patient.

[048] The invention thus provides for possibility of improved treatment strategies by, for example, employing the combination at least two different drugs or compounds, directed to inhibiting the activity of combination of proteins/enzymes as disclosed herein in a NRAS-, KRAS- or BRAF-mutated cancer cells. This thus allows to optimize the drug treatment by inhibiting the combination of proteins/enzymes in the most effective way, for example by applying selective inhibitors for the different targets disclosed herein. For example, by the combination, the dose of each of the drugs in the combination may be optimized in order to achieve optimal treatment effect. For example the individual dose of a first individual drug in the combination may be optimized to achieve optimal inhibition of a first protein, and a second, third or further drug in the combination may be optimized to achieve optimal inhibition of the other protein/enzyme to be inhibited, and as detailed herein.

[049] In addition, the invention allows for the treatment with various and different combinations of inhibitors of the proteins/enzymes to be inhibited, as detailed herein. This is very useful in case, for example, for an individual patient, certain drugs or drug combinations are not well tolerated or lead to undesired further complications. The current invention may allow for the replacement of a drug in such combination, or of the combination by another drug combination, in accordance with the invention and in order to overcome undesired effects or, again to optimize treatment of the patient. In addition, when using the combination, the dose of the individual drugs may be lowered compared to when the drugs are used individually, which may be beneficial in view of toxicity.

[050] The combination disclosed herein exhibits (therapeutic) co-operation and/or synergy when used to treat a subject or patient. Such effect may be demonstrated by the showing that the combination is superior to one or other of the constituents used as at a given, for example, optimum dose.

[051] According to the disclosure there is provided for an inhibitor of ERN1 for use in the treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer.

[052] Preferably there is provided for a combination of an inhibitor of ERN1 and an inhibitor of a protein of the RAF-MAPK-ERK pathway for use as a medicament, preferably for use in the treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer.

[053] The combination therapy disclosed herein is particular suitable for use in

patients that carry mutations in the genes encoding a RAS protein and/or BRAF protein, leading to proteins with aberrant function.

[054] The term "RAS protein" as used herein means any protein which is a member of the ras-subfamily, a subfamily of GTPases involved in cellular signaling. As is known in the art, activation of RAS causes cell growth, differentiation and survival. RAS proteins include, but are not limited to, HRAS, KRAS and NRAS. The proteins differ significantly only in the C-terminal 40 amino acids.

[055] These proteins are GTPases that function as molecular switches regulating pathways responsible for proliferation and cell survival. RAS proteins are normally tightly regulated by guanine nucleotide exchange factors (GEFs) promoting GDP dissociation and GTP binding and GTPase-activating proteins (GAPs) that stimulate the intrinsic GTPase activity of RAS to switch off signaling. Aberrant RAS function is associated with hyper-proliferative developmental disorders and cancer and in tumors is associated with a single mutation typically at codons 12, 13 or 61. A comprehensive overview of RAS mutations in cancer was reported by Prior (Prior et al (2012) Cancer

Res; 2457 - 67).

[056] In a preferred embodiment, the cancer is KRAS-mutated cancer. The

combination therapy disclosed herein is suitable for use in patients with KRAS- mutated (also referred to as or KRAS-mutant) cancer. The term "KRAS-mutated cancer" is well known to the skilled person.

[057] In a preferred embodiment, the cancer is NRAS-mutated cancer. In this

embodiment, the combination therapy disclosed herein is for use in patients with NRAS-mutated (also referred to as or NRAS-mutant) cancer. The term "NRAS- mutated cancer" is well known to the skilled person. A comprehensive overview of RAS mutations, including NRAS-mutations, in cancer was reported by Prior (Prior et al

(2012) Cancer Res; 2457 - 67). NRAS-mutant cells promote ontogenesis due to being mutationally activated, in most cases, again at codon 12, 13 and 61.

[058] The NRAS protein is a GTPase enzyme that in humans is encoded by NRAS (neuroblastoma RAS viral (v-ras) oncogene homolog) gene gene (e.g. Gene accession number 4893; Refseq RNA Accessions NM_002524.4; protein

NP_002515.1). The N-ras gene specifies two main transcripts of 2Kb and 4.3Kb, both transcripts appear to encode identical proteins as they differ only in the 3' untranslated region.

[059] In a preferred embodiment, the cancer is BRAF-mutated cancer. The

combination therapy disclosed herein is suitable for use in patients with BRAF- mutated (also referred to as BRAF-mutant) cancer, and in a preferred embodiment particular useful in patients that are characterized by having a BRAF-mutant melanoma or colon cancer. The term "BRAF-mutated cancer" is well known to the skilled person. BRAF (e.g. Gene accession number 673; Refseq RNA Accessions NM_004333.4 ; protein NP_004324.2) , is a member of the RAF family, which includes ARAF and CRAF in humans (Ikawa, Mol Cell Biol. 8(6):2651-4 (1988)).

BRAF is a serine/threonine protein kinase and participates in the RAS/RAF/MEK/ERK mitogen activated protein kinase pathway (MAPK pathway, see Williams & Roberts, Cancer Metastasis Rev. 13(1): 105-16 (1994); Fecher et al 2008 Curr Opin Oncol 20, 183-189 or Cargnello M, Roux PP. Microbiol Mol Biol Rev. 201 1 Mar;75(1):50-83). Approximately 40-60% of (cutaneous) melanomas carry a mutation in the BRAF protein. Approximately 90% of these mutations result in the substitution of glutamic acid for valine at codon 600 (BRAF V600E, although other mutations are also known (e.g. BRAF V600K and BRAF V600R). Such mutation in BRAF typically leads to proliferation and survival of melanoma cells (Davies et al Nature 2002; 417:949-54; Curtin et al N Engl J Med 2005;353:2135-47), through activation of the RAF-MAPK- ERK pathway. As is well-known to the skilled person, this pathway plays a significant role in modulating cellular responses to extracellular stimuli, particularly in response to growth factors, and the pathway controls cellular events including cell proliferation, cell-cycle arrest, terminal differentiation and apoptosis (Peyssonnaux et al., Biol Cell. 93(l-2):53-62 (2001)).

[060] The amino acid sequence of BRAF, NRAS or KRAS protein and any other protein mentioned herein, and variations thereof are available in GenBAnk, accessible via http://www.ncbi.nlm.nih.gov/genbank/.

[061] The treatment of a NRAS-, KRAS- and BRAF-mutated cancer disclosed herein comprises the use of an inhibitor of ERN 1. The combinations disclosed herein comprise an inhibitor of ERN1 (or a ERN1 -inhibitor) and at least one inhibitor of a protein of the RAF-MAPK-ERK pathway. The skilled person is well aware of such inhibitors of ERN1 and such inhibitors of a protein of the RAF-MAPK-ERK pathway, as these are readily available in the scientific literature or in various patent documents.

[062] ERN1 is a serine/threonine-protein kinase/endoribonuclease also referred to as IRE1 or ERNI alpa, ER to nucleus signaling 1 protein or IRE1a, encoded by the ERN1 gene (in humans: OHIM: 604033; MGI: 1930134; Gene ID: 2081).

[063] The protein possesses intrinsic kinase activity and an endoribonuclease

activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals. ERN1 initiates a non-spliceosomal cytoplasmic splicing reaction of transcription factors encoding mRNA initiating a genome-scale transcriptional program termed unfolded protein response (UPR). It becomes activated when unfolded proteins accumulate within the organelle. The bifunctional kinase/endoribonuclease controls entry into the terminal UPR. It has been suggested that ERN1 senses unfolded proteins through an ER lumenal domain that becomes oligomerized during stress (Aragon, T. et al. Nature 457, 736-740 (2009).

[064] Within the context of the current invention an inhibitor of ERN1 comprises compounds that inhibit ERN1 activity and/or compounds that reduced expression of ERN1 in said cancer. By ERN1 activity is meant any function of ERN1. By ERN1 inhibitor is meant a compound that reduces the biological activity of ERN1 ; or that reduces the expression of an mRNA encoding a ERN1 polypeptide; or that reduces the expression of a ERN1 polypeptide.

[065] The activity of a (potential) ERN1 inhibitor may be established using assays described in the art, for example as disclosed in US 2012/0322814, US

201 1/0319436, WO 2014/052669, and/or US 2013/0303599.

[066] The ERN1 inhibitor may for example be a small molecule or an antibody. The ERN1 inhibitor may also be a small interfering nucleotide sequence capable of inhibiting ERN1 activity, such as siRNA using one or more small double stranded RNA molecules. For example, ERN1 activity in a cell can be decreased or knocked down by exposing (once or repeatedly) the cell to an effective amount of the appropriate small interfering nucleotide sequence. The skilled person knows how to design such small interfering nucleotide sequence, for example as described in handbooks such as Doran and Helliwell RNA interference: methods for plants and animals Volume 10 CABI 2009. A variety of techniques can be used to assess interference with ERN1 activity of such small interfering nucleotide sequence, for example by determining whether the candidate small interfering nucleotide sequence decreases ERN1 activity in a cell.

[067] Two types of inhibitors exist targeting either the catalytic core of the RNase domain or the ATP-binding pocket of the kinase domain of ERN 1. Examples of RNase domain inhibitors include salicylaldehydes (3-methoxy-6-bromosalicylaldehyde), 4μ80,ΜΚΟ3946, STF-083010, toyocamycin and compound 3 (see Nature Reviews Drug Discovery 12, 703-719 (2013). Sunitinib and APY29 inhibit the ATP-binding pocket. Inhibitors of ERN1 are known in the art and have been described in, for example US 2012/0322814, US 201 1/0319436, WO 2014/052669, US 2013/0303599 (STF-083010) .

[068] The inhibitor of a protein of the RAF-MAPK-ERK pathway may be any inhibitor that reduces the activity of one or more proteins that belong to the RAF-MAPK-ERK pathway.

[069] The RAF-MAPK-ERK pathway is well-known to the skilled person and is one of the four parallel mitogen activated protein kinase (MAPK) signaling pathways identified: ERK1/ERK2, JNK, p38 and ERK5.

[070] Of these known MAPK signaling pathways, the RAF-MAPK-ERK pathway (also referred to as RAF-MEK-ERK pathway or Ras-Raf-MEK-ERK pathway) mediates proliferative and anti-apoptotic signaling from growth factors and oncogenic factors such as Ras and Raf mutant phenotypes that promote tumor growth, progression, and metastasis.

[071] Within the context of the current invention a protein of the RAF-MAPK-ERK pathway includes ERK, MEK, and RAF proteins, as discussed below. In a preferred embodiment, the protein of the RAF-MAPK-ERK pathway is selected from the group consisting of RAF, MEK, and ERK, and combination of two, or three thereof. Thus in a preferred embodiment, the inhibitor of a protein of the RAF-MAPK-ERK pathway is selected from the group consisting of a RAF-inhibitor, an ERK-inhibitor, and a MEK- inhibitor, or combinations thereof.

[072] In a preferred embodiment more than one inhibitor of a protein of the RAF- MAPK-ERK pathway is used. For example, two, three, or four inhibitors of one or more proteins of the RAF-MAPK-ERK pathway are used in the combination therapy disclosed herein, i.e. in combination with an inhibitor of ERN1. For example, at least one ERN1-inhibitor may be combined with at least one MEK-inhibitor and/or at least one ERK-inhibitor, and/or at least one RAF-inhibitor.

[073] A RAF protein, polypeptide or peptide is to indicate a polypeptide having

serine/threonine protein kinase activity belonging to the RAF kinase family. RAF kinases are a family of three serine/threonine-specific protein kinases that are related to retroviral oncogenes. The three RAF kinase family members are ARAF (A-RAF; for example Genbank Accession NO: NP001243125 ), BRAF (B-RAF) and CRAF (C-

RAF; (e.g. Gene accession number 5894; Refseq RNA Accessions NM_002880.3 ; protein NP_002871.1).

[074] For example, BRAF (for example, Genbank Accession NO: NP004324)

phosphorylates and activates MEK (MEK1 and MEK2) and thus participates in the RAS/RAF/MEK/ERK mitogen activated protein kinase pathway (MAPK pathway, see

Williams & Roberts, Cancer Metastasis Rev. 13(1): 105-16 (1994); Fecher et al 2008 Curr Opin Oncol 20, 183-189). CRAF acts as a MAP3 kinase, initiating the entire kinase cascade of the RAF-MAPK-ERK pathway.

[075] These amino acid sequence of BRAF, CRAF and ARAF enzymes, other

proteins mentioned herein, and variations thereof are available in GenBAnk, accessible via http://www.ncbi.nlm.nih.gov/genbank/ by entering either the numbers mentioned above or entering the relevant protein name.

[076] By RAF (biological) activity is meant any function of RAF, such as enzymatic activity, kinase activity, or signaling the RAF-MAPK-ERK pathway.

[077] By RAF inhibitor, for example a BRAF inhibitor, is meant a compound that reduces the biological activity of RAF, for example BRAF; or that reduces the expression of an mRNA encoding a RAF polypeptide, for example BRAF; or that reduces the expression of a RAF polypeptide, for example BRAF. RAF kinase inhibitors as used herein include efficient inhibitors of RAF kinase, particularly CRAF kinase inhibitors and wild and mutated BRAF kinase inhibitors, e.g. including inhibitors of mutant BRAF kinase. Such RAF kinase inhibitors are well known to the skilled person and any RAF inhibitor, including any pharmaceutical agent having RAF inhibitory activity or selective RAF inhibitors may be utilized in the present invention.

[078] Examples of RAF kinase inhibitors, including BRAF kinase inhibitors include the compounds GW5074, BAY 43-9006, CHIR-265 (Novartis), Vemurafenib, PLX4720 (Tsai et al. 2008 PNAS 105(8):3041) , PLX4032 (RG7204), GDC-0879 (Klaus P. Hoeflich et al. Cancer Res.2009 April 1 ;69:3042-3051), sorafenib tosylate (e.g. from

Bayer and Onyx Pharmaceuticals as Nexavar), dasatinib (also known as BMS- 354825, e.g. as produced by Bristol-Myers Squibb and sold under the trade name Sprycel), erlotinib (e.g. as marketed by Genentech and OSI pharmaceuticals as Tarceva), LGX818 from Novartis, dabrafenib (Tafinlar™ capsule, made by

GlaxoSmithKline, LLC), dabrafenib, gefitinib, imatinib mesilate, lapatinib, sunitinib malate, GSK21 18436, and benzenesulfonamide Preferably the RAF inhibitor is sorafenib tosylate, vemurafenib (also known as PLX4032, RG7204 or R05185426, e.g. marketed as Zelboraf, from Plexxikon (Daiichi Sankyo group) and Hoffmann-La Roche, or XL281 (Exelixis), or a derivative thereof.

[079] Other examples include those RAF kinase inhibitors, including B-RAF kinase inhibitors, disclosed in, for example, US69871 19, WO98022103, WO99032436, WO2006084015, WO2006125101 , WO2007027855, WO2005004864,

WO2005028444, WO03082272, WO2005032548, WO2007030377, WO2010114928, WO2005123696, WO2007002325, US20090181371 , WO2008120004,

WO2006024834, WO2006067446, which patent applications can be referenced to the extent of their disclosure of RAF inhibitors, including B-RAF inhibitors and methods of making and using the same.

[080] In particular examples, the RAF inhibitor is a small interfering nucleotide

sequence capable of inhibiting RAF activity, such as siRNA using one or more small double stranded RNA molecules. For example, RAF activity in a cell can be decreased or knocked down by exposing (once or repeatedly) the cell to an effective amount of the appropriate small interfering nucleotide sequence. The skilled person knows how to design such small interfering nucleotide sequence, for example as described in handbooks such as Doran and Helliwell (RNA interference: methods for plants and animals Volume 10 CABI 2009).

[081] A variety of techniques can be used to assess interference with RAF activity of such small interfering nucleotide sequence as discussed above. The RAF inhibitor according to the present invention may be a binding agent such as an antibody which specifically binds activated and/or mutated BRAF such as the ones described in WO 2005047542, or as described in US 20040096855.

[082] A RAF inhibitor has RAF inhibitor activity, or in other words reduces activated (or mutated) RAF activity, which activity may be verified by method known to the skilled person, for example those disclosed in EP0986382B1.

[083] A ERK polypeptide or peptide is to indicate a polypeptide having

serine/threonine protein kinase activity, e.g. ERK phosphorylates and activates MAP (microtubule-associated proteins), and having at least 85% amino acid identity to the amino acid sequence of a human ERK, e.g to ERK1 (e.g. Gene accession number

5595; Refseq RNA Accessions NM_001040056.2; protein NP_001035145.1) or ERK2 (e.g. Gene accession number 5594; Refseq RNA Accessions NM_002745.4 ; protein NP_002736.3).

[084] By ERK biological activity is meant any function of ERK, such as enzymatic activity, kinase activity, the ability to phosphorylate an ERK substrate, or signaling the

RAF-MAPK-ERK pathway. By ERK inhibitor is meant a compound that reduces the biological activity of ERK; or that reduces the expression of an mRNA encoding an ERK polypeptide; or that reduces the expression of an ERK polypeptide. An ERK inhibitor can inhibit one member, several members or all members of the family of ERK kinases.

[085] ERK (extracellular regulated kinase) is a group of MAP kinases which regulate the growth and proliferation of cells (Bokemeyer et al. 1996, Kidney Int. 49, 1187).

[086] Embodiments of the invention include an ERK inhibitor that inhibits or reduces ERK protein expression, amount of ERK protein or level of ERK translation, amount of ERK transcript or level of ERK transcription, stability of ERK protein or ERK transcript, half-life of ERK protein or ERK transcript, prevents the proper localization of an ERK protein or transcript; reduces or inhibits the availability of ERK polypeptide, reduces or inhibits ERK activity; reduces or inhibits ERK, binds ERK protein, or inhibits or reduces the post-translational modification of ERK, including its phosphorylation. In analogy, the above described inhibitory action are also to be construed to apply, in comparable fashion to any inhibitor described herein for its specific target (e.g. a BRAF inhibitor for BRAF, a ERN inhibitor of ERN1 and a MEK inhibitor of MEK).

[087] In some embodiments of the present invention, the ERK inhibitor is an ERK inhibitor such as disclosed in WO2002058687, for example SL-327 (Carr et al Psychopharmacology (Berl). 2009 Jan;201 (4):495-5060). Further ERK inhibitors may be found in WO2002058687, AU2002248381 , US20050159385, US2004102506, US2005090536, US2004048861 , US20100004234, HR20110892, WO201 1163330, TW200934775, EP2332922, WO201 1041 152, US201 1038876, WO2009146034, HK11 17159, WO2009026487, WO2008115890, US2009186379, WO2008055236, US2007232610, WO2007025090, and US2007049591. Reference is made to said documents with respect to their content regarding MEK inhibitors, and methods for making the same.

[088] Further non-limiting examples or ERK-inhibitors include BVD-523, FR 180204

(CAS No. 865362-74-9), Hypothemycin (CAS no. 76958-67-3), MK-8353, SCH9003531 , Pluripotin (CAS no. 839707-37-8), SCH772984 (CAS no. 942183-80- 4), and VX-1 1e (Cas no. 896720-20-0).

[089] In particular examples, the ERK inhibitor is a small interfering nucleotide

sequence capable of inhibiting ERK activity, such as siRNA using one or more small double stranded RNA molecules. For example, ERK activity in a cell can be decreased or knocked down by exposing (once or repeatedly) the cell to an effective amount of the appropriate small interfering nucleotide sequence. The skilled person knows how to design such small interfering nucleotide sequence, for example as described in handbooks such as Doran and Helliwell (RNA interference: methods for plants and animals Volume 10 CABI 2009).

[090] The ERK inhibitor according to the present invention may be a binding agent such as an antibody which specifically binds ERK, thereby inhibiting its function.

[091] ERK inhibitor activity may be assayed in vitro, in vivo or in a cell line. In vitro assays include assays that determine inhibition of either the kinase activity or ATPase activity of activated ERK. Alternate in vitro assays quantitate the ability of the inhibitor to bind to ERK and may be measured either by radiolabelling the inhibitor prior to binding, isolating the inhibitor/ERK complex and determining the amount of radiolabel bound, or by running a competition experiment where new inhibitors are incubated with ERK bound to known radioligands. One may use any type or isoform of ERK, depending upon which ERK type or isoform is to be inhibited. An example of measuring ERK inhibitory activity is described in EP 1317453 B1.

[092] A MEK polypeptide (e.g. Gene accession numbers 5604 or 5605; Refseq RNA Accessions NM_002755.3 or NM_030662.3; protein NP_002746.1 or NP_109587.1), protein or peptide is to indicate a polypeptide having serine/threonine protein kinase activity. For example MEK1 (e.g. Genbank Accession NO: NP002746) and MEK2 (e.g. Genbank Accession NO: NP109587) phosphorylates and activates MAPK. Another example is MEK3 ((e.g. Genbank Accession NO: NP002747). MEK comprises both MEK1 and MEK2 : MAP/ERK kinase 1 , MEK1 , PRKMK1 , MAPKK1 , MAP2K1 , MKK1 are the same enzyme, known as MEK1 , MAP/ERK kinase 2, MEK2, PRKMK2, MAPKK2, MAP2K2, MKK2 are the same enzyme, known as MEK2. MEK1 and MEK2, together MEK, can phosphorylate serine, threonine and tyrosine residues in protein or peptide substrates. To date, few cellular substrates of MEK isoforms have been identified. The amino acid sequence of MEK enzymes, other proteins mentioned herein, and variations thereof are available in GenBAnk, accessible via

http://www.ncbi.nlm.nih.gov/genbank/ by entering either the numbers mentioned above or entering the relevant protein name.

[093] By MEK biological activity is meant any function of MEK, such as enzymatic activity, kinase activity, or signaling the RAF-MAPK-ERK pathway.

[094] By MEK inhibitor is meant a compound that reduces the biological activity of MEK; or that reduces the expression of an mRNA encoding a MEK polypeptide; or that reduces the expression of a MEK polypeptide. A MEK inhibitor can inhibit one member, several members or all members of the family of MEK kinases. In one embodiment the MEK inhibitor is a selective inhibitor.

[095] Preferred MEK inhibitors, already known in the art, include but are not limited to the MEK inhibitors PD184352 and PD98059, inhibitors of MEKI and MEK2 U0126

(see Favata, M., et al., Identification of a novel inhibitor of mitogen-activated protein kinase. J. Biol. Chem. 273, 18623, 1998) and SL327 (Carr et al Psychopharmacology (Berl). 2009 Jan;201 (4):495-506), and those MEK inhibitors discussed in Davies et al (2000) (Davies et al Biochem J. 351 , 95-105). In particular, PDI 84352 (Allen, Lee et al Seminars in Oncology, Oct. 2003, pp. 105-106, vol. 30) has been found to have a high degree of specificity and potency when compared to other known MEK inhibitors, and may thus be preferred. A preferred MEK inhibitor GSK1120212/Trametinib

(GlaxxoSmithKline) has been approved for treatment of BRAF mutant melanoma under the name Mekinist. MEK162 (Novartis) is also preferred. Other MEK inhibitors and classes of MEK inhibitors are described in Zhang et al. (2000) Bioorganic &

Medicinal Chemistry Letters; 10:2825-2828.

[096] Further MEK inhibitors are for example described in Tecle et al Medicinal

Chemistry Letters Volume 19, Issue 1 , 1 January 2009, Pages 226-229;

WO2009018238, W02007/044084, WO2005/051300, WO201 1/095807,

WO2008124085, WO2009018233, WO2007113505, US2011 105521 ,

WO2011067356, WO2011067348, US2010004247, and US2010130519. Reference is made to said documents with respect to their content regarding MEK inhibitors, and methods for making the same. GSK1 120212 is an example of a further MEK inhibitor.

[097] The MEK inhibitor may also preferably be selected from AZD6244, 4-(4- Bromo-2- fluorophenylamino)-N-(2-hydroxyethoxy)- 1 ,5-dimethyl-6-oxo- 1 ,6- dihydropyridazine-3- carboxamide or 2-(2-fluoro-4-iodophenylamino)-N-(2- hydroxyethoxy)- 1 ,5-dimethyl-6- oxo-l,6-dihydropyridine-3-carboxamide. [098] In another embodiment the MEK inhibitor is selected from 6-(4-Bromo-2- chloro- phenylamino)-7-fluoro-3-methyl-3H-benzoimidazole-5-carboxylic acid (2- hydroxy- ethoxy)-amide or a pharmaceutically acceptable salt thereof. In one embodiment the MEK inhibitor is 6-(4-Bromo-2-chloro-phenylamino)-7-fluoro-3- methyl-3H-benzoimidazole-5- carboxylic acid (2-hydroxy-ethoxy)-amide hydrogen sulphate salt. 6-(4-Bromo-2-chloro- phenylamino)-7-fluoro-3-methyl-3H- benzoimidazole-5-carboxylic acid (2-hydroxy- ethoxy)-amide hydrogen sulphate salt may be synthesized according to the process described in International Patent Publication Number WO2007/076245.

[099] Furthermore, according to the invention the MEK inhibitor may be selected from the group consisting of certain experimental compounds, some of which are currently in Phase 1 or Phase II studies, namely PD-325901 (Phase 1 , Pfizer), XL518 (Phase 1 , Genentech), PD-184352 (Allen and Meyer Semin Oncol. 2003 Oct;30(5 SuppI 16): 105-16.), PD- 318088 (Tecle et al nic & Medicinal Chemistry Letters Volume 19, Issue 1 , 1 January 2009, Pages 226-229), AZD6244 (Phase II, Dana Farber,

AstraZeneca; WO2007/076245.) and CI-1040 (Lorusso et al Journal of clinical oncology 2005, vol. 23, no23, pp. 5281-5293).

[100] Other examples of drugs that inhibit MEK include, PD-0325901 (Pfizer), AZD- 8330 (AstraZeneca), RG-7167 (Roche/Chugai), RG-7304 (Roche), CIP-137401 (Cheminpharma), WX-554 (Wilex; UCB), SF-2626 (Semafore Pharmaceuticals Inc),

RO-5068760 (F Hoffmann-La Roche AG), RO-4920506 (Roche), G-573 (Genentech) and G-894 (Genentech), N-acyl sulfonamide prodrug GSK-2091976A

(GlaxoSmithKline), BI-847325 (Boehringer Ingelheim), WYE-130600 (Wyeth/Pfizer), ERK1-624, ERK1-2067, ERK1 -2321 1 , AD-GL0001 (ActinoDrug Pharmaceuticals GmbH), selumetinib (AZD6244), trametinib, TAK-733, Honokiol, MEK-162, derivates, and salts thereof.

[101] In another embodiment the MEK inhibitor may inhibit (gene) expression of MEK, for example by interfering with mRNA stability or translation. In one embodiment the MEK inhibitor is selected from small interfering RNA (siRNA), which is sometimes known as short interfering RNA or silencing RNA, or short hairpin RNA (shRNA), which is sometimes known as small hairpin RNA. The skilled person knows how to design such small interfering nucleotide sequence, for example as described in handbooks such as Doran and Helliwell RNA interference: methods for plants and animals Volume 10 CABI 2009.

[102] The MEK inhibitor according to the present invention may be a binding agent such as an antibody which specifically binds MEK, thereby inhibiting its function. [103] A number of assays for identifying kinase inhibitors, including MEK inhibitors, are known, for example from Downey et al. (1996) J Biol Chem.; 271 (35): 21005- 21011 or EP2496575.

[104] The use of an inhibitor of ERN 1 as disclosed herein, in particular in the

combination therapy disclosed herein is useful in the treatment of patients having a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancers. However, the combination is in particular useful in the treatment of patients having cancer wherein said cancer is a solid cancer, preferably selected from the group consisting of melanoma, pancreatic cancer, lung cancer, or colon cancer.

[105] The cancer maybe a naive cancer (previously untreated with anti-cancer

drugs, e.g. with an inhibitor on the RAF-MAPK-ERK pathway; another inhibitor, chemotherapy or radiation therapy), or may be a cancer that is resistant or acquired resistance as a consequence of prior treatment (e.g. with an inhibitor on the RAF- MAPK-ERK pathway; another inhibitor, chemotherapy or radiation therapy).

[106] The experimental data disclosed herein supports a therapy using ERN1

inhibitors, in particular combination therapy of inhibitors of the RAF-MAPK-ERK pathway and ERN1 inhibitors for NRAS, KRAS and/or BRAF mutated cancers.

[107] In some embodiments, the combination disclosed herein and the use of the disclosed combination in the treatment of the type of cancers disclosed herein may further be combined with other drugs or treatments , for example with (the use of) chemotherapy and/or radiotherapy.

[108] In a preferred embodiment, in the combination therapy disclosed herein, the inhibitors are selected from those with established use in the hospital setting, such as those inhibitors that are of will be commercially available for use in the treatment of patients, or those that are or have been tested in clinical trials for use in the treatment of patients.

[109] The combination of such particular ERN1 inhibitor, RAF inhibitor, MEK inhibitor and/or ERK inhibitor in the treatment disclosed herein may be in particular

advantegous in the treatment of the patient.

[1 10] In a preferred embodiment there is disclosed that in the combination disclosed herein, said inhibitor of a protein of the RAF-MAPK-ERK pathway is an inhibitor of MEK, and said cancer is a KRAS-mutated cancer; or wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is an inhibitor of RAF, and wherein said cancer is a BRAF-mutated cancer. It has now been found that these combinations are in particular active in the treatment of the specific cancer (MEK inhibitor and a ERN1 inhibitor for KRAS-mutated cancer and a RAF inhibitor (e.g. vemurafenib) and a ERN1 inhibitor in BRAF mutated cancer. In particular it was found that by the combination of for example a RAF inhibitor, vemurafenib, and an inhibitor of ERN1 BRAF mutated colon cancer cells were effectively treated.

[1 11] In a preferred embodiment, the inhibitor of ERN1 is administrated

simultaneously, separately or sequentially with an inhibitor of a protein of the RAF- MAPK-ERK pathway, preferably wherein said inhibitor of a protein of the RAF-MAPK-

ERK pathway is selected from the group consisting of an inhibitor of RAF, an inhibitor of ERK, and an inhibitor of MEK, even more preferably wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is an inhibitor of MEK, and wherein said cancer is a KRAS-mutated cancer; or wherein said inhibitor of a protein of the RAF- MAPK-ERK pathway is an inhibitor of RAF, and wherein said cancer is a BRAF- mutated cancer.

[1 12] The inhibitors for the combination therapy as disclosed herein may be

administered to the patient either simultaneously, separately or sequentially with the other drug(s) of the combination. For example, in practice the product leaflet of the ERN1 -inhibitor may suggest the simultaneous, separate or sequential use of the

ERN1 -inhibitor with an inhibitor of a protein of the RAF-MAPK-ERK-pathway, preferably an ERK inhibitor and/or a MEK-inhibitor and/or a RAF-inhibitor. Or the combination may as such be prescribed or provided to a patient.

[1 13] In another example, in practice the product leaflet of the inhibitor of a protein of the RAF-MAPK-ERK pathway (preferably an ERK inhibitor and/or a MEK-inhibitor and/or a RAF-inhibitor) may suggest the simultaneous, separate or sequential use of the inhibitor of a protein of the RAF-MAPK-ERK pathway with a ERN1 -inhibitor. Or the combination may as such be prescribed or provided to the patient.

[1 14] As explained above, the new use of the combination of inhibitors is not limited to combinations administered separately, but also includes the compositions obtained by physical association of the drugs and in either case a synergistic effect is obtained.

[1 15] As used herein "simultaneous" administration refers to administration of more than one drug at the same time, but not necessarily via the same route of

administration or in the form of one combined formulation. For example, one drug may be provided orally whereas the other drug may be provided intravenously during a patients visit to a hospital. Separate includes the administration of the drugs in separate form and/or at separate moments in time, but again, not necessarily via the same route of administration. Sequentially indicates that the administration of a first drug if followed, immediately or in time, by the administration of the second drug.

[1 16] The combination of drugs disclosed herein will preferably be administered to the patient in a form that is suitable for administration to the patient and in a dose that is efficacious, i.e. in an effective amount. [1 17] Therefor the disclosure also provides for an inhibitor of RAF for use in treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer, preferably BRAF-mutated cancer, wherein the inhibitor of RAF is administrated simultaneously, separately or sequentially with an inhibitor of ERN 1.

[1 18] Likewise there is provided for an inhibitor of ERK for use in treatment of a

cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer, wherein the inhibitor of ERK is administrated simultaneously, separately or sequentially with an inhibitor of ERN1.

[1 19] Likewise there is provided for an inhibitor of MEK for use in treatment of a

cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer, preferably KRAS-mutated cancer, wherein the inhibitor of MEK is

administrated simultaneously, separately or sequentially with an inhibitor of ERN1.

[120] As discussed above, the cancer is preferably selected from the group

consisting of melanoma, pancreatic cancer, lung cancer, or colon cancer.

[121] The current disclosure thus relates, in these aspects, to a combination therapy, wherein during the therapy the patient is treated with a drug that is an inhibitor of ERNl in combination with (another) inhibitor that inhibits a protein of the RAF-MAPK- ERK pathway, preferably an ERK-inhibitor, a MEK-inhibitor, and/or a RAF-inhibitor.

[122] Also provided is a product comprising an inhibitor of ERN1 and an inhibitor of a protein of the RAF-MAPK-ERK pathway, as a combined preparation for

simultaneous, separate or sequential use in treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer, preferably wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is selected from the group consisting of an inhibitor of RAF, an inhibitor of ERK, and an inhibitor of MEK.

[123] In a preferred embodiment of the product to be used in the treatment of a

cancer, said inhibitor of a protein of the RAF-MAPK-ERK pathway is an inhibitor of RAF and said cancer is BRAF-mutated cancer; or said inhibitor of a protein of the RAF-MAPK-ERK pathway is an inhibitor of MEK and said cancer is KRAS-mutated cancer.

[124] Also provided is a method for the treatment of a cancer selected from the

group consisting of NRAS-, KRAS- and BRAF-mutated cancer, wherein the method comprises the simultaneous, separate or sequential administering to a patient of an inhibitor of ERN1 and an inhibitor of a protein of the RAF-MAPK-ERK pathway, preferably wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is selected from the group consisting of an inhibitor of RAF, an inhibitor of ERK, and an inhibitor of MEK. Again, the cancer, in a preferred embodiment is selected from the group consisting of melanoma, pancreatic cancer, lung cancer, or colon cancer. [125] In a further aspect there is provided for a method for predicting treatment response of a cancer, wherein the treatment comprises treatment with an inhibitor of ERN 1 and an inhibitor of a protein of the RAF-MAPK-ERK pathway, preferably selected from the group consisting of an inhibitor of RAF, an inhibitor of ERK, and an inhibitor of MEK, wherein the method comprises the step of determining in tissue or cells obtained from said patient the presence or absence of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer; and wherein the presence of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF- mutated cancer is predictive for a good response as compared to a treatment response when said cancer selected from the group consisting of NRAS-, KRAS- and

BRAF-mutated cancer is absent.

[126] The skilled person is well aware of method for determining the presence of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer. The current disclosure now provides that such patients may beneficial be treated with ERN 1 inhibitors, in particular using the combinations as disclosed herein.

Examples

Example 1

Material and Methods [127] Cell Culture and Inhibitors

[128] All cell lines were maintained in RPMI 1640 medium containing 10% FBS and penicillin/streptomycin, except A375 cells and BJET fibroblasts, which were maintained in DMEM , supplemented with 10% FBS and penicillin/streptomycin.

PLX4032 and AZD6244 were purchased from Selleck Chemicals and kept as 10mM stock solutions in DMSO. STF083010 and 4sii8C were purchased from Axon Medchem and kept as 100mM and 64mM stock solution in DMSO respectively.

[129] siRNA Transfection

[130] Cells were transfected with Lipofectamine RNAiMAX following manufacturer's instructions on reverse transfection (invitrogen). The siRNAs used in the experiments were, Ern1#2; GAC CUG CGU AAA UUC AGG ACC UAU A (ERN 1 HSS176615, Invitrogen), Ern1#5; AGA ACA AGC UCA ACU ACU U (D-004951 -03-0005,

Dharmacon).

[131 ] Total RNA isolation and reverse-transcription

[132] Total RNA was isolated and purified using Quick-RNA™ MiniPrep (Zymo

Research). Total RNA concentration and purity were measured on a NanoDrop spectrophotometer (NanoDrop technologies). Next, cDNA synthesis was performed with Maxima First Strand cDNA synthesis (Thermo scientific).

[133] Real-time RT-PCR

[134] Primers to detect human TBP mRNA were hTBP-F 5'

GTTCTGGGAAAATGGTGTGC, hTBP-R 5' GCTGGAAAACCCAACTTCTG. Primers to detect human ERN1 mRNA were hERN1-F 5' AGCAAGCTGACGCCCACTCTG, hERN1-R 5' TGGGGCCCTTCCAGCAAAGGA. Quantitative PCR was carried out at 50°C for an initial 2 min followed by 95°C for an initial 10 min and than 40 cycles of denaturation at 95°C for 15 s, annealing and extension at 60°C for 60 s at using SYBR

Green mastermix (Applied Biosystems). Each assay was run on an Applied

Biosystems 7500 Fast Real-Time PCR System in triplicates. Relative mRNA concentrations of TBP were used as reference to calculate the normalized expression. [135] Growth curves

[136] Cell growth was measured by automated determination of confluency every 4 hours for one week using an IncuCyte Zoom (Essen Bioscience). Cells were plated in a 384 well format. 1500 cells were plated per well and experiments were carried out in triplicate.

Results

[137] To investigate whether there is interaction between oncogenic RAS and/or BRAF and ERN1 in humans we used RNAi. Multiple siRNAs targeting ERN1

(siRNA#2 and siRNA #5) were selected using two criteria. First we tested whether the target genes were down regulated 24 hours after RNAi treatment using qPCR.

Secondly, we tested whether the RNAi treatment increased the sensitivity of fibroblasts to the ER stress agent 2-Mercaptoethanol in a 4-day growth assay (Figure 1).

[138] To test whether ERN 1 is essential in cells with active RAS signaling we

knocked down ERN1 in 3 colon cancer cell lines with a KRAS activating mutation

(SW480, LOVO, SKC01). Growth was measured by automated determination of confluency every 4 hours for one week. The fitness of these colon cell lines was decreased upon ERN1 knockdown (Figure 2). Downstream of RAS is the RAF-MEK- ERK MAPK pathway (also referred to as the RAF-MAPK-ERK pathway). Inhibitors are available that target the various proteins of this pathway. We tested the effect of ERN 1 knockdown in the absence of active RAS-MAPK signaling by using the MEK inhibitor AZD6244. Unexpectedly, ERN1 knockdown significantly enhanced the sensitivity to AZD6244 in RAS mutant cells (Figure 2). This suggests that inhibition of ERN1 is synthetic lethal in combination with inhibition of a protein of the RAF-MAPK-ERK pathway, for example MEK, in RAS driven colon cancer cells, for example in KRAS mutated cancers

[139] BRAF is mutated in approximately 50% of melanomas. Specific BRAF(V600E) inhibitors have been developed. The BRAF kinase is upstream of MEK in the RAF- MAPK-ERK pathway and we investigated whether ERN1 inhibition also sensitizes cells to BRAF(V600E) inhibitor. We tested the interaction in MEL888 and A375 melanoma cells, both the cell lines have a BRAF mutant allele. Knockdown of ERN1 sensitized both cell lines to BRAF inhibition (PLX4032; Figure 3). Moreover, ERN 1 knock down also enhanced sensitivity to MEK inhibitor AZD6244 (Figure 3). This indicates that combining ERN1 inhibition and inhibition of a protein of the RAF-MAPK- ERK pathway is synthetic lethal in BRAF mutant (melanoma) cells.

[140] We next asked whether sensitivity to the combination of ERN1 knockdown and RAF-MAPK-ERK pathway inhibition was specific to RAS-mutated cells and BRAF mutant cells. LOVO colon cancer cells have a KRAS mutation and have wild type BRAF alleles. Therefore, LOVO cells are insensitive to the BRAF inhibitor PLX4032. Knockdown of ERN1 did not enhance the sensitivity of LOVO cells to PLX4032, even if we added 2 μΜ of the compound (Figure 4). CaCo2 cells are wild type for both RAS and BRAF. We treated these cells with MEK inhibitor and found that these cells are insensitive to the combination of AZD6244 and ERN 1 knock down (Figure 4).

[141] KRAS and BRAF mutations are mainly found in melanoma, colon, lung and pancreas cancers. Therefore we also treated WiDr cells (colon, BRAF mutant), H358 cells (lung, KRAS mutant), PANC1 and PANC10.05 (pancreas, KRAS mutant) with the combination of ERN1 siRNA and AZD6244 or PLX4032. All cell lines were sensitive to the combination treatment (Figure 5). Interestingly, the RAS-mutant pancreatic cell lines were also very sensitive to the treatment with ERN1 siRNA alone.

[142] Specific inhibitors have been developed that target the endonuclease domain of ERN1. 4μ80 is a specific inhibitor that inhibits the endonuclease activity at 8μΜ - 64μΜ in MEF cells (Cross et al. (2012) Proceedings of the National Academy of

Sciences of the United States of America, 109(15), E869-78.

doi: 10.1073/pnas.1 115623109). STF083010 is a specific inhibitor that inhibits the endonuclease activity at 10μΜ - 100μΜ in a cell free system (Papandreou et al.

(201 1) Blood, 1 17(4), 1311-4. doi: 10.1182/blood-2010-08-303099). We tested these inhibitors in combination with MAPK inhibitors. MEL888 cells were grown for a week in the presence of PLX4032 and ERN 1 inhibitors. Both ERN1 inhibitors enhanced the sensitivity of MEL888 cells to BRAF inhibition (Figure 6). In addition to growth curve assays we performed colony-forming assays by growing cells for 12 days in 6 well plates. MEL888, A375 and Widr cells all showed enhanced sensitivity to the

ERN1 i+MAPKi combination treatment (Figure 6)

Example 2

[143] Next, we created ERN1 knockout LOVO human colon cancer cells (KRAS mutant) cells using lentiviral CRISPR-Cas9 vectors. The ERN1 knockout cells were created by infecting cells with CRISPR-Cas9 vectors with the following gRNA sequence; GATGGCAGCCTGTATACGCT. Single cell clones were tested for ERN 1 knockout by western blot and by measuring the levels of spliced XBP1 using qPCR.

[144] Cell clones were selected in which ERN 1 protein was undetectable by western blot (Figure 7A) and in which XBP1 spliced (XBP1 s) levels were 100 fold down (Figure 7B). Control cells were generated that contain the Cas9 vector but lack the guide RNA that targets the ERN1 gene.

[145] Proliferation assays were performed using the isogenic ERN1 KO and control cells. 10K cells were seeded in a 6 well plate format. MEK inhibitor (AZD6244) was added 24 hours after plating the cells and refreshed every three days. The cells were fixed and stained 18 days after plating. We found that the proliferation of untreated ERN1 KO cells was similar to untreated control cells. However, the sensitivity to MEK inhibition in ERN1 KO cells increased 10 fold. We repeated the same procedure for SW480 cells and found that ERN1 loss was also synthetic lethal with MEK inhibition in this cell line (Figure 8)

[146]

Claims

Claims
An inhibitor of ERN1 for use in the treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer.
A combination of an inhibitor of ERN1 and an inhibitor of a protein of the RAF-MAPK- ERK pathway for use as a medicament, preferably for use in the treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer.
The combination of claim 2 wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is selected from the group consisting of an inhibitor of RAF, an inhibitor of ERK, and an inhibitor of MEK.
The combination of any one of claims 2 - 3 wherein said cancer is selected from the group consisting of melanoma, pancreatic cancer, lung cancer, or colon cancer.
The combination of any one of claims 2 - 4 wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is an inhibitor of MEK, and wherein said cancer is a KRAS- mutated cancer; or wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is an inhibitor of RAF, and wherein said cancer is a BRAF-mutated cancer.
An inhibitor of ERN1 for use in treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer, wherein the inhibitor of ERN1 is administrated simultaneously, separately or sequentially with an inhibitor of a protein of the RAF-MAPK-ERK pathway.
The inhibitor of ERN 1 for use in treatment of a cancer of claim 6 wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is selected from the group consisting of an inhibitor of RAF, an inhibitor of ERK, and an inhibitor of MEK.
The inhibitor of ERN1 use in treatment of a cancer of any one of claims 6- 7, wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is an inhibitor of MEK, and wherein said cancer is a KRAS-mutated cancer; or wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is an inhibitor of RAF, and wherein said cancer is a BRAF-mutated cancer.
9. An inhibitor of RAF for use in treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer, wherein the inhibitor of RAF is administrated simultaneously, separately or sequentially with an inhibitor of ERN 1.
10. The inhibitor of RAF for use in treatment of a cancer of claim 9, wherein said cancer is a BRAF-mutated cancer.
1 1. An inhibitor of ERK for use in treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer, wherein the inhibitor of ERK is administrated simultaneously, separately or sequentially with an inhibitor of ERN 1.
12. An inhibitor of MEK for use in treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer, wherein the inhibitor of MEK is administrated simultaneously, separately or sequentially with an inhibitor of ERN1.
13. The inhibitor of MEK for use in treatment of a cancer of claim 12, wherein said cancer is a KRAS-mutated cancer.
14. The inhibitor of ERN1 , inhibitor of RAF, inhibitor of ERK, or inhibitor of MEK for use in treatment of a cancer of any one of claims 6- 13, wherein the cancer is selected from the group consisting of melanoma, pancreatic cancer, lung cancer, or colon cancer.
15. A product comprising an inhibitor of ERN1 and an inhibitor of a protein of the RAF- MAPK-ERK pathway, as a combined preparation for simultaneous, separate or sequential use in treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer.
16. The product of claim 15, wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is selected from the group consisting of an inhibitor of RAF, an inhibitor of ERK, and an inhibitor of MEK.
17. The product of any of claims 15 - 16, wherein said inhibitor of a protein of the RAF- MAPK-ERK pathway is an inhibitor of RAF and wherein said cancer is BRAF-mutated cancer or said inhibitor of a protein of the RAF-MAPK-ERK pathway is an inhibitor of MEK and wherein said cancer is KRAS-mutated cancer.
18. A method for the treatment of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer, wherein the method comprises the simultaneous, separate or sequential administering to a patient of an inhibitor of ERN1 and an inhibitor of a protein of the RAF-MAPK-ERK pathway.
19. The method of claim 18, wherein said inhibitor of a protein of the RAF-MAPK-ERK pathway is selected from the group consisting of an inhibitor of RAF, an inhibitor of ERK, and an inhibitor of MEK.
20. The method of any one of claims 18 - 19, wherein the cancer is selected from the group consisting of melanoma, pancreatic cancer, lung cancer, or colon cancer.
21. A method for predicting treatment response of a cancer, wherein the treatment
comprises treatment with an inhibitor of ERN1 and an inhibitor of a protein of the RAF- MAPK-ERK pathway, preferably selected from the group consisting of an inhibitor of RAF, an inhibitor of ERK, and an inhibitor of MEK, wherein the method comprises the step of determining in tissue or cells obtained from said patient the presence or absence of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF- mutated cancer; and wherein the presence of a cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer is predictive for a good response as compared to a treatment response when said cancer selected from the group consisting of NRAS-, KRAS- and BRAF-mutated cancer is absent.
22. The method of claim 21 , wherein the method in performed in vitro.
PCT/NL2015/050360 2014-05-19 2015-05-19 Compositions for cancer treatment WO2015178770A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
NL2012840 2014-05-19
NL2012840 2014-05-19

Publications (1)

Publication Number Publication Date
WO2015178770A1 true WO2015178770A1 (en) 2015-11-26

Family

ID=51266395

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2015/050360 WO2015178770A1 (en) 2014-05-19 2015-05-19 Compositions for cancer treatment

Country Status (1)

Country Link
WO (1) WO2015178770A1 (en)

Citations (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998022103A1 (en) 1996-11-16 1998-05-28 Zeneca Limited Raf kinase inhibitors
WO1999032436A1 (en) 1997-12-22 1999-07-01 Bayer Corporation Inhibition of raf kinase using symmetrical and unsymmetrical substituted diphenyl ureas
WO2002058687A2 (en) 2001-01-25 2002-08-01 Board Of Regents, The University Of Texas System Inhibition of erk to reduce or prevent tolerance to and dependence on opioid analgesics
WO2003082272A1 (en) 2002-03-29 2003-10-09 Chiron Corporation Substituted benzazoles and use thereof as raf kinase inhibitors
US20040048861A1 (en) 2000-02-05 2004-03-11 Guy Bemis Compositions useful as inhibitors of ERK
US20040096855A1 (en) 2001-12-24 2004-05-20 Michael Stratton Genes
US20040102506A1 (en) 2000-02-05 2004-05-27 Michael Hale Pyrazole compositions useful as inhibitors of ERK
WO2005004864A1 (en) 2003-07-11 2005-01-20 Merck Patent Gmbh Benzimidazole derivatives as raf kinase inhibitors
WO2005028444A1 (en) 2003-09-24 2005-03-31 Novartis Ag 1,4-disubstituted isoquinilone derivatives as raf-kinase inhibitors useful for the treatment of proliferative diseases
WO2005032548A1 (en) 2003-09-29 2005-04-14 Chiron Corporation Substituted benzazoles and use thereof as inhibitors of raf kinase
US20050090536A1 (en) 2000-09-15 2005-04-28 Hale Michael R. Isoxazole compositions useful as inhibitors of ERK
WO2005047542A1 (en) 2003-10-16 2005-05-26 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Treatments for inhibiting development and progression of nevi and melanoma having braf mutations
WO2005051300A2 (en) 2003-11-19 2005-06-09 Array Biopharma Inc. Bicyclic inhibitors of mek and methods of use thereof
US20050159385A1 (en) 2003-12-19 2005-07-21 Mohapatra Shyam S. JAK/STAT inhibitors and MAPK/ERK inhibitors for RSV infection
WO2005123696A1 (en) 2004-06-15 2005-12-29 Astrazeneca Ab Substituted quinazolones as anti-cancer agents
US6987119B2 (en) 2000-03-06 2006-01-17 Smithkline Beecham P.L.C. Imidazol-2-carboxamide derivatives as raf kinase inhibitors
WO2006024834A1 (en) 2004-08-31 2006-03-09 Astrazeneca Ab Quinazolinone derivatives and their use as b-raf inhibitors
WO2006067446A1 (en) 2004-12-22 2006-06-29 Astrazeneca Ab Pyridine carboxamide derivatives for use as anticancer agents
WO2006084015A2 (en) 2005-02-04 2006-08-10 Genentech, Inc. Raf inhibitor compounds and methods
WO2006125101A2 (en) 2005-05-20 2006-11-23 Array Biopharma Inc. Raf inhibitor compounds and methods of use thereof
WO2007002325A1 (en) 2005-06-22 2007-01-04 Plexxikon, Inc. Pyrrolo[2,3-b] pyridine derivatives as protein kinase inhibitors
WO2007025090A2 (en) 2005-08-25 2007-03-01 Kalypsys, Inc. Heterobicyclic and - tricyclic inhibitors of mapk/erk kinase
WO2007027855A2 (en) 2005-09-01 2007-03-08 Array Biopharma Inc. Raf inhibitor compounds and methods of use thereof
WO2007030377A1 (en) 2005-08-30 2007-03-15 Novartis Ag Substituted benzimidazoles as kinase inhibitors
WO2007044084A2 (en) 2005-05-18 2007-04-19 Array Biopharma Inc. Heterocyclic inhibitors of mek and methods of use thereof
WO2007076245A2 (en) 2005-12-21 2007-07-05 Array Biopharma Inc. Novel hydrogen sulfate salt
WO2007101224A2 (en) * 2006-02-27 2007-09-07 The Board Of Trustees Of The Leland Stanford Junior University Inhibitors of the unfolded protein response and methods for their use
US20070232610A1 (en) 2006-02-16 2007-10-04 Yongqi Deng Novel compounds that are ERK inhibitors
WO2007113505A2 (en) 2006-03-30 2007-10-11 The University Court Of The University Of Edinburgh Culture medium containing kinase inhibitors. and uses thereof
WO2008055236A2 (en) 2006-10-31 2008-05-08 Takeda Pharmaceutical Company Limited Mapk/erk kinase inhibitors
EP0986382B1 (en) 1997-05-23 2008-06-25 Bayer Pharmaceuticals Corporation Raf kinase inhibitors
WO2008115890A2 (en) 2007-03-19 2008-09-25 Takeda Pharmaceutical Company Limited Mapk/erk kinase inhibitors
WO2008120004A1 (en) 2007-04-02 2008-10-09 Astrazeneca Ab Combination of a mek- inhibitor and a b-raf inhibitor for the treatment of cancer
WO2008124085A2 (en) 2007-04-03 2008-10-16 Exelixis, Inc. Methods of using combinations of mek and jak-2 inhibitors
WO2009018238A1 (en) 2007-07-30 2009-02-05 Ardea Biosciences, Inc. Combinations of mek inhibitors and raf kinase inhibitors and uses thereof
WO2009018233A1 (en) 2007-07-30 2009-02-05 Ardea Biosciences, Inc. Derivatives of n-(arylamino) sulfonamides including polymorphs as inhibitors of mek as well as compositions, methods of use and methods for preparing the same
WO2009026487A1 (en) 2007-08-22 2009-02-26 The Ohio State University Research Foundation Methods and compositions for inducing deregulation of epha7 and erk phosphorylation in human acute leukemias
US20090181371A1 (en) 2005-07-13 2009-07-16 Samowitz Wade S Methods and compositions related to a braf mutation and microsatellite stability
US20090186379A1 (en) 2006-11-13 2009-07-23 Thomas David Reed ERK ligands and polynucleotides encoding ERK ligands
TW200934775A (en) 2007-11-12 2009-08-16 Takeda Pharmaceutical MAPK/ERK kinase inhibitors
WO2009146034A2 (en) 2008-03-31 2009-12-03 Takeda Pharmaceutical Company Limited Mapk/erk kinase inhibitors and methods of use thereof
US20100004247A1 (en) 2007-12-12 2010-01-07 Astrazeneca Ab Combination comprising a mek inhibitor and an aurora kinase inhibitor 188
US20100004234A1 (en) 2004-09-27 2010-01-07 Kosan Biosciences Incorporated Specific kinase inhibitors
US20100130519A1 (en) 2007-04-13 2010-05-27 Stephen Robert Wedge Combination therapy comprising azd2171 and azd6244 or mek-inhibitor ii
WO2010114928A2 (en) 2009-04-03 2010-10-07 F.Hoffmann-La Roche Ag Compositions and uses thereof
US20110038876A1 (en) 2007-06-18 2011-02-17 Robert Sun Heterocyclic compounds and use thereof as erk inhibitors
WO2011041152A1 (en) 2009-09-30 2011-04-07 Schering Corporation Novel compounds that are erk inhibitors
US20110105521A1 (en) 2008-07-11 2011-05-05 Novartis Ag Combination of (a) a phosphoinositide 3-kinase inhibitor and (b) a modulator of ras/raf/mek pathway
WO2011067348A2 (en) 2009-12-03 2011-06-09 Novartis Ag Mek inhibitor salts and solvates thereof
WO2011067356A2 (en) 2009-12-03 2011-06-09 Novartis Ag Polymorphs of a mek inhibitor
EP2332922A1 (en) 2001-10-23 2011-06-15 Merck Serono S.A. N-substituted azoles and their use as MEK-1 and/or ERK-2 modulators
WO2011095807A1 (en) 2010-02-07 2011-08-11 Astrazeneca Ab Combinations of mek and hh inhibitors
US20110319436A1 (en) 2008-09-15 2011-12-29 The Regents Of The University Of California Methods and Compositions for Modulating IRE1, SRC, and ABL Activity
WO2011163330A1 (en) 2010-06-24 2011-12-29 Merck Sharp & Dohme Corp. Novel heterocyclic compounds as erk inhibitors
HRP20110892T1 (en) 2005-12-13 2011-12-31 Schering Corporation Polycyclic indazole derivatives that are erk inhibitors
EP2496575A1 (en) 2009-11-04 2012-09-12 Novartis AG Heterocyclic sulfonamide derivatives useful as mek inhibitors
US20120322814A1 (en) 2009-10-16 2012-12-20 The Regents Of The University Of California Methods of inhibiting ire1
US20130303599A1 (en) 2010-11-10 2013-11-14 The Board Of Trustees Of The Leland Stanford Junior University Ire1alpha endonuclease specific inhibitor with cytotoxic activity
WO2014052669A1 (en) 2012-09-26 2014-04-03 The Regents Of The University Of California Modulation of ire1

Patent Citations (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998022103A1 (en) 1996-11-16 1998-05-28 Zeneca Limited Raf kinase inhibitors
EP0986382B1 (en) 1997-05-23 2008-06-25 Bayer Pharmaceuticals Corporation Raf kinase inhibitors
WO1999032436A1 (en) 1997-12-22 1999-07-01 Bayer Corporation Inhibition of raf kinase using symmetrical and unsymmetrical substituted diphenyl ureas
US20040048861A1 (en) 2000-02-05 2004-03-11 Guy Bemis Compositions useful as inhibitors of ERK
US20040102506A1 (en) 2000-02-05 2004-05-27 Michael Hale Pyrazole compositions useful as inhibitors of ERK
US6987119B2 (en) 2000-03-06 2006-01-17 Smithkline Beecham P.L.C. Imidazol-2-carboxamide derivatives as raf kinase inhibitors
US20050090536A1 (en) 2000-09-15 2005-04-28 Hale Michael R. Isoxazole compositions useful as inhibitors of ERK
EP1317453B1 (en) 2000-09-15 2006-08-09 Vertex Pharmaceuticals Incorporated Isoxazoles and their use as inhibitors of erk
AU2002248381A1 (en) 2001-01-25 2002-08-06 Board Of Regents, The University Of Texas System Inhibition of erk to reduce or prevent tolerance to and dependence on opioid analgesics
WO2002058687A2 (en) 2001-01-25 2002-08-01 Board Of Regents, The University Of Texas System Inhibition of erk to reduce or prevent tolerance to and dependence on opioid analgesics
EP2332922A1 (en) 2001-10-23 2011-06-15 Merck Serono S.A. N-substituted azoles and their use as MEK-1 and/or ERK-2 modulators
US20040096855A1 (en) 2001-12-24 2004-05-20 Michael Stratton Genes
WO2003082272A1 (en) 2002-03-29 2003-10-09 Chiron Corporation Substituted benzazoles and use thereof as raf kinase inhibitors
WO2005004864A1 (en) 2003-07-11 2005-01-20 Merck Patent Gmbh Benzimidazole derivatives as raf kinase inhibitors
WO2005028444A1 (en) 2003-09-24 2005-03-31 Novartis Ag 1,4-disubstituted isoquinilone derivatives as raf-kinase inhibitors useful for the treatment of proliferative diseases
WO2005032548A1 (en) 2003-09-29 2005-04-14 Chiron Corporation Substituted benzazoles and use thereof as inhibitors of raf kinase
WO2005047542A1 (en) 2003-10-16 2005-05-26 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Treatments for inhibiting development and progression of nevi and melanoma having braf mutations
WO2005051300A2 (en) 2003-11-19 2005-06-09 Array Biopharma Inc. Bicyclic inhibitors of mek and methods of use thereof
US20050159385A1 (en) 2003-12-19 2005-07-21 Mohapatra Shyam S. JAK/STAT inhibitors and MAPK/ERK inhibitors for RSV infection
WO2005123696A1 (en) 2004-06-15 2005-12-29 Astrazeneca Ab Substituted quinazolones as anti-cancer agents
WO2006024834A1 (en) 2004-08-31 2006-03-09 Astrazeneca Ab Quinazolinone derivatives and their use as b-raf inhibitors
US20100004234A1 (en) 2004-09-27 2010-01-07 Kosan Biosciences Incorporated Specific kinase inhibitors
WO2006067446A1 (en) 2004-12-22 2006-06-29 Astrazeneca Ab Pyridine carboxamide derivatives for use as anticancer agents
WO2006084015A2 (en) 2005-02-04 2006-08-10 Genentech, Inc. Raf inhibitor compounds and methods
WO2007044084A2 (en) 2005-05-18 2007-04-19 Array Biopharma Inc. Heterocyclic inhibitors of mek and methods of use thereof
WO2006125101A2 (en) 2005-05-20 2006-11-23 Array Biopharma Inc. Raf inhibitor compounds and methods of use thereof
WO2007002325A1 (en) 2005-06-22 2007-01-04 Plexxikon, Inc. Pyrrolo[2,3-b] pyridine derivatives as protein kinase inhibitors
US20090181371A1 (en) 2005-07-13 2009-07-16 Samowitz Wade S Methods and compositions related to a braf mutation and microsatellite stability
US20070049591A1 (en) 2005-08-25 2007-03-01 Kalypsys, Inc. Inhibitors of MAPK/Erk Kinase
WO2007025090A2 (en) 2005-08-25 2007-03-01 Kalypsys, Inc. Heterobicyclic and - tricyclic inhibitors of mapk/erk kinase
WO2007030377A1 (en) 2005-08-30 2007-03-15 Novartis Ag Substituted benzimidazoles as kinase inhibitors
WO2007027855A2 (en) 2005-09-01 2007-03-08 Array Biopharma Inc. Raf inhibitor compounds and methods of use thereof
HRP20110892T1 (en) 2005-12-13 2011-12-31 Schering Corporation Polycyclic indazole derivatives that are erk inhibitors
WO2007076245A2 (en) 2005-12-21 2007-07-05 Array Biopharma Inc. Novel hydrogen sulfate salt
US20070232610A1 (en) 2006-02-16 2007-10-04 Yongqi Deng Novel compounds that are ERK inhibitors
HK1117159A1 (en) 2006-02-16 2010-12-31 Schering Corp Pyrrolidine derivatives as erk inhibitors
WO2007101224A2 (en) * 2006-02-27 2007-09-07 The Board Of Trustees Of The Leland Stanford Junior University Inhibitors of the unfolded protein response and methods for their use
WO2007113505A2 (en) 2006-03-30 2007-10-11 The University Court Of The University Of Edinburgh Culture medium containing kinase inhibitors. and uses thereof
WO2008055236A2 (en) 2006-10-31 2008-05-08 Takeda Pharmaceutical Company Limited Mapk/erk kinase inhibitors
US20090186379A1 (en) 2006-11-13 2009-07-23 Thomas David Reed ERK ligands and polynucleotides encoding ERK ligands
WO2008115890A2 (en) 2007-03-19 2008-09-25 Takeda Pharmaceutical Company Limited Mapk/erk kinase inhibitors
WO2008120004A1 (en) 2007-04-02 2008-10-09 Astrazeneca Ab Combination of a mek- inhibitor and a b-raf inhibitor for the treatment of cancer
WO2008124085A2 (en) 2007-04-03 2008-10-16 Exelixis, Inc. Methods of using combinations of mek and jak-2 inhibitors
US20100130519A1 (en) 2007-04-13 2010-05-27 Stephen Robert Wedge Combination therapy comprising azd2171 and azd6244 or mek-inhibitor ii
US20110038876A1 (en) 2007-06-18 2011-02-17 Robert Sun Heterocyclic compounds and use thereof as erk inhibitors
WO2009018233A1 (en) 2007-07-30 2009-02-05 Ardea Biosciences, Inc. Derivatives of n-(arylamino) sulfonamides including polymorphs as inhibitors of mek as well as compositions, methods of use and methods for preparing the same
WO2009018238A1 (en) 2007-07-30 2009-02-05 Ardea Biosciences, Inc. Combinations of mek inhibitors and raf kinase inhibitors and uses thereof
WO2009026487A1 (en) 2007-08-22 2009-02-26 The Ohio State University Research Foundation Methods and compositions for inducing deregulation of epha7 and erk phosphorylation in human acute leukemias
TW200934775A (en) 2007-11-12 2009-08-16 Takeda Pharmaceutical MAPK/ERK kinase inhibitors
US20100004247A1 (en) 2007-12-12 2010-01-07 Astrazeneca Ab Combination comprising a mek inhibitor and an aurora kinase inhibitor 188
WO2009146034A2 (en) 2008-03-31 2009-12-03 Takeda Pharmaceutical Company Limited Mapk/erk kinase inhibitors and methods of use thereof
US20110105521A1 (en) 2008-07-11 2011-05-05 Novartis Ag Combination of (a) a phosphoinositide 3-kinase inhibitor and (b) a modulator of ras/raf/mek pathway
US20110319436A1 (en) 2008-09-15 2011-12-29 The Regents Of The University Of California Methods and Compositions for Modulating IRE1, SRC, and ABL Activity
WO2010114928A2 (en) 2009-04-03 2010-10-07 F.Hoffmann-La Roche Ag Compositions and uses thereof
WO2011041152A1 (en) 2009-09-30 2011-04-07 Schering Corporation Novel compounds that are erk inhibitors
US20120322814A1 (en) 2009-10-16 2012-12-20 The Regents Of The University Of California Methods of inhibiting ire1
EP2496575A1 (en) 2009-11-04 2012-09-12 Novartis AG Heterocyclic sulfonamide derivatives useful as mek inhibitors
WO2011067356A2 (en) 2009-12-03 2011-06-09 Novartis Ag Polymorphs of a mek inhibitor
WO2011067348A2 (en) 2009-12-03 2011-06-09 Novartis Ag Mek inhibitor salts and solvates thereof
WO2011095807A1 (en) 2010-02-07 2011-08-11 Astrazeneca Ab Combinations of mek and hh inhibitors
WO2011163330A1 (en) 2010-06-24 2011-12-29 Merck Sharp & Dohme Corp. Novel heterocyclic compounds as erk inhibitors
US20130303599A1 (en) 2010-11-10 2013-11-14 The Board Of Trustees Of The Leland Stanford Junior University Ire1alpha endonuclease specific inhibitor with cytotoxic activity
WO2014052669A1 (en) 2012-09-26 2014-04-03 The Regents Of The University Of California Modulation of ire1

Non-Patent Citations (32)

* Cited by examiner, † Cited by third party
Title
ALLEN, LEE ET AL., SEMINARS IN ONCOLOGY, vol. 30, October 2003 (2003-10-01), pages 105 - 106
ALLEN; MEYER, SEMIN ONCOL., vol. 30, no. 16, October 2003 (2003-10-01), pages 105 - 16
ARAGON, T. ET AL., NATURE, vol. 457, 2009, pages 736 - 740
BAST ET AL.: "Cancer Medicine", B. C. DECKER INC.
BELDEN SARAH ET AL: "MEK and RAF inhibitors for BRAF-mutated cancers", EXPERT REVIEWS IN MOLECULAR MEDICINE, CAMBRIDGE UNIVERSITY PRESS, CAMBRIDGE, vol. 14, 1 October 2012 (2012-10-01), pages e17/1 - 11, XP009182295, ISSN: 1462-3994, DOI: 10.1017/ERM.2012.11 *
BOKEMEYER ET AL., KIDNEY INT., vol. 49, 1996, pages 1187
CARGNELLO M; ROUX PP, MICROBIOL MOL BIOL REV., vol. 75, no. 1, March 2011 (2011-03-01), pages 50 - 83
CARR ET AL., PSYCHOPHARMACOLOGY (BERL, vol. 201, no. 4, January 2009 (2009-01-01), pages 495 - 506
CARR ET AL., PSYCHOPHARMACOLOGY (BERL, vol. 201, no. 4, January 2009 (2009-01-01), pages 495 - 5060
CROSS ET AL., PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 109, no. 15, 2012, pages E869 - 78
CURTIN ET AL., N ENGL J MED, vol. 353, 2005, pages 2135 - 47
DAVIES ET AL., BIOCHEM J., vol. 351, 2000, pages 95 - 105
DAVIES ET AL., NATURE, vol. 417, 2002, pages 949 - 54
DOWNEY ET AL., J BIOL CHEM, vol. 271, no. 35, 1996, pages 21005 - 21011
FAVATA, M. ET AL.: "Identification of a novel inhibitor of mitogen-activated protein kinase", J. BIOL. CHEM., vol. 273, 1998, pages 18623, XP002141538, DOI: doi:10.1074/jbc.273.29.18623
FECHER ET AL., CURR OPIN ONCOL, vol. 20, 2008, pages 183 - 189
FLAHERTY KEITH T ET AL: "Combined BRAF and MEK Inhibition in Melanoma with BRAF V600 Mutations", vol. 367, no. 18, 1 November 2012 (2012-11-01), pages 1694 - 1703, XP002725869, ISSN: 0028-4793, Retrieved from the Internet <URL:http://www.nejm.org/doi/pdf/10.1056/NEJMoa1210093> [retrieved on 20120929], DOI: 10.1056/NEJMOA1210093 *
IKAWA, MOL CELL BIOL., vol. 8, no. 6, 1988, pages 2651 - 4
KLAUS P. HOEFLICH ET AL., CANCER RES., vol. 69, 1 April 2009 (2009-04-01), pages 3042 - 3051
LORUSSO ET AL., JOURNAL OF CLINICAL ONCOLOGY, vol. 23, no. 23, 2005, pages 5281 - 5293
NATURE REVIEWS DRUG DISCOVERY, vol. 12, 2013, pages 703 - 719
PAPANDREOU ET AL., BLOOD, vol. 117, no. 4, 2011, pages 1311 - 4
PEYSSONNAUX ET AL., BIOL CELL, vol. 93, no. 1-2, 2001, pages 53 - 62
PEYSSONNAUX ET AL., BIOL CELL., vol. 93, no. 1-2, 2001, pages 53 - 62
POSCH, ONCOTARGET, vol. 4, no. 4, 2013, pages 494 - 5
PRIOR ET AL., CANCER RES, 2012, pages 2457 - 67
TECLE ET AL., MEDICINAL CHEMISTRY LETTERS, vol. 19, no. 1, 1 January 2009 (2009-01-01), pages 226 - 229
TECLE ET AL., NIC & MEDICINAL CHEMISTRY LETTERS, vol. 19, no. 1, 1 January 2009 (2009-01-01), pages 226 - 229
TSAI ET AL., PNAS, vol. 105, no. 8, 2008, pages 3041
WAGLE ET AL., J CLIN ONCOL, vol. 29, no. 22, 2011, pages 3085 - 96
WILLIAMS; ROBERTS, CANCER METASTASIS REV., vol. 13, no. 1, 1994, pages 105 - 16
ZHANG ET AL., BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 10, 2000, pages 2825 - 2828

Similar Documents

Publication Publication Date Title
Wang et al. CRNDE, a long-noncoding RNA, promotes glioma cell growth and invasion through mTOR signaling
Zhao et al. The clinical development of MEK inhibitors
Lee et al. Drug resistance via feedback activation of Stat3 in oncogene-addicted cancer cells
Von Roemeling et al. Stearoyl-CoA desaturase 1 is a novel molecular therapeutic target for clear cell renal cell carcinoma
Ma et al. Novel agents on the horizon for cancer therapy
Na et al. Oncogenic potential of Nrf2 and its principal target protein heme oxygenase-1
Franco et al. CDK4/6 inhibitors have potent activity in combination with pathway selective therapeutic agents in models of pancreatic cancer
Sun et al. MicroRNA-99a/100 promotes apoptosis by targeting mTOR in human esophageal squamous cell carcinoma
Donev et al. Transient PI3K inhibition induces apoptosis and overcomes HGF-mediated resistance to EGFR-TKIs in EGFR mutant lung cancer
Han et al. Hypoxia-inducible factor 1α and antiangiogenic activity of farnesyltransferase inhibitor SCH66336 in human aerodigestive tract cancer
Zhou et al. MicroRNA-340 suppresses osteosarcoma tumor growth and metastasis by directly targeting ROCK1
Patel et al. Therapeutic implications of the emerging molecular biology of uveal melanoma
Cruz-Monserrate et al. Integrin α6β4 promotes migration, invasion through Tiam1 upregulation, and subsequent Rac activation
Zhou et al. MicroRNA-21 regulates the migration and invasion of a stem-like population in hepatocellular carcinoma
Wang et al. Cardiac glycosides inhibit p53 synthesis by a mechanism relieved by Src or MAPK inhibition
Luo et al. S-adenosylmethionine inhibits the growth of cancer cells by reversing the hypomethylation status of c-myc and H-ras in human gastric cancer and colon cancer
Lee et al. WNT signaling in glioblastoma and therapeutic opportunities
Huang et al. B-Raf and the inhibitors: from bench to bedside
Sáez-Ayala et al. Directed phenotype switching as an effective antimelanoma strategy
Kudchadkar et al. Targeting mutant BRAF in melanoma: current status and future development of combination therapy strategies
Alla et al. E2F1 confers anticancer drug resistance by targeting ABC transporter family members and Bcl-2 via the p73/DNp73-miR-205 circuitry
McCubrey et al. Effects of mutations in Wnt/β-catenin, hedgehog, Notch and PI3K pathways on GSK-3 activity—Diverse effects on cell growth, metabolism and cancer
McCain The MAPK (ERK) pathway: investigational combinations for the treatment of BRAF-mutated metastatic melanoma
Zhang et al. miR-874 functions as a tumor suppressor by inhibiting angiogenesis through STAT3/VEGF-A pathway in gastric cancer
Johnson et al. Treatment of NRAS-mutant melanoma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15732467

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15732467

Country of ref document: EP

Kind code of ref document: A1