RU2795707C1 - TRANSFORMANT OGATAEA HAGLERORUM AS A PRODUCER OF THERMOSTABLE α-AMYLASE - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: transformant of the yeast Ogataea haglerorum, producing a thermostable α-amylase and containing an optimized synthetic gene in the chromosome, the nucleotide sequence of which is shown in the sequence listing under the number SEQ ID NO:1. The Ogataea haglerorum RNCIM Y-4980 strain, resistant to geneticin, and the strain Ogataea haglerorum RNCIM Y-5018, sensitive to geneticin, which are producers of thermostable α-amylase.

EFFECT: expansion of the arsenal of yeast recombinant microorganisms that produce α-amylase.

3 cl, 5 dwg, 1 tbl, 6 ex

Description

Technical field

The invention relates to the field of biotechnology and genetic engineering and concerns the production of a transformant of the yeast Ogataea haglerorum that produces a thermostable α-amylase and contains an expression cassette in the chromosomal DNA, which includes a synthetic gene sequence with codons optimized for methylotrophic yeast, encoding the target enzyme.

State of the art

α-Amylase (α-1,4-glucan-4-glucanohydrolase, E.C.3.2.1.1) is an endo-enzyme that hydrolyzes α-1,4-glycosidic bonds in the starch molecule and thus decomposes the amylose component of starch.

α-Amylase is one of the leaders in the global enzyme market, accounting for 25-30% of the market [Biotechnol Appl Biochem., 2021, 1-10. DOI: 10.1002/bab.2140].

Source of genes encoding α-amylases. are plants, animals and microorganisms, but the dominant source of α-amylases for industrial use are bacteria and fungi [Process Biochem., 2003, 38, 1599-1616. https://doi.org/10.1016/S0032-9592(03)00053-α-amylase is used in the food industry to liquefy starch-containing vegetable raw materials in order to obtain glucose-fructose syrups. Enzymatic conversion of starch includes 3 stages: gelatinization, liquefaction and saccharification. The first two stages proceed at a high temperature: gelatinization of starch granules is carried out at a temperature of 105-110°C and pH 5.8-6.5 for 5 minutes, and starch is liquefied at a temperature of 95°C for 2-3 hours, therefore thermostable α-amylases are required, which have a temperature optimum of about 90°C [Appl Biochem Biotechnol., 2010, 160 (8), 2401-2414. DOI: 10.1007/s12010-009-8735-4].

Another important use of α-amylase is in the textile industry, where it is used to desize fabrics. This process takes place at high temperature (80° C.) for a short time (10 min) and uses thermostable α-amylases [WO 99/35325].

Also, α-amylases are used in detergents, in the paper and alcohol industries [Process Biochem., 2003, 38, 1599 - 1616. https://doi.org/10.1016/S0032-9592(03)00053-01.

The maximum requirements of the industrial starch hydrolysis process correspond to α-amylases from various Bacillus species [US2012252101; CA2798504; US2012282672; Int J Biol Macromol., 2010, 47(2), 288-91. DOI: 10.1016/j.ijbiomac.2010.04.006].

Thermostable α-amylases from B. licheniformis, B. amiloliquefaciens and B. stearothermophilus and their mutant variants, which have high amino acid sequence homology (at least 79%) and are industrially important, belong to the class Termamyl-like α-amylases [WO 99/ 23211, US20030170769 A1]. Among them, α-amylase from B. licheniformis is distinguished by exceptional temperature stability (more than 80%) of activity remains after heating at a temperature of 90 ° C for 30 minutes, the optimum activity temperature is 80-85 ° C) and a low need for calcium ions [J . of Biological Chemistry, 1989, 264(32), 18933-18938], followed by α-amylase from B. stearothermophilus (60% residual activity after heating at 80°C for 60 min [Applied and Environmental Microbiology, 1983, 46( 5), 1059-1065], while α-amylase from B. amiloliquefaciens is rapidly inactivated at 90°C (half-life at 90°C is almost 100 times lower than that of α-amylase from B. licheniformis), but has a higher specific activity than α-amylase from B. licheniformis [J. of Biological Chemistry, 1989, 264(32), 18933-18938; Can. J. Microbiol., 2004, 50, 1-17. doi: 10.1139 /W03-076].

Sources of fame describe producers of thermostable α-amylase based on the methylotrophic yeast Komagataella phaffii (Pichia pastoris), which is a widely used model organism for the expression of heterologous genes under the control of a strong methanol-regulated promoter of the AOX1 gene.

A P. pastoris GS115 transformant containing a gene with P. pastoris yeast-optimized codons (BlAmy-opt) encoding natural B. licheniformis α-amylase (GenBank M38570) is described. The transformant, when cultivated in flasks in a rich medium, produces α-amylase with an activity of 420 U/ml QOL after 144 hours of cultivation at 30°C [BioMed Research International, 2015, Article ID 248680, 9 P. http://dx.doi. org/10.1155/2015/248680].

A P. pastoris GS115 transformant containing a gene with P. pastoris yeast-preferred codons (Pic-bla) encoding α-amylase from B. licheniformis WX-02 is described (NCBI Reference Sequence: СР012110.1). The transformant, when cultivated in flasks in a rich medium, produces α-amylase with an activity of 900 units/ml QOL after 168 hours of cultivation at 28°C [3 Biotech, 2019, 9, 427. https://doi.org/10.1007/s13205- 019-1943-x].

Another known methylotrophic system for heterologous expression is the thermotolerant yeast Ogataea (Hansenula). Yeast of the genus Ogataea, like the yeast P. pastoris, has a unique organization and regulation of metabolism in the presence of methanol due to the presence of strong promoters induced by methanol. Like P. pastoris, yeasts of the genus Ogataea combine the advantages of being easy to grow on an inexpensive growth medium with a high secretion ability, and when grown in a bioreactor, they allow obtaining biomass with a high cell density, which contributes to a high yield of the target product [FEMS Yeast Res., 2005, 5 , 1079-1096; Microb. Cell Fact, 2006, 5, 39; Curr Microbiol. 2014, 69, 143-148. DOI 10.1007/s00284-014-0568-x; FEMS Microbiology Letters, 2019, 366, fnz052. doi:10.1093/femsle/fnz052].

Unlike P. pastoris, yeasts of the genus Ogataea are thermotolerant, which allows fermentation at a temperature of 37°C. Increasing the temperature of the fermentation process reduces contamination and the cost of cooling the bioreactor [Appl. microbiol. Biotechnol., 2010, 85, 861-867. doi: 10.1007/s00253-009-2248-5] and as a result shortens the fermentation time.

For the yeast O. haglerorum, genetic technologies have been developed for constructing producer strains, including expression vectors and a method for introducing DNA into recipient cells [Biotechnology, 2019, 35 (6), 51-56]. Yeast O. haglerorum was used to obtain producers of α-mannanase from B. subtilis, phytase from E. coli [RU2747782, RU2764793, RU2771079].

Currently, to achieve the properties of the enzyme required for the enzymatic hydrolysis of starch, including high thermal stability and specific activity, and low dependence on calcium ions, hybrid proteins (chimeras) are used, in particular, obtained by combining DNA sequences encoding α-amylases from various bacilli both wild-type and mutant [EP 0252666, WO 97/41213, WO 99/46399, WO 99/23211, US 2010144575, US 2012208251].

B. licheniformis, B. amyloliquefaciens, B. subtilis, B. stearothermophilus [Biotechnol Appl Biochem. 2021; 1-10. DOI: 10.1002/bab.2140].

[WO 99/46399] describes a hybrid Termamyl-type α-amylase, the mature peptide of which consists of amino acid residues from the α-amylase from B. B. licheniformis with substitutions H156Y, A181T, N190F, A209V Q264S.

The great advantage of yeast over bacillary producers is that they predominantly secrete recombinant proteins and few of their own secretory proteins.

However, it is known that the process of expression of heterologous genes and protein biosynthesis is quite selective and depends on the species of the recipient strain [Applied and Environmental Microbiology, 1983, 46(5), 1059-1065], and even more so, the result of expression cannot be predicted when choosing a strain- producer from another kingdom of microorganisms.

We have not found any works on the expression of chimeric α-amylase genes in yeast.

The technical problem to be solved by the claimed invention is the improvement of methods for constructing yeast strains producing thermostable α-amylase.

Disclosure of the essence of the invention

The technical result of the claimed invention is the expansion of the arsenal of yeast recombinant microorganisms producing α-amylase.

The technical result is achieved by obtaining a transformant of the yeast Ogataea haglerorum that produces and secretes a thermostable α-amylase into the culture liquid, containing an optimized synthetic gene encoding the specified α-amylase in the chromosome, the nucleotide sequence of which is shown in the sequence listing under the number SEQ ID NO:1.

This sequence was synthesized based on the sequence described in [WO 99/46399] by codon optimization for the methylotrophic yeast O. haglerorum .

Optimization of the nucleotide sequence for the gene encoding the hybrid α-amylase of the Termamyl type is carried out on the basis of codon frequency data (http://www.kazusa.or.jp/codon/P.html). The resulting sequence (hereinafter AMYsyni), 1467 bp in size. shown in the sequence listing under the number SEQ ID NO:1. The sequence was synthesized at the Twist company (https://www.twistbioscience.com/) by order of the National Research Center "Kurchatov Institute" - State Research Institute of Genetics.

Brief description of the drawings

The invention is illustrated by the following figures.

Fig. 1 - Expression cassette.

Fig. 2 - Relative activity of α-amylase at different pH values.

Fig. 3 - Relative activity of α-amylase at various temperatures.

Fig. 4 - Residual activity of α-amylase after heating the QOL with the enzyme at temperatures of 80-100°C for 5, 10, 15, 20, 30 and 60 minutes.

Fig. 5 - SDS-PAGE electrophoresis of recombinant α-amylase, where:

M - molecular weight marker (kDa)

1 - Cell-free QOL obtained after cultivation of the strain O. haglerorum N388;

2 - Cell-free QOL treated with EndoH enzyme;

Implementation of the invention

Obtaining the claimed transformant includes:

- transformation into yeast cells Ogataea haglerorum of an expression cassette containing

- a synthetic gene, the nucleotide sequence of which is given in the sequence listing under the number SEQ ID N0:1, called AMYsynt and encoding a thermostable α-amylase,

- a promoter active in the yeast Ogataea (Hansenula),

- a signal peptide for the secretion of the enzyme into the culture fluid,

- Terminator,

- marker gene with regulatory elements, HARS and, preferably,

- site for homologous integration into chromosomal DNA.

The process of transformation of the expression cassette into cells of the yeast Ogataea (Hansenula) is carried out, in particular, by the method of electroporation [Yeast Metabolic Engineering: Methods and Protocols, Methods in Molecular Biology, 2014, 1152, Chapter 3, 43-62. DOI 10.1007/978-1-4939-0563-8_3] or the lithium acetate method [Curr. Genet. 1990, 18, 169-170. https://doi.org/10.1007/BF003126061, and integration of the expression cassette is carried out by homologous or non-homologous recombination;

Yeast transformant Ogataea haglerorum is obtained - a producer of thermostable α-amylase.

To increase the productivity of the obtained transformant, the following is carried out:

- removal of a selective marker that provides yeast resistance to geneticin (G418) due to the induction of recombination at lox sites in the presence of cre-recombinase;

- increase in the number of copies of the expression cassette in the chromosomal DNA of the O. haglerorum transformant by re-transformation with the cassette;

- analysis of the obtained transformants for the ability to secrete active α-amylase into the culture liquid during fermentation.

The most productive strain of Ogataea haglerorum N388 is selected, from which a marker-free strain of Ogataea haglerorum N404 is then obtained by recombination at lox sites in the presence of cre-recombinase.

The construction of the expression cassette is carried out by standard methods of genetic engineering [Sambrook J., Maniatis T., Fritsch E. Molecular cloning: a laboratory manual. - N.Y.: Cold Spring Harbor Laboratory, 1989] using genetic elements suitable for working with yeasts of the genus Ogataea (Hansenula). As promoters, for example, MOX, FMD, DAS, TPS1, FLD1, PHO1, YNT1, YNI1, YNR1, GAP, ACT, PMA1, AOX, MAL, AMO, TEF1, PEX14, PEX11 can be used [FEMS Yeast Research, 2005 , 5, 1079-1096. doi:10.1016/j.femsyr.2005.06.004; Curr Microbiol., 2014, 69, 143-148. DOI 10.1007/s00284-014-0568-x; FEMS Microbiol Lett., 2018, 365, fny238, 6 p.doi: 10.1093/femsle/fny238; FEMS Yeast Res., 2012, 12, 271-278. DOI: 10.1111/j.1567-1364.2011.00772.x].

As signal peptides, for example, PHO1 leader sequence, MFα pre-proleader sequence from Saccharomyces cerevisiae or Ogataea thermomethanolica, GAM1 from Schwanniomyces occidentalis [FEMS Yeast Research, 2005, 5, 1079-1096. doi:10.1016/j.femsyr.2005.06.004; Curr Microbiol., 2014, 69, 143-148. DOI 10.1007/s00284-014-0568-x; Appl Biochem Biotechnol., 2016, 178(4), 710-724. doi: 10.1007/s12010-015-1904-8].

As transcription terminators, for example, the sequences of the MOX, AMO1, PH05, AOX1 genes are used [Appl. microbiol. Biotechnol, 2000, 54, 741-750; FEMS Yeast Res., 2012, 12, 271-278. DOI: 10.1111/j.1567-1364.2011.00772.x; FEMS Yeast Research, 2003, 4, 185-193. doi:10.1016/S1567-1356(03)00148-X; FEMS Yeast Research, 2003, 4, 175-184. doi: 10.1016/S1567-1356(03)00150-8].

As selectable markers, for example, genes of resistance to antibiotics zeocin, or geneticin (G418), or hygromycin B, or norseothricin, or blasticidin, as well as genes complementing auxotrophic mutations in the genome of the yeast of the genus Ogataea, such as LEU2, HIS3, TRP3 are used. , ADE2, URA3, MET6, ADE11 [FEMS Yeast Res, 2012, 12, 271-278. DOI: 10.1111/j.1567-1364.2011.00772.x; Yeast, 1995, 11,343-353].

As sequences that provide efficient transformation and autonomous replication, use, for example, HARS1, HARS2, HARS3, HARS 36 [Mol. Gene Genet. 1986, 202, 302-308; Yeast, 1995, 11, 343-353; Journal of Bacteriology, 1996, 178(15), 4420-4428].

As sites for homologous integration, for example, MOX, TRP, URA3, LEU2, GAP, gene cluster for ribosomal DNA, HARS, AMO, TEF1 gene sequences are used [FEMS Yeast Research, 2005, 5, 1079-1096. doi:10.1016/j.femsyr.2005.06.004; FEMS Yeast Research, 2003, 4, 185-193. doi:10.1016/S1567-1356(03)00148-X; FEMS Yeast Res, 2012, 12, 271-278. DOI: 10.1111/j.1567-1364.2011.00772.x] or other sequences homologous to regions of the yeast chromosome of the genus Ogataea.

The problem was also solved by the fact that the obtained strain O. haglerorum N388 VKPM Y-4980 is a producer of thermostable α-amylase, resistant to geneticin (G418).

The problem was also solved by the fact that the obtained strain O. haglerorum N404 - VKPM Y-5018 - producer of thermostable α-amylase, sensitive to geneticin (G418).

In the sources of fame, the yeast of the species O. haglerorum is not described, producing recombinant α-amylase. Their ability to produce and secrete the thermostable α-amylase enzyme was shown by us for the first time.

Example 1. Obtaining a transformant of the yeast Ogataea haglerorum - a producer of thermostable α-amylase

Yeast transformant O. haglerorum is obtained by introducing into the recipient strain O. haglerorum VKPM Y-2584 [Int. J. Syst. Evol. Microbiol., 2017, 67, 2465-2469. DOI 10.1099/ijsem.0.002012] expression cassette containing a synthetic gene with codons optimized for methylotrophic yeast encoding α-amylase.

To construct an expression plasmid, the pMOX-MFopt-HARS vector (6966 bp) obtained on the basis of the pMOX-Km-HARS vector [Biotechnology, 2019, 35(6), 51-56] is used, in which the DNA fragment containing the signal the MFα sequence of Saccharomyces cerevisiae is replaced with the MFα opt signal sequence, codon-optimized for the yeast of the genus Ogataea, shown in the sequence listing under SEQ ID NO:2. The sequence of SEQ ID NO:2 is identical to the sequence of nucleotides of the signal peptide MFα Saccharomyces cerevisiae by 89.7% according to the program AlignX in Vector NTI.

The sequence of SEQ ID NO:1 is inserted into the pMOX-MFopt-HARS vector at the EcoRI and NotI sites, and the 8433 bp pMOX-AMYsynt expression plasmid is obtained.

Plasmid pMOX-AMYsynt is digested with BpiI and a 5536 bp expression cassette is isolated. (figure 1), which includes the following genetic elements:

1. Synthetic AMYsynt gene inserted into the reading frame with the nucleotide sequence of the optimized signal peptide MFα opt from the yeast Saccharomyces cerevisiae, the transcription of which is under the control of the pMOX promoter, generated using the chromosomal DNA of the Ogataea polymorpha strain VKPM Y-1546 (line CBS4732).

2. Transcription terminator tMOX generated using chromosomal DNA of Ogataea polymorpha strain VKPM Y-1546.

3. Yeast selective marker KmMX flanked by lox66 and lox71 sites, whose transcription is under the control of the pGAPD promoter of the glyceraldehyde-3-phosphate dehydrogenase gene, generated using the chromosomal DNA of the Ogataea polymorpha strain VKPM Y-1546 and the transcription terminator tTEF. The resistance of the yeast Ogataea haglerorum to the antibiotic geneticin (G418) is provided by the KmMX marker.

4. HARS sequence generated using chromosomal DNA of the Ogataea polymorpha strain VKPM Y-916 (DL1 line), which ensures the preservation of the transformable DNA in the cells of the recipient strain and is a possible site of integration.

5. Integration region - nucleotide sequence of the 3' region of the MOX region.

The expression cassette is transformed into a strain of O. haglerorum VKPM Y-2584. Competent cells are prepared as described [Valeria Mapelli (ed.), Yeast Metabolic Engineering: Methods and Protocols, Methods in Molecular Biology. - Vol.1152. - Chapter 3. DOI 10.1007/978-l-4939-0563-8_3, © Springer Science+Business Media, LLC 2014]. Electroporation was performed on a GenePulser Xcell electroporator (Bio-Rad) at 1500 V, 200 ohms, 25uF. After electroporation, 1 ml of YP liquid medium (wt.%: yeast extract - 1, peptone - 2, water - the rest) is added to the cells with the addition of glucose (2 wt.%), the cell suspension is transferred into sterile test tubes of 1.5 ml and incubated at 37° C. for 60 min with shaking.

The selection of transformants is carried out on YP agar medium (wt. %: yeast extract - 1, peptone - 2, agar - 2, water - the rest) with the addition of glucose (2 wt. %) and geneticin (G418) in an amount of 300 μg / ml at temperature 37°C for 3 days.

The selection of the most productive transformants is carried out according to the results of their cultivation according to the following scheme:

- The inoculum is grown in test tubes (50 ml) with 5 ml of YP liquid nutrient medium supplemented with glucose (2 wt %) at 37°C for 24 hours on a shaker (250 rpm). The inoculation of the fermentation medium is carried out in a ratio of 1/40.

- Fermentation is carried out at 37°C on a rocking chair (250 rpm) in YP nutrient medium with the addition of glucose (2 wt.%) for 6 days. After 24 hours of cultivation, induction with methanol is started, which is added in an amount of 3 vol.%, then the same amount of methanol is added for 48 hours of cultivation. The strain O. haglerorum VKPM Y-2584 containing the pMOX-MFopt-HARS expression vector is used as a control.

The productivity of O. haglerorum transformants is assessed by the activity of secreted α-amylase. For this, transformant cells are precipitated by centrifugation, and the supernatant is used to determine amylase activity according to the method with 3,5-dinitrosalicylic acid (DNS) [Anal. Chem. - 1959. - Vol.31. - No. 3. - P.426-428], using glucose as a standard. Soluble starch is used as a substrate.

The standard reaction mixture consists of 0.1 ml of a solution of 1% substrate (w/v) in 0.1 M phosphate buffer, pH 7.0 and 0.1 ml of the enzyme sample (supernatant). Before the reaction, enzyme samples are diluted 10, 100, 300, 500, 800, 1000 times with sterile water. Reaction time 10 minutes. Then add 0.3 ml of 1% SDS solution to the tubes, mix and place the tubes in a thermostat at 98°C for 5 minutes. The optical density of all samples (calibration, experimental samples, control samples) is determined at a wavelength of 540 nm in 96-well plates on a Multiskan spectrum spectrophotometer (Thermo Fisher Scientific, USA) using the Skanlt RE for MSS 2.4.4 program. All measurements are carried out three times.

A unit of enzymatic activity of α-amylase (1 unit) is taken as the amount of enzyme acting on the substrate with the release of 1 μM of reducing sugars (glucose) per minute under the following reaction conditions: temperature 70°C, pH 7.0, duration of hydrolysis 10 minutes.

Among the tested transformants, the most productive, stable transformant of O. haglerorum N372 is selected, which, when cultivated in test tubes, produces α-amylase with an activity of 795 units/ml QOL.

Testing for the stability of the inheritance of the trait "resistance to geneticin" is carried out as follows. The transformant O. haglerorum N372 is grown under non-selective conditions, in a liquid YP medium with glucose (2 wt.%), in test tubes on a shaker at 37°C for 24 h, then five successive transfers of the culture are made from non-selective conditions into test tubes with fresh medium. YP containing glucose (2 wt. %). The tubes are incubated on a shaker at 37°C for 24 hours. Then the culture is seeded to individual colonies on Petri dishes with agarized non-selective YP medium containing glucose (2 wt.%). Using a replicator, 100 independent colonies are selected and analyzed for their ability to grow on YP selective medium with glucose (2 wt.%) and geneticin (300 μg/ml) and control medium - YP with glucose (2 wt.%). The absence of colonies that do not grow on the selective medium with the antibiotic indicates that the expression cassette is contained in the transformant cells as part of the chromosomal DNA.

Example 2 Preparation of O. haglerorum strain N388 resistant to geneticin

To increase the productivity of the transformant, which is assessed by the activity of α-amylase in the culture fluid, re-transformation is carried out with an expression cassette, for which the selective marker KmMX is removed from the chromosomal DNA of the transformant O. haglerorum N372 by recombination at lox sites in the presence of Cre recombinase [FEMS Yeast Res. 2014, 14, 1048-1054. DOI: 10.1111/1567-1364.12197]. From the transformant, a colony was selected that did not grow on YP medium with glucose (2 wt %) and geneticin (300 μg/ml), but grew on complete medium without antibiotic, and was named O. haglerorum N382. Clone O. haglerorum N382, sensitive to geneticin, cultured in test tubes in YP medium with glucose (2%), followed by induction with methanol and measure the activity of α-amylase. Clone O. haglerorum N382 produces α-amylase with an activity of 800 U/ml QOL.

Competent O. haglerorum N382 cells are transformed with an expression cassette (FIG. 1). Analyze 24 independent transformants resistant to geneticin. The selection of the most productive transformants is carried out according to the results of their cultivation in test tubes. As a control, in vitro cultivation of the parent strain O. haglerorum N382 is carried out. One stable, most productive transformant of O. haglerorum N388 was selected, which produces α-amylase with an activity of 2150 U/ml QOL for 144 hours of cultivation, is resistant to geneticin and contains at least two copies of the expression cassette.

The selected transformant O. haglerorum N388, resistant to geneticin (G418), is deposited at the Bioresource Center All-Russian Collection of Industrial Microorganisms (BRC VKPM) of the National Research Center "Kurchatov Institute" - GosNIIgenetika (117545 Moscow, 1st Dorozhny proezd, 1) as an Ogataea strain haglerorum N388 VKPM Y-4980.

The strain Ogataea haglerorum N388 VKPM Y-4980 is characterized by the following features:

Cultural and morphological characteristics of the proposed strain:

When cultivated at 37°C for 48 h on YP agar medium supplemented with glucose-2 (wt %) and geneticin (300 μg/mL), the cells are oval, 3–4 μm in diameter. Cells bud, while budding is true, multilateral. True mycelium does not form.

Sporulation occurs when the culture is incubated on an agar medium of the following composition (wt %): potassium chloride - 0.5, sodium acetate - 1.0, agar - 2.0, water - the rest at 25°C for 3-4 days. Asci have a tetrahedral shape, include up to 4 ascospores.

On YP agar medium supplemented with glucose (2, wt %) and geneticin (300 µg/mL), light beige colonies with a smooth edge, matte surface, lenticular profile, and pasty consistency were observed.

Growth in a YP liquid medium with the addition of glucose-2 (wt %) and geneticin (300 μg/mL) at 37°C for 24 hours of cultivation results in a cloudy liquid, a white precipitate, no coagulation, and no parietal films.

Physiological and biochemical characteristics of the proposed strain: The strain is capable of growth in both aerobic and anaerobic conditions. The strain is capable of using glucose, glycerol, methanol, ethanol, L-rhamnose, sucrose, and maltose as the only source of carbon; unable to assimilate D-gluconate, L-arabinose, succinate, lactose, starch.

The strain is capable of synthesizing α-amylase when cultured in test tubes in liquid YP medium with glucose (2 wt %) under induction conditions with methanol.

Example 3 Preparation of O. haglerorum strain N404 susceptible to geneticin

The resistance of the strain to antibiotics makes it difficult to use it in industry, because. requires additional costs for the utilization of cell biomass, and obtaining an antibiotic-sensitive strain helps to solve this problem.

From the transformant O. haglerorum N388, the KmMX gene, which provides yeast cells with resistance to geneticin, is removed by recombination at lox sites in the presence of Cre recombinase [FEMS Yeast Res. 2014, 14, 1048-1054. DOI: 10.1111/1567-1364.12197].

Transformant O. haglerorum N388 is grown in liquid nutrient medium YP (wt. %: yeast extract - 1, peptone - 2, water - the rest) with the addition of glucose (2 wt. %) and geneticin in the amount of 300 μg/ml at 37°C within 6 hours until the culture reaches an optical density (OD ₆₀₀ ) of 1.5. Cells are harvested by centrifugation (hereinafter 6000 rpm) for 10 min at room temperature, resuspended in TED buffer composition: 100 mM Tris-HCl, 50 mM EDTA, pH 8.0, 25 mM dithiothreitol prepared in water SQ, incubated at 37°C for 15 min and collected by centrifugation for 10 min at room temperature. Next, the cells are washed twice with cold STM buffer of the composition: 270 mM sucrose, 10 mM Tris-HCl, pH 8.0, 1 mM MgCl2 prepared in SQ water, and harvested by centrifugation for 10 min at 5°C. The cells thus treated are resuspended in cold STM solution at a concentration of 1-5×10 ⁹ cells/ml. A 60 µl aliquot of the cell suspension is transferred to a chilled eppendorf, 200 ng of plasmid DNA with Cre recombinase is added and incubated on ice for 5 minutes. The mixture of cells and DNA is transferred to a pre-chilled electroporation cuvette. Electroporation is carried out at 1500 V, 200 ohms, 25 uF. After electroporation, 1 ml of liquid YP medium with glucose (2 wt %) is added to the cells, the cell suspension is transferred into sterile 1.5 ml tubes and incubated at 37° C. for 60 min with shaking.

The selection of transformants is carried out on YP agar medium with glucose (2 wt %) and hygromycin in the amount of 200 μg/ml at 37°C for 4 days.

The biomass of three independent transformants was transferred into three tubes with 3 ml of YP medium containing 200 μg/ml of hygromycin and methanol used as a carbon source and inducer of Cre recombinase biosynthesis. The tubes are incubated at 37° C. for 48 hours while shaking. Then the culture is sieved from test tubes to individual colonies on YP medium with glucose (2 wt. %) on three Petri dishes. Cups are incubated in a thermostat at 37°C for 72 hours Analyze 100 independently selected colonies from each cup. 200 μl of sterile water is added to the wells of the replicator, the biomass of one colony is transferred to each well of the replicator with a toothpick, then a replica is made from the replicator into three Petri dishes with YP with glucose (2 wt. %), YP with glucose (2 wt. %) ) and geneticin at 300 µg/ml and YP with glucose (2 wt %) and hygromycin at 200 µg/ml. The dishes are incubated in a thermostat at 37°C for 48 hours. Colonies are selected that grow on YP medium with glucose (2 wt.%), but do not grow on media with antibiotics.

The selected colonies are cultivated in test tubes according to the following scheme:

- The inoculum is grown in test tubes (50 ml) with 5 ml of YP liquid nutrient medium supplemented with glucose (2 wt %) at 37°C for 24 hours on a shaker (250 rpm). The inoculation of the fermentation medium is carried out in a ratio of 1/40.

- Fermentation is carried out at 37°C on a rocking chair (250 rpm) in YP nutrient medium with the addition of glucose (2 wt.%) for 5 days. After 24 hours of cultivation, induction with methanol is started, which is added in an amount of 3 vol.%, then the same amount of methanol is added for 48 hours of cultivation. Strain O is used as a control . haglerorum N388.

The productivity of antibiotic-sensitive geneticin and hygromycin colonies of O. haglerorum is assessed by the activity of secreted α-amylase. For this, transformant cells are precipitated by centrifugation, and the supernatant is used to determine amylase activity according to the method with 3,5-dinitrosalicylic acid (DNS) [Anal. Chem. - 1959. - Vol.31. - No. 3. - P.426-428], using glucose as a standard. Soluble starch is used as a substrate.

Selected clone N404, which produces α-amylase with an activity of 2350 units/ml for 144 hours of cultivation in test tubes at a temperature of 37°C, which is comparable to the productivity of the parent strain O. haglerorum N388.

The clone O. haglerorum N404 was deposited at the Bioresource Center All-Russian Collection of Industrial Microorganisms (BRC VKPM) of the National Research Center "Kurchatov Institute" (117545 Moscow, 1st Dorozhny proezd, 1) as strain Ogataea haglerorum N404 VKPM Y-5018.

The strain Ogataea haglerorum N404 VKPM Y-5018 is characterized by the following features:

Cultural and morphological characteristics of the proposed strain:

When cultivated at a temperature of 37°C for 48 h on YP agar medium with the addition of glucose - 2 (wt %), the cells have an oval shape, 3-4 μm in diameter. Cells bud, while budding is true, multilateral. True mycelium does not form.

Sporulation occurs when the culture is incubated on an agar medium of the following composition (wt %): potassium chloride - 0.5, sodium acetate - 1.0, agar - 2.0, water - the rest at 25°C for 3-4 days. Asci have a tetrahedral shape, include up to 4 ascospores.

On YP agar medium supplemented with glucose (2, wt %), light beige colonies with a smooth edge, matte surface, lenticular profile, and pasty consistency.

Growth in a YP liquid medium with the addition of glucose - 2 (wt.%), at 37°C for 24 hours of cultivation - the liquid is turbid, the precipitate is white, no coagulation is observed, no wall films are formed.

Physiological and biochemical characteristics of the proposed strain:

The strain is capable of growth under both aerobic and anaerobic conditions.

The strain is capable of using glucose, glycerol, methanol, ethanol, L-rhamnose, sucrose, and maltose as the sole source of carbon; unable to assimilate D-gluconate, L-arabinose, succinate, lactose, starch.

The strain is capable of synthesizing α-amylase when cultured in test tubes in liquid YP medium with glucose (2 wt %) under induction conditions with methanol.

Example 4 Cultivation of the strain Ogataea haglerorum N388 in flasks

The seed culture of the strain is prepared in a test tube in 5 ml of YP medium with glucose (2 wt %). The tube is incubated at 37°C for 20 hours on a shaker (250 rpm). Into a 0.75 L flask with 100 ml of YP liquid medium with glycerol (2 wt %), 2.5 ml of inoculum are transferred and the flask is incubated at 37° C. on a shaker (250 rpm) for 144 hours. Methanol (3 vol.%) is added to the culture after 24 and 48 hours of cultivation. The biomass is separated by centrifugation for 15 minutes.

The activity of α-amylase is determined by the CSN method at a temperature of 70°C and pH 7.0.

Spend three independent cultivation.

The strain Ogataea haglerorum N388 produces α-amylase, the activity of the enzyme is, respectively, 2200, 2080, 2470 U/ml QOL after 144 hours of cultivation.

Example 5. Cultivation of the Ogataea haglerorum N404 strain in flasks The seed culture of the strain is prepared in a test tube in 5 ml of YP medium with glucose (2 wt. %). The tube is incubated at 37°C for 20 hours on a shaker (250 rpm). Into a 0.75 L flask with 100 ml of YP liquid medium with glycerol (2 wt %), 2.5 ml of inoculum are transferred and the flask is incubated at 37° C. on a shaker (250 rpm) for 144 hours. Methanol (3 vol.%) is added to the culture after 24 and 48 hours of cultivation. The biomass is separated by centrifugation for 15 minutes.

The activity of α-amylase is determined by the method of DNS at a temperature of 70°C and pH 7.0.

Spend three independent cultivation.

The strain Ogataea haglerorum N404 produces α-amylase, the activity of the enzyme is 2310, 2240, 2500 units/ml QOL, respectively, after 144 hours of cultivation.

Example 6 Characterization of Recombinant α-Amylase pH Profile of Recombinant α-Amylase Activity

To determine the optimal pH value for the functioning of the enzyme, the activity of α-amylase in relation to the substrate (1% solution of soluble starch, w/v) is measured in the range of pH 1.0-10.0 using 0.1 M solutions of citrate (pH 1.0 - 3, 0), acetate (pH 4.0-5.0), phosphate (pH 6.0-8.0) and borate (pH 9.0-10.0) buffers. The reaction is carried out at a temperature of 70°C for 10 minutes. Relative activity is calculated as a percentage of the average maximum enzyme activity measured in three independent reactions in the pH range of 1.0-10.0.

The measurement results are shown in Fig.2. The results obtained show that recombinant α-amylase synthesized by the yeast Ogataea haglerorum exhibits the highest activity in the pH range of 5.0-7.0 with an optimum at pH 7.0.

Temperature profile of recombinant α-amylase activity

To determine the temperature profile of the activity of the α-amylase enzyme, reactions of samples with a substrate (1% solution of soluble starch, w/v) in 0.1 M phosphate buffer (pH 7.0) are carried out in the temperature range from 35 to 100°C in increments of 5° WITH. Relative activity is calculated as a percentage of the average maximum activity of the enzyme, measured in three reactions in the temperature range from 35 to 100°C. The results are shown in Fig.3.

Recombinant α-amylase exhibits the highest activity in the temperature range from 65 to 95°C (retains at least 80% of activity), with an optimum at 85°C.

Thermal stability of recombinant α-amylase at different temperatures

Determination of the thermal stability of the recombinant enzyme at different temperatures is carried out by preheating the culture liquid containing the enzyme at temperatures of 80, 85, 90, 95 and 100°C for 5, 10, 15, 20, 30 and 60 minutes. The samples are cooled to room temperature. Then carry out the reaction with the substrate at a temperature of 70°C in 0.1M phosphate buffer (pH 7.0). Relative activity is calculated as a percentage of the unheated enzyme activity value. Measurements are carried out in triplicate. The results are shown in Fig.4.

The results obtained show that the enzyme practically does not lose activity when heated at temperatures of 80°C and 85°C for 60 min. If the recombinant α-amylase is kept at temperatures of 90, 95 and 100°C for 5 min, the enzyme retains more than 75% of its activity. Keeping α-amylase at a temperature of 95°C or 100°C for a longer time leads to a decrease in the activity of the enzyme, however, even after heating at a temperature of 100°C for 60 min, the recombinant enzyme is not inactivated, the residual activity is 30%. Thus, the recombinant α-amylase synthesized by the yeast Ogataea haglerorum is a thermostable enzyme. Determination of the molecular weight of recombinant α-amylase To determine the molecular weight of recombinant α-amylase, electrophoretic separation of proteins from a QOL sample in 12%) polyacrylamide gel under denaturing conditions (SDS-PAGE) in a Mini-PROTEAN Tetra Bio-Rad vertical electrophoresis chamber (Bio -Rad USA). For protein visualization, Coomassie Brilliant Blue R250 was used (FIG. 5). Analysis of the amino acid sequence using the NetNGlyc 1.0 Server program showed that the amino acid sequence of α-amylase contains five potential Asn-Arg-Thr N-glycosylation sites, but only three of them are most likely glycosylated. For deglycosylation of recombinant α-amylase, the EndoH enzyme (Endoglycosidase H from Streptomyces plicatus, Sigma-Aldrich, USA) is used.

Deglycosylation of recombinant α-amylase in QOL is carried out for 3 hours at 37°C in accordance with the manufacturer's instructions.

It has been established that the recombinant α-amylase synthesized by the yeast O. haglerorum is a glycosylated protein with a molecular weight of 65-100 kDa.

The molecular weight of the N-deglycosylated protein is approximately 56 kDa (calculated value of 55.65 kDa by Protein Parameters: https://protparam.net/index.html).

Table 1 compares the properties of the obtained α-amylase from the strain Ogataea haglerorum N404 VKPM Y-5018 and thermostable α-amylases obtained in P. pastoris yeast cells.

Thus, in terms of its properties, the recombinant α-amylase produced by the cells of the thermotolerant methylotrophic yeast O. haglerorum is comparable to Termamyl-type α-amylases produced by the yeast P. pastoris (Table 1)

The resulting α-amylase is also comparable to commercial α-amylase BAN (hybrid termamyl - like α-amylase with substitutions H156Y, A181T, N190F, A209V Q264S, produced in Bacillus amyloliquefaciens), and Termamyl wt α-amylase from Bacillus licheniformis, which retain 57 % and 52% activity, respectively, after enzyme incubation at 95°C for 30 min [US7625737].

α-Amylase produced in the yeast O. haglerorum retains 52% of its activity after keeping the QOL sample (pH 6.5) without a substrate at a temperature of 95°C for 30 min, which makes it possible to use it in technological processes occurring at high temperatures, in particular in the food industry for liquefying starch-containing vegetable raw materials in order to obtain glucose-fructose syrups, in the textile industry for desizing fabrics.

The obtained strains Ogataea haglerorum N388 VKPM Y-4980 and Ogataea haglerorum N404 VKPM Y-5018 produce thermostable α-amylase in flasks in a rich medium with an average activity of 2250 U/ml QOL and 2350 U/ml QOL after 144 h, respectively. cultivation, which is significantly higher than the parameters of P. pastoris GS115 yeast transformants synthesizing α-amylase from B. licheniformis in flasks in a rich medium with an activity of 420 units/ml after 144 hours of cultivation [BioMed Research International, 2015, Article ID 248680, 9 P . http://dx.doi.org/10.1155/2015/248680] or α-amylase from B. licheniformis WX-02 with an activity of 900 units/ml after 168 hours of cultivation [3 Biotech, 2019, 9, 427. https ://doi.org/10.1007/s13205-019-1943-x].

The strain Ogataea haglerorum N404 VKPM Y-5018, unlike Ogataea haglerorum N388 VKPM Y-4980, does not contain a marker of resistance to geneticin (G418), which gives it an advantage when used in industry. After cultivation, cell-free CL is used to isolate and purify the enzyme, and the cell biomass is utilized, and the resistance of strains to antibiotics is a serious threat to the environment and health. Obtaining antibiotic-susceptible strains is an important measure to prevent and control the spread of resistance in the environment, to solve the problem of utilization of antibiotic-resistant strains.

--->

<?xml version="1.0" encoding="UTF-8"?>

<!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing

1.3//EN" "ST26SequenceListing_V1_3.dtd">

<ST26SequenceListing originalFreeTextLanguageCode="en"

nonEnglishFreeTextLanguageCode="en" dtdVersion="V1_3" fileName="Yeast

transformant Ogataea haglerorum-producer of thermostable

alpha-amylase.xml" softwareName="WIPO Sequence"

softwareVersion="2.1.2" productionDate="2022-09-20">

<ApplicationIdentification>

<IPOfficeCode>EN</IPOfficeCode>

<ApplicationNumberText>2022119881/20(041870)</ApplicationNumberText>

<FilingDate>2022-07-20</FilingDate>

</ApplicationIdentification>

<ApplicantName languageCode="en">National Research

Center &quot;Kurchatov Institute&quot;</ApplicantName>

<ApplicantNameLatin>National Research Center &quot;Kurchatov

Institute&quot;</ApplicantNameLatin>

<InventionTitle languageCode="en">Ogataea yeast transform

haglerorum is a thermostable alpha-amylase producer.</InventionTitle>

<SequenceTotalQuantity>2</SequenceTotalQuantity>

<SequenceData sequenceIDNumber="1">

<INSDSeq>

<INSDSeq_length>1467</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..1467</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q1">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>attactaaaacttctgccgttaatggtactttgatgcagtactttgaat

ggtatactcctaacgacggtcaacactggaaaagattgcagaatgatgctgaacacttgtctgatatcgg

tattactgccgtttggattccaccagcttacaagggaacttctcaagctgatgttggttacggtgcttac

gacttgtatgatttgggtgagtttcaccaaaaaggtactgttagaaccaagtacggtactaaaggagagt

tgcaatctgctatcaaatctttgcactccagagacattaacgtttacggtgatgttgtcatcaaccacaa

aggtggtgctgatgctaccgaagatgttactgctgttgaagtcgatccagctgacagaaacagagttatt

tctggagaacacttgattaaagcctggacccactttcactttcggaagaggatctacttactccgatt

ttaaatggtactggtatcactttgacggaaccgattgggacgagtccagaaagttgaacagaatctataa

gtttcaaggaaagacctgggattgggaagtttccaatgaatttggtaactacgactatttgatgtatgcc

gacatcgattatgaccaccctgatgtcgttgcagaaattaagagatggggtacttggtatgccaatgaat

tgcaattggacggtttcagattggatgctgtcaaacacattaaattttcttttttgagagattgggttaa

ccacgtcagagagaaaactggtaaggaaatgtttactgttgctgaatattggtctaatgacttgggtgcc

ttggaaaactacttgaacaaaaccaactttaatcactctgtctttgacgttccattgcactatcagttcc

acgctgcatctactcagggaggtggttacgatatgagaaaattgttgaacggtactgtcgtttccaagca

cccattgaaatctgttacctttgtcgataaccacgatacccagccaggacaatctttggagtccactgtc

caaacctggtttaagccattggcttacgccttcattttgaccagagagtctggataccctcaggttttct

acggtgatatgtacggtactaaaggagactcccagagagaaattcctgccttgaaacacaaaattgaacc

tatcttgaaagctagaaaacagtatgcttacggagcacagcacgattacttcgaccaccacgacattgtc

ggttggactagaagaaggtgactcttccgttgctaattccggtttggctgccttgattactgacggaccag

gtggagctaagagaatgtacgtcggtagacaaaacgccggtgagacttggcacgacattaccggaaacag

atccgagccagttgtcatcaactctgaaggatggggagagtttcacgtcaacggtggatctgtttccatt

tacgttcaaagatagtaa</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

<SequenceData sequenceIDNumber="2">

<INSDSeq>

<INSDSeq_length>273</INSDSeq_length>

<INSDSeq_moltype>DNA</INSDSeq_moltype>

<INSDSeq_division>PAT</INSDSeq_division>

<INSDSeq_feature-table>

<INSDFeature>

<INSDFeature_key>source</INSDFeature_key>

<INSDFeature_location>1..273</INSDFeature_location>

<INSDFeature_quals>

<INSDQualifier>

<INSDQualifier_name>mol_type</INSDQualifier_name>

<INSDQualifier_value>other DNA</INSDQualifier_value>

</INSDQualifier>

<INSDQualifier id="q2">

<INSDQualifier_name>organism</INSDQualifier_name>

<INSDQualifier_value>synthetic construct</INSDQualifier_value>

</INSDQualifier>

</INSDFeature_quals>

</INSDFeature>

</INSDSeq_feature-table>

<INSDSeq_sequence>atgagatttccttcgatttttaccgcagttctgttcgcagcatcctccg

cattggctgctccagtcaacactaccacagaagatgaaaccgcacaaattccggctgaagctgtcatcgg

ttactcggatctggaaggcgatttcgatgttgctgttttgccattttccaactcgaccaataacggactg

ttgtttatcaatactaccattgcctcgattgctgctaaggaagaaggcgtgtctctggagaagagagagg

ctgaagcttacgta</INSDSeq_sequence>

</INSDSeq>

</SequenceData>

</ST26SequenceListing>

<---

Claims (3)

1. Ogataea haglerorum yeast transformant containing an optimized synthetic gene in the chromosome, the nucleotide sequence of which is shown in the sequence listing under the number SEQ ID NO:1, producing thermostable α-amylase. 2. Strain Ogataea haglerorum VKPM Y-4980, resistant to geneticin - producer of thermostable α-amylase. 3. Strain Ogataea haglerorum VKPM Y-5018, sensitive to geneticin - producer of thermostable α-amylase.

Images