CN112553134B - Method for expressing alpha-amylase in bacillus subtilis - Google Patents
Method for expressing alpha-amylase in bacillus subtilis Download PDFInfo
- Publication number
- CN112553134B CN112553134B CN202011601201.9A CN202011601201A CN112553134B CN 112553134 B CN112553134 B CN 112553134B CN 202011601201 A CN202011601201 A CN 202011601201A CN 112553134 B CN112553134 B CN 112553134B
- Authority
- CN
- China
- Prior art keywords
- bacillus subtilis
- amylase
- alpha
- seq
- amysa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
- C12N9/2411—Amylases
- C12N9/2414—Alpha-amylase (3.2.1.1.)
- C12N9/2417—Alpha-amylase (3.2.1.1.) from microbiological source
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
- C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01001—Alpha-amylase (3.2.1.1)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/35—Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
Abstract
The invention discloses a method for expressing alpha-amylase in bacillus subtilis, belonging to the technical field of genetic engineering and biological engineering. The invention obtains bacillus subtilis genetic engineering WHS9 by knocking out the hrcA gene on the bacillus subtilis WS9 genome; by optimizing the components of the Sec secretion system, the co-expression of the gene coding for SecYEG, the main component of the membrane transport channel in the Sec secretion system, is found to be most favorable for the recombinant expression of alpha-amylase in Bacillus subtilis WHS 9; the whole secretion process of alpha-amylase in the bacillus subtilis WHS9 is balanced by the screened signal peptide, the extracellular alpha-amylase activity of the finally obtained bacillus subtilis recombinant strain WHS9GSAB after shake flask culture is 2835.1U/mL, and the extracellular alpha-amylase activity can reach 35779.5U/mL after 3-L tank fermentation culture.
Description
Technical Field
The invention relates to a method for expressing alpha-amylase in bacillus subtilis, belonging to the technical field of genetic engineering and biological engineering.
Background
Alpha-amylase (alpha-amylase, ec.3.2.1.1), an important glycoside hydrolase, cleaves the alpha-1, 4-glucosidic bonds in starch and related alpha-glucan molecules, hydrolyzes starch into soluble dextrins, oligosaccharides, maltose and glucose, and the product retains the alpha-isomer conformation, thus it is widely used in the food, washing, paper, textile, alcohol and pharmaceutical industries. Alpha-amylases have been found in many hosts such as: escherichia coli, Bacillus pumilus, Bacillus subtilis, Pichia pastoris, and the like.
Although the expression level of the alpha-amylase in the bacillus coli and the bacillus pumilus is good, the bacillus coli host has the problem of food safety, and the bacillus pumilus host has the problem of unstable fermentation, so that the application of the bacillus coli host as a fermentation host in industry is limited; the yield of the alpha-amylase in other hosts is very low, and the industrial requirement cannot be met. Therefore, the high expression of alpha-amylase has been a hot point of research.
Bacillus subtilis belongs to gram-positive bacteria, has become an important industrial strain due to the characteristics of easy isolated culture, clear genetic background, good secretion, no pathogenicity and the like, and is increasingly used for producing antibiotics, pharmaceutical proteins, industrial enzyme preparations and the like. Therefore, the Bacillus subtilis can be used as a starting point to obtain an expression host for efficiently expressing the high-temperature alpha-amylase, and the industrial demand for the high-temperature alpha-amylase can be met.
However, the recombinant expression level of alpha-amylase in Bacillus subtilis is currently reported to be low, for example, Chen et al studied the recombinant expression of alpha-amylase in Bacillus subtilis by overexpressing the extracellular chaperone proteins prsA and the intracellular chaperones of DnaK series, and finally obtained Bacillus subtilis recombinant strain B.subtilis 1A751(pMA5-Amys) has an alpha-amylase activity of 2300U/mL in the extracellular supernatant after fermentation culture in 7.5-L tank (Ref: Jingqi Chen, et al. combinatorial Sec pathway analysis for improving viral genes in Bacillus subtilis: identification of infection of viral gene expression, 201514). Fu et al studied the recombinant expression of alpha-amylase in Bacillus subtilis, and the technical proposal was that after the final Bacillus subtilis recombinant strain B.subtilis 1A751pSP4 was cultured in a 7.5-L tank fermentation, the activity of the alpha-amylase in the extracellular supernatant was 5086U/mL at the highest (Ref: Gang Fu, et al. systematic Screening of Optimal Signal Peptides for creating product of heterogeneous protocols in Bacillus subtilis. journal of Agricultural and Food Chemistry,66(50), 2018.). Yao et al studied the recombinant expression of alpha-amylase in Bacillus subtilis, the technical scheme was that the alpha-amylase activity in the extracellular supernatant was 9201.1U/mL (Ref: Dongbang Yao, et al. enhanced expression of extracellular expression of Bacillus stearothermophilus alpha-amylase in Bacillus subtilis polypeptide timing, microbial cells 18(69),2019.) after fermentation culture of Bacillus subtilis recombinant strain B.subtilis WHS11YSA in 3-L tank by combining signal peptide screening, overexpression of intracellular chaperone and mutation of alpha-amylase self amino acid sequence. Because the enzyme activity of extracellular alpha-amylase produced by recombination of bacillus subtilis is low at present, the industrial production and application of the alpha-amylase are limited. Therefore, the recombinant expression level of the alpha-amylase in the bacillus subtilis is improved, and the realization of the high-efficiency expression and production of the alpha-amylase by using the bacillus subtilis has important significance on the industrial production and application of the alpha-amylase.
Disclosure of Invention
The technical problem is as follows:
the invention aims to solve the technical problem of low expression level of alpha-amylase in the prior art.
The technical scheme is as follows:
the invention knocks out hrcA gene to over-express intracellular molecular chaperones of GroE series and DnaK series of bacillus subtilis, and the over-expressed intracellular molecular chaperones can not only ensure that alpha-amylase precursors maintain a transportable folded state in the bacillus subtilis, thereby effectively carrying out targeted transportation of the alpha-amylase precursors in cells, but also prevent intracellular protease from degrading the alpha-amylase precursors or the alpha-amylase precursors from abnormally aggregating into non-secretable inclusion bodies in the cells; coexpression of intracellular molecular chaperones of GroE series and DnaK series in Sec secretion pathwayThe coding gene secYEG of the main component secYEG of the membrane transport channel improves the transmembrane transport efficiency of the intracellular alpha-amylase precursor; based on overexpression of intracellular molecular chaperones of GroE series and DnaK series and co-expression of Sec pathway secretion element SecYEG, signal peptide SP RpmG The whole secretion process of the alpha-amylase in the bacillus subtilis is balanced, so that the alpha-amylase is efficiently expressed in the bacillus subtilis.
The invention provides a recombinant bacillus subtilis with the improvement of at least two of the following (a) to (c):
(a) overexpresses coding gene csaA of specific intracellular chaperonin CsA and/or knocks out coding gene hrcA of repressor protein HrcA of intracellular chaperonin negatively regulating GroE series and DnaK series;
(b) the secretory element of the Sec secretory system is expressed;
(c) using the signal peptide SP RpmG Or SP AspB Promote the secretion of the target protein.
In one embodiment of the invention, the hrcA gene has a nucleotide sequence shown as SEQ ID No. 1.
In one embodiment of the invention, the nucleotide coding sequence of the intracellular chaperonin CsaA coding gene csaA is shown as SEQ ID NO. 2.
In one embodiment of the invention, the secretory component of the co-expressed Sec secretion system comprises one or more of the co-expressed transmembrane recognition factor secA, membrane transport channel major component secYEG, signal peptidase sipS, signal peptidase sipT, signal peptide peptidase sppA and signal peptidase tepA.
In one embodiment of the present invention, the genes SecA, SecYEG, SipS, SipT, SppA and TepA encoding the secretory components SecA, SecYEG, SipS, SppA and TepA of the Sec secretory system are all derived from the genome of Bacillus subtilis 168, and the corresponding nucleotide sequences are shown in SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6, SEQ ID No.7 and SEQ ID No.8, respectively.
In one embodiment of the invention, the signal peptide SP PeL 、SP PelB 、SP YqxI 、SP LipB 、SP YbfO 、SP BglS 、SP RpmG 、SP AspB The genes are all derived from the genome of bacillus subtilis 168.
In one embodiment of the present invention, the signal peptide gene is inserted upstream of the target gene.
In one embodiment of the present invention, the bacillus subtilis host suitable for recombinant expression of alpha-amylase is determined according to the extracellular alpha-amylase activity of the bacillus subtilis recombinant bacterium by recombinant expression of alpha-amylase using bacillus subtilis having 6, 7 and 8 extracellular protease deletion types as expression hosts, respectively.
In one embodiment of the present invention, the bacillus subtilis with 6, 7 and 8 extracellular protease deletion types is WS9, WS10 and WS 11; all are obtained by knocking out extracellular protease on the basis of WS 5;
the B.subtilis WS9 is obtained by knocking out proteases delta nprE, delta aprE, delta nprB, delta bpr, delta mpr and delta epr from B.subtilis WS5, and the B.subtilis WS5 is preserved in the China center for type culture collection in 2016, 9 and 29 days, with the preservation number of CCTCC NO: M2016536 and the preservation address of China, Wuhan university;
the b.subtilis WS10 was obtained from b.subtilis WS5 by knock-out of the proteases Δ nprE, Δ aprE, Δ nprB, Δ bpr, Δ mpr, Δ epr and Δ vpr, i.e. b.subtilis WS10 was obtained from b.subtilis WS9 by knock-out of the protease Δ vpr;
the b.subtilis WS11 was obtained from b.subtilis WS5 by knock-out of the proteases Δ nprE, Δ aprE, Δ nprB, Δ bpr, Δ mpr, Δ epr, Δ vpr and Δ WprA, i.e. b.subtilis WS11 was obtained from b.subtilis WS10 by knock-out of the protease Δ WprA.
In one embodiment of the present invention, the α -amylase is a high temperature α -amylase derived from Bacillus stearothermophilus, and the amino acid sequence of the α -amylase is described in patent application publication No. CN 109022396A.
In one embodiment of the present invention, the recombinant plasmid is pHY-SP YojL -amySA-secA、pHY-SP YojL -amySA-secYEG、pHY-SP YojL -amySA-sipS、pHY-SP YojL -amySA-sipT、pHY-SP YojL -amySA-sppA or pHY-SP YojL -amySA-tepA。
In one embodiment of the present invention, the recombinant plasmid is pHY-SP RpmG -amySA-secA、pHY-SP RpmG -amySA-secYEG、pHY-SP RpmG -amySA-sipS、pHY-SP RpmG -amySA-sipT、pHY-SP RpmG -amySA-sppA or pHY-SP RpmG -amySA-tepA。
The invention also provides application of the recombinant bacillus subtilis in improving the expression quantity of alpha-amylase.
The invention also provides a method for producing the alpha-amylase, which comprises the step of fermenting by using the bacillus subtilis engineering bacteria capable of efficiently expressing the alpha-amylase as a production strain.
In one embodiment of the invention, the method is that the recombinant bacillus subtilis is inoculated into a seed culture medium to obtain a seed solution, and the seed solution is inoculated into a shake flask fermentation culture medium for shake flask fermentation.
In one embodiment of the invention, the recombinant bacillus subtilis is inoculated in a seed culture medium and cultured for 8-10h at 35-38 ℃ and 180-220 rpm to obtain a seed solution; and inoculating the seed solution into a shake flask fermentation culture medium, and culturing for 45-50 h at 30-37 ℃ and 180-220 rpm.
In one embodiment of the invention, the method is to inoculate recombinant bacillus subtilis into a seed culture medium to obtain a seed solution, and inoculate the seed solution into a fermentation culture medium in an upper tank for 3-L tank fermentation.
In one embodiment of the invention, the recombinant bacillus subtilis is inoculated in a seed culture medium and cultured for 8-10h at 35-38 ℃ and 180-220 rpm to obtain a seed solution; inoculating the seed liquid into an upper tank fermentation culture medium, and fermenting at the pH of 6-8, the temperature of 30-37 ℃ and the dissolved oxygen of 20-40%.
In one embodiment of the invention, the components of the seed culture medium comprise 8-12 g/L peptone, 4-6 g/L yeast powder and 8-12 g/L sodium chloride.
In one embodiment of the invention, the shake flask fermentation medium comprises 20-25 g/L yeast extract, 5-10 g/L soybean peptone and 12-20 g/L K 2 HPO 4 ·3H 2 O, KH 1-4 g/L 2 PO 4 And 2-7 g/L of glycerol, wherein the initial pH is 6-8.
In one embodiment of the invention, the upper fermentation medium comprises an upper basal medium and an upper feed medium.
In one embodiment of the present invention, after the cells are inoculated onto the basic culture medium in the upper tank and cultured for 6 to 8 hours, the feed medium in the upper tank is started to flow into the basic culture medium in the upper tank.
In one embodiment of the invention, the basic culture medium of the upper tank comprises 5-15 g/L soybean peptone, 5-15 g/L corn steep liquor, 0.5-1.5 g/L ammonium citrate, 1-10 g/L sucrose, 0.5-5 g/L Na 2 SO 3 、1～5g/L(NH 4 ) 2 SO 4 、10～30g/L K 2 HPO 4 ·3H 2 O、1～10g/L NaH 2 PO 4 ·H 2 O、0.1～3g/L MgSO 4 ·7H 2 O、0.1～1g/L CaCl 2 1-5 mL/L of trace elements, which are described in Yao et al (Ref: Dongbang Yao, et al. enhanced expression of Bacillus stearothermophilus alpha-amylase in Bacillus subtilis through signal optimization, carrier overexpression and alpha-amylase mutation selection. microbial Cell efficiencies, 18(69), 2019.).
In one embodiment of the invention, the feed medium of the upper tank: 200-800 g/L glucose, 10-50 g/L soybean peptone, 10-50 g/L corn steep liquor, 5-50 mL/L microelement, wherein the microelement is shown in the paper of Yao et al (Ref: Dongbang Yao, et al. enhanced expression of Bacillus stearothermophilus alpha-amylase in Bacillus subtilis through signal peptide optimization, silicone overexpression and alpha-amylase mutant selection. Microbial Cell industries, 18(69), 2019.).
The invention also provides the application of the recombinant bacillus subtilis in preparing food, washing, paper making, spinning, alcohol and medicines containing alpha-amylase.
Advantageous effects
The invention successfully realizes the efficient expression of the alpha-amylase in the bacillus subtilis, and adopts the technical scheme that the bacillus subtilis WHS9 is taken as an expression host, and pHY-SP is taken RpmG And (3) taking amySA-secYEG as an expression vector, carrying out shake flask fermentation culture on the constructed bacillus subtilis recombinant WHS9GSAB for 45-50 h, improving the activity of the supernatant enzyme of the shake flask fermentation of the alpha-amylase to 2835.1U/mL, and carrying out tank-loading fermentation in a 3-L fermentation tank, so that the activity of the extracellular alpha-amylase of the bacillus subtilis recombinant WHS9GSAB is up to 35779.5U/mL, the activity of the alpha-amylase is greatly improved, and the application prospect in industrial production is great.
Drawings
FIG. 1: structural schematic of knock-out vector pHYcas9 dhrcA.
FIG. 2 is a schematic diagram: quickcut of delta hrcA gene PCR product TM Xho I enzyme digestion verification electrophoretogram; wherein M is DL1000 DNA Marker, Lane 1 is Quickcut of PCR product of Δ hrcA gene TM Xho I digested the electrophoresed band, lane 2 is Quickcut of hrcA gene PCR product TM Xho I cut the electrophoretic band.
FIG. 3: recombinant plasmid pHY-SP YojL A flow chart for the construction of amySA-secYEG.
FIG. 4: recombinant plasmid pHY-SP YojL Quickcut of amySA-secYEG TM Hind III enzyme digestion verification result; wherein M is DL1000 DNA Marker, and pHY-SP is shown in lane 1 YojL Quickcut of amySA TM Hind III restriction of the band.
FIG. 5: recombinant plasmid pHY-SP RpmG -flowchart of construction of amySA-secYEG.
Detailed Description
Bacillus subtilis WS5, which is referred to in the following examples, is described in patent application publication No. CN106754466A and has been deposited at the China center for type culture Collection (CCTCC NO: M2016536) at 29/9/2016, with the deposit number M2016536, and the deposit address M.Wuhan university.
The high temperature alpha-amylase referred to in the examples below is an alpha-amylase derived from Bacillus stearothermophilus, the sequence of which is described in patent application publication No. CN109022396A, the amino acid sequence of which is shown in SEQ ID NO. 9.
The detection methods referred to in the following examples are as follows:
the detection method of the enzyme activity of the alpha-amylase comprises the following steps:
1mL of 1% soluble starch solution and 0.9mL of 20mM phosphate buffer solution with pH of 6.0 are fully mixed, preheated at 70 ℃ for 10min, added with 0.1mL of crude enzyme solution, uniformly mixed by oscillation, reacted for 5min, added with 3mL of DNS, rapidly cooled by oscillation and boiling for 7min, added with distilled water to reach volume of 15mL, and measured for absorbance at 540nm (the same operation is carried out by taking the inactivated enzyme solution as a catalyst to be used as a blank).
Enzyme activity is defined as the amount of enzyme required to catalyze the production of 1. mu. mol glucose per minute as one unit of starch hydrolysis activity.
The media involved in the following examples are as follows:
seed culture medium: 10g/L of peptone, 5g/L of yeast powder and 10g/L of sodium chloride.
Shake flask fermentation medium: 24g/L yeast extract, 12g/L soyabean peptone and 16.4g/L K 2 HPO 4 ·3H 2 O, 2.3g/L KH 2 PO 4 And 5g/L of glycerol, with an initial pH of 7.
Basic culture medium for upper tank: 10g/L soybean peptone, 10g/L corn steep liquor, 1g/L ammonium citrate, 5g/L sucrose and 2g/LNa 2 SO 3 、2.68g/L(NH 4 ) 2 SO 4 、19.2g/L K 2 HPO 4 ·3H 2 O、4g/L NaH 2 PO 4 ·H 2 O、1g/L MgSO 4 ·7H 2 O、0.38843g/L CaCl 2 3mL/L of trace elements, see Yao et al (Ref: Dongbang Yao, et al. enhanced extracellular expression of Bacillus stearothermophilus alpha-amylase in Bacillus subtilis through signal peptide optimization, carrier overexpression)ression andα-amylase mutant selection.Microbial Cell Factories,18(69),2019.)。
Feeding culture medium for feeding: 500g/L glucose, 35g/L soybean peptone, 35g/L corn steep liquor, 20mL/L trace elements, the trace elements are shown in Yao et al (Ref: Dongbang Yao, et al, enhanced expression of Bacillus stearothermophilus alpha-amylase in Bacillus subtilis through signal timing, carrier overexpression and alpha-amylase mutation selection. microbial Cell industries, 18(69), 2019.).
LB solid Medium: 10g/L peptone, 5g/L yeast extract, 10g/L NaCl and 0.2g/L agar powder.
LB liquid medium: 10g/L peptone, 5g/L yeast extract and 10g/L NaCl.
Growth medium: 10g/L peptone, 5g/L yeast extract, 10g/L NaCl, 0.5M sorbitol.
Electrotransfer buffer solution: 0.5M sorbitol, 0.5M mannitol, 10% glucose.
Recovery medium RM: sorbitol 0.5M, mannitol 0.38M, peptone 10g/L, yeast extract 5g/L, and NaCl 10 g/L.
Example 1: bacillus subtilis expression host optimization
The construction methods of bacillus subtilis WS9, WS10 and WS11 for constructing bacillus subtilis WS9, bacillus subtilis WS10 and bacillus subtilis WS11 which are used as host cells for recombinant expression of alpha-amylase are all disclosed in Zhang Kangsu's doctor papers (modification of bacillus subtilis strain, optimization of promoter and efficient preparation research of pullulanase).
The construction of the recombinant bacteria comprises the following specific steps:
(1) respectively scribing the constructed bacillus subtilis WS9, the constructed bacillus subtilis WS10 and the constructed bacillus subtilis WS11 on an LB solid culture medium, and then culturing at 37 ℃ overnight for activation to respectively obtain single colonies;
(2) respectively selecting single colonies, inoculating the single colonies into 5mL LB liquid culture medium, and culturing for 10-12h at 37 ℃ and 200rpm to respectively obtain seed solutions;
(3) respectively taking 2.5mL of the seed liquid obtained in the step (2) and transferring to 40mL of growth culture medium, and culturing at 37 ℃ and 200rpm for about 4.5h to respectively obtain fermentation liquor;
(4) respectively carrying out ice bath on the fermentation liquor obtained in the step (3) for 10min, then centrifuging at 5000 Xg and 4 ℃ for 5min to remove supernatant, and respectively collecting thalli;
(5) resuspending the cells in 50mL of precooled electrotransfer buffer, centrifuging at 5000 Xg and 4 ℃ for 5min to remove the supernatant, and collecting the cells respectively;
(6) repeating the operation in the step (5) for 3 times;
(7) respectively suspending the washed thallus in 1mL of electrotransfer buffer solution, subpackaging in 1.5mL of EP tubes, filling 200 mu L of bacterial liquid in each tube, namely competent cells, and then freezing and storing in a refrigerator at the temperature of 80 ℃ below zero;
(8) taking the competent cells of the bacillus subtilis WS9, the bacillus subtilis WS10 and the bacillus subtilis WS11 prepared in the step (7), and respectively adding 10 mu L of recombinant plasmid pHY-SP YojL amySA, ice-cooled for about 15min, then transferred to an electric rotor (2mm) which has been pre-cooled, shocked once; the electrotransformation instrument sets up: 2.4kv, 25 muF, 200 Ω;
recombinant plasmid pHY-SP YojL Construction of amySA
Recombinant plasmid pHY-SP YojL amySA takes pHYCGTd4 as a starting plasmid, and a specific construction method is described in Yao et al (Ref: Yao D, Su L, Li N, Wu J. enhanced expression of Bacillus stearothermophilus alpha-amylase in Bacillus subtilis through signal peptide optimization, carbon overexpression and alpha-amylase selection. microbial cells, 18(69), 2019.);
(9) immediately adding 1mL of recovery culture medium RM into the electric shock cup after the electric shock is finished, and slowly blowing, sucking and uniformly mixing. Then, after thawing at 37 ℃ and 200rpm for 3 hours, the cells were plated on LB solid medium containing tetracycline resistance (50. mu.g/mL). Performing static culture on an LB solid culture medium at 37 ℃ for 10-12h, and selecting positive clones to respectively obtain recombinant bacillus subtilis WS9/pHY-SP YojL -amySA, named WS9 YSA; subtilisWS10/pHY-SP YojL -amySA, named WS10 YSA; subtilis WS11/pHY-SP YojL amySA, named WS11 YSA.
Inoculating the obtained bacillus subtilis recombinant bacteria WS9YSA, WS10YSA and WS11YSA into a seed culture medium at 35-38 ℃ and 180-220 rpm for 8-10h to obtain a seed solution, inoculating the seed solution into a fermentation culture medium according to the inoculation amount of 2-8% (v/v), and culturing at 30-37 ℃ and 180-220 rpm for 45-50 h to obtain a fermentation broth.
And centrifuging the fermentation liquor of the obtained bacillus subtilis recombinant bacteria WS9YSA, WS10YSA and WS11YSA at 4 ℃ and 12000 Xg for 10min, wherein the centrifuged supernatant is the crude enzyme liquid obtained by fermentation.
The obtained crude enzyme solutions were subjected to the detection of α -amylase activity, and the results are shown in table 1:
TABLE 1 fermentation of different recombinant Bacillus subtilis enzymes for producing alpha-amylase
| Bacterial strains | Enzyme activity (U/mL) |
| B.subtilis WS9/pHY-SP YojL -amySA(WS9YSA) | 1100.0 |
| B.subtilis WS10/pHY-SP YojL -amySA(WS10YSA) | 1054.8 |
| B.subtilis WS11/pHY-SP YojL -amySA(WS11YSA) | 976.6 |
Therefore, the alpha-amylase activity in the fermentation supernatant of the bacillus subtilis WS9YSA is the highest, and therefore, the bacillus subtilis WS9 is used as a host for the recombinant expression of the alpha-amylase.
Example 2: construction and fermentation of bacillus subtilis recombinant bacteria over-expressing intracellular chaperonin
1. Construction of Bacillus subtilis WCS9
Based on the Bacillus subtilis WS9 constructed in example 1, a Bacillus subtilis WCS9 for over-expressing intracellular chaperone csaA is constructed, and a specific construction method is disclosed in Zhang Kangshu thesis (thesis, modification of Bacillus subtilis strain, optimization of promoter and efficient preparation and research of pullulanase).
2. Construction of Bacillus subtilis WHS9
Based on the bacillus subtilis WS9 constructed in example 1, hrcA-deleted bacillus subtilis WHS9 on the genome is constructed, and the specific construction process is as follows:
(1) construction of knock-out vector pHYcas9 dhrcA:
the knockout vector pHYcas9dhrcA is constructed on the basis of the vector pHYcas9dhrc, and the construction method of the vector pHYcas9dhrc is described in the theory of Bacillus subtilis strain modification, promoter optimization and high-efficiency preparation research of pullulanase, and the vector pHYcas9dhrc contains Cas9 protein of a CRISPR/Cas9 gene editing system and N20 sequence of sgRNA of hrcA gene. On the basis of the vector pHYcas9dhrc, a 2000bp repair template of hrcA gene is inserted, namely the hrcA gene knockout vector pHYcas9dhrcA (the vector structure schematic diagram is shown in figure 1). The repair template of the hrcA gene is obtained by fusion PCR of upstream and downstream homologous arms of the hrcA gene, wherein the length of the upstream and downstream homologous arms of the hrcA gene is 1000 bp.
Compared with the original sequence of the hrcA gene in the genome of Bacillus subtilis WS9, the repair template of the hrcA gene in the knock-out vector pHYcas9dhrcA deletes a 6bp nucleotide sequence (TACTCG), and inserts an Xho I enzyme cutting site (CTCGAG) and a 5bp random nucleotide sequence (CGTAA).
Repair template for hrcA Gene Using one-step cloning kit of Novozam (R) ((R))
One Step Cloning Kit) was ligated with the linearized pHYcas9dhrc fragment by homologous recombination.
The upstream and downstream homologous arms of hrcA gene were obtained by PCR using the genome of Bacillus subtilis WS 9as a template by primers F1/R1 and F2/R2, respectively. The sequences of the primers F1/R1 and F2/R2 are shown in Table 2, and the PCR system is shown in Table 3. The upstream and downstream homology arms of the hrcA gene obtained were subjected to fusion PCR to obtain a repair template for the hrcA gene. The adopted fusion PCR is divided into two steps, in the first step, the homologous sequences of the upstream and downstream homologous arms of the hrcA gene are utilized to carry out recombination fusion under the condition of no primer, and the PCR system is shown in a table 4; in the second step, the recombinant product obtained in the first step was amplified in a large amount by PCR using the primer F1/R2, and the PCR system is shown in Table 5. Linearization of vector pHYcas9dhrc was performed using restriction enzyme Xba I, the system for Xba I is shown in Table 6. The connection system of the repair template of hrcA gene and the linearized vector pHYcas9dhrc fragment is shown in Table 7, and the knock-out vector pHYcas9dhrc A is constructed.
TABLE 2 primer sequences
| Primer and method for producing the same | Sequence (5 '-3') |
| F1 | CTAGTCTAGATATTTTATAATTTGATGCAA |
| R1 | GCCTTACGCTCGAGCGATGGATGTGTAATTCGT |
| F2 | ATCGCTCGAGCGTAAGGCCGAAGTTGAGTGAGAAT |
| R2 | CTAGTCTAGAAGCAAATCAGTCACGATATTTTGA |
Note: the underlined part is the cleavage site for the restriction enzyme Xho I.
TABLE 3 PCR reaction System
PCR conditions were as follows: pre-denaturation at 94 ℃ for 10 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 72 ℃ for 1min, 30 cycles, and gel recovery of PCR products.
TABLE 4 PCR reaction System
PCR conditions were as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 72 ℃ for 30s, 10 cycles, and gel recovery of PCR products.
TABLE 5 PCR reaction System
PCR conditions were as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 72 ℃ for 2min, 30 cycles, and gel recovery of PCR products.
TABLE 6 Quickcut TM Xba I digestion System
| Enzyme digestion component | Enzyme dosage |
| QuickCut TM Xba I | 0.2μL |
| 10×QuickCut Green Buffer | 1.0μL |
| pHYcas9dhrc | 2.0μL |
| ddH 2 O | 6.8μL |
Enzyme cutting conditions are as follows: the enzyme digestion reaction was carried out at 37 ℃ for 20 min.
TABLE 7 one-step cloning ligation System
| Composition (A) | Dosage of |
| Repair template of hrcA gene | 2.0μL |
| pHYcas9dhrc fragment | 1.0μL |
| 5x CE II Buffer | 4.0μL |
| Exnase II | 2.0μL |
| ddH 2 O | 11.0μL |
Connection conditions are as follows: the reaction was carried out at 37 ℃ for 30 min.
(2) Construction of Bacillus subtilis WHS 9:
the vector pHYcas9dhrcA obtained in step (1) was transformed into the competence of Bacillus subtilis WS9 prepared in example 1 according to the Bacillus subtilis electrotransformation method in example 1 to obtain a transformant.
The transformants were plated on LB solid medium containing tetracycline resistance (50. mu.g/mL). And (3) performing static culture on the solid culture medium at 37 ℃ for 10-12h, and selecting positive clone to obtain the delta hrcA genetic engineering bacterium bacillus subtilis WHS 9. Due to the introduction of an Xho I cleavage site (CTCGAG) in the repair template of the hrcA gene, when verified by PCR with the verification primer F3/R3, the PCR product corresponding to Bacillus subtilis WHS9 could be cleaved into two fragments by the restriction enzyme Xho I, whereas the PCR product corresponding to Bacillus subtilis WS9 could not be cleaved by the restriction enzyme Xho I. The sequence of the verification primer F3/R3 is shown in Table 8, the Xho I enzyme digestion verification system of the PCR product of the bacillus subtilis WHS9 and the bacillus subtilis WS9 is shown in Table 9, and the nucleic acid electrophoresis result after enzyme digestion is shown in FIG. 2.
And if the bacillus subtilis WHS9 is verified to be correct, the successfully constructed bacillus subtilis WHS9 is obtained.
TABLE 8 primer sequences
| Primer and method for producing the same | Sequence (5 '-3') |
| F3 | GATCTCATGTTCGGGCTTCCG |
| R3 | TTGCTTGACGCTCAGCATCG |
TABLE 9 Quickcut TM Xho I cleavage System
| Enzyme digestion component | Enzyme dosage |
| QuickCut TM Xho I | 0.2μL |
| 10×QuickCut Green Buffer | 1.0μL |
| PCR products | 2.0μL |
| ddH 2 O | 6.8μL |
Enzyme cutting conditions are as follows: the enzyme digestion reaction was carried out at 37 ℃ for 20 min.
3. Recombinant bacterium B.subtilis WCS9/pHY-SP YojL amySA and B.subtilis WHS9/pHY-SP YojL Construction of amySA and enzyme production by fermentation
(1) The bacillus subtilis WCS9 and the bacillus subtilis WHS9 obtained in the steps 1 and 2 are subjected to electrotransformation competence preparation of bacillus subtilis WCS9 and WHS9 according to the method for preparing the bacillus subtilis electrotransformation competence in the example 1.
(2) The steps of example 1 (a)8) The recombinant expression vector pHY-SP obtained in (1) YojL Transferring amySA into electrotransformation competence of the bacillus subtilis WCS9 and WHS9 respectively, and picking positive clone as recombinant bacteria B.subtilis WCS9/pHY-SP YojL amySA and B.subtilis WHS9/pHY-SP YojL amySA, named WCS9YSA, WHS9YSA, respectively.
(3) According to the method of seed culture and shake flask fermentation in example 1, after recombinant Bacillus subtilis WCS9YSA and WHS9YSA were shake flask cultured, the activity of alpha-amylase in the fermentation supernatant is shown in Table 10
TABLE 10 recombinant Bacillus subtilis enzyme activity for the production of alpha-amylase by overexpression of different chaperones
| Bacterial strains | Enzyme activity (U/mL) |
| B.subtilis WCS9/pHY-SP YojL -amySA(WCS9YSA) | 1095.5 |
| B.subtilis WHS9/pHY-SP YojL -amySA(WHS9YSA) | 1652.8 |
It can be seen that the extracellular α -amylase activity of recombinant bacterium WHS9YSA was 1.5 times and 1.7 times that of recombinant bacterium WS11YSA in example 1.
Example 3: construction and fermentation of bacillus subtilis recombinant bacteria co-expressing Sec secretion system elements
1. Construction of recombinant vectors co-expressing different Sec secretion System elements
RecombinationVector pHY-SP YojL -amySA-secA、pHY-SP YojL -amySA-secYEG、pHY-SP YojL -amySA-sipS、pHY-SP YojL -amySA-sipT、pHY-SP YojL -amySA-sppA and pHY-SP YojL AmySA-tepA replacement of the vector pHY-SP with secA, secYEG, sipS, sipT, sppA and tepA fragments (genes encoding different Sec secretion system elements), respectively YojL The prsA gene fragment from amySA-prsA.
(1) Vector pHY-SP YojL Construction of (E) -amySA-prsA
Vector pHY-SP YojL The original plasmid pHYYamySP is used as the origin plasmid for the amySA-prsA, and the construction method of the original plasmid pHYYamySP is described in Yao et al (Ref: Dongbang Yao, et al. enhanced expression of Bacillus stearothermophilus alpha-amylase in Bacillus subtilis third signal peptide optimization, carbon overexpression and alpha-amylase mutation selection. microbial industries, 18(69), 2019.). Using the recombinant expression vector pHY-SP obtained in step (8) of example 1 YojL The amySA gene in amySA replaces the amyS gene in the starting plasmid pHYYamySP.
(2) The secA, secYEG, sipS, sipT, sppA and tepA fragments were obtained by PCR using the primers secA-F/secA-R, secYEG-F/secYEG-R, sipS-F/sipS-R, sipT-F/sipT-R, sppA-F/sppA-R and tepA-F/tepA-R, respectively, and the Bacillus subtilis WHS9 genome as a template. The sequences of primers secA-F/secA-R, secYEG-F/secYEG-R, sipS-F/sipS-R, sipT-F/sipT-R, sppA-F/sppA-R and tepA-F/tepA-R are shown in Table 11.
(3) Construction of recombinant vector with heavy-duty vector pHY-SP YojL The example of-amySA-secYEG is illustrated.
The specific construction process is as follows:
pHY-SP constructed by recombinant vector step (1) YojL -amySA-prsA as template, linearized by PCR using primers F4/R4 to obtain pHY-SP YojL amySA fragments, PCR system see Table 12. The PCR amplification system for secYEG fragment is shown in Table 13. The secYEG fragment obtained by PCR and the linearized pHY-SP YojL The amySA-prsA fragment was cloned using the Novozam one-step cloning kit (
One Step Cloning Kit) for homologous recombination ligation. The ligation system for the one-step cloning is shown in Table 14. Heavy Carrier pHY-SP YojL A schematic diagram of the construction process of amySA-secYEG is shown in FIG. 3. Constructed recombinant vector pHY-SP YojL The amySA-secYEG was digested with restriction enzyme Hind III, and the product was verified by nucleic acid electrophoresis, the result of which is shown in FIG. 4.
The correct verification is the heavy load carrier pHY-SP YojL -amySA-secYEG。
(4) Construction of recombinant vector pHY-SP according to the method of step (3) YojL -amySA-secA、pHY-SP YojL -amySA-sipS、pHY-SP YojL -amySA-sipT、pHY-SP YojL -amySA-sppA and pHY-SP YojL -amySA-tepA。
TABLE 11 primer sequences
TABLE 12 PCR reaction System
PCR conditions were as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 72 ℃ for 7min, 35s, 30 cycles, and gel recovery of PCR products.
TABLE 13 PCR reaction System
PCR conditions were as follows: pre-denaturation at 94 ℃ for 10 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 72 ℃ for 2min, 15s, 30 cycles, and gel recovery of PCR products.
TABLE 14 one-step cloning ligation System
| Composition (I) | Dosage of |
| secYEG fragment | 2.0μL |
| pHY-SP YojL Fragment of amySA | 1.0μL |
| 5x CE II Buffer | 4.0μL |
| Exnase II | 2.0μL |
| ddH 2 O | 11.0μL |
Connection conditions are as follows: the reaction was carried out at 37 ℃ for 30 min.
2. Construction of recombinant bacteria and shake flask fermentation
(1) The electrotransformation competence of Bacillus subtilis WHS9 was prepared according to the method for preparing Bacillus subtilis electrotransformation competence described in example 1. Respectively transferring the recombinant vectors obtained in the step 1 into electrotransfer competence of bacillus subtilis WHS9, and selecting positive clones to obtain recombinant bacteria B.subtilis WHS9/pHY-SP YojL amySA-secA (named WHS9YSAA), B.sublis WHS9/pHY-SP YojL amySA-secYEG (named WHS9YSAB), B.subtilis WHS9/pHY-SP YojL -amySA-sipS (named WHS9YSAC), B.sublis WHS9/pHY-SP YojL -amySA-sipT(WHS9YSAD)、B.subtilis WHS9/pHY-SP YojL -amySA-sppA(WHS9YSAE)、B.subtilis WHS9/pHY-SP YojL -amySA-tepA(WHS9YSAF)。
After the recombinant Bacillus subtilis strains WHS9YSAA, WHS9YSAB, WHS9YSAC, WHS9YSAD, WHS9YSAE and WHS9YSAF were subjected to shake flask culture according to the seed culture and shake flask fermentation method in example 1, the activities of the alpha-amylase in the fermentation supernatant were as shown in Table 15.
TABLE 15 expression of the enzyme activity of alpha-amylase produced by fermenting recombinant Bacillus subtilis strains with different Sec system elements
| Bacterial strains | Enzyme activity (U/mL) |
| B.subtilis WHS9/pHY-SP YojL -amySA-secA(WHS9YSAA) | 1950.3 |
| B.subtilis WHS9/pHY-SP YojL -amySA-secYEG(WHS9YSAB) | 2148.6 |
| B.subtilis WHS9/pHY-SP YojL -amySA-sipS(WHS9YSAC) | 1785.1 |
| B.subtilis WHS9/pHY-SP YojL -amySA-sipT(WHS9YSAD) | 1983.4 |
| B.subtilis WHS9/pHY-SP YojL -amySA-sppA(WHS9YSAE) | 1917.3 |
| B.subtilis WHS9/pHY-SP YojL -amySA-tepA(WHS9YSAF) | 1702.4 |
It can be seen that the recombinant bacterium WHS9YSAB had an extracellular α -amylase activity 1.3 times that of the recombinant bacterium WHS9YSA in example 2 and 2.2 times that of the recombinant bacterium WS11YSA in example 1.
Example 4: construction and fermentation of bacillus subtilis recombinant bacteria containing different signal peptides
1. Construction of recombinant vectors containing different signal peptides
Vector pHY-SP constructed in example 3 YojL Based on amySA-secYEG, the signal peptide SP was used separately PeL 、SP PelB 、SP YqxI 、SP LipB 、SP YbfO 、SP BglS 、SP RpmG 、SP AspB To replace the vector pHY-SP YojL SP in amySA-secYEG YojL The signal peptide SP PeL 、SP PelB 、SP YqxI 、SP LipB 、SP YbfO 、SP BglS 、SP RpmG 、SP AspB The genes are all derived from the genome of bacillus subtilis 168, and the amino acid sequences are shown in table 16, so that recombinant vectors containing different signal peptides are obtained respectively.
(1) Signal peptide SP PeL 、SP PelB 、SP YqxI 、SP LipB 、SP YbfO 、SP BglS 、SP RpmG 、SP AspB The fragment was obtained by PCR using Bacillus subtilis WHS9 genome as template and primers F5/R5, F6/R6, F7/R7, F8/R8, F9/R9, F10/R10, F11/R11, and F12/R12, respectively. The sequences of the primers F5/R5, F6/R6, F7/R7, F8/R8, F9/R9, F10/R10, F11/R11 and F12/R12 are shown in Table 17. The obtained Signal peptide SP PeL 、SP PelB 、SP YqxI 、SP LipB 、SP YbfO 、SP BglS 、SP RpmG 、SP AspB Fragment and linearized vector pHY-amySA-secYEG fragment without Signal peptide Using the one-step cloning kit of Novozam (R) ((R))
One Step Cloning Kit) for homologous recombination ligation.
TABLE 16 amino acid sequences of different signal peptides
| Signal peptide | Sequence (5 '-3') |
| SP PeL | MKKVMLATALFLGLTPAGANA |
| SP PelB | MKRLCLWFTVFSLFLVLLPGKALG |
| SP YqxI | MFKKLLLATSALTFSLSLVLPLDGHAKA |
| SP LipB | MKKVLMAFIICLSLILSVLAAPPSGAKA |
| SP YbfO | MKRMIVRMTLPLLIVCLAFSSFSASARA |
| SP BglS | MPYLKRVLLLLVTGLFMSLFAVTATASA |
| SP RpmG | MRKKITLACKTCGNRNYTTMKSSASA |
| SP AspB | MKLAKRVSALTPSTTLAITAKA |
(2) Construction of recombinant vectors containing different signal peptides, using recombinant vector pHY-SP RpmG The example of-amySA-secYEG is described. Recombinant vector pHY-SP RpmG The construction of amySA-secYEG is as follows:
with recombinant vector pHY-SP YojL The plasmid amySA-secYEG was used as a template and linearized by PCR using primers F13/R13 to obtain a vector pHY-amySA-secYEG fragment without signal peptide. The sequence of primer F13/R13 is shown in Table 17, and the PCR system for the vector pHY-amySA-secYEG fragment without signal peptide is shown in Table 18. Signal peptide SP RpmG The fragment was obtained by PCR using a primer F11/R11 and the genome of Bacillus subtilis WHS9as a template. Signal peptide SP RpmG The PCR amplification system for the fragments is shown in Table 19. The signal peptide SP obtained by PCR RpmG Using the one-step cloning kit of Novozan with the linearized vector pHY-amySA-secYEG fragment containing no signal peptide (
One Step Cloning Kit) for homologous recombination ligation. The ligation system for the one-step cloning is shown in Table 20. Recombinant vector pHY-SP RpmG A schematic diagram of the construction process of amySA-secYEG is shown in FIG. 5.
TABLE 17 primer sequences
TABLE 18 PCR reaction System
PCR conditions were as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 72 ℃ for 9min, 30s, 30 cycles, and gel recovery of PCR products.
TABLE 19 PCR reaction System
PCR conditions were as follows: pre-denaturation at 94 ℃ for 10 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 72 ℃ for 10s, 30 cycles, and gel recovery of PCR products.
TABLE 20 one-step cloning ligation System
| Composition (I) | Dosage of |
| SP RpmG Fragments | 2.0μL |
| pHY-amySA-secYEG fragment | 1.0μL |
| 5x CE II Buffer | 4.0μL |
| Exnase II | 2.0μL |
| ddH 2 O | 11.0μL |
Connection conditions are as follows: the reaction was carried out at 37 ℃ for 30 min.
(3) The recombinant vectors pHY-SP were obtained according to the above-mentioned method PeL -amySA-secYEG、pHY-SP PelB -amySA-secYEG、pHY-SP YqxI -amySA-secYEG、pHY-SP LipB -amySA-secYEG、pHY-SP YbfO -amySA-secYEG、pHY-SP BglS -amySA-secYEG、pHY-SP AspB -amySA-secYEG。
2. Recombinant bacterium construction containing different signal peptides and shake flask fermentation
(1) Respectively transforming the recombinant vectors containing different signal peptides, which are constructed in the step 1, into the electrotransformation competence of the bacillus subtilis WHS9 prepared in the example 2, and selecting positive clones, namely the bacillus subtilis WHS9/pHY-SP PeL amySA-secYEG (named WHS9ASAB), B.subtilis WHS9/pHY-SP PelB amySA-secYEG (named WHS9BSAB), B.sublis WHS9/pHY-SP YqxI amySA-secYEG (named WHS9CSAB), B.sublis WHS9/pHY-SP LipB amySA-secYEG (named WHS9DSAB), B.sublis WHS9/pHY-SP YbfO amySA-secYEG (named WHS9ESAB), B.subtilis WHS9/pHY-SP BglS amySA-secYEG (named WHS9FSAB), B.subtilis WHS9/pHY-SP RpmG amySA-secYEG (named WHS9GSAB), B.subtilis WHS9/pHY-SP AspB amySA-secYEG (named WHS9 HSAB).
(2) According to the method of seed culture and shake flask fermentation in example 1, after shake flask culture of the bacillus subtilis recombinant bacteria WHS9ASAB, WHS9BSAB, WHS9CSAB, WHS9DSAB, WHS9ESAB, WHS9FSAB, WHS9GSAB and WHS9HSAB obtained in step (1), the α -amylase activity in the fermentation supernatant is shown in table 21:
TABLE 21 Shake flask fermentation production of recombinant Bacillus subtilis containing different signal peptides
| Bacterial strains | Enzyme activity (U/mL) |
| B.subtilis WHS9/pHY-SP PeL -amySA-secYEG(WHS9ASAB) | 345.9 |
| B.subtilis WHS9/pHY-SP PelB -amySA-secYEG(WHS9BSAB) | 231.1 |
| B.subtilis WHS9/pHY-SP YqxI -amySA-secYEG(WHS9CSAB) | 227.0 |
| B.subtilis WHS9/pHY-SP LipB -amySA-secYEG(WHS9DSAB) | 125.4 |
| B.subtilis WHS9/pHY-SP YbfO -amySA-secYEG(WHS9ESAB) | 201.5 |
| B.subtilis WHS9/pHY-SP BglS -amySA-secYEG(WHS9FSAB) | 142.4 |
| B.subtilis WHS9/pHY-SP RpmG -amySA-secYEG(WHS9GSAB) | 2835.1 |
| B.subtilis WHS9/pHY-SP AspB -amySA-secYEG(WHS9HSAB) | 1913.2 |
It can be seen that the extracellular α -amylase activity of the recombinant strain WHS9GSAB is 1.3 times higher than that of the recombinant strain WHS9YSAB in example 3, and 2.9 times higher than that of the recombinant strain WS11YSA in example 1.
From the above results, it can be seen that: bacillus subtilis WS9 with six extracellular protease deletion types is more suitable as a recombinant expression host of alpha-amylase than WS10 and WS 11. The gene engineering WHS9 of the bacillus subtilis with over-expressed intracellular chaperone proteins of GroE series and DnaK series is obtained by knocking out the hrcA gene on the genome of the bacillus subtilis WS 9.
In addition, on the basis of coexpression of Sec secretory pathway element SecYEG encoding gene SecYEG, signal peptide SP obtained by screening RpmG The whole secretion process of the alpha-amylase in the bacillus subtilis WHS9 is balanced, and the extracellular alpha-amylase activity of the finally obtained bacillus subtilis recombinant strain WHS9GSAB is improved by 2.9 times compared with the extracellular alpha-amylase activity of the bacillus subtilis recombinant strain WS11 SA.
Example 5: recombinant bacillus subtilis 3-L fermentation tank horizontal enzyme production
The method comprises the following specific steps:
(1) recombinant bacteria B.subtilis WHS9/pHY-SP preserved in refrigerator at-80 deg.C RpmG An amySA-secYEG (WHS9GSAB) glycerol tube, streaking on an LB solid culture medium containing tetracycline resistance (50 mu g/mL), performing static culture on the streaked LB solid culture medium at 37 ℃ for 10-12h, picking a single clone from the LB solid culture medium to an LB liquid culture medium, and performing culture at 30-37 ℃ and 180-220 rpm for 8-12 h to obtain a seed solution.
(2) Inoculating the seed solution obtained in the step (1) into a 3-L fermentation tank containing basic culture of an upper tank according to the inoculation amount of 5-15% (v/v), culturing at 30-37 ℃ and pH 6-8, inoculating thalli onto the basic culture medium of the upper tank, culturing for 6-8 h, and then starting to flow the supplemented culture medium of the upper tank into the basic culture medium of the upper tank; controlling the dissolved oxygen content in the fermentation liquor in the fermentation process to be 20-40% by coupling the stirring rotating speed (200-800 rpm) and the pure oxygen content (0-30%) in the aeration; in addition, the glucose parameter of the fermentation liquid in the fermentation process is controlled to be 0-5 g/L by regulating and controlling the feeding flow speed in the feeding culture medium.
Under the 3-L tank fermentation culture condition, the activity of the alpha-amylase in extracellular fermentation supernatant is highest when the fermentation is carried out for 93 hours, the highest activity is 35779.5U/mL, is 12.6 times of the activity of shake flask fermentation enzyme (2835.1U/mL), and is 3.9 times of the highest extracellular enzyme activity (9201.1U/mL) of alpha-amylase derived from bacillus stearothermophilus in bacillus subtilis through recombination expression, which is reported in the literature at present.
Example 6: recombinant bacillus subtilis expression alpha-amylase
The specific implementation manner is the same as that of example 3, except that the signal peptide in the recombinant expression vector for regulating the alpha-amylase gene amySA is SP RpmG Construction of recombinant expression vector pHY-SP of alpha-amylase RpmG -amySA-secA、pHY-SP RpmG -amySA-sipS、pHY-SP RpmG -amySA-sipT、pHY-SP RpmG -amySA-sppA and pHY-SP RpmG -amySA-tepA。
Then constructing a bacillus subtilis recombinant strain B.subtilis WHS9/pHY-SP by taking bacillus subtilis WHS9as an expression host RpmG amySA-secA (named WHS9RSAA), B.subtilis WHS9/pHY-SP RpmG amySA-secYEG (named WHS9RSAB), B.subtilis WHS9/pHY-SP RpmG amySA-sipS (named WHS9RSAC), B.subtilis WHS9/pHY-SP RpmG -amySA-sipT(WHS9RSAD)、B.subtilis WHS9/pHY-SP RpmG -amySA-sppA(WHS9RSAE)、B.subtilis WHS9/pHY-SP RpmG -amySA-tepA(WHS9RSAF)。
According to the seed culture and shake flask fermentation method in example 1, after the recombinant bacillus subtilis WHS9RSAA, WHS9RSAB, WHS9RSAC, WHS9RSAD, WHS9RSAE and WHS9RSAF were subjected to shake flask culture, the α -amylase activity in the fermentation supernatant was as shown in table 22.
TABLE 22 expression of recombinant Bacillus subtilis strain with different Sec secretion system elements for producing alpha-amylase by fermentation
| Bacterial strains | Enzyme activity (U/mL) |
| B.subtilis WHS9/pHY-SP RpmG -amySA-secA(WHS9RSAA) | 2552.3 |
| B.subtilis WHS9/pHY-SP RpmG -amySA-secYEG(WHS9RSAB) | 2835.1 |
| B.subtilis WHS9/pHY-SP RpmG -amySA-sipS(WHS9RSAC) | 2360.1 |
| B.subtilis WHS9/pHY-SP RpmG -amySA-sipT(WHS9RSAD) | 2635.1 |
| B.subtilis WHS9/pHY-SP RpmG -amySA-sppA(WHS9RSAE) | 2541.3 |
| B.subtilis WHS9/pHY-SP RpmG -amySA-tepA(WHS9RSAF) | 2244.5 |
As can be seen, the extracellular alpha-amylase activity of the Bacillus subtilis recombinant strain WHS9RSAB co-expressing the Sec secretion system element secYEG is still higher than that of the Bacillus subtilis recombinant strains WHSRSAA, WHSRSAC, WHSRSAD, WHSRSAE and WHSRSAF co-expressing the Sec secretion system elements secYEG, so that the co-expression of the Sec secretion system element secYEG is more favorable for the recombinant expression of the alpha-amylase.
In addition, as can be seen from Table 22, in the signal peptide SP RpmG Constructed under mediationThe activity of the extracellular alpha-amylase of the recombinant bacillus subtilis WHSRSAA, WHSRSAC, WHSRSAD, WHSRSAE and WHSRSAF shake flask fermentations is all compared with that of the signal peptide SP YojL The extracellular alpha-amylase activity of the bacillus subtilis recombinant bacteria WHSYSAA, WHSYSAC, WHSYSAD, WHSYSAE and WHSYSAF shake flask fermentation constructed under the mediation is high, which indicates that the signal peptide SP RpmG Comparison Signal peptide SP YojL Is more suitable for mediating the recombinant expression of the alpha-amylase in the bacillus subtilis WHS 9.
Comparative example 1:
the specific implementation mode is the same as that of example 2, except that the Bacillus subtilis host is adjusted to WS11, the Bacillus subtilis genetically engineered bacterium WHS11 is obtained by knocking out hrcA gene, and then the recombinant expression vector pHY-SP YojL Transferring amySA into bacillus subtilis WHS11 competence in an electrotransformation mode to construct bacillus subtilis recombinant strain WHS11/pHY-SP YojL -amySA(WHS11YSA)。
After the bacillus subtilis recombinant strain WHS11YSA is subjected to seed culture, carrying out shake-flask fermentation culture. After shaking flask fermentation, the enzyme activity of the bacillus subtilis recombinant strain WHS11YSA extracellular alpha-amylase is 1496.8U/mL. In example 2, the extracellular alpha-amylase activity (1652.8U/mL) of the bacillus subtilis WHS9YSA shake flask fermentation is improved by 10.4% compared with the extracellular alpha-amylase activity of the heavier group bacteria WHS11 YSA. Therefore, it can be seen that by optimizing the expression host of Bacillus subtilis, the finally obtained host bacterium WS9 is indeed more suitable for recombinant expression of alpha-amylase than WS 11.
The construction of the recombinant Bacillus subtilis WHS11YSA is described in Yao et al (Ref: Dongbang Yao, et al. enhanced expression of Bacillus stearothermophilus alpha-amylase in Bacillus subtilis through signal optimization, carrier overexpression and alpha-amylase mutation selection. microbial cells industries, 18(69), 2019.).
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> a method for expressing alpha-amylase in Bacillus subtilis
<130> BAA201194A
<160> 9
<170> PatentIn version 3.3
<210> 1
<211> 1032
<212> DNA
<213> Artificial sequence
<400> 1
atgttaacaa atcgtcagct gctgatcctt caggttataa tcaacgattt tattaaatcg 60
gcacagccgg tgggatcaag aactctttcg aaaaaagatg aaatcacatt tagctctgca 120
acaataagaa acgagatggc tgacttggag gaattgggct ttattgaaaa aacccattca 180
tcctcaggac gtgttccgtc agaaaaaggg tatcggtact atgttgacca tttgctgtca 240
cccgtcaaat tgacgaaaag cgacctggac caaatccact cgatcttcaa agagaaaatt 300
ttcgagctgg agaagacagt tcaaaaatca gcgcaaattt tgtccgatct gacgaattac 360
acatccatcg tactcgggcc gaagttgagt gagaattacc ttaaacagat tcaaatcatt 420
ccgattcagc ctgatatggc ggtagcgatt ctcgttacca atacggggca tgtggaaaac 480
aaaacgatta actttccgac caaaatggat ctgtctgata ttgaaaaact ggtaaatata 540
ctgaacgacc gtttaagcgg cgttccaatg gatgaactga atgagcgcat atttaaagaa 600
gttgtcatgt acctaagaca gcacattaaa aactatgaca atatactcga cgcgcttcgt 660
tcaacctttc attccacaaa tcacgttgaa aagttgtttt ttggcgggaa aatcaatatg 720
ctgaaccagc ctgagttcca tgatatcacc cgagttcggt cgctgctttc attaattgag 780
aaagaacagg atgttttaaa gctggttcaa tccccgcaca cgggaatttc gattaaaatc 840
ggaaaagaaa acgactatga agagatggaa aattgcagtc tgattacggc ttcttattcc 900
agggttgtca gcctgcttca gcatgtgact tcggacttgt caaaagcatt aacaagtctg 960
agggttgtca gcctgcttca gcatgtgact tcggacttgt caaaagcatt aacaagtctg 1020
tatgatgaat aa 1032
<210> 2
<211> 333
<212> DNA
<213> Artificial sequence
<400> 2
atggcagtta ttgatgactt tgagaaattg gatatcagaa cgggaacaat tgtaaaagcg 60
gaagaatttc ctgaagcaag agtaccggca atcaagcttg tgatagattt tgggactgaa 120
atcggcataa aacaatcgag cgcacaaatc acgaagcgtt acaagccgga aggtctcatc 180
aacaagcaag tcatagcagt cgtgaacttt ccgccccgcc ggatcgccgg atttaaatcg 240
gaagtcttgg tcctcggcgg catacccggc cagggcgacg tcgtcctttt gcagccggat 300
cagcctgtcc caaacggcac aaaaatcgga taa 333
<210> 3
<211> 2526
<212> DNA
<213> Artificial sequence
<400> 3
atgcttggaa ttttaaataa aatgtttgat ccaacaaaac gtacgctgaa tagatacgaa 60
aaaattgcta acgatattga tgcgattcgc ggagactatg aaaatctctc tgacgacgca 120
ttgaaacata aaacaattga atttaaagag cgtcttgaaa aaggggcgac aacggatgat 180
cttcttgttg aagctttcgc tgttgttcga gaagcttcac gccgcgtaac aggcatgttt 240
ccgtttaaag tccagctcat ggggggcgtg gcgcttcatg acggaaatat agcggaaatg 300
aaaacagggg aagggaaaac attaacgtct accctgcctg tttatttaaa tgcgttaacc 360
ggtaaaggcg tacacgtcgt gactgtcaac gaatacttgg caagccgtga cgctgagcaa 420
atggggaaaa ttttcgagtt tctcggtttg actgtcggtt tgaatttaaa ctcaatgtca 480
aaagacgaaa aacgggaagc ttatgccgct gatattactt actccacaaa caacgagctt 540
ggcttcgact atttgcgtga caatatggtt ctttataaag agcagatggt tcagcgcccg 600
cttcattttg cggtaataga tgaagttgac tctattttaa ttgatgaagc aagaacaccg 660
cttatcattt ctggacaagc tgcaaaatcc actaagctgt acgtacaggc aaatgctttt 720
gtccgcacgt taaaagcgga gaaggattac acgtacgata tcaaaacaaa agctgtacag 780
cttactgaag aaggaatgac gaaggcggaa aaagcattcg gcatcgataa cctctttgat 840
gtgaagcatg tcgcgctcaa ccaccatatc aaccaggcct taaaagctca cgttgcgatg 900
caaaaggacg ttgactatgt agtggaagac ggacaggttg ttattgttga ttccttcacg 960
ggacgtctga tgaaaggccg ccgctacagt gaggggcttc accaagcgat tgaagcaaag 1020
gaagggcttg agattcaaaa cgaaagcatg accttggcga cgattacgtt ccaaaactac 1080
ttccgaatgt acgaaaaact tgccggtatg acgggtacag ctaagacaga ggaagaagaa 1140
ttccgcaaca tctacaacat gcaggttgtc acgatcccta ccaacaggcc tgttgtccgt 1200
gatgaccgcc cggatttaat ttaccgcacg atggaaggaa agtttaaggc agttgcggag 1260
gatgtcgcac agcgttacat gacgggacag cctgttctag tcggtacggt tgccgttgaa 1320
acatctgaat tgatttctaa gctgcttaaa aacaaaggaa ttccgcatca agtgttaaat 1380
gccaaaaacc atgaacgtga agcgcagatc attgaagagg ccggccaaaa aggcgcagtt 1440
acgattgcga ctaacatggc ggggcgcgga acggacatta agcttggcga aggtgtaaaa 1500
gagcttggcg ggctcgctgt agtcggaaca gaacgacatg aatcacgccg gattgacaat 1560
cagcttcgag gtcgttccgg acgtcaggga gacccgggga ttactcaatt ttatctttct 1620
atggaagatg aattgatgcg cagattcgga gctgagcgga caatggcgat gcttgaccgc 1680
ttcggcatgg acgactctac tccaatccaa agcaaaatgg tatctcgcgc ggttgaatcg 1740
tctcaaaaac gcgtcgaagg caataacttc gattcgcgta aacagcttct gcaatatgat 1800
gatgttctcc gccagcagcg tgaggtcatt tataagcagc gctttgaagt cattgactct 1860
gaaaacctgc gtgaaatcgt tgaaaatatg atcaagtctt ctctcgaacg cgcaattgca 1920
gcctatacgc caagagaaga gcttcctgag gagtggaagc ttgacggtct agttgatctt 1980
atcaacacaa cttatcttga tgaaggtgca cttgagaaga gcgatatctt cggcaaagaa 2040
ccggatgaaa tgcttgagct cattatggat cgcatcatca caaaatataa tgagaaggaa 2100
gagcaattcg gcaaagagca aatgcgcgaa ttcgaaaaag ttatcgttct tcgtgccgtt 2160
gattctaaat ggatggatca tattgatgcg atggatcagc tccgccaagg gattcacctt 2220
cgtgcttacg cgcagacgaa cccgcttcgt gagtatcaaa tggaaggttt tgcgatgttt 2280
gagcatatga ttgaatcaat tgaggacgaa gtcgcaaaat ttgtgatgaa agctgagatt 2340
gaaaacaatc tggagcgtga agaggttgta caaggtcaaa caacagctca tcagccgcaa 2400
gaaggcgacg ataacaaaaa agcaaagaaa gcaccggttc gcaaagtggt tgatatcgga 2460
cgaaatgccc catgccactg cggaagcggg aaaaaatata aaaattgctg cggccgtact 2520
gaatag 2526
<210> 4
<211> 1747
<212> DNA
<213> Artificial sequence
<400> 4
ttgtttaaaa caatctccaa ctttatgcgt gtgagtgata tcaggaataa aatcatattc 60
actttactca tgcttatcgt ctttcgcata ggtgcgttta ttcctgtgcc ttacgttaac 120
gctgaagcgt tacaggcaca gtctcaaatg ggtgtttttg atctccttaa tacatttggc 180
ggcggtgcgc tttaccaatt ttccattttc gcaatgggaa ttactcctta tatcacggct 240
tcgatcatca ttcagctgct tcagatggat gtggtaccga agtttaccga gtggtctaag 300
caaggtgaag ttggccgccg taaattagct cagttcacaa ggtactttac gattgtgctt 360
ggtttcatcc aagcgttagg tatgtcatat ggattcaaca atctggcaaa cggtatgctg 420
atcgaaaaat ccggtgtatc gacatatctt atcattgctt tagtgctcac tggcggaact 480
gcctttttaa tgtggcttgg ggaacaaatt acttctcatg gagtaggcaa cggaatatcg 540
atcattatct tcgcggggat tgtgtctagt attccaaaaa caattgggca aatatatgag 600
actcaatttg tcggcagcaa cgatcagttg tttattcata ttgtgaaagt cgcacttctt 660
gtgattgcga ttttagcagt tattgttgga gttattttca ttcagcaagc cgtacggaaa 720
attgcgattc aatatgctaa aggcacaggt cgttcacctg ctggcggagg tcagtctaca 780
caccttccat tgaaagtgaa tcctgcaggg gttattccgg taatctttgc ggttgcgttt 840
ttgataacgc cgcggacgat cgcgtcattc tttggaacaa acgatgtgac aaagtggatt 900
caaaacaact ttgataatac gcatccggtg ggtatggcga tatatgttgc gttgattatt 960
gcctttacgt acttttatgc ttttgtacag gtaaaccctg aacaaatggc tgataacctt 1020
aaaaaacagg gtggctatat cccgggggtt cgtccaggga aaatgactca agatagaatt 1080
acgagcattt tgtatcgact tacgtttgtg ggttctatat tcttagccgt gatttccatt 1140
cttcctatct ttttcattca attcgctgga ttgcctcaaa gtgcacaaat tggcggaaca 1200
tctttgttaa ttgttgtcgg ggtagccttg gagacaatga aacaactaga aagccagttg 1260
gtgaaacgaa actaccgtgg atttatgaaa aactagaaat tgtggaggtc ttttacatgc 1320
gtattatgaa attctttaaa gatgttggga aagaaatgaa aaaggtaagc tggcctaaag 1380
gaaaagagtt aacgcgttat accattacgg taatttcaac agttatcttt tttgttatct 1440
tttttgccct ccttgacaca ggaatttctc aattaattcg tttaatagtt gaataatgag 1500
tctggaggtg tatgggatgc acgcagtttt gattacctta ttggttatcg tcagcattgc 1560
acttattatt gtcgttttgc ttcaatccag taaaagtgcc ggattatctg gtgcgatttc 1620
aggcggagcg gagcagctct tcgggaaaca aaaagcaaga ggtcttgatt taattttgca 1680
ccgcattacg gtagtgctgg cagtcttgtt tttcgtgtta acgattgcgc ttgcttatat 1740
cctatag 1747
<210> 5
<211> 555
<212> DNA
<213> Artificial sequence
<400> 5
ttgaaatcag aaaatgtttc gaagaaaaag tcaatattag aatgggcaaa agcaattgtg 60
attgctgtcg ttcttgcttt gctcatccgc aactttattt ttgcgccgta tgtcgttgat 120
ggtgactcta tgtatcctac acttcacaac cgtgaaaggg tttttgttaa tatgacagtc 180
aaatacatcg gcgagtttga tagaggagac atcgtcgtgt taaacggaga tgatgttcac 240
tatgtcaaac gtattatcgg ccttcccggc gatacggttg agatgaaaaa tgaccagctc 300
tatatcaacg ggaaaaaggt ggacgaacct tatttggcgg ctaataaaaa gagagcgaaa 360
caggacggtt ttgaccattt gaccgatgat ttcggcccgg ttaaagtgcc tgataacaag 420
tattttgtga tgggtgacaa tcgtcgcaat tccatggaca gccgtaacgg ccttggcctc 480
ttcacgaaaa aacaaattgc gggtacgtca aagtttgttt tctacccgtt taacgaaatg 540
cgcaaaacaa attag 555
<210> 6
<211> 582
<212> DNA
<213> Artificial sequence
<400> 6
ttgaccgagg aaaaaaatac gaatactgag aaaacggcga agaaaaaaac caatacgtac 60
ctggaatggg gtaaagcgat tgtcatcgct gttctgctgg ctctcctgat ccgtcacttt 120
ttgtttgaac cgtatttagt tgaaggttca tctatgtatc ccacattaca tgacggagaa 180
aggctgtttg tgaataaaac agtcaactat atcggcgagc tgaagcgcgg agatatcgtt 240
attatcaacg gtgaaacttc taaaatccat tatgtaaaaa gattgatcgg aaagcctgga 300
gaaaccgttc aaatgaagga tgacacgctt tatataaacg gtaaaaaagt agccgagcct 360
tacttgtcta aaaacaagaa ggaagcagaa aaacttggtg tcagtctgac aggagacttt 420
ggaccggtta aggttccgaa aggcaaatac tttgtcatgg gagataaccg gctgaattct 480
atggacagcc gaaacgggct gggactgatc gcggaagatc gaattgtcgg cacatcgaag 540
tttgtctttt tcccgtttaa cgaaatgcgt caaacaaaat aa 582
<210> 7
<211> 1008
<212> DNA
<213> Artificial sequence
<400> 7
atgaatgcaa aaagatggat tgcattagtg attgctctgg ggattttcgg cgtgtctatt 60
atcgtcagca tctctatgag tttctttgaa agcgtcaaag gcgctcaaac ggatctcaca 120
tcactgacgg atgaatcgca ggagaagacg ctggaaaacg gcagtccctc aagtaaaatt 180
gccgtattag aggtcagcgg caccattcag gataatgggg actcaagcag tctgcttggt 240
gcagacggat ataaccacag aacgttctta aaaaaccttg agcgcgcaaa agatgacaag 300
acggtcaaag gtatcgttct gaaggtgaat tctccgggtg gcggagtgta tgaaagtgct 360
gaaatacata agaaactgga agaaatcaag aaagaaacga aaaaaccgat ttacgtgtca 420
atgggttcga tggcagcatc aggaggctat tacatctcaa cagcggctga taagattttt 480
gcgacaccgg aaaccctgac cgggtcactc ggcgtcatta tggaaagcgt caattattca 540
aagcttgccg acaagcttgg catttctttt gaaacgatta agagcggggc ccataaggac 600
attatgtctc cttcccgtga gatgacgaaa gaagaaaaaa acatcatgca atcgatggtt 660
gataattcgt atgaaggctt tgttgatgtc atttcaaaag ggcgcggcat gccgaaagca 720
gaggtaaaga aaattgcgga cggccgcgtg tatgacggac ggcaggcgaa aaaactgaac 780
ctcgttgatg agcttggttt ttatgacgat accattacgg ccatgaaaaa ggatcacaag 840
gatttgaaaa acgcctctgt catttcttat gaggaaagct tcggattagg ctcactgttt 900
tccatgggcg cgaacaaaat gtttaaaagt gaaattgatt ttttgaatat gagagaaatt 960
ctatcgcaat ccggttcgcc gagaatgatg tatctctatg cgaagtag 1008
<210> 8
<211> 738
<212> DNA
<213> Artificial sequence
<400> 8
atggatcatc gtatggaaaa cacagaagaa gagcgtcctg aaaaaaatga tgcgaaggac 60
agcattatga ataaaataca gcagcttggt gaaacgacgc ttccgcagct gccccaagat 120
acaaatattc attgtctgac cattatcgga caaattgaag gccatgttca gcttcctccg 180
caaaacaaaa caacaaaata tgaacatgtc atcccgcaga ttgtggcaat tgaacaaaat 240
cccaaaattg aaggcttgct gatcatatta aatactgtcg gaggagatgt tgaagctggt 300
cttgccatag cggaaatgct tgcatcttta tcgaaaccga ccgtttctat cgtgcttggc 360
ggggggcatt caatcggcgt tccgattgct gtatcctgtg attacagcta tatcgccgaa 420
acagcaacga tgacgattca tccagttagg ctcaccgggc tggtcatcgg ggtgccgcaa 480
acgtttgaat acctggataa gatgcaagaa agagttgtta aatttgtgac aagccattcc 540
aatataaccg aagagaagtt taaagagcta atgttttcaa aaggaaactt aacacgcgat 600
atcggaacaa atgtagtcgg taaggatgca gttaaatacg gattgatcga tcacgcaggc 660
ggtgtcggac aggcaatcaa taaactgaat gagctcatcg atgaagcaag gaaagaagaa 720
ggacggatga ttcaatga 738
<210> 9
<211> 482
<212> PRT
<213> Artificial sequence
<400> 9
Met Ala Ala Pro Phe Asn Gly Thr Met Met Gln Tyr Phe Glu Trp Tyr
1 5 10 15
Leu Pro Asp Asp Gly Thr Leu Trp Thr Lys Val Ala Asn Glu Ala Asn
20 25 30
Asn Leu Ser Ser Leu Gly Ile Thr Ala Leu Trp Leu Pro Pro Ala Tyr
35 40 45
Lys Gly Thr Ser Arg Ser Asp Val Gly Tyr Gly Val Tyr Asp Leu Tyr
50 55 60
Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly
65 70 75 80
Thr Lys Ala Gln Tyr Leu Gln Ala Ile Gln Ala Ala His Ala Ala Gly
85 90 95
Met Gln Val Tyr Ala Asp Val Val Phe Asp His Lys Gly Gly Ala Asp
100 105 110
Gly Thr Glu Trp Val Asp Ala Val Glu Val Asn Pro Ser Asp Arg Asn
115 120 125
Gln Glu Ile Ser Gly Thr Tyr Gln Ile Gln Ala Trp Thr Lys Phe Asp
130 135 140
Phe Pro Gly Arg Gly Asn Thr Tyr Ser Ser Phe Lys Trp Arg Trp Tyr
145 150 155 160
His Phe Asp Gly Val Asp Trp Asp Glu Ser Arg Lys Leu Ser Arg Ile
165 170 175
Tyr Lys Phe Arg Gly Lys Ala Trp Asp Trp Glu Val Asp Thr Glu Phe
180 185 190
Gly Asn Tyr Asp Tyr Leu Met Tyr Ala Asp Leu Asp Met Asp His Pro
195 200 205
Glu Val Val Thr Glu Leu Lys Asn Trp Gly Lys Trp Tyr Val Asn Thr
210 215 220
Thr Asn Ile Asp Gly Phe Arg Leu Asp Ala Val Lys His Ile Lys Phe
225 230 235 240
Ser Phe Phe Pro Asp Trp Leu Ser Tyr Val Arg Ser Gln Thr Gly Lys
245 250 255
Pro Leu Phe Thr Val Gly Glu Tyr Trp Ser Tyr Asp Ile Asn Lys Leu
260 265 270
His Asn Tyr Ile Thr Lys Thr Asp Gly Thr Met Ser Leu Phe Asp Ala
275 280 285
Pro Leu His Asn Lys Phe Tyr Thr Ala Ser Lys Ser Gly Gly Ala Phe
290 295 300
Asp Met Arg Thr Leu Met Thr Asn Thr Leu Met Lys Asp Gln Pro Thr
305 310 315 320
Leu Ala Val Thr Phe Val Asp Asn His Asp Thr Glu Pro Val Gln Ala
325 330 335
Leu Gln Ser Trp Val Asp Pro Trp Phe Lys Pro Leu Ala Tyr Ala Phe
340 345 350
Ile Leu Thr Arg Gln Glu Gly Tyr Pro Cys Val Phe Tyr Gly Asp Tyr
355 360 365
Tyr Gly Ile Pro Gln Tyr Asn Ile Pro Ser Leu Lys Ser Lys Ile Asp
370 375 380
Pro Leu Leu Ile Ala Arg Arg Asp Tyr Ala Tyr Gly Thr Gln His Asp
385 390 395 400
Tyr Leu Asp His Ser Asp Ile Ile Gly Trp Thr Arg Glu Gly Gly Thr
405 410 415
Glu Lys Pro Gly Ser Gly Leu Ala Ala Leu Ile Thr Asp Gly Pro Gly
420 425 430
Gly Ser Lys Trp Met Tyr Val Gly Lys Gln His Ala Gly Lys Val Phe
435 440 445
Tyr Asp Leu Thr Gly Asn Arg Ser Asp Thr Val Thr Ile Asn Ser Asp
450 455 460
Gly Trp Gly Glu Phe Lys Val Asn Gly Gly Ser Val Ser Val Trp Val
465 470 475 480
Pro Arg
Claims (6)
1. The recombinant bacillus subtilis WS9 for expressing the alpha-amylase is characterized in that the expression host of the recombinant bacillus subtilis WS9 is bacillus subtilis WS5 with the CCTCC NO of M2016536, and protease delta is knocked outnprE，ΔaprE，ΔnprB，Δbpr，ΔmprAnd ΔeprObtaining; and the following improvements were made to the Bacillus subtilis WS 9:
knockout of coding gene of repressor protein HrcA of intracellular chaperone protein of negative regulation GroE series and DnaK serieshrcASaidhrcAThe nucleotide sequence of the gene is shown as SEQ ID NO.1, and expresses a secretion element of a Sec secretion system, wherein the secretion element of the Sec secretion system is as follows: the nucleotide sequence is shown as SEQ ID NO.3secAThe nucleotide sequence is shown as SEQ ID NO.4secYEGThe nucleotide sequence is shown as SEQ ID NO.5sipSThe nucleotide sequence is shown as SEQ ID NO.6sipTThe nucleotide sequence is shown as SEQ ID NO.7sppAOr the nucleotide sequence is shown as SEQ ID NO.8tepA；
Or, knocking out the coding gene of repressor protein HrcA for negatively regulating GroE series and DnaK series intracellular chaperone proteinhrcASaidhrcAThe nucleotide sequence of the gene is shown as SEQ ID NO.1, and expresses a secretion element of a Sec secretion system, wherein the secretion element of the Sec secretion system is as follows: the nucleotide sequence is shown as SEQ ID NO.3secAThe nucleotide sequence is shown as SEQ ID NO.4secYEGThe nucleotide sequence is shown as SEQ ID NO.5sipSThe nucleotide sequence is shown as SEQ ID NO.6sipTThe nucleotide sequence is shown as SEQ ID NO.7sppAOr the nucleotide sequence is shown as SEQ ID NO.8tepAAnd using a signal peptide SP with the amino acid sequence of MRKKITLACKTCGNRNYTTMKSSASA RpmG Promoting the secretion of the target protein;
the amino acid sequence of the alpha-amylase is shown as SEQ ID NO. 9.
2. The use of the recombinant Bacillus subtilis of claim 1 for increasing the expression level of alpha-amylase.
3. A method for producing an alpha-amylase, which comprises fermenting the recombinant Bacillus subtilis of claim 1 as a production strain.
4. The method according to claim 3, wherein the recombinant Bacillus subtilis is inoculated into a seed culture medium to obtain a seed solution, and the seed solution is inoculated into a fermentation culture medium for fermentation.
5. The method of claim 3 or 4, wherein the recombinant bacillus subtilis is inoculated into a seed culture medium and cultured at 35-38 ℃ and 180-220 rpm for 8-10h to obtain a seed solution; inoculating the seed solution into a shake flask fermentation culture medium, and culturing at 30-37 ℃ and 180-220 rpm for 45-50 h; or inoculating the seed liquid into an upper tank fermentation culture medium, and performing fermentation culture at the pH of 6-8, the temperature of 30-37 ℃ and the dissolved oxygen of 20-40%.
6. Use of the recombinant Bacillus subtilis of claim 1 for the preparation of an alpha-amylase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011601201.9A CN112553134B (en) | 2020-12-30 | 2020-12-30 | Method for expressing alpha-amylase in bacillus subtilis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011601201.9A CN112553134B (en) | 2020-12-30 | 2020-12-30 | Method for expressing alpha-amylase in bacillus subtilis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112553134A CN112553134A (en) | 2021-03-26 |
| CN112553134B true CN112553134B (en) | 2022-09-06 |
Family
ID=75032919
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011601201.9A Active CN112553134B (en) | 2020-12-30 | 2020-12-30 | Method for expressing alpha-amylase in bacillus subtilis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112553134B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113151135A (en) * | 2021-05-17 | 2021-07-23 | 江南大学 | Food safety-grade bacillus subtilis and application thereof in production of chitobiose deacetylase |
| CN113528495A (en) * | 2021-07-05 | 2021-10-22 | 江南大学 | Bacillus subtilis for stably expressing chitobiose deacetylase and construction method and application thereof |
| CN114107146B (en) * | 2021-11-05 | 2023-08-25 | 江南大学 | Construction method and application of resistance-marker-free auxotroph bacillus subtilis |
| CN114875057A (en) * | 2022-06-14 | 2022-08-09 | 中农华威生物制药(湖北)有限公司 | Construction method of bacillus subtilis capable of efficiently expressing feeding low-temperature acidic alpha-amylase |
| CN116286575B (en) * | 2023-02-03 | 2023-10-27 | 安徽大学绿色产业创新研究院 | Method for efficiently expressing raw starch alpha-amylase by using bacillus subtilis |
| CN116656588A (en) * | 2023-05-23 | 2023-08-29 | 江南大学 | Method for improving expression quantity of recombinant protein in bacillus subtilis by coexpression of bacillus-derived enhancement factor |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104245927A (en) * | 2011-12-23 | 2014-12-24 | 丹尼斯科美国公司 | Enhanced production of isoprene using host cells having decreased ISPA activity |
| CN108841772A (en) * | 2018-07-16 | 2018-11-20 | 江南大学 | A kind of bacillus subtilis engineering bacteria of high efficient expression alpha-amylase |
| CN110004166A (en) * | 2018-01-05 | 2019-07-12 | 中国科学院天津工业生物技术研究所 | The recombined bacillus subtilis bacterial strain and its preparation method of high efficient expression secretion 'beta '-mannase |
| CN112004929A (en) * | 2018-04-20 | 2020-11-27 | 味之素株式会社 | Method for secretory production of protein |
-
2020
- 2020-12-30 CN CN202011601201.9A patent/CN112553134B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104245927A (en) * | 2011-12-23 | 2014-12-24 | 丹尼斯科美国公司 | Enhanced production of isoprene using host cells having decreased ISPA activity |
| CN110004166A (en) * | 2018-01-05 | 2019-07-12 | 中国科学院天津工业生物技术研究所 | The recombined bacillus subtilis bacterial strain and its preparation method of high efficient expression secretion 'beta '-mannase |
| CN112004929A (en) * | 2018-04-20 | 2020-11-27 | 味之素株式会社 | Method for secretory production of protein |
| CN108841772A (en) * | 2018-07-16 | 2018-11-20 | 江南大学 | A kind of bacillus subtilis engineering bacteria of high efficient expression alpha-amylase |
Non-Patent Citations (2)
| Title |
|---|
| Secretory expression in Bacillus subtilis and biochemical characterization of a highly thermostable polyethylene terephthalate hydrolase from bacterium HR29;Xingxiang Xi，et al;《Enzyme and Microbial Technology 》;20201118;第143卷;第1-10页 * |
| 枯草芽孢杆菌菌株改造、启动子优化和普鲁兰酶的高效制备研究;张康;《中国优秀博硕士学位论文全文数据库(博士)工程科技Ⅰ辑》;20190415(第4期);B018-9 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112553134A (en) | 2021-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112553134B (en) | Method for expressing alpha-amylase in bacillus subtilis | |
| CN108795937B (en) | Promoter combination for high-efficiency heterologous expression of alkaline protease and gene engineering bacteria thereof | |
| CN109679887B (en) | Method for producing trehalose by coupling fermentation of double-enzyme fusion enzyme with efficient secretory expression | |
| US11447760B2 (en) | Special enzyme for galactooligosaccharide production as well as preparation and application thereof | |
| CN112522173B (en) | Engineering bacterium for producing heterologous alkaline protease and construction method thereof | |
| CN110607319B (en) | Expression vector suitable for bacillus subtilis secretion expression protein and application | |
| JP2018504136A (en) | Production and use of truncated pullulanase | |
| CN107904223A (en) | A kind of algin catenase, the host cell for secreting algin catenase and its application | |
| CN113151270A (en) | Promoter for efficiently expressing alkaline protease and application thereof | |
| CN109022396B (en) | Alpha-amylase mutant with improved enzyme activity and application thereof | |
| CA2156302A1 (en) | An amylolytic enzyme | |
| CN102851266B (en) | Heat-resistant alpha-amylase and construction method of gene engineering bacteria thereof | |
| CN108841772B (en) | Bacillus subtilis engineering bacterium for efficiently expressing alpha-amylase | |
| CN108103049B (en) | Thermophilic L-asparaginase mutant and screening and fermenting method thereof | |
| CN116254249A (en) | Construction of recombinant bacterium for expressing chitinase and preparation of high-enzyme activity mutant | |
| EP2451954A1 (en) | Modified promoter | |
| CN112980753B (en) | Glycoside hydrolase fusion expression system for secretion of exogenous proteins | |
| US10647970B2 (en) | L-type amylase variant and use thereof | |
| CN107083375B (en) | Medium-temperature alpha-amylase and gene and application thereof | |
| CN108384740B (en) | Bacillus subtilis for high-density fermentation | |
| EP0216080B1 (en) | Novel plasmids and transformants | |
| CN112980755B (en) | Genetically engineered bacterium capable of efficiently secreting isoamylase | |
| CN113881618B (en) | Recombinant bacillus subtilis secreting milk casein, and construction method and application thereof | |
| CN113801830B (en) | Bacillus subtilis strain for high yield of pullulanase and application thereof | |
| RU2795707C1 (en) | TRANSFORMANT OGATAEA HAGLERORUM AS A PRODUCER OF THERMOSTABLE α-AMYLASE |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |