CN112980755B - Genetically engineered bacterium capable of efficiently secreting isoamylase - Google Patents

Genetically engineered bacterium capable of efficiently secreting isoamylase Download PDF

Info

Publication number
CN112980755B
CN112980755B CN201911282988.4A CN201911282988A CN112980755B CN 112980755 B CN112980755 B CN 112980755B CN 201911282988 A CN201911282988 A CN 201911282988A CN 112980755 B CN112980755 B CN 112980755B
Authority
CN
China
Prior art keywords
gly
leu
asn
asp
glu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911282988.4A
Other languages
Chinese (zh)
Other versions
CN112980755A (en
Inventor
游淳
石婷
刘珊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin Institute of Industrial Biotechnology of CAS
Original Assignee
Tianjin Institute of Industrial Biotechnology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Institute of Industrial Biotechnology of CAS filed Critical Tianjin Institute of Industrial Biotechnology of CAS
Priority to CN201911282988.4A priority Critical patent/CN112980755B/en
Publication of CN112980755A publication Critical patent/CN112980755A/en
Application granted granted Critical
Publication of CN112980755B publication Critical patent/CN112980755B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2451—Glucanases acting on alpha-1,6-glucosidic bonds
    • C12N9/246—Isoamylase (3.2.1.68)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
    • C12N9/2411—Amylases
    • C12N9/2414—Alpha-amylase (3.2.1.1.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405—Glucanases
    • C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
    • C12N9/2437—Cellulases (3.2.1.4; 3.2.1.74; 3.2.1.91; 3.2.1.150)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01001—Alpha-amylase (3.2.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01004—Cellulase (3.2.1.4), i.e. endo-1,4-beta-glucanase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01068—Isoamylase (3.2.1.68)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses a genetic engineering bacterium capable of efficiently secreting isoamylase, and belongs to the technical fields of biotechnology and genetic engineering. The invention uses bacillus subtilis knocked out alpha amylase as a host, and uses proper signal peptide and secretion auxiliary protein to construct the genetic engineering bacteria capable of efficiently secreting isoamylase. The strain has short fermentation period and low production cost, and the isoamylase fused and secreted with BsCel5 does not form inclusion bodies, is easy to purify, and is favorable for large-scale production of the isoamylase. The invention also discloses a recombinant plasmid containing the isoamylase gene and a method for constructing the genetically engineered bacterium.

Description

Genetically engineered bacterium capable of efficiently secreting isoamylase
Technical Field
The invention belongs to the technical field of biotechnology and genetic engineering, and particularly relates to a bacillus subtilis engineering strain capable of efficiently secreting isoamylase. The invention also relates to a method for producing said genetically engineered bacterium.
Background
Isoamylase (EC 3.2.1.68) is a major starch debranching enzyme capable of catalyzing cleavage reactions of alpha-1, 6 glycosidic bonds in amylopectin, glycogen and certain branched dextrins. Isoamylase is not only of great value in the starch processing industry, but also useful in the production of glucose-1-phosphate. Isoamylase is more favored to hydrolyze macromolecular amylopectin having longer branches than another widely used pullulanase favored to hydrolyze very short branched dextrins, producing linear dextrins having a degree of polymerization of about 20-30. Such long-chain dextrins can be more efficiently converted to glucose-1-phosphate by alpha glucan phosphorylase. The produced glucose-1-phosphate can then be used in an enzyme fuel cell to produce electricity, in an ATP regeneration process that provides slow release for cell-free protein synthesis, and in other biochemicals that synthesize fructose 1, 6-bisphosphate and inositol, among others. Although the isoamylase has wide application, only the isoamylase from the pseudomonas amyloliquefaciens Pseudomonas amyloderamosa realizes industrialized production so far, and the current industrial production is to ferment by natural strains, so that the production period is long, the nutrient composition requirement of the culture medium is high, the production cost is high, and the popularization and the utilization of the isoamylase are not facilitated. Recombinant expression of isoamylase using E.coli has been reported, however, there are problems such as low yield and serious inclusion body. In addition, E.coli contains endotoxins, which affect the use of recombinantly produced isoamylases.
Disclosure of Invention
The first aspect of the present invention provides a genetically engineered bacterium which efficiently secretes isoamylase, wherein the genetically engineered bacterium uses bacillus subtilis as a host, knocks out a coding gene of alpha amylase and secretes and expresses the isoamylase.
The coding gene of the alpha amylase is knocked out to avoid polluting the alpha amylase in the isoamylase produced by fermenting the genetically engineered bacterium, so that the application of the isoamylase is influenced. On the other hand, the knockout of alpha amylase can increase the secretion level of isoamylase.
The isoamylase is natural isoamylase derived from sulfolobus (Sulfolobus tokodaii) or mutant thereof, and comprises amino acid sequences selected from SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 and SEQ ID NO. 10. Mutants were obtained by directed evolution.
The isoamylase is used as a fusion protein to be secreted and expressed in genetic engineering bacteria, wherein glycoside hydrolase family 5endoglucanase (B.subtilis native glycoside hydrolase family endoglucanase, bsCel 5) or a mutant thereof derived from bacillus subtilis is fused at the N end of the isoamylase, and is used as an enhancer to promote the secretion of the isoamylase.
The fusion protein is secreted under the direction of the signal peptide. It will be appreciated by those skilled in the art that a variety of signal peptides known in the art to be functional in Bacillus subtilis may be used in the present invention, including, but not limited to, the protease nprB signal peptide derived from Bacillus subtilis, the alpha amylase amyE signal peptide derived from Bacillus subtilis, and the amyL signal peptide derived from Bacillus licheniformis (B.lichenifermis). Preferably, the signal peptide used in the present invention is a protease nprB signal peptide derived from Bacillus subtilis.
It will be appreciated by those skilled in the art that various strains of Bacillus subtilis known in the art can be used as hosts in the present invention. Preferably, the bacillus subtilis host is a protease knock-out bacillus subtilis strain, e.g., WB800, WB600, SCK6, 1a751, etc. More preferably, the bacillus subtilis host is SCK6.
In a second aspect the invention provides a recombinant plasmid comprising an isoamylase gene, said plasmid comprising a promoter, a ribosome binding site, a signal peptide coding sequence, a gene encoding BsCel5 or a variant thereof, an isoamylase coding gene and a termination sequence. Wherein the signal peptide coding sequence, the coding gene for BsCel5 or a variant thereof and the isoamylase coding gene are fused in the order described in an open reading frame and are operably linked to a promoter sequence.
Those skilled in the art will appreciate that various promoters known in the art may be used as promoters for the present invention, so long as they function in Bacillus subtilis. These promoters include, but are not limited to, the P43 promoter, the PamyL promoter, the Plaps promoter, the PhpaII promoter, the PamyE promoter, the Pgrad promoter, and the like.
Preferably, the recombinant plasmid further comprises a marker gene for screening engineering bacteria containing the recombinant plasmid. More preferably, the marker gene is a resistance gene.
Preferably, the recombinant plasmid is an episomal plasmid, i.e., it is autonomously replicable in bacillus subtilis.
In a third aspect, the present invention provides a method for constructing the genetically engineered bacterium of the first aspect, comprising the steps of:
(1) Knocking out an alpha amylase coding gene amyE in a bacillus subtilis host;
(2) Constructing the recombinant plasmid of the second aspect of the present invention and transferring it into the strain obtained in the step (1);
(3) The correct transformants were selected based on the marker gene on the vector.
The beneficial effects of the invention are as follows:
(1) Secreted isoamylase is favorable for the correct folding of proteins in low-reduction environments without inclusion body formation.
(2) Bacillus subtilis is a food-grade microorganism generally regarded as safe (Generally Recognized As Safe, GRAS), does not produce endotoxins, and is beneficial for the use of isoamylase.
(3) BsCel5 is fused at the N end of the isoamylase, and the BsCel5 contains a cellulose binding module, can be specifically bound with solid cellulose, and is beneficial to separation and purification of products.
(4) The bacillus subtilis is easy to culture, the fermentation process is mature, and the large-scale production of the isoamylase is facilitated.
(5) The mutant with greatly improved secretion and specific enzyme activity is obtained through directed evolution.
Drawings
FIG. 1 is a SDS-PAGE electrophoresis of culture supernatants of engineering bacteria expressing isoamylase. Lane 1, protein marker; lane 2, culture supernatant of Bacillus subtilis strain SCK6/ΔamyE/pNWP43N-BsCel 5-StIA; lane 3: isoamylase fusion protein adsorbed on regenerated amorphous cellulose (Regenerated amorphous cellulose, RAC).
FIG. 2 shows the growth and enzyme production curves for recombinant strain SCK6/ΔamyE/pNWP 43N-6-1.
Detailed Description
The technical means adopted by the invention and the effects thereof are further described by the following specific embodiments. It should be understood that the embodiments described are exemplary only and should not be construed as limiting the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions can be made in the details and form of the technical solution of the present invention without departing from the spirit and scope of the invention, but these changes and substitutions fall within the scope of the present invention.
Example 1: construction of engineering bacteria expressing isoamylase
1) Knock-out of alpha amylase encoding gene amyE:
competent preparation: the activated SCK6 strain was streaked onto LB solid plates containing 0.3. Mu.g/mL erythromycin and incubated overnight at 37 ℃. The following day the monoclonal was picked and inoculated in 5mL of LB liquid medium containing 0.3. Mu.g/mL erythromycin and incubated at 37℃for 8-12h at 200 rpm. Absorbance at 600nm was measured and then the culture was diluted to a600= -1.0 with fresh LB liquid medium containing 0.3 μg/mL erythromycin pre-warmed at 37 ℃. D-xylose was added at a final concentration of 1% (w/v), and the culture was continued at 37℃for 2 hours at 200rpm, thereby obtaining a product for transformation.
Conversion: 50ng PDG1730 plasmid was mixed with 200. Mu.L competent cells, incubated at 37℃for 1.5h at 200rpm, and then plated with LB solid plates containing 100. Mu.g/mL Qamycin, and incubated overnight at 37 ℃.
Colony PCR identification: a small amount of transformant cells were selected from the plate and diluted in 30. Mu.L of sterile water, boiled water for 5min, frozen at-20℃for 5min, then dissolved at room temperature, centrifuged at 12000rpm for 1min, 2. Mu.L of supernatant was taken as a template, and primer amyE-F was used: 5'-ACCTCTTTACTGCCGTTATTCG-3' and amyE-R:5'-TAGCACGTAATCAAAGCCAGG-3' PCR amplification was performed according to the following conditions: denaturation at 98℃for 2min was performed for 30 cycles as follows: denaturation at 98℃for 15s, annealing at 58℃for 15s, extension at 72℃for 30s, and finally extension at 72℃for 5min. As a result of the electrophoresis analysis, only a single band of-2.6 kb was amplified, namely, the successfully knocked-out strain amyE was labeled SCK6/amyE.
2) Construction of recombinant plasmids
The isoamylase coding sequence shown in SEQ ID NO.1 was synthesized total-genetically and amplified using the following primers:
StIA-IF：
5′-
ACTGATTTGGGGAACAGAACCAAATATGGTGTTCAGCCATAAAGATCGTC-
3′
StIA-IR：
5′-
CACAACGCAAACCTCCTATTAGATGTTAATATTCAATGCGACGATAAACC-3′
the DNA fragment encoding mature glycoside hydrolase BsCel5 (GenBank accession number: CAA82317, amino acids 30-499) was amplified from the genome of Bacillus subtilis 168 using the following primers:
BsCel5-IF：
5′-
GTAACACATGCCTCAGCTGCAGCAGGGACAAAAACGCCAGTAGCCA-3′
BsCel5-IR：
5′-
GACGATCTTTATGGCTGAACACCATATTTGGTTCTGTTCCCCAAATCAGT-3′
the pNWP43N vector linear backbone was amplified using the following primers with the pNWP43N plasmid as template, comprising the P43 promoter and the signal peptide of protease NprB derived from bacillus subtilis 168:
pNWP43N-VF：
5′-
GGTTTATCGTCGCATTGAATATTAACATCTAATAGGAGGTTTGCGTTGTG-3′
pNWP43N-VR：
5′-TGGCTACTGGCGTTTTTGTCCCTGCTGCAGCTGAGGCATGTGTTAC-
3′
PCR conditions were 98℃for 2min and 30 cycles were performed as follows: denaturation at 98℃for 15s, annealing at 58℃for 15s, extension at 72℃for 1min, and extension at 72℃for 5min. The products obtained by the PCR reaction were analyzed by 1% agarose gel electrophoresis, respectively. After the correct size of the fragments was confirmed by imaging with a gel imaging system, the target fragments were recovered using a DNA purification recovery kit (Tiangen Biochemical Co., ltd., china).
The isoamylase gene fragment, bsCel5 gene fragment and pNWP43N vector backbone were then assembled using POE-PCR. POE-PCR system is as follows: purified pNWP3N linear backbone, 200ng; 131ng of purified isoamylase gene fragment; purified BsCel5 gene fragment, 2X PrimeSTAR MAX DNA Polymerase (Dalianbao organism, china), 25. Mu.L, was added with water to make up 50. Mu.L. POE-PCR conditions were 98℃for 2min denaturation, 30 cycles according to the following parameters: denaturation at 98℃for 15s, annealing at 58℃for 15s, extension at 72℃for 3.5min, and extension at 72℃for 5min.
3) Construction of engineering bacteria
SCK6/Δamye competence was prepared as described above for SCK6. mu.L of POE-PCR product was mixed with 200. Mu.L of SCK 6/. DELTA.amyE competent cells, incubated at 37℃for 1.5h at 200rpm, and then plated with LB solid plates containing 5. Mu.g/mL chloramphenicol, and incubated overnight at 37 ℃. The following day 2-3 transformants were selected for sequencing verification, and the sequencing result shows that pNWP3N-BsCel5-StIA recombinant plasmid and corresponding engineering bacteria SCK 6/delta amyE/pNWP43N-BsCel5-StIA expressing isoamylase were successfully obtained.
Example 2: shake flask fermentation enzyme production
The isoamylase-expressing engineering bacteria SCK6/ΔamyE/pNWP43N-BsCel5-StIA obtained in example 1 was cultured in SR medium (1.5% peptone, 2.5% yeast extract and 0.3% K) 2 HPO 4 ) Is incubated at 30℃and 250rpm for 48h. mu.L of the cell-free supernatant was mixed with 10. Mu.L of 5 XSDS loading buffer, and after 5min boiling at 100℃20. Mu.L was loaded onto 12% SDS-PAGE. And (3) carrying out constant pressure treatment at 120V for 1-1.5h, and stopping electrophoresis after the bromophenol blue indicator strip leaves the gel. Coomassie brilliant blue staining detects protein secretion. In addition, the protein in the culture supernatant was adsorbed by RAC, and the specific procedure was as follows: 0.5mg of RAC was added to 10mL of the culture supernatant, mixed well, adsorbed on ice for 15-30min, centrifuged at 5000 Xg for 5min at 4℃and resuspended in 40. Mu.L of 40mM sodium acetate buffer (pH 5.5), then mixed with 10. Mu.L of 5 XSDS loading buffer, and after 5min of boiling at 100℃10. Mu.L of sample was taken for SDS-PAGE analysis. As shown in FIG. 1, a distinct protein band with a molecular weight corresponding to BsCel5-StIA (135 kDa) was observed in the supernatant, and the protein was specifically adsorbed on RAC.
The culture supernatant was analyzed for isoamylase activity using the iodine method with corn amylopectin as a substrate. The enzyme activity assay system comprises 0.35% (wt/v) corn amylopectin, 40mM sodium acetate buffer (pH 5.5), 0.5mM MgCl 2 And an appropriate amount of concentrated supernatant in a total volume of 500. Mu.L. After incubation at 50℃for 30min, 50. Mu.L of the reaction mixture was taken and mixed with 50. Mu.L of 0.01. 0.01M I 2 0.1M KI solution, then diluted to 1mL with distilled water, and the absorbance at 610nm was measured immediately. The 1U enzyme activity was defined as the amount of enzyme required to increase the absorbance at 610nm by 0.1 in 1h under the above assay conditions. Specific enzyme activities were measured under the same conditions to determine the secretion amount of the protein. The results showed that the culture supernatant had isoamylase secretion with an enzyme activity of 1.19U/mL, corresponding to 9.75. 9.75 mg/L fusion protein.
Example 3: directed evolution to increase secretion levels
1) Construction of a mutant library with the appropriate mutation Rate
Plasmid pNWP43N-BsCel5-IA as templateSP removal by high fidelity DNA polymerase amplification nprB -BsCel5-IA encoding gene outside the part as linear plasmid backbone; the PCR amplified fragment library containing the random mutation new secretion regulatory element is obtained by adopting an error-prone PCR technology by taking an expression vector pNWP43N-BsCel5-IA as a template; the obtained linear plasmid skeleton and random mutant fragment library are subjected to overlap extension PCR technology according to the mol ratio of 1:1 to obtain DNA multimer (DNA multimer), and the DNA multimer is transformed into B.subtis SCK6/amyE super competence. The mutation rate of the obtained library was-0.13%.
2) Forward mutant obtained by using amylopectin/iodine screening system
Transformants containing the mutant plasmid pNWP 43N-Bxcel 5-IA were grown on LB plates overnight at 50℃and covered with an upper agar containing 0.5% maize amylopectin and then incubated for 5h at 50 ℃. Since amylose tends to form a regular helix structure, each helix contains 6 residues. When forming a complex with iodine, each turn accommodates one iodine molecule (I 2 ) The 6 turns, i.e. 36 glucose residues, can produce a characteristic blue color. Whereas short-chain iodine molecules in amylopectin absorb light of shorter wavelength, and thus amylopectin turns purple to purplish red when it encounters iodine. When the alpha-1.6 branches in amylopectin are hydrolyzed by isoamylase, complexation of the resulting product with iodine can produce longer strings of iodine molecules, thereby producing a stronger blue color, resulting in blue hydrolyzed circles on the bilayer plates. A larger hydrolysis circle indicates that the corresponding cell can secrete a higher activity or greater amount of isoamylase.
3) Characterization of mutants
The positive mutants 6-1 obtained by the screening were cultured in SR medium at 30℃and 250rpm, sampled at intervals, OD600 was measured, and IA enzyme activity in cell-free supernatants was measured as described in example 2. At 48h, the IA enzyme activity in the supernatant reached 97.4U/mL and the secretion level reached 234mg/L.
Sequence listing
<110> institute of Tianjin Industrial biotechnology, national academy of sciences
<120> genetically engineered bacterium highly effective in secreting isoamylase
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2151
<212> DNA
<213> Artificial sequence ()
<400> 1
atggtgttca gccataaaga tcgtccgctg cgtccgggtg aaccgtatcc gctgggtgca 60
aattgggaag aggaagatga cggcgttaac tttagcattt ttagcgaaaa tgccaccaaa 120
gtggaactgc tgatttatag cccgaccaat cagaaatatc cgaaagaagt gatcgaagtt 180
aaacagcgta gcggtgatat ttggcatgtt tttgttccgg gtctgggtcc gggtacactg 240
tatgcatatc gtatttatgg tccgtataaa ccggatcagg gtctgcgttt taatccgaat 300
aaagttctga ttgatccgta cgccaaagca attaatggca ccctgaattg gaatgatgca 360
gtgtttggct ataaaatcgg tgatagcaat caggatctga gctttgatga tcgtccggat 420
gatgaattca ttccgaaagg tgttgtgatc aacccgtatt ttgaatggga tgatgatcac 480
ttttttcgtc gcaaaaaaat cccgctgaaa gacaccatta tctatgaagt tcatgtgaaa 540
ggcttcacca aactgcgtcc ggatctgccg gaaaatattc gtggcaccta taaaggtttt 600
gcaagccgtc agatgatcga gtatctgaaa gatctgggtg ttaccaccgt tgaaattatg 660
ccggttcagc agtttgttga tgatcgtttt ctggttgaaa aaggcctgcg taattattgg 720
ggttataatc cgatcaacta cttcagtccg gaatgtcgtt atagcagcag cggttgtatg 780
ggtgaacagg tgaatgaatt taaagaaatg gtgaacgaac tgcacaacgc aggttttgaa 840
gttattatcg atgtggtgta taaccatacc gcagaaggta atcatctggg tccgaccctg 900
agctttcgtg gtattgataa tctggcctat tatatgctgg tgccggataa caaacgttat 960
tatctggatt ttaccggcac cggtaatacc ctgaatctga gccatccgcg tgttctgcag 1020
atggttctgg atagcctgcg ttattgggtt ctggaaatgc atgttgatgg ttttcgtttt 1080
gatctggcag cagcactggc acgtcagctg tatagcgtta atatgctgag cacctttttt 1140
gttgcaattc agcaggatcc ggttctgagc caggttaaac tgattgcaga accgtgggat 1200
gttggtccgg gtggttatca ggttggtaat tttccgtatc tgtgggcaga atggaatggt 1260
aaatatcgtg ataccattcg tcgtttttgg cgtggtgaag caattccgta tgaagaactg 1320
gcaaatcgtc tgatgggtag tccggatctg tatgcaggta ataacaaaac cccgtttgcc 1380
agcattaact atattaccag ccatgatggt ttcaccctgg aagatctggt tagctataac 1440
cagaaacata atgaagccaa cggcttcaat aatcaggatg gcatgaatga aaactacagc 1500
tggaattgtg gtgttgaagg tgaaaccaat gatgccaatg ttattcagtg tcgcgaaaaa 1560
cagaaacgca actttattat caccctgttt gttagccagg gtgttccgat gattctgggt 1620
ggtgatgaac tgagccgtac ccagcgtggt aataacaatg cattttgtca ggataacgag 1680
attagctggt ttaactggaa tctggatgaa cgtaaacagc gctttcatga ttttgtgcgt 1740
agcatgattt atttctatcg tgcccatccg atttttcgtc gtgaacgtta ttttcagggc 1800
aaaaaactgc atggtatgcc gctgaaagat gtgacctttc tgaaaccgga tggtaatgaa 1860
gcagatgaac agacctggaa aagcccgacc aactttattg catatattct ggaaggtagc 1920
gtgatcgatg aagttaatga tcgtggtgaa cgtattgccg atgatagctt tctgattatt 1980
ctgaatggta gcccgaataa cattaaattc aaattcccgc agggtaaatg gtcactggtt 2040
gttagcagct atctgcgtga actgcgtgat gatgaacgtg ttgttgatgg tggtaaagaa 2100
ctggaaattg aaggtcgtac cgcaatggtt tatcgtcgca ttgaatatta a 2151
<210> 2
<211> 716
<212> PRT
<213> Artificial sequence ()
<400> 2
Met Val Phe Ser His Lys Asp Arg Pro Leu Arg Pro Gly Glu Pro Tyr
1 5 10 15
Pro Leu Gly Ala Asn Trp Glu Glu Glu Asp Asp Gly Val Asn Phe Ser
20 25 30
Ile Phe Ser Glu Asn Ala Thr Lys Val Glu Leu Leu Ile Tyr Ser Pro
35 40 45
Thr Asn Gln Lys Tyr Pro Lys Glu Val Ile Glu Val Lys Gln Arg Ser
50 55 60
Gly Asp Ile Trp His Val Phe Val Pro Gly Leu Gly Pro Gly Thr Leu
65 70 75 80
Tyr Ala Tyr Arg Ile Tyr Gly Pro Tyr Lys Pro Asp Gln Gly Leu Arg
85 90 95
Phe Asn Pro Asn Lys Val Leu Ile Asp Pro Tyr Ala Lys Ala Ile Asn
100 105 110
Gly Thr Leu Asn Trp Asn Asp Ala Val Phe Gly Tyr Lys Ile Gly Asp
115 120 125
Ser Asn Gln Asp Leu Ser Phe Asp Asp Arg Pro Asp Asp Glu Phe Ile
130 135 140
Pro Lys Gly Val Val Ile Asn Pro Tyr Phe Glu Trp Asp Asp Asp His
145 150 155 160
Phe Phe Arg Arg Lys Lys Ile Pro Leu Lys Asp Thr Ile Ile Tyr Glu
165 170 175
Val His Val Lys Gly Phe Thr Lys Leu Arg Pro Asp Leu Pro Glu Asn
180 185 190
Ile Arg Gly Thr Tyr Lys Gly Phe Ala Ser Arg Gln Met Ile Glu Tyr
195 200 205
Leu Lys Asp Leu Gly Val Thr Thr Val Glu Ile Met Pro Val Gln Gln
210 215 220
Phe Val Asp Asp Arg Phe Leu Val Glu Lys Gly Leu Arg Asn Tyr Trp
225 230 235 240
Gly Tyr Asn Pro Ile Asn Tyr Phe Ser Pro Glu Cys Arg Tyr Ser Ser
245 250 255
Ser Gly Cys Met Gly Glu Gln Val Asn Glu Phe Lys Glu Met Val Asn
260 265 270
Glu Leu His Asn Ala Gly Phe Glu Val Ile Ile Asp Val Val Tyr Asn
275 280 285
His Thr Ala Glu Gly Asn His Leu Gly Pro Thr Leu Ser Phe Arg Gly
290 295 300
Ile Asp Asn Leu Ala Tyr Tyr Met Leu Val Pro Asp Asn Lys Arg Tyr
305 310 315 320
Tyr Leu Asp Phe Thr Gly Thr Gly Asn Thr Leu Asn Leu Ser His Pro
325 330 335
Arg Val Leu Gln Met Val Leu Asp Ser Leu Arg Tyr Trp Val Leu Glu
340 345 350
Met His Val Asp Gly Phe Arg Phe Asp Leu Ala Ala Ala Leu Ala Arg
355 360 365
Gln Leu Tyr Ser Val Asn Met Leu Ser Thr Phe Phe Val Ala Ile Gln
370 375 380
Gln Asp Pro Val Leu Ser Gln Val Lys Leu Ile Ala Glu Pro Trp Asp
385 390 395 400
Val Gly Pro Gly Gly Tyr Gln Val Gly Asn Phe Pro Tyr Leu Trp Ala
405 410 415
Glu Trp Asn Gly Lys Tyr Arg Asp Thr Ile Arg Arg Phe Trp Arg Gly
420 425 430
Glu Ala Ile Pro Tyr Glu Glu Leu Ala Asn Arg Leu Met Gly Ser Pro
435 440 445
Asp Leu Tyr Ala Gly Asn Asn Lys Thr Pro Phe Ala Ser Ile Asn Tyr
450 455 460
Ile Thr Ser His Asp Gly Phe Thr Leu Glu Asp Leu Val Ser Tyr Asn
465 470 475 480
Gln Lys His Asn Glu Ala Asn Gly Phe Asn Asn Gln Asp Gly Met Asn
485 490 495
Glu Asn Tyr Ser Trp Asn Cys Gly Val Glu Gly Glu Thr Asn Asp Ala
500 505 510
Asn Val Ile Gln Cys Arg Glu Lys Gln Lys Arg Asn Phe Ile Ile Thr
515 520 525
Leu Phe Val Ser Gln Gly Val Pro Met Ile Leu Gly Gly Asp Glu Leu
530 535 540
Ser Arg Thr Gln Arg Gly Asn Asn Asn Ala Phe Cys Gln Asp Asn Glu
545 550 555 560
Ile Ser Trp Phe Asn Trp Asn Leu Asp Glu Arg Lys Gln Arg Phe His
565 570 575
Asp Phe Val Arg Ser Met Ile Tyr Phe Tyr Arg Ala His Pro Ile Phe
580 585 590
Arg Arg Glu Arg Tyr Phe Gln Gly Lys Lys Leu His Gly Met Pro Leu
595 600 605
Lys Asp Val Thr Phe Leu Lys Pro Asp Gly Asn Glu Ala Asp Glu Gln
610 615 620
Thr Trp Lys Ser Pro Thr Asn Phe Ile Ala Tyr Ile Leu Glu Gly Ser
625 630 635 640
Val Ile Asp Glu Val Asn Asp Arg Gly Glu Arg Ile Ala Asp Asp Ser
645 650 655
Phe Leu Ile Ile Leu Asn Gly Ser Pro Asn Asn Ile Lys Phe Lys Phe
660 665 670
Pro Gln Gly Lys Trp Ser Leu Val Val Ser Ser Tyr Leu Arg Glu Leu
675 680 685
Arg Asp Asp Glu Arg Val Val Asp Gly Gly Lys Glu Leu Glu Ile Glu
690 695 700
Gly Arg Thr Ala Met Val Tyr Arg Arg Ile Glu Tyr
705 710 715
<210> 3
<211> 2151
<212> DNA
<213> Artificial sequence ()
<400> 3
atggtgttca gccataaaga tcgtccgctg cgtccgggtg aaccgtatcc gctgggtgca 60
aattgggaag aggaagatga cggcgttaac tttagcattt ttagcgaaaa tgccaccaaa 120
gtggaactgc tgatttatag cccgaccaat cagaaatatc cgaaagaagt gatcgaagtt 180
aaacagcgta gcggtgatat ttggcatgtt tttgttccgg gtctgggtcc gggtacactg 240
tatgcatatc gtatttatgg tccgtataaa ccggatcagg gtctgcgttt taatccgaat 300
aaagttctga ttgacccgta cgccaaagca attaatggca ccctgaattg gaatgatgca 360
gtgtttggct ataaaatcgg tgatagcaat caggatctga gctttgatga tcgtccggat 420
gatgaattca ttccgaaagg tgttgtgatc aacccgtatt ttgaatggga tgatgatcac 480
ttttttcgtc gcaaaaaaat cccgctgaaa gacaccatta tctataaagt tcatgtgaaa 540
ggcttcacca aactgcgtcc ggatctaccg gaaaatattc gtggcaccta taaaggtttt 600
gcaagccgtc agatgatcga gtatctgaaa gatctgggtg ttaccaccgt tgaaattatg 660
ccggttcagc agtttgttga tgatcgtttt ctggttgaaa aaggcctgcg taattattgg 720
ggttataatc cgttcaacta cttcagtccg gaatgtcgtt atagcagcag cggttgtatg 780
ggtgaacagg tgaatgaatt taaagaaatg gtgaacgaac tgcacaacgc aggttttgaa 840
gttattatcg atgtggtgta taaccatacc gcagaaggta atcatctggg tccgaccctg 900
agctttcgtg gtattgataa tctggcctat tatatgctgg tgccggataa caaacgttat 960
tatctggatt ttaccggcac cggtaatacc ctgaatctga gccatccgcg tgttctgcag 1020
atggttctgg atagcctgcg ttattgggtt ctggaaatgc atgttgatgg ttttcgtttt 1080
gatctggcaa cagcactggc acgtcagctg tatagcgtta atatgctgag cacctttttt 1140
gttgcaattc agcaggatcc ggttctgagc caggttaaac tgattgcaga accgtgggat 1200
gttggtccgg gtggttatca ggttggtaat tttccgtatc tgtggtcaga atggaatggt 1260
aaatatcgtg ataccattcg tcgtttttgg cgtggtgaag caattccgta tgaagaactg 1320
gcaaatcgtc tgatgggtag tccggatctg tatgcaggta ataacaaaac cccgtttgcc 1380
agcattaact atattaccag ccatgatggt ttcaccctgg aagatctggt tagctataac 1440
cagaaacata atgaagccaa cggcttcaat aaccaggatg gcatgaatga aaactacagc 1500
tggaattgtg gtgttgaagg tgaaaccaat gatgccaatg ttattcagtg tcgcgaaaaa 1560
cagaaacgca actttattat caccctgttt gttagccagg gtgttccgat gattctgggt 1620
ggtgatgaac tgagccgtac ccagcgtggt aataacaatg cattttgtca ggataacgag 1680
attagctggt ttaactggaa tctggatgaa cgtaaacagc gcttccatga ttttgtgcgt 1740
agcatgattt atttctatcg tgcccatccg atttttcgtc gtgaacgtta ttttcagggc 1800
aaaaaactgc atggtatgcc gctgaaagat gtgacctttc tgaaaccgga tggtaatgaa 1860
gcagatgaac agacctggaa aagcccgacc aactttattg catatattct ggaaggtagc 1920
gtgatcgatg aagttaatga tcgtggtgaa cgtattgccg atgatagctt tctgattatt 1980
ctgagtggta gcccgaataa cattaaattc aaattcccgc agggtaaatg gtcactggtt 2040
gttagcagct atctgcgtga actgcgtgat gatgaacgtg ttgttgatgg tggtaaagaa 2100
ctggaaattg aaggtcgtac cgcaatggtt tatcgtcgca ttgaatatta a 2151
<210> 4
<211> 716
<212> PRT
<213> Artificial sequence ()
<400> 4
Met Val Phe Ser His Lys Asp Arg Pro Leu Arg Pro Gly Glu Pro Tyr
1 5 10 15
Pro Leu Gly Ala Asn Trp Glu Glu Glu Asp Asp Gly Val Asn Phe Ser
20 25 30
Ile Phe Ser Glu Asn Ala Thr Lys Val Glu Leu Leu Ile Tyr Ser Pro
35 40 45
Thr Asn Gln Lys Tyr Pro Lys Glu Val Ile Glu Val Lys Gln Arg Ser
50 55 60
Gly Asp Ile Trp His Val Phe Val Pro Gly Leu Gly Pro Gly Thr Leu
65 70 75 80
Tyr Ala Tyr Arg Ile Tyr Gly Pro Tyr Lys Pro Asp Gln Gly Leu Arg
85 90 95
Phe Asn Pro Asn Lys Val Leu Ile Asp Pro Tyr Ala Lys Ala Ile Asn
100 105 110
Gly Thr Leu Asn Trp Asn Asp Ala Val Phe Gly Tyr Lys Ile Gly Asp
115 120 125
Ser Asn Gln Asp Leu Ser Phe Asp Asp Arg Pro Asp Asp Glu Phe Ile
130 135 140
Pro Lys Gly Val Val Ile Asn Pro Tyr Phe Glu Trp Asp Asp Asp His
145 150 155 160
Phe Phe Arg Arg Lys Lys Ile Pro Leu Lys Asp Thr Ile Ile Tyr Lys
165 170 175
Val His Val Lys Gly Phe Thr Lys Leu Arg Pro Asp Leu Pro Glu Asn
180 185 190
Ile Arg Gly Thr Tyr Lys Gly Phe Ala Ser Arg Gln Met Ile Glu Tyr
195 200 205
Leu Lys Asp Leu Gly Val Thr Thr Val Glu Ile Met Pro Val Gln Gln
210 215 220
Phe Val Asp Asp Arg Phe Leu Val Glu Lys Gly Leu Arg Asn Tyr Trp
225 230 235 240
Gly Tyr Asn Pro Phe Asn Tyr Phe Ser Pro Glu Cys Arg Tyr Ser Ser
245 250 255
Ser Gly Cys Met Gly Glu Gln Val Asn Glu Phe Lys Glu Met Val Asn
260 265 270
Glu Leu His Asn Ala Gly Phe Glu Val Ile Ile Asp Val Val Tyr Asn
275 280 285
His Thr Ala Glu Gly Asn His Leu Gly Pro Thr Leu Ser Phe Arg Gly
290 295 300
Ile Asp Asn Leu Ala Tyr Tyr Met Leu Val Pro Asp Asn Lys Arg Tyr
305 310 315 320
Tyr Leu Asp Phe Thr Gly Thr Gly Asn Thr Leu Asn Leu Ser His Pro
325 330 335
Arg Val Leu Gln Met Val Leu Asp Ser Leu Arg Tyr Trp Val Leu Glu
340 345 350
Met His Val Asp Gly Phe Arg Phe Asp Leu Ala Thr Ala Leu Ala Arg
355 360 365
Gln Leu Tyr Ser Val Asn Met Leu Ser Thr Phe Phe Val Ala Ile Gln
370 375 380
Gln Asp Pro Val Leu Ser Gln Val Lys Leu Ile Ala Glu Pro Trp Asp
385 390 395 400
Val Gly Pro Gly Gly Tyr Gln Val Gly Asn Phe Pro Tyr Leu Trp Ser
405 410 415
Glu Trp Asn Gly Lys Tyr Arg Asp Thr Ile Arg Arg Phe Trp Arg Gly
420 425 430
Glu Ala Ile Pro Tyr Glu Glu Leu Ala Asn Arg Leu Met Gly Ser Pro
435 440 445
Asp Leu Tyr Ala Gly Asn Asn Lys Thr Pro Phe Ala Ser Ile Asn Tyr
450 455 460
Ile Thr Ser His Asp Gly Phe Thr Leu Glu Asp Leu Val Ser Tyr Asn
465 470 475 480
Gln Lys His Asn Glu Ala Asn Gly Phe Asn Asn Gln Asp Gly Met Asn
485 490 495
Glu Asn Tyr Ser Trp Asn Cys Gly Val Glu Gly Glu Thr Asn Asp Ala
500 505 510
Asn Val Ile Gln Cys Arg Glu Lys Gln Lys Arg Asn Phe Ile Ile Thr
515 520 525
Leu Phe Val Ser Gln Gly Val Pro Met Ile Leu Gly Gly Asp Glu Leu
530 535 540
Ser Arg Thr Gln Arg Gly Asn Asn Asn Ala Phe Cys Gln Asp Asn Glu
545 550 555 560
Ile Ser Trp Phe Asn Trp Asn Leu Asp Glu Arg Lys Gln Arg Phe His
565 570 575
Asp Phe Val Arg Ser Met Ile Tyr Phe Tyr Arg Ala His Pro Ile Phe
580 585 590
Arg Arg Glu Arg Tyr Phe Gln Gly Lys Lys Leu His Gly Met Pro Leu
595 600 605
Lys Asp Val Thr Phe Leu Lys Pro Asp Gly Asn Glu Ala Asp Glu Gln
610 615 620
Thr Trp Lys Ser Pro Thr Asn Phe Ile Ala Tyr Ile Leu Glu Gly Ser
625 630 635 640
Val Ile Asp Glu Val Asn Asp Arg Gly Glu Arg Ile Ala Asp Asp Ser
645 650 655
Phe Leu Ile Ile Leu Ser Gly Ser Pro Asn Asn Ile Lys Phe Lys Phe
660 665 670
Pro Gln Gly Lys Trp Ser Leu Val Val Ser Ser Tyr Leu Arg Glu Leu
675 680 685
Arg Asp Asp Glu Arg Val Val Asp Gly Gly Lys Glu Leu Glu Ile Glu
690 695 700
Gly Arg Thr Ala Met Val Tyr Arg Arg Ile Glu Tyr
705 710 715
<210> 5
<211> 2151
<212> DNA
<213> Artificial sequence ()
<400> 5
atggtgttca gccataaaga tcgtccgctg cgtccgggtg aaccgtatcc gctgggtgca 60
aattgggaag aggaagatga cggcgttaac tttagcattt ttagcgaaaa tgccaccaaa 120
gtggaactgc tgatttatag cccgaccaat cagaaatatc cgaaagaagt gatcgaagtt 180
aaacagcgta gcggtgatat ttggcatgtt tttgttccgg gtctgggtcc gggtacactg 240
tatgcatatc gtatttatgg tccgtataaa ccggatcagg gtctgcgttt taatccgaat 300
aaagttctga ttgacccgta cgccaaagca attaatggca ccctgaattg gaatgatgca 360
gtgtttggct ataaaatcgg tgatagcaat caggatctga gctttgatga tcgtccggat 420
gatgaattca ttccgaaagg tgctgtgatc aacccgtatt ttgaatggga tgatgatcac 480
ttttttcgtc gcaaaaaaat cccgctgaaa gacaccatta tctataaagt tcatgtgaaa 540
ggcttcacca aactgcgtcc ggatctaccg gaaaatattc gtggcaccta taaaggtttt 600
gcaagccgtc agatgatcga gtatctgaaa gatctgggtg ttaccaccgt tgaaattatg 660
ccggttcagc agtttgttga tgatcgtttt ctggttgaaa aaggcctgcg taattattgg 720
ggttataatc cgttcaacta cttcggtccg gaatgtcgtt atagcagcag cggttgtatg 780
ggtgaacagg tgaatgaatt taaagaaatg gtgaacgaac tgcacaacgc aggttttgaa 840
gttattatcg atgtggtgta taaccatacc gcagaaggta atcatctggg tccgaccctg 900
agctttcgtg gtattgataa tctggcctat tatatgctgg tgccggataa caaacgttat 960
tatctggatt ttaccggcac cggtaatacc ctgaatctga gccatccgcg tgttctgcag 1020
atggttctgg atagcctgcg ttattgggtt ctggaaatgc atgttgatgg ttttcgtttt 1080
gatctggcaa cagcactggc acgtcagctg tatagcgtta atatgctgag cacctttttt 1140
gttgcaattc agcaggatcc ggttctgagc caggttaaac tgattgcaga accgtgggat 1200
gttggtccgg gtggttatca ggttggtaat tttccgtatc tgtggtcaga atggaatggt 1260
aaatatcgtg ataccattcg tcgtttttgg cgtggtgaag caattccgta tgaagaactg 1320
gcaaatcgtc tgatgggtag tccggatctg tatgcaggta ataacaaaac cccgtttgcc 1380
agcattaact atattaccag ccatgatggt ttcaccctgg aagatctggt tagctataac 1440
cagaaacata atgaagccaa cggcttcaat aaccaggatg gcatgaatga aaactacagc 1500
tggaattgtg gtgttgaagg tgaaaccaat gatgccaatg ttattcagtg tcgcgaaaaa 1560
cagaaacgca gctttattat caccctgttt gttagccagg gtgttccgat gattctgggt 1620
ggtgatgaac tgagccgtac ccagcgtggt aataacaatg cattttgtca ggataacgag 1680
attagctggt ttaactggaa tctggatgaa cgtaaacagc gcttccatga ttttgtgcgt 1740
agcatgattt atttctatcg tgcccatccg atttttcgtc gtgaacgtta ttttcagggc 1800
aaaaaactgc atggtatgcc gctgaaagat gtgacctttc tgaaaccgga tggtaatgaa 1860
gcagatgaac agacctggaa aagcccgacc aactttattg catatattct ggaaggtagc 1920
gtgatcgatg aagttaatga tcgtggtgaa cgtattgccg atgatagctt tctgattatt 1980
ctgagtggta gcccgaataa cattaaattc aaattcccgc agggtaaatg gtcactggtt 2040
gttagcagct atctgcgtga actgcgtgat gatgaacgtg ttgttgatgg tggtaaagaa 2100
ctggaaattg aaggtcgtac cgcaatggtt tatcgtcgca ttgaatatta a 2151
<210> 6
<211> 716
<212> PRT
<213> Artificial sequence ()
<400> 6
Met Val Phe Ser His Lys Asp Arg Pro Leu Arg Pro Gly Glu Pro Tyr
1 5 10 15
Pro Leu Gly Ala Asn Trp Glu Glu Glu Asp Asp Gly Val Asn Phe Ser
20 25 30
Ile Phe Ser Glu Asn Ala Thr Lys Val Glu Leu Leu Ile Tyr Ser Pro
35 40 45
Thr Asn Gln Lys Tyr Pro Lys Glu Val Ile Glu Val Lys Gln Arg Ser
50 55 60
Gly Asp Ile Trp His Val Phe Val Pro Gly Leu Gly Pro Gly Thr Leu
65 70 75 80
Tyr Ala Tyr Arg Ile Tyr Gly Pro Tyr Lys Pro Asp Gln Gly Leu Arg
85 90 95
Phe Asn Pro Asn Lys Val Leu Ile Asp Pro Tyr Ala Lys Ala Ile Asn
100 105 110
Gly Thr Leu Asn Trp Asn Asp Ala Val Phe Gly Tyr Lys Ile Gly Asp
115 120 125
Ser Asn Gln Asp Leu Ser Phe Asp Asp Arg Pro Asp Asp Glu Phe Ile
130 135 140
Pro Lys Gly Ala Val Ile Asn Pro Tyr Phe Glu Trp Asp Asp Asp His
145 150 155 160
Phe Phe Arg Arg Lys Lys Ile Pro Leu Lys Asp Thr Ile Ile Tyr Lys
165 170 175
Val His Val Lys Gly Phe Thr Lys Leu Arg Pro Asp Leu Pro Glu Asn
180 185 190
Ile Arg Gly Thr Tyr Lys Gly Phe Ala Ser Arg Gln Met Ile Glu Tyr
195 200 205
Leu Lys Asp Leu Gly Val Thr Thr Val Glu Ile Met Pro Val Gln Gln
210 215 220
Phe Val Asp Asp Arg Phe Leu Val Glu Lys Gly Leu Arg Asn Tyr Trp
225 230 235 240
Gly Tyr Asn Pro Phe Asn Tyr Phe Gly Pro Glu Cys Arg Tyr Ser Ser
245 250 255
Ser Gly Cys Met Gly Glu Gln Val Asn Glu Phe Lys Glu Met Val Asn
260 265 270
Glu Leu His Asn Ala Gly Phe Glu Val Ile Ile Asp Val Val Tyr Asn
275 280 285
His Thr Ala Glu Gly Asn His Leu Gly Pro Thr Leu Ser Phe Arg Gly
290 295 300
Ile Asp Asn Leu Ala Tyr Tyr Met Leu Val Pro Asp Asn Lys Arg Tyr
305 310 315 320
Tyr Leu Asp Phe Thr Gly Thr Gly Asn Thr Leu Asn Leu Ser His Pro
325 330 335
Arg Val Leu Gln Met Val Leu Asp Ser Leu Arg Tyr Trp Val Leu Glu
340 345 350
Met His Val Asp Gly Phe Arg Phe Asp Leu Ala Thr Ala Leu Ala Arg
355 360 365
Gln Leu Tyr Ser Val Asn Met Leu Ser Thr Phe Phe Val Ala Ile Gln
370 375 380
Gln Asp Pro Val Leu Ser Gln Val Lys Leu Ile Ala Glu Pro Trp Asp
385 390 395 400
Val Gly Pro Gly Gly Tyr Gln Val Gly Asn Phe Pro Tyr Leu Trp Ser
405 410 415
Glu Trp Asn Gly Lys Tyr Arg Asp Thr Ile Arg Arg Phe Trp Arg Gly
420 425 430
Glu Ala Ile Pro Tyr Glu Glu Leu Ala Asn Arg Leu Met Gly Ser Pro
435 440 445
Asp Leu Tyr Ala Gly Asn Asn Lys Thr Pro Phe Ala Ser Ile Asn Tyr
450 455 460
Ile Thr Ser His Asp Gly Phe Thr Leu Glu Asp Leu Val Ser Tyr Asn
465 470 475 480
Gln Lys His Asn Glu Ala Asn Gly Phe Asn Asn Gln Asp Gly Met Asn
485 490 495
Glu Asn Tyr Ser Trp Asn Cys Gly Val Glu Gly Glu Thr Asn Asp Ala
500 505 510
Asn Val Ile Gln Cys Arg Glu Lys Gln Lys Arg Ser Phe Ile Ile Thr
515 520 525
Leu Phe Val Ser Gln Gly Val Pro Met Ile Leu Gly Gly Asp Glu Leu
530 535 540
Ser Arg Thr Gln Arg Gly Asn Asn Asn Ala Phe Cys Gln Asp Asn Glu
545 550 555 560
Ile Ser Trp Phe Asn Trp Asn Leu Asp Glu Arg Lys Gln Arg Phe His
565 570 575
Asp Phe Val Arg Ser Met Ile Tyr Phe Tyr Arg Ala His Pro Ile Phe
580 585 590
Arg Arg Glu Arg Tyr Phe Gln Gly Lys Lys Leu His Gly Met Pro Leu
595 600 605
Lys Asp Val Thr Phe Leu Lys Pro Asp Gly Asn Glu Ala Asp Glu Gln
610 615 620
Thr Trp Lys Ser Pro Thr Asn Phe Ile Ala Tyr Ile Leu Glu Gly Ser
625 630 635 640
Val Ile Asp Glu Val Asn Asp Arg Gly Glu Arg Ile Ala Asp Asp Ser
645 650 655
Phe Leu Ile Ile Leu Ser Gly Ser Pro Asn Asn Ile Lys Phe Lys Phe
660 665 670
Pro Gln Gly Lys Trp Ser Leu Val Val Ser Ser Tyr Leu Arg Glu Leu
675 680 685
Arg Asp Asp Glu Arg Val Val Asp Gly Gly Lys Glu Leu Glu Ile Glu
690 695 700
Gly Arg Thr Ala Met Val Tyr Arg Arg Ile Glu Tyr
705 710 715
<210> 7
<211> 2151
<212> DNA
<213> Artificial sequence ()
<400> 7
atggtgttca gccataaaga tcgtccgctg cgtccgggtg aaccgtatcc gctgggtgca 60
aattgggaag aggaagatga cggcgttaac tttagcattt ttagcgaaaa tgccaccaaa 120
gtggaactgc tgatttatag cccgaccaat cagaaatatc cgaaagaagt gatcgaagtt 180
aaacagcgta gcggtgatat ttggcatgtt tttgttccgg gtctgggtcc gggtacactg 240
tatgcatatc gtatttatgg tccgtataaa ccggatcagg gtctgcgttt taatccgaat 300
aaagttctga ttgacccgta cgccaaagca attaatggca ccctgaattg gaatgatgca 360
gtgtttggct ataaaatcgg tgatagcaat caggatctga gctttgatga tcgtccggat 420
gatgaattca ttccgaaagg tgttgtgatc aacccgtatt ttgaatggga tgatgatcac 480
ttttttcgcc gcaaaaaaat cccgctgaaa gacaccatta tctataaagt tcatgtgaaa 540
ggcttcacca aactgcgtcc ggatctaccg gaaaatattc gtggcaccta taaaggtttt 600
gcaagccgtc agatgatcga gtatctgaaa gatctgggtg ttaccaccgt tgaaattatg 660
ccggctcaac agtttgttga tgatcgtttt ctggttgaaa aaggcctgcg taattattgg 720
ggttataatc cgttcaacta cttcagtccg gaatgtcgtt atagcagcag cggttgtatg 780
ggtgaacagg tgaatgaatt taaagaaatg gtgaacgaac tgcacaacgc aggttttgaa 840
gttattatcg atgtggtgta taaccatacc gcagaaggta atcatctggg tccgaccctg 900
agctttcgtg gtattgataa tctggcctat tatatgctgg tgccggataa caaacgttat 960
tatctggatt ttaccggcac cggtaatacc ctgaatctga gccatccgcg tgttctgcag 1020
atggttctgg atagcctgcg ttattgggtt ctggaaatgc atgttgatgg ttttcgtttt 1080
gatctggcaa cagcactggc acgtcagctg tatagcgtta atatgctgag cacctttttt 1140
gttgcaattc agcaggatcc ggttctgagc caggttaaac tgattgcaga accgtgggat 1200
gttggtccgg gtggttatca ggttggtaat tttccgtatc tgtggtcaga atggaatggt 1260
aaatatcgtg ataccattcg tcgtttttgg cgtggtgaag caattccgta tgaagaactg 1320
gcaaatcgtc tgatgggtag tccggatctg tatgcaggta ataacaaaac cccgtttgcc 1380
agcattaact atattaccag ccatgatggt ttcaccctgg aagatctggt tagctataac 1440
cagaaacata atgaagccaa cggcttcaat aaccaggatg gcatgaatga aaactacagc 1500
tggaattgtg gtgttgaagg tgaaaccaat gatgccaatg ttattcagtg tcgcgaaaaa 1560
cagaaacgca actttattat caccctgttt gttagccagg gtgttccgat gattctgggt 1620
ggtgatgaac tgagccgtac ccagcgtggt aataacaatg cattttgtca ggataacgag 1680
attagctggt ttaactggaa tctggatgaa cgtaaacagc gcttccatga ttttgtgcgt 1740
agcatgattt atttctatcg tgcccatccg atttttcgtc gtgaacgtta ttttcagggc 1800
aaaaaactgc atggtatgcc gctgaaagat gtgacctttc tgaaaccgga tggtaatgaa 1860
gcagatgaac agacctggaa aagcccgacc aactttattg catgtattct ggaaggtagc 1920
gtgatcgatg aagttaatga tcgtggtgaa cgtattgccg atgatagctt cctgattatt 1980
ctgagtggta gcccgaataa cattaaattc aaattcccgc agggtaaatg gtcactggtt 2040
gttagcagct atctgcgtga actgcgtgat gatgaacgtg ttgttgatgg tggtaaagaa 2100
ctggaaattg aaggtcgtac cgcaatggtt tatcgtcgca ttgaatatta a 2151
<210> 8
<211> 716
<212> PRT
<213> Artificial sequence ()
<400> 8
Met Val Phe Ser His Lys Asp Arg Pro Leu Arg Pro Gly Glu Pro Tyr
1 5 10 15
Pro Leu Gly Ala Asn Trp Glu Glu Glu Asp Asp Gly Val Asn Phe Ser
20 25 30
Ile Phe Ser Glu Asn Ala Thr Lys Val Glu Leu Leu Ile Tyr Ser Pro
35 40 45
Thr Asn Gln Lys Tyr Pro Lys Glu Val Ile Glu Val Lys Gln Arg Ser
50 55 60
Gly Asp Ile Trp His Val Phe Val Pro Gly Leu Gly Pro Gly Thr Leu
65 70 75 80
Tyr Ala Tyr Arg Ile Tyr Gly Pro Tyr Lys Pro Asp Gln Gly Leu Arg
85 90 95
Phe Asn Pro Asn Lys Val Leu Ile Asp Pro Tyr Ala Lys Ala Ile Asn
100 105 110
Gly Thr Leu Asn Trp Asn Asp Ala Val Phe Gly Tyr Lys Ile Gly Asp
115 120 125
Ser Asn Gln Asp Leu Ser Phe Asp Asp Arg Pro Asp Asp Glu Phe Ile
130 135 140
Pro Lys Gly Val Val Ile Asn Pro Tyr Phe Glu Trp Asp Asp Asp His
145 150 155 160
Phe Phe Arg Arg Lys Lys Ile Pro Leu Lys Asp Thr Ile Ile Tyr Lys
165 170 175
Val His Val Lys Gly Phe Thr Lys Leu Arg Pro Asp Leu Pro Glu Asn
180 185 190
Ile Arg Gly Thr Tyr Lys Gly Phe Ala Ser Arg Gln Met Ile Glu Tyr
195 200 205
Leu Lys Asp Leu Gly Val Thr Thr Val Glu Ile Met Pro Ala Gln Gln
210 215 220
Phe Val Asp Asp Arg Phe Leu Val Glu Lys Gly Leu Arg Asn Tyr Trp
225 230 235 240
Gly Tyr Asn Pro Phe Asn Tyr Phe Ser Pro Glu Cys Arg Tyr Ser Ser
245 250 255
Ser Gly Cys Met Gly Glu Gln Val Asn Glu Phe Lys Glu Met Val Asn
260 265 270
Glu Leu His Asn Ala Gly Phe Glu Val Ile Ile Asp Val Val Tyr Asn
275 280 285
His Thr Ala Glu Gly Asn His Leu Gly Pro Thr Leu Ser Phe Arg Gly
290 295 300
Ile Asp Asn Leu Ala Tyr Tyr Met Leu Val Pro Asp Asn Lys Arg Tyr
305 310 315 320
Tyr Leu Asp Phe Thr Gly Thr Gly Asn Thr Leu Asn Leu Ser His Pro
325 330 335
Arg Val Leu Gln Met Val Leu Asp Ser Leu Arg Tyr Trp Val Leu Glu
340 345 350
Met His Val Asp Gly Phe Arg Phe Asp Leu Ala Thr Ala Leu Ala Arg
355 360 365
Gln Leu Tyr Ser Val Asn Met Leu Ser Thr Phe Phe Val Ala Ile Gln
370 375 380
Gln Asp Pro Val Leu Ser Gln Val Lys Leu Ile Ala Glu Pro Trp Asp
385 390 395 400
Val Gly Pro Gly Gly Tyr Gln Val Gly Asn Phe Pro Tyr Leu Trp Ser
405 410 415
Glu Trp Asn Gly Lys Tyr Arg Asp Thr Ile Arg Arg Phe Trp Arg Gly
420 425 430
Glu Ala Ile Pro Tyr Glu Glu Leu Ala Asn Arg Leu Met Gly Ser Pro
435 440 445
Asp Leu Tyr Ala Gly Asn Asn Lys Thr Pro Phe Ala Ser Ile Asn Tyr
450 455 460
Ile Thr Ser His Asp Gly Phe Thr Leu Glu Asp Leu Val Ser Tyr Asn
465 470 475 480
Gln Lys His Asn Glu Ala Asn Gly Phe Asn Asn Gln Asp Gly Met Asn
485 490 495
Glu Asn Tyr Ser Trp Asn Cys Gly Val Glu Gly Glu Thr Asn Asp Ala
500 505 510
Asn Val Ile Gln Cys Arg Glu Lys Gln Lys Arg Asn Phe Ile Ile Thr
515 520 525
Leu Phe Val Ser Gln Gly Val Pro Met Ile Leu Gly Gly Asp Glu Leu
530 535 540
Ser Arg Thr Gln Arg Gly Asn Asn Asn Ala Phe Cys Gln Asp Asn Glu
545 550 555 560
Ile Ser Trp Phe Asn Trp Asn Leu Asp Glu Arg Lys Gln Arg Phe His
565 570 575
Asp Phe Val Arg Ser Met Ile Tyr Phe Tyr Arg Ala His Pro Ile Phe
580 585 590
Arg Arg Glu Arg Tyr Phe Gln Gly Lys Lys Leu His Gly Met Pro Leu
595 600 605
Lys Asp Val Thr Phe Leu Lys Pro Asp Gly Asn Glu Ala Asp Glu Gln
610 615 620
Thr Trp Lys Ser Pro Thr Asn Phe Ile Ala Cys Ile Leu Glu Gly Ser
625 630 635 640
Val Ile Asp Glu Val Asn Asp Arg Gly Glu Arg Ile Ala Asp Asp Ser
645 650 655
Phe Leu Ile Ile Leu Ser Gly Ser Pro Asn Asn Ile Lys Phe Lys Phe
660 665 670
Pro Gln Gly Lys Trp Ser Leu Val Val Ser Ser Tyr Leu Arg Glu Leu
675 680 685
Arg Asp Asp Glu Arg Val Val Asp Gly Gly Lys Glu Leu Glu Ile Glu
690 695 700
Gly Arg Thr Ala Met Val Tyr Arg Arg Ile Glu Tyr
705 710 715
<210> 9
<211> 2151
<212> DNA
<213> Artificial sequence ()
<400> 9
atggtgttca gccataacga tcgtccgctg cgtccgggtg aaccgtatcc gctgggtgca 60
aattgggaag aggaagatga cggcgttaac tttagcattt ttagcgaaaa tgccaccaaa 120
gtggaactgc tgatttatag cccgaccaat cagaaatatc cgaaagaagt gatcgaagtt 180
aaacagcgta gcggtgatat ttggcatgtt tttgttccgg gtctgggtcc gggtacactg 240
tatgcatatc gtatttatgg tccgtataaa ccggatcagg gtctgcgttt taatccgaat 300
aaagttctga ttgacccgta cgccaaagca attaatggca ccctgaattg gaatgatgca 360
gtgtttggct ataaaatcgg tgatagcaat caggatctga gctttgatga tcgtccggat 420
gatgaattca ttccgaaagg tgttgtgatc aacccgtatt ttgaatggga tgatgatcac 480
ttttttcgcc gcaaaaaaat cccgctgaaa gacaccatta tctataaagt tcatgtgaaa 540
ggcttcacca aactgcgtcc ggatctaccg gaaaatattc gtggcaccta taaaggtttt 600
gcaagccgtc agatgatcga gtatctgaaa gatctgggtg ttaccaccgt tgaaattatg 660
ccggctcaac agtttgttga tgatcgtttt ctggttgaaa aaggcctgcg taattattgg 720
ggttataatc cgttcaacta cttcagtccg gaatgtcgtt atagcagcag cggttgtatg 780
ggtgaacagg tgaatgaatt taaagaaatg gtgaacgaac tgcacaacgc aggttttgaa 840
gttattatcg atgtggtgta taaccatacc gcagaaggta atcatctggg tccgaccctg 900
agctttcgtg gtattgataa tctggcctat tatatgctgg tgccggataa caaacgttat 960
tatctggatt ttaccggcac cggtaatacc ctgaatctga gccatccgcg tgttctgcag 1020
atggttctgg atagcctgcg ttattgggtt ctggaaatgc atgttgatgg ttttcgtttt 1080
gatctggcaa cagcactggc acgtcagctg tatagcgtta atatgctgag cacctttttt 1140
gttgcaattc agcaggatcc ggttctgagc caggttaaac tgattgcaga accgtgggat 1200
gttggtccgg gtggttatca ggttggtaat tttccgtatc tgtggtcaga atggaatggt 1260
aaatatcgtg ataccattcg tcgtttttgg cgtggtgaag caattccgta tgaagaactg 1320
gcaaatcgtc tgatgggtag tccggatctg tatgcaggta ataacaaaac cccgtttgcc 1380
agcattaact atattaccag ccatgatggt ttcaccctgg aagatctggt tagctataac 1440
cagaaacata atgaagccaa cggcttcaat aaccaggatg gcatgaatga aaactacagc 1500
tggaattgtg gtgttgaagg tgaaaccaat gatgccaatg ttattcagtg tcgcgaaaaa 1560
cagaaacgca actttattat caccctgttt gttagccagg gtgttccgat gattctgggt 1620
ggtgatgaac tgagccgtac ccagcgtggt aataacaatg cattttgtca ggataacgag 1680
attagctggt ttaactggaa tctggatgaa cgtaaacagc gcttccatga ttttgtgcgt 1740
agcatgattt atttctatcg tgcccatccg atttttcgtc gtgaacgtta ttttcagggc 1800
aaaaaactgc atggtatgcc gctgaaagat gtgacctttc tgaaaccgga tggtaatgaa 1860
gcagatgaac agacctggaa aagcccgacc aactttattg catgtattct ggaaggtagc 1920
gtgatcgatg aagttaatga tcgtggtgaa cgtattgccg atgatagctt cctgattatt 1980
ctgagtggta gcccgaataa cattaaattc aaattcccgc agggtaaatg gtcactggtt 2040
gttagcagct atctgcgtga actgcgtgat gatgaacgtg ttgttgatgg tggtaaagaa 2100
ctggaaattg aaggtcgtac cgcaatggtt tatcgtcgca ttgaatatta a 2151
<210> 10
<211> 716
<212> PRT
<213> Artificial sequence ()
<400> 10
Met Val Phe Ser His Asn Asp Arg Pro Leu Arg Pro Gly Glu Pro Tyr
1 5 10 15
Pro Leu Gly Ala Asn Trp Glu Glu Glu Asp Asp Gly Val Asn Phe Ser
20 25 30
Ile Phe Ser Glu Asn Ala Thr Lys Val Glu Leu Leu Ile Tyr Ser Pro
35 40 45
Thr Asn Gln Lys Tyr Pro Lys Glu Val Ile Glu Val Lys Gln Arg Ser
50 55 60
Gly Asp Ile Trp His Val Phe Val Pro Gly Leu Gly Pro Gly Thr Leu
65 70 75 80
Tyr Ala Tyr Arg Ile Tyr Gly Pro Tyr Lys Pro Asp Gln Gly Leu Arg
85 90 95
Phe Asn Pro Asn Lys Val Leu Ile Asp Pro Tyr Ala Lys Ala Ile Asn
100 105 110
Gly Thr Leu Asn Trp Asn Asp Ala Val Phe Gly Tyr Lys Ile Gly Asp
115 120 125
Ser Asn Gln Asp Leu Ser Phe Asp Asp Arg Pro Asp Asp Glu Phe Ile
130 135 140
Pro Lys Gly Val Val Ile Asn Pro Tyr Phe Glu Trp Asp Asp Asp His
145 150 155 160
Phe Phe Arg Arg Lys Lys Ile Pro Leu Lys Asp Thr Ile Ile Tyr Lys
165 170 175
Val His Val Lys Gly Phe Thr Lys Leu Arg Pro Asp Leu Pro Glu Asn
180 185 190
Ile Arg Gly Thr Tyr Lys Gly Phe Ala Ser Arg Gln Met Ile Glu Tyr
195 200 205
Leu Lys Asp Leu Gly Val Thr Thr Val Glu Ile Met Pro Ala Gln Gln
210 215 220
Phe Val Asp Asp Arg Phe Leu Val Glu Lys Gly Leu Arg Asn Tyr Trp
225 230 235 240
Gly Tyr Asn Pro Phe Asn Tyr Phe Ser Pro Glu Cys Arg Tyr Ser Ser
245 250 255
Ser Gly Cys Met Gly Glu Gln Val Asn Glu Phe Lys Glu Met Val Asn
260 265 270
Glu Leu His Asn Ala Gly Phe Glu Val Ile Ile Asp Val Val Tyr Asn
275 280 285
His Thr Ala Glu Gly Asn His Leu Gly Pro Thr Leu Ser Phe Arg Gly
290 295 300
Ile Asp Asn Leu Ala Tyr Tyr Met Leu Val Pro Asp Asn Lys Arg Tyr
305 310 315 320
Tyr Leu Asp Phe Thr Gly Thr Gly Asn Thr Leu Asn Leu Ser His Pro
325 330 335
Arg Val Leu Gln Met Val Leu Asp Ser Leu Arg Tyr Trp Val Leu Glu
340 345 350
Met His Val Asp Gly Phe Arg Phe Asp Leu Ala Thr Ala Leu Ala Arg
355 360 365
Gln Leu Tyr Ser Val Asn Met Leu Ser Thr Phe Phe Val Ala Ile Gln
370 375 380
Gln Asp Pro Val Leu Ser Gln Val Lys Leu Ile Ala Glu Pro Trp Asp
385 390 395 400
Val Gly Pro Gly Gly Tyr Gln Val Gly Asn Phe Pro Tyr Leu Trp Ser
405 410 415
Glu Trp Asn Gly Lys Tyr Arg Asp Thr Ile Arg Arg Phe Trp Arg Gly
420 425 430
Glu Ala Ile Pro Tyr Glu Glu Leu Ala Asn Arg Leu Met Gly Ser Pro
435 440 445
Asp Leu Tyr Ala Gly Asn Asn Lys Thr Pro Phe Ala Ser Ile Asn Tyr
450 455 460
Ile Thr Ser His Asp Gly Phe Thr Leu Glu Asp Leu Val Ser Tyr Asn
465 470 475 480
Gln Lys His Asn Glu Ala Asn Gly Phe Asn Asn Gln Asp Gly Met Asn
485 490 495
Glu Asn Tyr Ser Trp Asn Cys Gly Val Glu Gly Glu Thr Asn Asp Ala
500 505 510
Asn Val Ile Gln Cys Arg Glu Lys Gln Lys Arg Asn Phe Ile Ile Thr
515 520 525
Leu Phe Val Ser Gln Gly Val Pro Met Ile Leu Gly Gly Asp Glu Leu
530 535 540
Ser Arg Thr Gln Arg Gly Asn Asn Asn Ala Phe Cys Gln Asp Asn Glu
545 550 555 560
Ile Ser Trp Phe Asn Trp Asn Leu Asp Glu Arg Lys Gln Arg Phe His
565 570 575
Asp Phe Val Arg Ser Met Ile Tyr Phe Tyr Arg Ala His Pro Ile Phe
580 585 590
Arg Arg Glu Arg Tyr Phe Gln Gly Lys Lys Leu His Gly Met Pro Leu
595 600 605
Lys Asp Val Thr Phe Leu Lys Pro Asp Gly Asn Glu Ala Asp Glu Gln
610 615 620
Thr Trp Lys Ser Pro Thr Asn Phe Ile Ala Cys Ile Leu Glu Gly Ser
625 630 635 640
Val Ile Asp Glu Val Asn Asp Arg Gly Glu Arg Ile Ala Asp Asp Ser
645 650 655
Phe Leu Ile Ile Leu Ser Gly Ser Pro Asn Asn Ile Lys Phe Lys Phe
660 665 670
Pro Gln Gly Lys Trp Ser Leu Val Val Ser Ser Tyr Leu Arg Glu Leu
675 680 685
Arg Asp Asp Glu Arg Val Val Asp Gly Gly Lys Glu Leu Glu Ile Glu
690 695 700
Gly Arg Thr Ala Met Val Tyr Arg Arg Ile Glu Tyr
705 710 715

Claims (4)

1. A genetic engineering bacterium for efficiently secreting isoamylase is characterized in that: the genetically engineered bacterium takes bacillus subtilis as a host, knocks out an encoding gene of alpha amylase and secretively expresses isoamylase, wherein glycoside hydrolase family 5endoglucanase (B. subtilis native glycoside hydrolase family 5endoglucanase,BsCel5) derived from the bacillus subtilis is fused at the N end of the isoamylase and used as an enhancer to promote the secretion of the isoamylase.
2. The genetically engineered bacterium of claim 1, wherein: the isoamylase is natural isoamylase derived from sulfolobus or mutant thereof, and comprises amino acid sequences selected from SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 and SEQ ID NO. 10.
3. A plasmid for expressing isoamylase in the genetically engineered bacterium of claim 1 or 2, characterized in that: the plasmid comprises a promoter, a ribosome binding site, a signal peptide coding sequence, a BsCel5 coding gene, an isoamylase coding gene and a termination sequence, wherein the signal peptide coding sequence, bsCel5 coding gene and isoamylase coding gene are fused in the stated order in an open reading frame and are operably linked to a promoter sequence.
4. A method for constructing the genetically engineered bacterium of any one of claims 1-3, characterized in that: comprising the following steps:
(1) Knocking out an alpha amylase coding gene amyE in a bacillus subtilis host;
(2) Constructing the recombinant plasmid of claim 3 and transferring it into the strain obtained in step (1);
(3) The correct transformants were selected based on the marker gene on the vector.
CN201911282988.4A 2019-12-13 2019-12-13 Genetically engineered bacterium capable of efficiently secreting isoamylase Active CN112980755B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911282988.4A CN112980755B (en) 2019-12-13 2019-12-13 Genetically engineered bacterium capable of efficiently secreting isoamylase

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911282988.4A CN112980755B (en) 2019-12-13 2019-12-13 Genetically engineered bacterium capable of efficiently secreting isoamylase

Publications (2)

Publication Number Publication Date
CN112980755A CN112980755A (en) 2021-06-18
CN112980755B true CN112980755B (en) 2023-05-12

Family

ID=76332443

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911282988.4A Active CN112980755B (en) 2019-12-13 2019-12-13 Genetically engineered bacterium capable of efficiently secreting isoamylase

Country Status (1)

Country Link
CN (1) CN112980755B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0302838A2 (en) * 1987-08-07 1989-02-08 ENICHEM SYNTHESIS S.p.A. Cloning of the gene coding the isoamylase enzyme and its use in the production of said enzyme
CN102286443A (en) * 2011-07-16 2011-12-21 中国热带农业科学院热带生物技术研究所 Method for producing mixture of recombinant isoamylase, alpha-amylase and glucamylase
WO2018156705A1 (en) * 2017-02-24 2018-08-30 Danisco Us Inc. Compositions and methods for increased protein production in bacillus licheniformis
CN108676808A (en) * 2018-05-25 2018-10-19 厦门大学 A kind of recombinant plasmid pET28a-Ag43, surface showing plasmid, recombination engineering and its application
CN109022396A (en) * 2018-08-30 2018-12-18 江南大学 The alpha-amylase mutant and its application that a kind of enzyme activity improves

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0302838A2 (en) * 1987-08-07 1989-02-08 ENICHEM SYNTHESIS S.p.A. Cloning of the gene coding the isoamylase enzyme and its use in the production of said enzyme
CN102286443A (en) * 2011-07-16 2011-12-21 中国热带农业科学院热带生物技术研究所 Method for producing mixture of recombinant isoamylase, alpha-amylase and glucamylase
WO2018156705A1 (en) * 2017-02-24 2018-08-30 Danisco Us Inc. Compositions and methods for increased protein production in bacillus licheniformis
CN108676808A (en) * 2018-05-25 2018-10-19 厦门大学 A kind of recombinant plasmid pET28a-Ag43, surface showing plasmid, recombination engineering and its application
CN109022396A (en) * 2018-08-30 2018-12-18 江南大学 The alpha-amylase mutant and its application that a kind of enzyme activity improves

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
异淀粉酶产生菌的分离鉴定及异淀粉酶基因的克隆表达;赵淑琴;;食品工业科技(17);第122-127页 *

Also Published As

Publication number Publication date
CN112980755A (en) 2021-06-18

Similar Documents

Publication Publication Date Title
CN112553134B (en) Method for expressing alpha-amylase in bacillus subtilis
CN109679887B (en) Method for producing trehalose by coupling fermentation of double-enzyme fusion enzyme with efficient secretory expression
CN107904223B (en) Alginate lyase, host cell secreting alginate lyase and application of host cell
KR101120359B1 (en) A recombinant vector introduced with gene which effectively degrade cellulose, a transformant comprising the vector and a method for producing ethanol using the same
CN110607319B (en) Expression vector suitable for bacillus subtilis secretion expression protein and application
WO2022148008A1 (en) Bacillus subtilis genetically engineered bacterium for producing tagatose and method for preparing tagatose
CN113817763B (en) Directed evolution method, mutant and application of beta-galactosidase family genes
WO2021179652A1 (en) Special enzyme for producing galactooligosaccharides, preparation therefor and use thereof
CN113122490B (en) Double-gene defective engineering bacterium and application thereof in improving yield of N-acetylglucosamine
CN112063666A (en) Application of recombinant sucrose isomerase in preparation of isomaltulose by converting sucrose
CN110144341B (en) Alginate lyase mutant
CN112301012B (en) Cyclodextrin glucosyltransferase mutant and construction method thereof
KR101367348B1 (en) Recombinant vector comprising chimeric beta-agarase-B, transformant comprising the same and use of the same
CN111621488B (en) Heat-adaptability-improved inulase exonuclease mutant MutQ23 delta 11
CN117866931A (en) Extracellular secretion expressed hyaluronic acid lyase, recombinant bacterium thereof and application thereof
CN111041013B (en) Algin lyase or pectinase and application thereof in cooperative degradation of brown algae
CN112575022A (en) Construction method of in-vitro artificial scaffold protein-mediated trehalose multienzyme complex
CN112980755B (en) Genetically engineered bacterium capable of efficiently secreting isoamylase
CN101457230B (en) High efficiency preparation method of high temperature alpha-amylase and mutant thereof
CN116254249A (en) Construction of recombinant bacterium for expressing chitinase and preparation of high-enzyme activity mutant
CN112980753B (en) Glycoside hydrolase fusion expression system for secretion of exogenous proteins
CN111850063B (en) Application of desaturase Des in increasing yield of bacillus poly gamma-glutamic acid
CN111187795B (en) Preparation method of diglucyl trehalose
KR101530078B1 (en) Recombinant Vector and Recombinant Microorganism Comprising Chimeric kappa-Carrageenase Gene and Chimeric lamda-Carrageenase Gene
WO2024114637A1 (en) Engineering bacteria for producing acarbose, and construction method therefor and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CB03 Change of inventor or designer information

Inventor after: Zhang Yiheng

Inventor after: You Chun

Inventor after: Shi Ting

Inventor after: Liu Shan

Inventor before: You Chun

Inventor before: Shi Ting

Inventor before: Liu Shan

CB03 Change of inventor or designer information