RU2795400C2 - Conjugates and their obtaining and application - Google Patents

Abstract

FIELD: medicinal chemistry.

SUBSTANCE: compound having the structure represented by formula (321). In the formula (321): n1 is an integer from 1 to 3, and n3 is an integer from 0 to 4; each of m1, m2 and m3 is independently an integer from 2 to 10; each of R₁₀, R₁₁, R₁₂, R₁₃, R₁₄ and R₁₅ is independently selected from H, methyl and ethyl; R₄ is a group capable of being associated with an active drug or active agent by a covalent link, where the active drug or active agent is an oligonucleotide and the bond is a phosphodiester bond; each L₁ is a connected combination of at least two of the groups A1, A4, A8, A10 and A11: where each j1 is independently an integer from 1 to 20; each j2 is independently an integer from 1 to 20; and

represents the connection site of the group to the rest of the molecule; each S₁ is independently M₁ in which any active hydroxyl, if any, is protected by a hydroxyl protecting group; each M₁ is a ligand capable of binding to asialoglycoprotein receptors on the surface of liver cells (ASGPR). A conjugate, the use of a conjugate, and a method for inhibiting the expression of a particular gene in hepatocytes.

EFFECT: obtaining a conjugate that can specifically target hepatocytes, due to which it effectively solves the problems associated with the delivery of drugs based on oligonucleotides in vivo, and has low toxicity and excellent delivery efficiency, while maintaining high stability of the delivered oligonucleotide.

35 cl, 67 dwg, 24 tbl, 37 ex

Formula (321)

Description

BACKGROUND OF THE INVENTION

[1] The delivery system is one of the key technologies in the development of drugs based on small RNAs. One type of small RNA delivery system is a technology for directed (targeted, targeted) delivery of the conjugate to liver cells.

BRIEF DESCRIPTION OF THE INVENTION

[2] According to one aspect of the present invention, this document provides a compound having the structure represented by formula (321):

Formula (321)

Where

n1 is an integer from 1 to 3, and n3 is an integer from 0 to 4;

each of m1, m2, and m3 is independently an integer from 2 to 10;

each of R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ is independently selected from H, C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl and C ₁ -C ₁₀ alkoxy;

R ₄ is a group capable of being bound to an active drug or active agent by a covalent bond;

each L ₁ is a linear alkylene from 1 to 70 carbon atoms in which one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH =N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, and L ₁ is optional substituted by any one or more elements of the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen, OH , -SH, NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl)(C ₁ -C ₁₀ alkylphenyl), NH(C ₁ -C ₁₀ alkylphenyl), cyano, nitro, CO ₂ H, C(O)OC ₁ -C ₁₀ alkyl, CON(C ₁ -C ₁₀ alkyl)( C ₁ -C ₁₀ alkyl), CONH (C ₁ -C ₁₀ alkyl), CONH ₂ , NHC (O) (C ₁ -C ₁₀ alkyl), NHC (O) (phenyl), N (C ₁ -C ₁₀ alkyl )C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), C (O) C ₁ -C ₁₀ alkyl, C (O) C ₁ -C ₁₀ alkylphenyl, C(O)C ₁ -C ₁₀ haloalkyl, OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH(C ₁ -C ₁₀ alkyl), SO ₂ NH(phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl);

each S ₁ is independently M ₁ in which any active hydroxyl, if any, is protected by a hydroxyl protecting group;

each M ₁ is independently selected from a ligand capable of binding to a receptor on the cell surface.

[3] In some embodiments, each L ₁ is independently selected from the group consisting of groups A1 - A26 and any combinations thereof:

where each j1 is independently an integer from 1 to 20;

each j2 is independently an integer from 1 to 20;

each R' is independently C ₁ -C ₁₀ alkyl;

each Ra is independently selected from the group consisting of A27 - A45 and any combinations thereof:

each Rb is independently C ₁ -C ₁₀ alkyl; And

представляет собой место присоединения группы к остальной части молекулы.

represents the point of attachment of the group to the rest of the molecule.

[4] In one aspect of the present invention, there is provided a conjugate having the structure represented by formula (1):

Formula 1),

Where

n1 is an integer from 1 to 3, and n3 is an integer from 0 to 4;

each of m1, m2, and m3 is independently an integer from 2 to 10;

each of R10, R11, R12, R13, R14 and R15 is independently selected from H, C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl and C ₁ -C ₁₀ alkoxy;

R ₃ is the active drug;

R ₂ is a linear alkylene from 1 to 20 carbon atoms in which one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH= N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, and where R ₂ is optionally substituted with any one or more elements of the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ -C ₁₀ alkylphenyl , -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen, OH, - SH, NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkylphenyl), NH (C ₁ -C ₁₀ alkylphenyl), cyano, nitro, CO ₂ H, C (O) OC ₁ -C ₁₀ alkyl, CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), CONH(C ₁ -C ₁₀ alkyl), CONH ₂ , NHC(O)(C ₁ -C ₁₀ alkyl), NHC(O)(phenyl), N(C ₁ -C ₁₀ alkyl)C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), C (O) C ₁ -C ₁₀ alkyl, C (O) C ₁ -C ₁₀ alkylphenyl , C (O) C ₁ -C ₁₀ haloalkyl, OC (O) C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH (C ₁ -C ₁₀ alkyl), SO ₂ NH (phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl);

each L ₁ is independently a linear alkylene from 1 to 70 carbon atoms in which one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, while L ₁ optionally substituted by any one or more members of the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ - C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen, OH, -SH, NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkylphenyl), NH (C ₁ -C ₁₀ alkylphenyl), cyano, nitro, CO ₂ H, C (O) OC ₁ -C ₁₀ alkyl, CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), CONH (C ₁ -C ₁₀ alkyl), CONH ₂ , NHC (O) (C ₁ -C ₁₀ alkyl), NHC (O) (phenyl), N (C ₁ -C ₁₀ alkyl) C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), C (O) C ₁ -C ₁₀ alkyl, C (O) C ₁ - C ₁₀ alkylphenyl, C (O) C ₁ -C ₁₀ haloalkyl, OC (O) C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH (C ₁ -C ₁₀ alkyl), SO ₂ NH (phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl);

each M ₁ is selected from one of the ligands capable of binding to a receptor on the cell surface.

[5] In some embodiments, each L ₁ is independently selected from the group consisting of groups A1 - A26 and any combinations thereof:

where each j1 is independently an integer from 1 to 20;

each j2 is independently an integer from 1 to 20;

each R' is independently C ₁ -C ₁₀ alkyl;

each Ra is independently selected from the group consisting of A27 - A45 and any combinations thereof:

each Rb is independently C ₁ -C ₁₀ alkyl; And

представляет собой место присоединения группы к остальной части молекулы.

represents the point of attachment of the group to the rest of the molecule.

[6] In one aspect of the present invention, the use of a conjugate described in this application for the preparation of a medicament for the treatment and/or prevention of a pathological condition or disease caused by the expression of a certain gene in hepatocytes is proposed.

[7] In one aspect, the present invention provides a method of treating a subject in need of a pathological condition or disease caused by the expression of a certain gene in hepatocytes, comprising administering to said subject an effective amount of a conjugate described in this application.

[8] In one aspect of the present invention, a method for inhibiting the expression of a particular gene in hepatocytes is provided, comprising contacting with a conjugate described in this application.

[9] In one aspect of the present invention, a kit is provided that contains the conjugate described in this application.

[10] Additional features and advantages of the present invention will be illustrated in detail later in this application.

INCLUSION BY LINK

[11] All publications, patents and patent applications mentioned in the present specification are hereby incorporated by reference to the same extent as if each individual publication, patent or patent application were specifically and separately indicated as being incorporated by reference.

BRIEF DESCRIPTION OF THE DRAWINGS

[12] The novel features of the present invention are described in detail in the appended claims. A better understanding of the features and advantages of the present invention will be achieved by considering the following detailed description, which describes illustrative embodiments in which the principles of the present invention are applied, and the accompanying drawings, of which:

[13] FIG. 1A and 1B show a semi-quantitative result of an in vitro tritosome stability assay of siRNA conjugates.

[14] FIG. 2A and 2B show a semi-quantitative result of an in vitro stability analysis of the tested siRNA conjugates in human plasma.

[15] FIG. 3A and 3B show a semi-quantitative result of in vitro monkey plasma stability analysis of the studied siRNA conjugates.

[16] FIG. 4-11 are metabolic profiles over time showing plasma or tissue PK/TK concentrations for: conjugate 24 in rat plasma at 10 mg/kg (FIG. 4); conjugate 24 in the liver and kidney of rats at a dosage of 10 mg/kg (Fig. 5); conjugate 24 in rat plasma at a dosage of 50 mg/kg (Fig. 6); conjugate 24 in the liver and kidney of rats at a dosage of 50 mg/kg (Fig. 7); conjugate 25 in rat plasma at a dosage of 10 mg/kg (Fig. 8); conjugate 25 in the liver and kidney of rats at a dosage of 10 mg/kg (Fig. 9); conjugate 25 in rat plasma at a dosage of 50 mg/kg (Fig. 10); conjugate 25 in the liver and kidney of rats at a dosage of 50 mg/kg (Fig. 11).

[17] FIG. 12A, 12B, 12C and 12D show the determination of the IC ₅₀ value for conjugate 24 in terms of inhibition of GSCM expression compared to GSSM, PSCM and PSSM, respectively.

[18] FIG. 13-15 show the in vivo inhibition of HBV mRNA by the conjugates described in this application.

[19] FIG. 16 shows the time-dependent inhibition of HBsAg expression in the serum of HBV transgenic mice by the conjugates described in this application.

[20] FIG. 17 shows the time-dependent inhibition of HBV DNA expression in the sera of HBV transgenic mice by the conjugates described in this application.

[21] FIG. 18 shows time-dependent inhibition of HBsAg expression in serum of HBV transgenic mice by conjugate 25 described in this application.

[22] FIG. 19 shows time-dependent inhibition of HBsAg expression in M-Tg models by the conjugates described in this application.

[23] FIG. 20 shows time-dependent inhibition of HBsAg expression in M-Tg models by the conjugates described in this application.

[24] FIG. 21 shows time-dependent inhibition of HBsAg expression in 1.28-copy M-Tg models by the conjugates described in this application.

[25] FIG. 22-24 show inhibition of target mRNA (target) compared to non-target mRNA conjugates described in this application.

[26] FIG. 25-27 show the in vivo inhibition of HBV mRNA by the conjugates described in this application.

[27] FIG. 28 shows the time-dependent inhibition of HBsAg expression in the serum of HBV transgenic mice by the conjugates described in this application.

[28] FIG. 29 shows the time-dependent inhibition of HBsAg expression in the serum of HBV transgenic mice by the conjugates described in this application.

[29] FIG. 30 shows in vivo inhibition of HBV mRNA at D85 by the conjugates described in this application.

[30] FIG. 31 shows time-dependent inhibition of HBsAg expression in serum of HBV transgenic mice by conjugate 43.

[31] FIG. 32 shows time dependent inhibition of HBV DNA expression in sera of HBV transgenic mice by conjugate 43.

[32] FIG. 33 and 34 show the stability of conjugate 167 in lysosome lysate from human and rat.

[33] FIG. 35 shows time-dependent inhibition of HBsAg expression in 1.28-copy M-Tg models by conjugate 168.

[34] FIG. 36 shows time-dependent inhibition of HBeAg expression in 1.28-copy M-Tg models by conjugate 168.

[35] FIG. 37 shows time-dependent inhibition of HBV DNA expression in 1.28-copy M-Tg models by conjugate 168.

[36] FIG. 38A and 38B show the ratio of inhibition of ANGPTL mRNA expression at D14 and D28.

[37] FIG. 39A and 39B show the ratio of inhibition of blood lipids, represented by total cholesterol (TC) and triglycerides (TG) in serum, by the conjugates described in this application.

[38] FIG. 40A and 40B show the time dependent ratio of blood lipid inhibition represented by total cholesterol (TC) and serum triglycerides (TG) by conjugate 115.

[39] FIG. 41A and 41B show the time dependent ratio of blood lipid inhibition, represented by total cholesterol (TC) and serum triglycerides (TG), conjugates 115 and 111.

[40] FIG. 42A, 42B, 42C and 42D show the time-dependent ratio of blood lipid inhibition, represented by total cholesterol (TC) and serum triglycerides (TG), by conjugate 111 at various dosages.

[41] FIG. 43A and 43B show the time-dependent ratio of blood lipid inhibition, represented by total cholesterol (TC) and serum triglycerides (TG), conjugates 25 and 169; and in FIG. 43C shows the ratio of inhibition of ANGPTL mRNA expression.

[42] FIG. 44A shows the ratio of hepatic APOC3 expression inhibition at D14, and FIG. 44B and 44C show the ratio of blood lipid inhibition, represented by total cholesterol (TC) and triglycerides (TG) in serum, by conjugate 144 at various dosages.

[43] FIG. 45A and 45B show the ratio of inhibition of blood lipids, represented by total cholesterol (TC) and triglycerides (TG) in serum, by conjugate 170 at various dosages.

[44] FIG. 46A, 46B, 46C and 46D show the ratio of blood lipid inhibition, represented by total cholesterol (TC) and triglycerides (TG) in serum, of the conjugates described in this application.

DETAILED DESCRIPTION OF THE INVENTION

[45] Specific embodiments of the present invention are described in detail below. It should be understood that the detailed implementation options described in this application are used only to illustrate and explain the present invention and are not intended to limit the present description in any respect.

Definitions

[46] In the context of the present description, unless otherwise indicated, the capital letters C, G, U and A denote the bases that make up the nucleotides; a lowercase m indicates that the nucleotide adjacent to the left of the m is a 2'-methoxy-modified nucleotide; a lowercase f indicates that the nucleotide adjacent to the left of f is a 2'-fluorine-modified nucleotide; a lowercase s indicates a phosphorothioate bond between two nucleotides adjacent to the s on both sides; P1 indicates that the nucleotide adjacent to the right of P1 is a nucleotide with 5'-phosphate or a nucleotide modified with a 5'-phosphate analog, especially a nucleotide modified with vinyl phosphate (denoted VP in the examples below), a nucleotide with 5'-phosphate (denoted P in the examples below) or a 5'-thiophosphate modified nucleotide (denoted Ps in the examples below).

[47] As used herein, the terms "complementary" and "reversely complementary" are used interchangeably throughout this application and have a meaning well known in the art, namely, each of the bases in one strand is complementary paired with a base in the other strand in double-stranded nucleic acid molecule. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA molecules); and the purine base guanine (G) always pairs with the pyrimidine base cytosine (C). Each base pair contains a purine and a pyrimidine. If adenines in a chain always pair with thymines (or uracils) in another chain and guanines pair with cytosines, then these chains are considered complementary; and the base sequence of the chain can be determined from the sequence of the complementary chain. Accordingly, "mismatch" refers to bases at appropriate sites (positions) that are not present in a complementary pair in a double-stranded nucleic acid.

[48] As used herein, unless otherwise indicated, "mostly reverse complementary" refers to no more than 3 mismatches in two nucleotide sequences. "Substantially reverse complementary" refers to no more than 1 mismatch in two nucleotide sequences. "Completely reverse complementary" refers to the absence of mismatches in two nucleotide sequences.

[49] As used herein, a "nucleotide difference" between a nucleotide sequence and another nucleotide sequence refers to a change in the bases of said nucleotides at the same position. For example, in the case where the base of a nucleotide in the second sequence is A while the base at the same site in the first sequence is U, C, G, or T, there is considered to be a difference in nucleotides at that site between the 2 sequences. In some embodiments, if a nucleotide at a position is changed to a base removed nucleotide or a nucleotide analog, then there is also considered to be a difference in the nucleotides at that site.

[50] In the context of the present description, in particular, in the description of the method for obtaining a conjugating molecule or siRNA conjugate described in the present description, unless otherwise indicated, "nucleoside monomer" or "nucleoside monomers" refers, depending on the RNA sequence that is needed to "unmodified or modified RNA phosphoramidite", or "unmodified or modified RNA phosphoramidite", respectively, used in the so-called "phosphoramidite solid phase synthesis", which is well known in the art as a method for the synthesis of RNA. RNA phosphoramidites are also referred to as nucleoside phosphoramidites elsewhere in this application. All nucleoside monomers used herein are commercially available.

[51] In this application, a dash ("-"), which is not between two letters or symbols, is used to indicate the point of attachment of the substituent. For example, C ₁ -C ₁₀ alkylNH ₂ is attached via C ₁ -C ₁₀ alkyl.

[52] As used herein, "optional" or "optional" means that the event or circumstance described below may or may not occur, and that the present description includes cases where said event or circumstance occurs and cases where it does not occur. For example, the term "optionally substituted alkyl" includes both "alkyl" and "substituent alkyl" as defined below. Those skilled in the art will appreciate, with respect to any group containing one or more substituents, that such groups are not intended to contain any substitution (substitution) or patterns of substitutions (substitutions) that are sterically unrealizable, that cannot be synthesized and/ or which are inherently unstable.

[53] In this application, "alkyl" refers to a straight chain and a branched chain containing the specified number of carbon atoms, usually from 1 to 20 carbon atoms, for example, from 1 to 10 carbon atoms, for example, from 1 to 8 or from 1 to 6 carbons. For example, C ₁ -C ₆ alkyl includes both straight and branched chain alkyl of 1 to 6 carbon atoms. When an alkyl residue containing the specified number of carbon atoms is mentioned, it is assumed that all branched and straight chain variants containing the specified number of carbon atoms are included; thus, for example, "butyl" is meant to include n-butyl, sec-butyl, isobutyl and t-butyl; "propyl" includes n-propyl and isopropyl. Alkylene is a subgroup of alkyl referring to the same residues as alkyl, but having two points of attachment.

[54] As used herein, "alkenyl" refers to an unsaturated branched or straight chain alkyl group containing at least one carbon-carbon double bond obtained by removing one hydrogen molecule from adjacent carbon atoms of the parent alkyl. Said group may be either in the cis or trans configuration with respect to the double bond(s). Typical alkenyl groups include, but are not limited to: ethenyl; propenyls such as prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl (allyl), prop-2-en-2-yl; butenyls such as but-1-en-1-yl, but-1-en-2-yl, 2-methylprop-1-en-1-yl, but-2-en-1-yl, but-2- en-1-yl, but-2-en-2-yl, buta-1,3-dien-1-yl, buta-1,3-dien-2-yl; and similar groups. In some embodiments, the alkenyl group contains 2 to 20 carbon atoms and, in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkenylene is a type of alkenyl that belongs to the same residues as alkenyl, but has two points of attachment.

[55] As used herein, "alkynyl" refers to an unsaturated branched or straight chain alkyl group containing at least one carbon-carbon triple bond obtained by removing two hydrogen molecules from adjacent carbon atoms of the parent alkyl. Typical alkynyl groups include, but are not limited to: ethynyl; propynyls such as prop-1-yn-1-yl, prop-2-yn-1-yl; butynyls such as but-1-yn-1-yl, but-1-yn-3-yl, but-3-yn-1-yl and the like groups. In some embodiments, the alkynyl group contains 2 to 20 carbon atoms, and in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkynylene is a form of alkynyl that belongs to the same moieties as alkynyl, but has two points of attachment.

[56] In this application, "alkoxy" refers to an alkyl group of the specified number of carbon atoms connected by an oxygen bridge, such as, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, 3-methylpentyloxy and the like groups. Alkoxy groups will typically contain 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms linked by an oxygen bridge.

[57] As used herein, "aryl" refers to a radical derived from an aromatic monocyclic or polycyclic hydrocarbon ring system by removal of a hydrogen atom from a ring carbon atom. An aromatic monocyclic or polycyclic hydrocarbon ring system contains only hydrogen and carbon, from six to eighteen carbon atoms, while at least one of the rings in the ring system is completely unsaturated, i.e., contains a ring system of delocalized (4n+2) π- electrons according to Hückel's theory. Aryl groups include, but are not limited to, phenyl, fluorenyl, and naphthyl groups. Arylene is a form of aryl that belongs to the same residues as aryl, but has two points of attachment.

[58] In this application, "cycloalkyl" refers to a non-aromatic carbocyclic ring, usually containing from 3 to 7 ring carbon atoms. The ring may be saturated or may contain one or more carbon-carbon double bonds. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl and cyclohexenyl, as well as bridging and backbone ring groups such as norbornane.

[59] In this application, "halo-" or "halogen" refers to fluoro-, chloro-, bromo- and iodo-, and the term "halogen" includes fluorine, chlorine, bromine and iodine.

[60] In this application, "haloalkyl" refers to alkyl as defined above, in which the specified number of carbon atoms is replaced by 1 or more halogen atoms, up to the maximum allowable number of halogen atoms. Examples of haloalkyl include, but are not limited to, trifluoromethyl, difluoromethyl, 2-fluoroethyl, and pentafluoroethyl.

[61] "Heterocyclyl" refers to a stable 3-18 membered non-aromatic ring radical that contains two to twelve carbon atoms and one to six heteroatoms selected from nitrogen, oxygen and sulfur. Unless otherwise specifically stated herein, a heterocyclic radical is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which may include fused or bridged ring systems. The heteroatoms in the heterocyclic radical may optionally be oxidized. One or more nitrogen atoms, if present, may optionally be quaternized. The heterocyclic radical is partially or fully saturated. Heterocyclyl can be attached to the rest of the molecule through any atom of the ring(s). Examples of such heterocyclic radicals include, but are not limited to: dioxolanyl, thienyl[1,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxo pyrrolidinyl, oxazolidinyl , piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxothiomorpholinyl, and 1,1-dioxothiomorpholinyl.

[62] "Heteroaryl" refers to a radical derived from a 3-18 membered aromatic ring radical that contains two to seventeen carbon atoms and one to six heteroatoms selected from nitrogen, oxygen and sulfur. In this application, the heteroaryl radical may be a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, wherein at least one of the rings in the ring system is fully unsaturated, i.e., contains a ring system of delocalized (4n+2) π-electrons in according to Hückel's theory. Heteroaryl includes fused or bridged ring systems. The heteroatom(s) in the heteroaryl radical are optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. The heteroaryl is attached to the rest of the molecule through any atom of the ring(s). Examples of heteroaryls include, but are not limited to: azepinyl, acridinyl, benzimidazolyl, benzdolyl, 1,3-benzodioxolyl, benzofuranyl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, benzo[b] [1,4]oxazinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxynyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl (benzothiophenyl), benzothieno[3,2-d]pyrimidinyl, benzotriazolyl, benzo[4, 6]imidazo[1,2-a]pyridinyl, carbazolyl, cinnolinyl, cyclopenta[d]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d]pyrimidinyl, 5,6- dihydrobenzo[h]quinazolinyl, 5,6-dihydrobenzo[h]cinnolinyl, 6,7-dihydro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, furanonyl, furo[ 3,2-c]pyridinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyrimidinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridazinyl, 5,6,7, 8,9,10-hexahydrocycloocta [d]pyridinyl, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, 5,8-methano-5,6,7,8-tetrahydroquinazolinyl, naphthyridinyl, 1,6-naphthyridinonyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranil, 5,6,6a,7,8,9,10,10a-octahydrobenzo[h]quinazolinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridinyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quinazolinyl, quinoxalinyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6, 7,8,9-tetrahydro-5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7,8-tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno[3,2-d]pyrimidinyl, thieno[2,3-c]pyridinyl, and thiophenyl (i.e., thienyl).

[63] In the present description, various protecting groups for hydroxyl can be used. Typically, protecting groups render chemical functional groups inactive under certain reaction conditions, and they can be added to and removed from such functional groups in a molecule substantially without damaging the rest of the molecule. Examples of hydroxyl protecting groups are described in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2nd Ed., John Wiley & Sons, New York, 1991, each of which is hereby incorporated herein by reference in its entirety. In some embodiments, the protecting group is stable under basic conditions but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used in this application are include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthen-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthen-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that may be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), and TMTr (4,4',4' '-trimethoxytrityl).

[64] The term "subject" in this application refers to any animal, such as a mammal or marsupial. Subjects of the present invention include, but are not limited to, humans, non-human primates (eg, rhesus monkeys or other types of monkeys), mice, pigs, horses, donkeys, cows, sheep, rats, and birds of any kind.

[65] In this application, "treatment", or "treat", or "mitigation" or "relief" is used interchangeably. These terms refer to the approach of obtaining beneficial or desirable results, including but not limited to therapeutic benefit. By "therapeutic benefit" is meant the elimination or reduction of the underlying disorder being treated. Also, a therapeutic benefit is achieved by the elimination or reduction of one or more physiological symptoms associated with the underlying disorder such that the patient is improved despite the fact that the patient may still be suffering from the underlying disorder.

[66] In this application, "prevent" and "prevent" are used interchangeably. These terms refer to the approach of obtaining beneficial or desirable results, including but not limited to preventive benefits. For "prophylactic benefit", the conjugates or compositions may be administered to a patient at risk of developing a particular disease, or to a patient reporting one or more physiological symptoms of a disease, even though the disease has not been diagnosed.

conjugating molecules

[67] In one aspect, this application describes a conjugating molecule for the delivery of an active agent or active drug. In some embodiments, the conjugating molecules described herein are useful for tissue-specific targeting. In some embodiments, the conjugating molecules described herein bind to a receptor on the cell surface. Any cell surface receptor or biomarker or fragment thereof is considered suitable for this purpose. In some embodiments, the conjugating molecules described herein bind specifically to a receptor unique to a particular tissue and thereby achieve tissue-specific targeting. In some embodiments, the conjugating molecules described herein specifically target receptors on the surface of hepatocytes and therefore specifically target liver tissues. In some embodiments, the conjugating molecules described herein specifically target receptors on the cell surface that are unique to liver cells. In some embodiments, the conjugating molecules described herein specifically target asialoglycoprotein receptors on the surface of liver cells (ASGPR).

[68] In this application, the term "active agent" is used interchangeably with the term "active drug", both terms refer to a molecule that is capable of delivering the conjugating molecule described in this application. In some embodiments, the active agents are agents that are to be delivered to the hepatocyte. Such agents are known to those skilled in the art and include, but are not limited to: functional nucleotides, such as functional oligonucleotides, especially those described herein.

[69] In some embodiments, the present invention provides a conjugating molecule having the structure represented by formula (321):

Formula (321)

Where:

n1 is an integer from 1 to 3, and n3 is an integer from 0 to 4;

each of m1, m2, and m3 is independently an integer from 2 to 10; each of R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ is independently selected from H, C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl and C ₁ -C ₁₀ alkoxy;

R ₄ is a group capable of being bound to an active drug or active agent by a covalent bond;

each L ₁ is a linear alkylene from 1 to 70 carbon atoms in which one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH =N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, and L ₁ is optional substituted by any one or more elements of the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen, OH , -SH, NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl)(C ₁ -C ₁₀ alkylphenyl), NH(C ₁ -C ₁₀ alkylphenyl), cyano, nitro, CO ₂ H, C(O)OC ₁ -C ₁₀ alkyl, CON(C ₁ -C ₁₀ alkyl)( C ₁ -C ₁₀ alkyl), CONH (C ₁ -C ₁₀ alkyl), CONH ₂ , NHC (O) (C ₁ -C ₁₀ alkyl), NHC (O) (phenyl), N (C ₁ -C ₁₀ alkyl )C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), C (O) C ₁ -C ₁₀ alkyl, C (O) C ₁ -C ₁₀ alkylphenyl, C(O)C ₁ -C ₁₀ haloalkyl, OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH(C ₁ -C ₁₀ alkyl), SO ₂ NH(phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl);

each S ₁ is independently M ₁ in which any active hydroxyl, if any, is protected by a hydroxyl protecting group;

each M ₁ is independently selected from a ligand capable of binding to a receptor on the cell surface.

[70] In some embodiments, n1 may be an integer from 1 to 3, and n3 may be an integer from 0 to 4, to ensure that there are at least 2 S ₁ groups in the conjugating molecule. In some embodiments, n1+n3 ≥ 2 such that the amount of M ₁ ligand in the conjugate formed by the conjugating molecule may be at least 3, thereby allowing the M ₁ ligand to more conveniently bind to asialoglycoprotein receptors on the surface of hepatocytes, which may promote endocytosis conjugate into cells. Experiments have shown that if the number of M ₁ ligands is greater than 3, then the possibility of binding the M ₁ ligand to asialoglycoprotein receptors on the surface of hepatocytes increases slightly. Therefore, considering various aspects such as synthesis convenience, structure/process cost, and delivery efficiency, in some embodiments, n1 is an integer from 1 to 2, n3 is an integer from 0 to 1, and n1+n3 = 2 - 3.

[71] In some embodiments, when each of m1, m2, and m3 is independently selected from an integer of 2-10, it is believed that the steric position among the plurality of M ₁ ligands in the conjugate formed by the conjugating molecule may be suitable for binding the M ligands ₁ with asialoglycoprotein receptors on the surface of hepatocytes. In order to make the conjugate molecule provided herein easier, more convenient to synthesize, and/or reduce cost, in some embodiments of the present disclosure, m1, m2, and m3 are each independently an integer from 2 to 5, in some embodiments realizations m1 = m2 = m3.

[72] Those skilled in the art will appreciate that if R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , and R ₁₅ are each independently selected from H, C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl and C ₁ -C ₁₀ alkoxy, then the purpose of the present description can be achieved without changing the properties of the conjugating molecule described in this application. In some embodiments, each of R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ is independently selected from H, methyl and ethyl. In some embodiments, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are all H.

[73] R ₄ is a group capable of contacting the active agent to be delivered using the conjugating molecules described in this application. In some embodiments, R ₄ is a group capable of binding to the oligonucleotide to be delivered by the conjugating molecules described herein. In some embodiments, R ₄ is a group capable of covalently bonding to the oligonucleotide. In some embodiments, R ₄ is a group capable of being linked to the oligonucleotide by a phosphodiester bond. In some embodiments, R ₄ is chosen to achieve bonding to the N atom on the nitrogenous backbone and to create suitable reaction sites for the synthesis of the oligonucleotide conjugate. As used herein, "nitrogen backbone" refers to a chain structure in which the carbon atoms to which R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are attached and the N atoms are bonded to each other. In some embodiments, R ₄ is a molecule that can be attached to the N atom on the nitrogen backbone in a suitable manner. In some embodiments, R ₄ contains a site that binds to the N atom on the nitrogenous backbone and any functional group that can be conjugated to the oligonucleotide by a phosphodiester bond during the reaction.

[74] In some embodiments, R ₄ contains a first functional group that can react with a group on the oligonucleotide or nucleotide to form a phosphoester bond, and a second functional group that can form a covalent bond with a hydroxy or amino group, or a solid phase support bound covalent bond. In some embodiments, the first functional group is phosphoramidite, hydroxy, or protected hydroxy. In some embodiments, the second functional group is a phosphoramidite, carboxyl, or carboxylate salt. In some embodiments, the second functional group is a solid phase support attached to the rest of the molecule by a covalent bond formed by a hydroxy group or an amino group. In some embodiments, the solid phase support is linked by a phosphoester bond, a carboxyester bond, or an amide bond. In some embodiments, the solid phase support is a resin.

[75] In some embodiments, the first functional group includes hydroxy, -OR _k , or a group represented by formula (C3); and/or the second functional group includes a group represented by formula (C1), (C2), (C3), (C1') or (C3'):

представляет собой сайт ковалентного присоединения указанной группы. where q ₁ is an integer from 1 to 4, X is O or NH, M ⁺ is a cation, R _k is a hydroxy protecting group, SPS is a solid phase support, and

represents the site of covalent attachment of the specified group.

[76] In some embodiments, the first functional group includes a phosphoramidite group, such as the group represented by formula (C3). The phosphoramidite group can combine with hydroxy at any position on the nucleotide, such as 2'- or 3'-hydroxy, and form a phosphodiester bond by oxidation to conjugate the conjugating molecule to the oligonucleotide. Thus, even if a second functional group does not exist, the conjugating molecule described in this application can be conjugated to a nucleotide. In this case, the conjugate molecule is suitable for contacting the hydroxy at the last nucleotide of a sequence of nucleotides and forming a phosphodiester bond by subsequent oxidation, thereby conjugating the conjugate molecule as described herein to the oligonucleotide.

[77] In some embodiments, the first functional group includes a protected hydroxy group. In some embodiments, the second functional group includes a group capable of reacting with the solid phase support to form a conjugating molecule containing the solid phase support. In some embodiments, the second functional group includes a carboxyl, carboxylate, or phosphoramidite, such as the functional group represented by formula (C1), (C2), or (C3). The carboxyl or carboxylate may be esterified or amidated with a hydroxy or amino group on a solid phase support, such as a resin, to form a conjugate molecule containing the solid phase support linked by a carboxylate ester bond or an amide bond. Phosphoramidite can combine with a hydroxy group on a versatile solid phase support, such as a resin, and form a conjugating molecule containing a solid phase support linked by a phosphodiester bond by subsequent oxidation. Accordingly, in one aspect of the present invention, a method is provided for preparing a conjugate described in this application with such a conjugate molecule. In some embodiments, said method comprises first coupling a conjugate molecule to a solid phase support by a condensation or coupling reaction, and then adding nucleoside monomers according to the phosphoramidite solid phase synthesis method, thereby obtaining a conjugate described herein containing a conjugate molecule as described herein, conjugated with an oligonucleotide. In some embodiments, the first functional group is deprotected during solid phase phosphoramidite synthesis, followed by coupling to the phosphoramidite group on the nucleoside under coupling conditions.

[78] In some embodiments, R ⁴ contains a first functional group and a second functional group, wherein the first functional group includes a hydroxy or protected hydroxy group, and the second functional group includes a carboxylate ester bond, an amide bond, or a phosphodiester bond, or a solid phase support linked by a carboxylate an ester bond, an amide bond, or a phosphodiester bond. In some embodiments, the second functional group is a molecule represented by formula (C1') or (C3'). In some embodiments, if the second functional group includes a solid phase support, a conjugating molecule containing such a solid phase support is useful to obtain the conjugate described in this application. Accordingly, in one aspect of the present invention, a method is provided for preparing a conjugate described in this application with a conjugating molecule. In some embodiments, said method comprises contacting a conjugate molecule comprising a solid phase support with nucleoside monomers according to the phosphoramidite solid phase synthesis method, thereby obtaining a conjugate molecule as described herein conjugated to an oligonucleotide. In some embodiments, a conjugating molecule containing a solid phase support can itself be prepared from a carboxyl, carboxylate, or phosphoramidite conjugating molecule by reacting the conjugating molecule with a solid phase support. In some embodiments, the conjugating molecule may be provided by a supplier.

[79] In some embodiments, the carboxylate may be represented as -COO ^- M ⁺ , where M ⁺ is a cation, such as a metal cation, an NH ₄ ⁺ ammonium cation, or an organic ammonium cation. In some embodiments, the metal cation may be an alkali metal cation such as K ⁺ or Na ⁺ . In order to increase solubility and speed up the reaction, in some embodiments, the organic ammonium cation is an ammonium cation derived from a tertiary amine or a quaternary ammonium cation such as an ammonium cation derived from triethylamine or N,N-diisopropylethylamine. In some embodiments, the carboxylate is triethylamine carboxylate or N,N-diisopropylethylamine carboxylate.

[80] In some embodiments, according to the present description, R ₄ is a group represented by formula (B9), (B10), (B9'), (B10'), (B11), (B12), (B11') or ( B12'):

представляет собой место ковалентного присоединения указанной группы. В некоторых вариантах реализации q₁ представляет собой 1 или 2. В некоторых вариантах реализации q₂ представляет собой целое число от 1 до 5. В некоторых вариантах реализации R₄ включает группу, представленную формулой (B9) или (B10). В некоторых вариантах реализации R₄ включает группу, представленную формулой (B11) или (B12). where q ₁ is an integer from 1 to 4, q ₂ is an integer from 1 to 10, X is O or NH, M ⁺ is a cation, R _k is a hydroxy protecting group, SPS is a solid phase support And

represents the site of covalent attachment of the specified group. In some embodiments, q ₁ is 1 or 2. In some embodiments, q ₂ is an integer from 1 to 5. In some embodiments, R ₄ includes a group represented by formula (B9) or (B10). In some embodiments, R ₄ includes a group represented by formula (B11) or (B12).

[81] In some embodiments, R _k is one or more of Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), and TMTr (4,4',4''-trimethoxytrityl) . In some embodiments, R _k is DMTr.

[82] L ₁ is a linear alkylene from 1 to 70 carbon atoms in which one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S , CH=N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, and at the same time L ₁ is optionally substituted by any one or more members of the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen , OH, -SH, NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), N (C ₁ - C ₁₀ alkyl) (C ₁ -C ₁₀ alkylphenyl), NH (C ₁ -C ₁₀ alkylphenyl), cyano, nitro, CO ₂ H, C (O) OC ₁ -C ₁₀ alkyl, CON (C ₁ -C ₁₀ alkyl )(C ₁ -C ₁₀ alkyl), CONH(C ₁ -C ₁₀ alkyl), CONH ₂ , NHC(O)(C ₁ -C ₁₀ alkyl), NHC(O)(phenyl), N(C ₁ -C ₁₀ alkyl) C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), C (O) C ₁ -C ₁₀ alkyl, C (O) C ₁ -C ₁₀ alkylphenyl, C(O)C ₁ -C ₁₀ haloalkyl, OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ ( C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH (C ₁ -C ₁₀ alkyl), SO ₂ NH (phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl ) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl). It will be apparent to those skilled in the art that while L ₁ is referred to as a linear alkylene for convenience, it may not be a linear group or may be referred to differently, such as an amine or alkenyl, as a result of the above substitution and/or substitution. For the purposes of this description given in this application, the length L ₁ represents the atomic number in the chain connecting the two points of attachment. For this purpose, a ring resulting from the replacement of a linear alkylene carbon atom, such as heterocyclylene or heteroarylene, is counted as one atom.

[83] In some embodiments, L ₁ is used to connect the M ₁ ligand (or the corresponding S ₁ group) to the N atom on the nitrogenous backbone, thereby obtaining the liver targeting function of the conjugate of the present invention. In some embodiments, L ₁ includes any of formulas A1 - A26 and any combinations thereof. In some embodiments, L ₁ is any of A1, A4, A5, A6, A8, A10, A11, A13, and combinations thereof. In some embodiments, L ₁ is a combination of at least two of A1, A4, A8, A10, and A11; in some embodiments, L ₁ is a combination of at least two of A1, A8, and A10.

[84] In some embodiments, the L ₁ length may be 3 to 25, 3 to 20, 4 to 15, or 5 to 12 atoms. In some embodiments, the length L ₁ is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 atoms.

[85] In some embodiments as described herein, therefore, j1 is an integer from 2 to 10, and in some embodiments, is an integer from 3 to 5; j2 is an integer from 2 to 10, and in some implementations is an integer from 3 to 5; R' is C ₁ -C ₄ alkyl, and in some embodiments is one of methyl, ethyl, and isopropyl. Ra is one of A27, A28, A29, A30 and A31 and in some embodiments is A27 or A28; Rb is C ₁ -C ₅ alkyl and in some embodiments is one of methyl, ethyl, isopropyl, and butyl. In some embodiments, j1, j2, R', Ra, and Rb are appropriately selected from A1 - A26 to achieve bonding between the M ₁ ligands and the N atom at the nitrogen backbone in the oligonucleotide conjugate formed by the conjugating molecule and to make a steric position among the ligands M ₁ is more suitable for binding M ₁ ligands to asialoglycoprotein receptors on the surface of hepatocytes.

[86] Each M ₁ is independently selected from a ligand capable of binding to a receptor on the cell surface. In some embodiments, at least one M ₁ is a ligand capable of binding to a receptor on the surface of hepatocytes. In some embodiments, at least one M ₁ is a ligand capable of binding to a receptor on the surface of a mammalian cell. In some embodiments, at least one M ₁ is a ligand capable of binding to a receptor on the surface of human hepatocytes. In some embodiments, at least one M ₁ is a ligand capable of binding to asialoglycoprotein receptors on the surface of liver cells (ASGPR).

[87] In some embodiments, M ₁ can be any of the ligands that has affinity for asialoglycoprotein receptors (ASGP-R) on the surface of mammalian hepatocytes. The types of these ligands are well known to those skilled in the art. In some embodiments, at least one of M ₁ is a saccharide. In some embodiments, each M ₁ is a saccharide. In some embodiments, at least one of M ₁ is a monosaccharide, disaccharide, trisaccharide, or polysaccharide. In some embodiments, each M ₁ is a monosaccharide, disaccharide, trisaccharide, or polysaccharide. In some embodiments, at least one of M ₁ is a modified saccharide. In some embodiments, each M ₁ is a modified saccharide. In some embodiments, each M ₁ is independently selected from polysaccharides, modified polysaccharides, monosaccharides, or monosaccharide derivatives. In some embodiments, each or at least one M ₁ can be independently selected from the group consisting of glucose and its derivatives, mannose and its derivatives, galactose and its derivatives, xylose and its derivatives, ribose and its derivatives, fucose and its derivatives, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives, fructose and its derivatives and sialic acid.

[88] In some embodiments, each or at least one M ₁ can be independently selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose , D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose , β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N- glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl-2,3,4-tris-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio -β-D-galactopyranose, ethyl-3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose , D-ribose, D-4-thioribose, L-ribose, L-4-thioribose. In some embodiments, at least one M ₁ is N-acetylgalactosamine (GalNAc). In some embodiments, each M ₁ is N-acetylgalactosamine (GalNAc). The choice of ligand can be found, for example, in the description CN105378082A, which is fully incorporated into this application by reference.

[89] CN105378082A describes a compound containing a modified oligonucleotide and a conjugating group, said conjugating group containing at least one phosphorus linking group or a neutral linking group, as well as one or more ligands, each ligand selected from the group consisting of polysaccharides modified polysaccharides, mannose, galactose, mannose derivatives, galactose derivatives, D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α- D-mannofuranoses, β-D-mannofuranoses, α-D-mannopyranoses, β-D-mannopyranoses, α-D-glucopyranoses, β-D-glucopyranoses, α-D-glucofuranoses, β-D-glucofuranoses, α-D- fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, α-D-galactosamine, N-acetylgalactosamine, 2-amino -3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3 -di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl-2,3,4- tris-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl-3,4,6,7-tetra-O-acetyl-2- deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose and L-4-thioribose. The compound is said to be able to reduce the amount or activity of nucleic acid transcription in cells.

[90] WO2016077321A1 describes a plurality of siRNAs specifically targeting the HBV gene and methods for their delivery, and the serum stability of these siRNAs is improved by modifying their nucleotides. This document also describes siRNA conjugates and additionally specifically describes several siRNA conjugates.

[91] WO2016168286A1 describes a plurality of siRNAs specifically targeting the ANGPTL3 gene and methods for their delivery, and the serum stability of these siRNAs is improved by modifying their nucleotides. This document also describes siRNA conjugates.

[92] N-acetylgalactosamine (GalNAc) is a ligand that binds to asialoglycoprotein receptors on the surface of liver cells (ASGPR). ASGPR is an endocytic receptor that is specifically expressed by hepatocytes. Recently, N-acetylgalactosamine (GalNAc) has been used as a targeting molecule for small RNA drug delivery to the liver. For example, Alnylam Pharmaceuticals, Inc., originally reported that siRNAs based on GalNAc conjugation technology exhibited interfering activity in mice (Nair et al., J. Am. Chem. Soc., 2014, 136, 16958-16961). This article reported that siRNA conjugated to three GalNAc cassettes exhibited good delivery activity both in vitro and in vivo. Using in vivo experiments with mice dosed subcutaneously, the ED ₅₀ of a single dose was determined to be 1 mg/kg when the single injection dose was less than 1 ml. In long-term administration experiments, it is claimed that stable interference activity can be achieved up to 9 months with subcutaneous injection once a week.

[93] In some embodiments, S ₁ is independently M ₁ . In some embodiments, S ₁ is independently M ₁ containing at least one active hydroxy group protected by a hydroxyl protecting group. In some embodiments, S ₁ is independently M ₁ in which all active hydroxyls, if any, have been protected with a hydroxyl protecting group. In some embodiments, any hydroxyl protecting group known to those skilled in the art can be used to protect the active hydroxyl at M ₁ . In some embodiments, the protected hydroxy group is represented by the formula YCOO-, where each Y is independently selected from the group consisting of C ₁ -C ₁₀ alkyl and C ₆ -C ₁₀ aryl, which are optionally substituted with one or more of the substituents selected from the group consisting of halogen and C ₁ -C ₆ alkyl. In some embodiments, each Y is independently selected from the group consisting of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and C ₁ -C ₆ alkylphenyl.

[94] In some embodiments, each S ₁ is independently selected from the group consisting of Formulas A46-A54:

[95] In some embodiments, S ₁ is A49 or A50. In some embodiments, Y independently for each occurrence is one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and alkylphenyl. In order to simplify the conjugate molecule of the present invention, in some embodiments, Y is methyl.

[96] In some embodiments, the conjugating molecule of the present invention has the structure represented by formula (403), (404), (405), (406), (407), (408), (409), (410), ( 411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421) or (422):

,

,

(405)

,

,

(406)

,

,

(407)

,

,

(408)

,

,

(409)

,

,

(410)

,

,

(411)

,

,

(412)

,

,

(413)

,

,

(414)

,

,

(415)

,

,

(416)

,

,

(417)

,

,

(418)

,

,

(419)

,

,

(420)

,

,

(421)

.

.

(422)

.[97] In the above formulas (403) to (422), X is O or NH, R _k is a protecting group for hydroxy, and M ⁺ is a metal cation, an ammonium cation, a cation formed from a tertiary amine, or a cation quaternary ammonium. In some embodiments, M ⁺ is

.

[98] In some embodiments, the conjugating molecule of the present invention has the structure represented by formula (423), (424), (425), (426), (427), (428), (429), (430), ( 431), (432), (433), (434), (435), (436), (437), (438), (439), (440), (441) or (442):

,

,

(423)

,

,

(424)

,

,

(425)

,

,

(426)

,

,

(427)

,

,

(428)

,

,

(429)

,

,

(430)

,

,

(431)

,

,

(432)

,

,

(433)

,

,

(434)

,

,

(435)

,

,

(436)

,

,

(437)

,

,

(438)

,

,

(439)

,

,

(440)

,

,

(441)

.

.

(442)

[99] In the above formulas (423) to (442), X is O or NH, _Rk is a hydroxyl protecting group, and SPS is a solid phase support.

[100] In some embodiments, the conjugating molecule of the present invention has the structure represented by formula (503), (504), (505), (506), (507), (508), (509), (510), ( 511), (512), (513), (514), (515), (516), (517), (518), (519), (520), (521) or (522):

(503)

(504)

(505)

(506)

(507)

(508)

(509)

(510)

(511)

(512)

(513)

(514)

(515)

(516)

(517)

(518)

(519)

(520)

(521)

.

.

(522)

представляет собой соли, образованные соответствующими карбоновыми кислотами и триэтиламином. [101] In the above formulas (503) - (522) DMTr represents 4,4'-dimethoxytrityl. Structure

is a salt formed by the corresponding carboxylic acids and triethylamine.

[102] In some embodiments, the conjugating molecule of the present invention has the structure represented by formula (523), (524), (525), (526), (527), (528), (529), (530), ( 531), (532), (533), (534), (535), (536), (537), (538), (539), (540), (541) or (542):

(523)

(524)

(525)

(526)

(527)

(528)

(529)

(530)

(531)

(532)

(533)

(534)

(535)

(536)

(537)

(538)

(539)

(540)

(541)

.

.

(542)

[103] In formulas (523) to (542) above, SPS is a solid phase support and DMTr refers to 4,4'-dimethoxytrityl.

Obtaining a conjugating molecule according to the present description.

[104] A conjugating molecule according to the present description can be prepared by those skilled in the art by any suitable synthetic route.

[105] In some embodiments according to the present description, a method for obtaining a conjugating molecule represented by formula (321) includes contacting a compound represented by formula (313) with a cyclic anhydride under esterification reaction conditions in the presence of a base and an esterification catalyst in an organic solvent; ion exchange and isolation of the compound represented by the formula (321):

,

,

Formula (313)

Where:

R ₆ is a group for obtaining R ₄ formula (321). In some embodiments, for example, R ₆ has the structure represented by formula (A61):

definitions and options n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ , S ₁ are, respectively, as described above; R _i is a group capable of combining with the N atom on the nitrogenous backbone, with R _k O and with a free hydroxy group; R _k is a protecting group for hydroxy. In this case, a compound represented by formula (321) is obtained, where R ₄ contains a protecting group for hydroxy as a first functional group and a group represented by formula (C1) or (C2) as a second functional group. In some embodiments, R ₆ is B7 or B8:

where q ₂ and R _k , respectively, such as described above.

[106] Conditions for the esterification reaction include a reaction temperature of 0 to 100°C and a reaction time of 8 to 48 hours. In some embodiments, the esterification reaction conditions include a reaction temperature of 10 to 40° C. and a reaction time of 20 to 30 hours.

[107] In some embodiments, the organic solvent includes one or more of an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments, the ethereal solvent is diethyl ether and/or methyl t-butyl ether. In some embodiments, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. The amount of organic solvent is 3-50 L/mol, and in some embodiments 5-20 L/mol, depending on the compound represented by formula (313).

[108] In some embodiments, the cyclic anhydride is one of succinic anhydride, glutaric anhydride, adipic anhydride, or pimelic anhydride. In some embodiments, the cyclic anhydride is succinic anhydride. The molar ratio of cyclic anhydride to compound represented by formula (313) is 1:1 to 10:1, and in some embodiments, 2:1 to 5:1.

[109] The esterification catalyst can be any catalyst capable of catalyzing the esterification, such as 4-dimethylaminopyridine. The molar ratio of catalyst to compound represented by formula (313) is 1:1 to 10:1, and in some embodiments, 2:1 to 5:1.

[110] In some embodiments, the base may be any inorganic base, an organic base, or a combination thereof. Considering the solubility as well as the stability of the product, the base is a tertiary amine. In some embodiments, the tertiary amine is triethylamine or N,N-diisopropylethylamine. The molar ratio of tertiary amine to compound represented by formula (313) is 1:1 to 20:1, and in some embodiments, 3:1 to 10:1.

[111] The ion exchange serves to convert the compound represented by formula (321) into the desired carboxylic acid form or salt thereof. For the ion exchange method, the M ⁺ cation conjugating molecule can be prepared using a suitable ion exchange solution and ion exchange conditions that are well known in the art. In some embodiments, a triethylamine phosphate solution is used for ion exchange. In some embodiments, the concentration of the triethylamine phosphate solution is 0.2 - 0.8 M. In some embodiments, the concentration of the triethylamine phosphate solution is 0.4 - 0.6 M. In some embodiments, the amount of triethylamine phosphate solution is 3 - 6 L / mol and in an additional implementation of 4 - 5 l/mol, depending on the compound represented by formula (313).

[112] The compound represented by formula (321) can be isolated from the reaction mixture using any suitable methods. In some embodiments, the compound represented by formula (321) can be isolated by removing the solvent by evaporation and subsequent chromatography, for example, using the following chromatographic conditions for isolation: (1) normal phase purification: silica gel filler with a particle size of 200-300 mesh by gradient elution with a mixture of dichloromethane containing 1‰ triethylamine (by mass): methanol = 100:18 - 100:20; or (2) reverse phase purification: reverse phase filler in C18 and C8 columns, eluting with a gradient of methanol:acetonitrile = 0.1:1 - 1:0.1. In some embodiments, the solvent can be removed immediately to provide a crude product of the compound represented by formula (321) which can be used directly in the following reactions.

[113] In some embodiments, the process for preparing the compound represented by formula (321) further comprises: contacting the ion exchange product described above with an amino or hydroxy solid phase support under condensation reaction conditions in the presence of a condensation agent, a condensation catalyst, and a tertiary amine in organic solvent. Here, a compound represented by formula (321) is obtained in which R ₄ has a hydroxy protecting group as a first functional group and a group represented by formula (C1') as a second functional group.

[114] The solid phase support is one of the supports used in solid phase siRNA synthesis, some of which are well known to those skilled in the art. For example, the solid phase support may be selected from supports containing an active hydroxy functionality or an amino functionality. In some embodiments, the solid phase support is an amino or hydroxy resin. In some embodiments, the particle size of the amino or hydroxy resin is 100-400 mesh and the surface loading of the amine or hydroxy is 0.2-0.5 mmol/g. The ratio of the compound represented by the formula (321) to the solid support is from 10 µmol of compound per gram of solid support (µmol/g) to 400 µmol/g. In some embodiments, the ratio of compound of formula (321) to solid phase support is from 50 µmol/g to 200 µmol/g.

[115] The organic solvent can be any suitable solvent or mixture of solvents known to those skilled in the art suitable for the purpose described in this application. In some embodiments, the organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran, the ethereal solvent is diethyl ether and/or methyl t-butyl ether, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments, the organic solvent is acetonitrile. The amount of organic solvent is 20-200 L/mol, in some embodiments 50-100 L/mol depending on the compound represented by formula (313).

[116] In some embodiments, the condensing agent may be benzotriazol-1-yloxytripyrrolidinophosphonium hexafluorophosphate, 3-diethoxyphosphoryl-1,2,3-benzotriazol-4(3H)-one, and/or O-benzotriazoletetramethyluronium hexafluorophosphate. In some embodiments, the condensing agent is O-benzotriazoletetramethyluronium hexafluorophosphate. The molar ratio of the condensing agent to the compound represented by formula (313) is 1:1 to 20:1, and in further embodiments, 1:1 to 5:1.

[117] In some embodiments, the tertiary amine is triethylamine and/or N,N-diisopropylethylamine and in some embodiments is N,N-diisopropylethylamine. The molar ratio of tertiary amine to compound represented by formula (313) is 1:1 to 20:1, and in some embodiments, 1:1 to 5:1.

[118] In some embodiments, said method for preparing a compound represented by formula (321) further comprises: contacting the resulting condensation reaction product with a capping reagent and an acylation catalyst under capping reaction conditions in an organic solvent, and isolating the compound represented by formula (321 ). The capping reaction is used to remove any active functional groups that should not be reacted to avoid unnecessary by-products in the following reactions. Capping reaction conditions include a reaction temperature of 0 to 50°C and in some embodiments 15 to 35°C and a reaction time of 1 to 10 hours and in some embodiments 3 to 6 hours. The capping reagent may be a reagent used in solid phase siRNA synthesis, which is well known to those skilled in the art. In some embodiments, the capping reagent consists of capping reagent A (capA) and capping reagent B (capB). CapA is N-methylimidazole and in some embodiments is provided as a solution of N-methylimidazole in a pyridine/acetonitrile mixed solvent wherein the volume ratio of pyridine to acetonitrile is from 1:10 to 1:1 and in some embodiments is from 1: 3 to 1:1. In some embodiments, the ratio of the total volume of pyridine and acetonitrile to the volume of N-methylimidazole is from 1:1 to 10:1, and in some embodiments, from 3:1 to 7:1. In some embodiments, capping reagent B is acetic anhydride. In some embodiments, capping reagent B is provided as a solution of acetic anhydride in the solvent acetonitrile, wherein the volume ratio of acetic anhydride to acetonitrile is 1:1 to 1:10, and in further embodiments, is 1:2 to 1:6.

[119] In some embodiments, the ratio of the volume of a solution of N-methylimidazole in a mixed solvent of pyridine/acetonitrile to the mass of the compound of formula (313) is 5 ml/g - 50 ml/g, and in some embodiments is 15 ml/g - 30 ml/ G. The ratio of the volume of a solution of acetic anhydride in acetonitrile to the weight of the compound of formula (313) is 0.5 ml/g - 10 ml/g, and in some embodiments is 1 ml/g - 5 ml/g.

[120] In some embodiments, the capping reagent is equimolar acetic anhydride and N-methylimidazole. In some embodiments, the organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the organic solvent is acetonitrile. In some embodiments, the amount of organic solvent is 10-50 L/mol, and in some embodiments it is 5-30 L/mol, depending on the compound represented by formula (313).

[121] In some embodiments, the acylation catalyst can be selected from any catalyst that can be used for esterification or amidation, such as alkaline heterocyclic compounds. In some embodiments, the acylation catalyst is 4-dimethylaminopyridine. The ratio of the weight of the catalyst to the weight of the compound represented by formula (313) may be from 0.001:1 to 1:1, and in some embodiments is from 0.01:1 to 0.1:1.

[122] In some embodiments, the compound represented by formula (321) can be isolated from the reaction mixture by any suitable means. In some embodiments, the compound of formula (321) can be prepared by sufficient washing with an organic solvent and filtration to remove unreacted reagents, excess capping reagent, and other impurities, the organic solvent being selected from acetonitrile, dichloromethane, or methanol. In some embodiments, the organic solvent is acetonitrile.

[123] In some embodiments, the preparation of a Conjugate molecule represented by formula (321) comprises contacting a compound represented by formula (313) with phosphorodiamidite under coupling reaction conditions in the presence of a coupling agent in an organic solvent and isolating the compound represented by formula ( 321). In this case, a compound represented by formula (321) is obtained, where R ₄ contains a protecting group for hydroxy as a first functional group and a group represented by formula (C3) as a second functional group.

[124] In some embodiments, the coupling reaction conditions include a reaction temperature of 0 to 50°C, such as 15 to 35°C. The molar ratio of the compound of formula (322) to phosphorodiamidite may be from 1:1 to 1:50, for example from 1:5 to 1:15. The molar ratio of the compound of formula (313) to the coupling agent may be from 1:1 to 1:100, for example from 1:50 to 1:80. The reaction time may be 200-3000 seconds, preferably 500-1500 seconds. Phosphorodiamidite may be, for example, 2-cyanoethyl-N,N,N',N'-tetraisopropylphosphorodiamidite and may be commercially available or may be prepared according to methods well known in the art. The coupling agent is selected from one or more of 1H-tetrazole, 5-ethylthio-1H-tetrazole and 5-benzylthio-1H-tetrazole, such as 5-ethylthio-1H-tetrazole. The coupling reaction can be carried out in an organic solvent. In some embodiments, the organic solvent is selected from one or more of anhydrous acetonitrile, anhydrous DMF, and anhydrous dichloromethane, preferably anhydrous acetonitrile. The amount of the organic solvent may be 3 to 50 L/mol, for example 5 to 20 L/mol, depending on the compound represented by the formula (313). Through a coupling reaction, the hydroxy group in compound (313) reacts with phosphorodiamidite to form a phosphoramidite group. In some embodiments, the solvent can be removed immediately to provide a crude product of the compound represented by formula (321) which can be used directly in the following reactions.

[125] In some embodiments, a method for preparing a compound represented by formula (321) further comprises: contacting the isolated product with a hydroxyl solid phase support under coupling reaction conditions in the presence of a coupling agent in an organic solvent, and then capping, oxidizing and isolating to obtain a compound represented by formula (321) wherein R ₄ has a hydroxy protecting group as a first functional group and a group represented by formula (C3') as a second functional group.

[126] In some embodiments, the solid phase support is a support used in solid phase nucleic acid synthesis, such as a commercially available universal deprotected solid phase support (such as the NittoPhase®HL UnyLinker™ 300 oligonucleotide synthesis support, Kinovate Life Sciences, represented by formula B80):

(B80).

[127] The deprotection reaction is well known in the art. In some embodiments, the deprotection reaction conditions include a temperature of 0 to 50°C, such as 15 to 35°C, and a reaction time of 30 to 300 seconds, such as 50 to 150 seconds. The deprotecting agent can be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid. In some embodiments, the deprotecting agent is dichloroacetic acid. The molar ratio of deprotectant to α-DMTr (4,4'-dimethoxytrityl) protecting group on the solid phase support may be from 2:1 to 100:1, eg 3:1 to 50:1. By this deprotection, reactive free hydroxyl groups are obtained on the surface of the solid phase support, which are therefore available for the subsequent coupling reaction.

[128] The coupling reaction conditions and the coupling reaction agent can be selected as described above. Through this coupling, the free hydroxy groups formed by deprotection react with the phosphoramidite groups to form a phosphite ester bond.

[129] In some embodiments, the capping reaction conditions include a temperature of 0 to 50°C, such as 15 to 35°C, and a reaction time of 5 to 500 seconds, such as 10 to 100 seconds. The capping agent and its amount can be selected as described above.

[130] The oxidation reaction conditions may include a temperature of 0 to 50°C, such as 15 to 35°C, and a reaction time of 1 to 100 seconds, such as 5 to 50 seconds. The oxidizing agent may be, for example, iodine (provided in some embodiments as iodine water). In some embodiments, the molar ratio of oxidant to nucleic acid sequence associated with the solid phase support in the coupling step is 1:1 to 100:1, preferably 5:1 to 50:1. In some embodiments, the oxidation reaction is carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1 - 1:1:3.

[131] In some embodiments, R ₆ is B7 or B8. Here, the compound represented by the formula (313) can be obtained by bringing the compound represented by the formula (314) into contact with the compound represented by the formula (A-1) or (A-2) under amidation reaction conditions in the presence of a condensing agent for the amidation reaction and a tertiary amine in an organic solvent followed by isolation:

,

,

Formula (314)

where the definitions and options n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ , S ₁ , q ₂ and R _k are, respectively, such as described above.

[132] Amidation reaction conditions may include a reaction temperature of 0 to 100°C and a reaction time of 1 to 48 hours. In some embodiments, the amidation reaction conditions include a reaction temperature of 10 to 40° C. and a reaction time of 2 to 16 hours.

[133] In some embodiments, the organic solvent is one or more of an alcohol solvent, an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the alcoholic solvent is one or more of methanol, ethanol, and propanol, and in additional embodiments, is ethanol. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments, the ethereal solvent is diethyl ether and/or methyl t-butyl ether. In some embodiments, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. The amount of organic solvent is 3-50 l/mol and in additional embodiments 3-20 l/mol depending on the compound represented by formula (314).

[134] In some embodiments, the condensing agent for the amidation reaction is benzotriazol-1-yl-hydroxytripyrrolidinophosphonium hexafluorophosphate, 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizin-4(3H)-one, 4-(4,6 -dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride, 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (EEDQ), or O-benzotriazoletetramethyluronium hexafluorophosphate and in further embodiments is 3-(diethoxyphosphoryloxy)-1,2 ,3-benzotrizin-4(3H)-one. The molar ratio of the condensing agent for the amidation reaction to the compound represented by formula (314) may be from 1:1 to 10:1, and in some embodiments is from 2.5:1 to 5:1.

[135] In some embodiments, the tertiary amine is triethylamine or N,N-diisopropylethylamine, and in additional embodiments is N,N-diisopropylethylamine. The molar ratio of the tertiary amine to the compound represented by formula (314) may be from 3:1 to 20:1, and in some embodiments is from 5:1 to 10:1.

[136] In some embodiments, the compounds of formulas (A-1) and (A-2) can be obtained using any suitable means. For example, a compound of formula (A-1) can be prepared by reacting calcium glycerate with DMTrCl, where R _k is the DMTr group. Similarly, a compound of formula (A-2) can be prepared by first contacting 3-amino-1,2-propanediol with a cyclic anhydride, which may contain 4-13 carbon atoms and in some embodiments 4-8 carbon atoms, and then bringing into contact with DMTrCl. Those skilled in the art will readily appreciate that the choice of different cyclic anhydrides corresponds to different q ₂ values in the compound of formula (A-2). For example, if the cyclic anhydride is succinic anhydride, then q _{2 =} 1; if the cyclic anhydride is glutaric anhydride, then q ₂ = 2, and so on.

[137] In some embodiments, a compound of formula (313) can also be prepared by sequentially reacting a compound represented by formula (314) with cyclic anhydride, 3-amino-1,2-propanediol, and DMTrCl. Those skilled in the art will readily appreciate that these variants will not affect the structure and function of the compound of formula (313), and these variants can be easily prepared by those skilled in the art based on the methods described above.

[138] Similarly, the compound represented by formula (313) can be isolated from the reaction mixture using any suitable isolation methods. In some embodiments, the compound represented by formula (313) can be isolated by removing the solvent by evaporation and subsequent chromatography. For example, the following two sets of chromatography conditions can be used for isolation: (1) normal phase purification: 200-300 mesh silica gel media eluting with a gradient of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide = 1:1: 1:0.5 - 1:1:1:0.6; and (2) reverse phase purification: reverse phase excipients in C18 and C8 columns eluting with a gradient of methanol:acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent can be removed immediately to provide a crude product of the compound represented by formula (313) that can be used directly in the following reactions.

[139] In some embodiments, a compound represented by formula (314) can be prepared by contacting a compound represented by formula (315) with haloacetic acid under deprotection reaction conditions in an organic solvent, followed by isolation of:

where R ₇ is selected from the group represented by formula (330), (331), (332) or (333), and in some embodiments R ₇ has the structure represented by formula (330):

where the definitions and options n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ and S ₁ are, respectively, as described above.

[140] The haloacetic acid can be selected from one or more of dichloroacetic acid, trichloroacetic acid, monochloroacetic acid, and trifluoroacetic acid, and in some embodiments it is dichloroacetic acid.

[141] Deprotection reaction conditions may include a reaction temperature of 0 to 100°C and a reaction time of 0.1 to 24 hours, and in some embodiments include a reaction temperature of 10 to 40°C and a reaction time of 0.5 up to 16 hours.

[142] In some embodiments, the organic solvent is one or more of an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments, the ethereal solvent is diethyl ether and/or methyl t-butyl ether. In some embodiments, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. The amount of organic solvent is 3-50 l/mol, and in additional embodiments 5-20 l/mol, depending on the compound represented by formula (315).

[143] The molar ratio of haloacetic acid to the compound represented by formula (315) may be from 5:1 to 100:1, and in some embodiments is from 10:1 to 50:1.

[144] Similarly, the compound represented by formula (314) can be isolated from the reaction mixture using any suitable isolation methods. In some embodiments, the compound represented by formula (314) can be isolated by removal of the solvent by evaporation and subsequent chromatography, for example, using the following two sets of chromatography conditions for isolation: (1) normal phase purification: silica gel fill with a particle size of 200 - 300 mesh with gradient elution with a mixture of dichloromethane:methanol = 100:30 - 100:40; and (2) reversed phase purification: reversed phase excipients in C18 and C8 columns eluting with a gradient of methanol:acetonitrile = 0.1:1 - 1:0.1. In some embodiments, the solvent can be removed immediately to provide a crude product of the compound represented by formula (314) that can be used directly in the following reactions.

[145] The compound represented by formula (315) can be obtained by bringing the compound represented by formula (317) into contact with the compound represented by formula (316) under condensation reaction conditions in the presence of an amidation reaction condensing agent and a tertiary amine in an organic solvent followed by isolation:

Formula (316)

,

,

Formula (317)

where the definitions and options n1, n3, m1, m2, m3, R ₇ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ and S ₁ are, respectively, as described above.

[146] With respect to the compound of formula (316), compounds such as those described in J. Am. Chem. soc. 2014, 136, 16958-16961. Alternatively, compounds of formula (316) may be prepared by one of ordinary skill in the art using a variety of methods. For example, some compounds of formula (316) can be obtained in accordance with the description in example 1 of US patent 8106022 B2, the entire content of which is fully incorporated into this application by reference.

[147] In some embodiments, the conditions for the condensation reaction include a reaction temperature of 0 to 100°C and a reaction time of 0.1 to 24 hours. In some embodiments, the reaction temperature is 10-40°C and the reaction time is 0.5-16 hours.

[148] The molar ratio of the compound represented by formula (316) to the compound represented by formula (317) may be from 2:1 to 10:1, and in some embodiments is from 2.5:1 to 5:1.

[149] In some embodiments, the organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments, the ethereal solvent is diethyl ether and/or methyl t-butyl ether. In some embodiments, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments, the organic solvent is acetonitrile. The amount of organic solvent may be 3-50 L/mol, and in some embodiments is 5-20 L/mol, depending on the compound represented by formula (317).

[150] In some embodiments, the condensing agent for the amidation reaction is benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate, 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizin-4(3H)-one (DEPBT), O-benzotriazoletetramethyluronium hexafluorophosphate or 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride and in further embodiments may be 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride. The molar ratio of the condensing agent for the amidation reaction to the compound represented by formula (317) may be from 2:1 to 10:1, and in some embodiments is from 2.5:1 to 5:1.

[151] The tertiary amine can be N-methylmorpholine, triethylamine, or N,N-diisopropylethylamine, and in some embodiments is N-methylmorpholine. The molar ratio of the tertiary amine to the compound represented by formula (317) may be from 3:1 to 20:1, and in some embodiments is from 5:1 to 10:1.

[152] Similarly, the compound represented by formula (315) can be isolated from the reaction mixture using any suitable isolation methods. In some embodiments, the compound represented by formula (315) is isolated by removal of the solvent by evaporation and subsequent chromatography, for example, using the following two sets of chromatography conditions for isolation: (1) normal phase purification: silica gel fill with a particle size of 200 - 300 mesh with gradient elution with a mixture of dichloromethane:methanol = 100:5 - 100:7; (2) reversed phase purification: reversed phase excipients in C18 and C8 columns with gradient elution with methanol:acetonitrile = 0.1:1 - 1:0.1. In some embodiments, the solvent is immediately removed to provide a crude product of the compound represented by formula (315) which can be used directly in the following reactions.

[153] In some embodiments, a compound of formula (317) is reacted with a sufficient amount of one compound of formula (316) in one batch to produce the desired compound of formula (315) containing identical S ₁ -L ₁ groups. In some embodiments, the compound of formula (317) is reacted in batches with various compounds of formula (316), i.e., with compounds of formula (316) containing various L ₁ and/or S ₁ that are necessary to obtain the compound formula (315) containing two or more types S ₁ and/or L ₁ . For example, 1 equivalent of a compound of formula (317) can first be contacted with 2 equivalents of a first compound of formula (316) to attach the first S ₁ -L ₁ groups to the two primary amine end groups in the compound of formula (317) and then bring into contact with (n3+n1-1) equivalents of the second compound of formula (316) to attach second S ₁ -L ₁ groups to (n3+n1-1) secondary amine groups (wherein the definition and limits of n3 and n1 are as defined above ) in the compound of formula (317).

[154] In some embodiments, a compound represented by formula (317) can be prepared by contacting a compound represented by formula (318) with an aqueous solution of methylamine under deprotection reaction conditions in the presence of an organic solvent, followed by isolation of:

,

,

Formula (318)

where the definitions and options n1, n3, m1, m2, m3, R ₇ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ , respectively, such as described above.

[155] Deprotection reaction conditions may include a reaction temperature of 0 to 150°C and a reaction time of 5 to 72 hours, and in some embodiments include a reaction temperature of 20 to 80°C and a reaction time of 10 to 30 hours.

[156] The organic solvent can be selected from alcohols, in some embodiments it is one of methanol, ethanol and isopropanol, and in additional embodiments it is methanol. The amount of organic solvent may be 1-20 L/mol, and in some embodiments is 1.5-10 L/mol, depending on the compound represented by formula (318).

[157] The concentration of an aqueous solution of methylamine may be 30% to 40% by mass, and the molar ratio of methylamine to the compound represented by formula (318) may be from 10:1 to 500:1, and in some embodiments is from 50:1 up to 200:1.

[158] Similarly, the compound represented by formula (317) can be isolated from the reaction mixture using any suitable isolation methods. In some embodiments, the compound represented by formula (317) can be isolated by removal of the solvent by evaporation and subsequent chromatography, for example, using the following two sets of chromatography conditions for isolation: (1) normal phase purification: silica gel fill with a particle size of 200 - 300 mesh with gradient elution with dichloromethane:methanol:aqueous ammonia (25% by weight) = 1:1:0.05 - 1:1:0.25; and (2) reversed phase purification: reversed phase excipients in C18 and C8 columns eluting with a gradient of methanol:acetonitrile = 0.1:1 - 1:0.1. In some embodiments, the solvent can be removed immediately to provide a crude product of the compound represented by formula (317) that can be used directly in the following reactions.

[159] The compound represented by formula (318) can be prepared by contacting the compound represented by formula (319) with triphenylchloromethane (TrCl), diphenylethylphenylchloromethane, phenyldiethylphenylchloromethane, or triethylphenylchloromethane, and in some embodiments with triphenylchloromethane (TrCl) under substitution reaction conditions in presence of an organic solvent, followed by isolation:

,

,

Formula (319)

where the definitions and options n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ , respectively, such as described above.

[160] The displacement reaction conditions may include a reaction temperature of 0 to 100°C and a reaction time of 5 to 72 hours, and in some embodiments include a reaction temperature of 10 to 40°C and a reaction time of 10 to 30 hours.

[161] Triphenylchloromethane (TrCl), diphenylethylphenylchloromethane, phenyldiethylphenylchloromethane or triethylphenylchloromethane are commercially available. The molar ratio of triphenylchloromethane (TrCl), diphenylethylphenylchloromethane, phenyldiethylphenylchloromethane or triethylphenylchloromethane to the compound represented by formula (319) may be from 1:1 to 10:1, and in some embodiments is from 1:1 to 3:1.

[162] The organic solvent may be one or more of an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments, the ethereal solvent is diethyl ether and/or methyl t-butyl ether. In some embodiments, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. The amount of organic solvent may be 3-50 L/mol, and in some embodiments is 5-20 L/mol, depending on the compound represented by formula (319).

[163] Similarly, the compound represented by formula (318) can be isolated from the reaction mixture using any suitable isolation methods. In some embodiments, the compound represented by formula (318) can be isolated by removing the solvent by evaporation and subsequent chromatography, for example, using the following two sets of chromatography conditions for isolation: (1) normal phase purification: silica gel fill with a particle size of 200 - 300 mesh with gradient elution with methanol:dichloromethane = 0.01:1 - 0.5:1 or gradient elution with methanol:dichloromethane:ethyl acetate:petroleum ether = 0.1:1:1:1 - 1:1:1:1 ; and (2) reversed phase purification: reversed phase excipients in C18 and C8 columns eluting with a gradient of methanol:acetonitrile = 0.1:1 - 1:0.1. In some embodiments, the solvent can be removed immediately to provide a crude product of the compound represented by formula (318) that can be used directly in the following reactions.

[164] In some embodiments, a compound represented by formula (319) can be prepared by contacting a compound represented by formula (320) with ethyl trifluoroacetate under substitution reaction conditions in an organic solvent, followed by isolation of:

,

,

Formula (320)

where the definitions and options n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ , respectively, such as described above.

[165] In some embodiments, the organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments, the ethereal solvent is diethyl ether and/or methyl t-butyl ether. In some embodiments, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments, the organic solvent is acetonitrile. The amount of organic solvent may be 1-50 L/mol, and in some embodiments is 1-20 L/mol, depending on the compound represented by formula (320).

[166] The displacement reaction conditions may include a reaction temperature of 0 to 100°C and a reaction time of 5 to 72 hours, and in some embodiments include a reaction temperature of 10 to 40°C and a reaction time of 10 to 30 hours.

[167] The compound represented by formula (320) can be purchased from a commercial source or obtained using methods known to a person skilled in the art. For example, in the case where m1 = m2 = m3 = 3, n1 = 1, n3 = 2, while each of R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ is H, the compound represented by formula (320), available from Alfa Aesar Inc.

[168] The molar ratio of ethyl trifluoroacetate to the compound represented by formula (320) may be from 2:1 to 10:1, and in some embodiments is from 3:1 to 5:1.

[169] Similarly, the compound represented by formula (319) can be isolated from the reaction mixture using any suitable isolation methods. In some embodiments, the compound represented by formula (319) can be isolated by removal of the solvent by evaporation and subsequent chromatography, for example, using the following two sets of chromatography conditions for isolation: (1) normal phase purification: silica gel fill with a particle size of 200 - 300 mesh with gradient elution with methanol:dichloromethane = 0.01:1 - 0.5:1 or gradient elution with methanol:dichloromethane:ethyl acetate:petroleum ether = 0.1:1:1:1 - 1:1:1:1 ; and (2) reversed phase purification: reversed phase excipients in C18 and C8 columns eluting with a gradient of methanol:acetonitrile = 0.1:1 - 1:0.1. In some embodiments, the solvent can be removed immediately to provide a crude product of the compound represented by formula (319) which can be used directly in the following reactions.

conjugate

[170] In another aspect, the present application proposes a conjugate having the structure represented by formula (1):

Formula 1),

Where:

n1 is an integer from 1 to 3, and n3 is an integer from 0 to 4;

each of m1, m2, and m3 is independently an integer from 2 to 10;

each of R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ is independently selected from H, C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl and C ₁ -C ₁₀ alkoxy, and in some embodiments independently is H, methyl or ethyl;

R ₃ is an active drug, in some embodiments, includes a functional oligonucleotide;

R ₂ is a linear alkylene from 1 to 20 carbon atoms in which one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH= N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, and where R ₂ is optionally substituted with any one or more elements of the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ -C ₁₀ alkylphenyl , -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen, OH, - SH, NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkylphenyl), NH (C ₁ -C ₁₀ alkylphenyl), cyano, nitro, CO ₂ H, C (O) OC ₁ -C ₁₀ alkyl, CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), CONH(C ₁ -C ₁₀ alkyl), CONH ₂ , NHC(O)(C ₁ -C ₁₀ alkyl), NHC(O)(phenyl), N(C ₁ -C ₁₀ alkyl)C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), C (O) C ₁ -C ₁₀ alkyl, C (O) C ₁ -C ₁₀ alkylphenyl , C (O) C ₁ -C ₁₀ haloalkyl, OC (O) C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH (C ₁ -C ₁₀ alkyl), SO ₂ NH (phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl);

each L ₁ is independently a linear alkylene from 1 to 70 carbon atoms in which one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, while L ₁ optionally substituted by any one or more members of the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ - C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen, OH, -SH, NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkylphenyl), NH (C ₁ -C ₁₀ alkylphenyl), cyano, nitro, CO ₂ H, C (O) OC ₁ -C ₁₀ alkyl, CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), CONH (C ₁ -C ₁₀ alkyl), CONH ₂ , NHC (O) (C ₁ -C ₁₀ alkyl), NHC (O) (phenyl), N (C ₁ -C ₁₀ alkyl) C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), C (O) C ₁ -C ₁₀ alkyl, C (O) C ₁ - C ₁₀ alkylphenyl, C (O) C ₁ -C ₁₀ haloalkyl, OC (O) C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH (C ₁ -C ₁₀ alkyl), SO ₂ NH (phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl), and in some embodiments, L ₁ may be selected from the group consisting of A1 - A26 or any combination thereof, with the structures and definitions of A1 - A26 as above;

n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ and M ₁ are as defined above.

[171] In some embodiments, R ₂ is a linking group formed by linking the R ₄ group in the compound of formula (321) to the active drug in a reaction. In some embodiments, R ₂ is a linking group formed by linking the R ₄ group in the compound of formula (321) to a functional oligonucleotide in a reaction. In some embodiments, the R ₂ group contains both a site that binds to the N atom on the nitrogenous backbone and a site that binds to the P atom of R ₃ . In some embodiments in R ₂ , the site that binds to the N atom on the nitrogenous backbone forms an amide bond to the N atom, and the site that binds to the P atom in R ₃ forms a phosphoester bond to the P atom. In some embodiments, R ₂ is a B5, B6, B5' or B6':

представляет собой сайт, в котором группы ковалентно связаны; выбор вариантов и диапазоны q₂ описаны выше.Where

is a site where the groups are covalently linked; choice of options and ranges q ₂ described above.

[172] In some embodiments, R ₃ is a group having the structure represented by formula A59:

where E ₁ is OH, SH or BH ₂ and in some embodiments is OH or SH; and Nu is a functional oligonucleotide.

[173] As used herein, unless otherwise indicated, a "conjugating" group or molecule refers to a group or molecule that is capable of forming a covalent bond with its suitable partner, and both the conjugating group or molecule and its partner have certain functions. Accordingly, "conjugate" refers to a compound formed by the covalent bond of such a chemical molecule with its partner. In addition, an "oligonucleotide conjugate" is a compound formed by a covalently attached oligonucleotide and one or more conjugating molecules, each of which has specific functions. In some embodiments, the implementation of the conjugate described in this application is an oligonucleotide conjugate. In this context, a "conjugating molecule" may be a specific compound capable of being conjugated to an oligonucleotide through reactions, thus finally forming an oligonucleotide conjugate according to the present invention. In some embodiments, the oligonucleotide is an siRNA, hence the oligonucleotide conjugate of the present invention is an siRNA conjugate.

[174] In some embodiments, the conjugate has the structure represented by formula (3), (4), (5), (6), (7), (8), (9), (10), (11), ( 12), (13), (14), (15), (16), (17), (18), (19), (20), (21) or (22):

Formula (3)

Formula (4)

Formula (5)

Formula (6)

Formula (7)

Formula (8)

Formula (9)

Formula (10)

Formula (11)

Formula (12)

Formula (13)

Formula (14)

Formula (15)

Formula (16)

Formula (17)

Formula (18)

Formula (19)

Formula (20)

Formula (21)

.

.

Formula (22)

[175] In some embodiments, the implementation of the oligonucleotide in the oligonucleotide conjugate according to the present description is a functional oligonucleotide. A functional oligonucleotide refers to an oligonucleotide that is capable of increasing or decreasing the expression of a target gene, or leading to alternative mRNA splicing, forming a stable and specific hybrid with the target sequence using principles such as RNA activation (RNA), RNA interference (RNAi), technology antisense nucleic acids and exon skipping technology. In some embodiments, a functional oligonucleotide can also be a nucleic acid structure that provides stable and specific binding to a target protein. In addition, those skilled in the art will readily appreciate that a polynucleotide, such as an mRNA as such or fragments thereof, is also suitable for conjugate formation by conjugation with a conjugation molecule provided herein to achieve targeted delivery, such as targeted delivery to the liver, thereby regulating the expression of the protein translated from the mRNA. Thus, in this context, the scope of the term "functional oligonucleotide" may also include mRNA or its fragments.

[176] In some embodiments, a functional oligonucleotide is capable of interacting with a target sequence, thereby affecting the normal function of the target sequence molecule, for example, causing breaks or repression of mRNA translation, or alternative mRNA splicing resulting from exon skipping, etc. In some embodiments, the functional oligonucleotide is complementary to the bases in the target sequence. In some embodiments, the functional oligonucleotide is more than 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93% complementary , 94%, 95%, 96%, 97%, 98%, or 99% bases in the target sequence, or may be fully complementary to the target sequence. In some embodiments, the functional oligonucleotide may contain 1, 2, or 3 bases that are not complementary to the target sequence. In some embodiments, the functional oligonucleotide contains deoxyribonucleotides, ribonucleotides, and modified nucleotides. In some embodiments, the functional oligonucleotide is a single-stranded DNA, RNA, or DNA-RNA chimera, or a double-stranded DNA, RNA, or DNA-RNA hybrid.

[177] For this reason, in some embodiments, a functional oligonucleotide suitable for an oligonucleotide conjugate of the present invention may be one of: small interfering RNA (miRNA), miRNA, anti-miRNA (antimiR), miRNA antagonist (antagonist), mimetics miRNA, decoy oligonucleotide, immunostimulator, G-quadruplex, splicing-altering, single-stranded RNA (ssRNA), antisense nucleic acid, nucleic acid aptamer, small activating RNA (siRNA), stem-loop RNA, or DNA. WO2015/006740A2 describes a conjugate with various ligands conjugated to an oligonucleotide, said ligands being linked to the oligonucleotide by linkers. The oligonucleotide is selected from the group consisting of small interfering RNA (siRNA), miRNA, anti-miRNA (antimiR), antagonism, microRNA mimetics, oligonucleotide decoys (traps), immunostimulator, G-quadruplex, splicing-altering, single-stranded RNA (ssRNA), antisense nucleic acid (antisense), aptamer, stem-loop RNA, or DNA. These conjugates show good stability when delivering oligonucleotides in vivo. In further embodiments, a functional oligonucleotide suitable for an oligonucleotide conjugate of the present invention is the oligonucleotides described in WO2009082607A2, WO2009073809A2, or WO2015006740A2, all of which are incorporated herein by reference in their entirety.

[178] The oligonucleotide conjugate of the present invention can regulate the aberrant expression of certain genes in certain cells, such as hepatocytes, increasing the liver-targeted delivery of an active agent, such as a functional oligonucleotide, and thus improving the interaction of the functional oligonucleotide with the target sequence in these cells. . In some embodiments, said specific gene may be an endogenous gene expressed in the liver or a pathogenic gene replicated in the liver. A gene that is aberrantly expressed in hepatocytes may be a gene such as ApoB, ApoC, ANGPTL3, PCSK9, SCD1, TIMP-1, Col1A1, FVII, STAT3, p53, HBV and HCV, etc. In some embodiments, the gene that is aberrantly expressed in hepatocytes is an HBV gene, an ANGPTL3 gene, or an APOC3 gene. In the context of the present description, the HBV gene refers to a gene having the sequence presented under the accession number in Genbank NC_003977.1; the ANGPTL3 gene refers to a gene having an mRNA sequence listed under Genbank accession number NM_014495.3; and the APOC3 gene refers to a gene having an mRNA sequence listed under Genbank accession number NM_000040.1.

[179] In some embodiments, the "target sequence" is the target mRNA. As used herein, "target mRNA" refers to an mRNA corresponding to a gene that is aberrantly expressed in cells such as hepatocytes, which can be either an mRNA corresponding to an overexpressed gene or an mRNA corresponding to an underexpressed gene. In some embodiments, the target mRNA is preferably an mRNA corresponding to an overexpressed gene, since most diseases result from overexpression of an mRNA. In some embodiments of the present description, the target mRNA corresponding to the above aberrantly expressed gene may be an mRNA corresponding to a gene such as ApoB, ApoC, ANGPTL3, PCSK9, SCD1, TIMP-1, Col1A1, FVII, STAT3, p53, HBV and HCV, etc. In some embodiments, the target mRNA may be mRNA transcribed from an appropriate HBV gene, ANGPTL3 gene, or APOC3 gene.

[180] The P atom in formula A59 can be linked to any possible position in the oligonucleotide sequence, for example, to any nucleotide of the oligonucleotide. In some embodiments, the functional oligonucleotide in an oligonucleotide conjugate as described herein is a single stranded oligonucleotide (eg, a single stranded RNA or an aptamer). In this case, the P atom in formula A59 may be linked to the end portion of the single stranded oligonucleotide, which refers to the 4 nucleotides closest to one end of the single stranded oligonucleotide. In some embodiments, the P atom in Formula A59 is linked to any ring of a single stranded oligonucleotide.

[181] In some embodiments, the functional oligonucleotide in an oligonucleotide conjugate as described herein is a double-stranded oligonucleotide (eg, siRNA, miRNA, or DNA) containing a sense strand and an antisense strand. In some embodiments, the P atom in Formula A59 may be linked to the end of the sense strand or antisense strand in a double stranded oligonucleotide that refers to the 4 nucleotides closest to one end of the sense or antisense strand. In some embodiments, the P atom in formula A59 is linked to any ring of the sense or antisense strand. In some embodiments, the P atom in Formula A59 is linked to the 3' end of the sense strand. In the case where the P atom in formula A59 is linked to the above position in the sense strand of the double-stranded oligonucleotide, the oligonucleotide conjugate provided herein can release the distinct antisense strand of the double-stranded oligonucleotide during unwinding after cell entry, thereby blocking translation of the target mRNA into protein and inhibiting the expression of a particular gene.

[182] The P atom in formula A59 can be linked to any possible nucleotide position in the oligonucleotide sequence, such as the 5', 2', or 3' position, or to the base of the nucleotide. In some embodiments, the P atom in Formula A59 may be linked to the 2', 3', or 5' position of a nucleotide in the oligonucleotide sequence by forming a phosphodiester bond. In some embodiments, the P atom in formula A59 is linked to an oxygen atom formed after deprotonation of the 3'-hydroxy group of a nucleotide at the 3'-end of the sense strand in a double-stranded oligonucleotide sequence, or linked to a nucleotide by replacing a hydrogen atom in the 2'-hydroxy- nucleotide group of the sense strand, or by substituting a hydrogen atom in the 5'-hydroxy group of the nucleotide at the 5' end of the sense strand in a double-stranded oligonucleotide sequence.

[183] Without limitation, the present invention is described in further detail in the following embodiments and examples with respect to exemplary embodiments in which the functional oligonucleotide in the oligonucleotide conjugate of the present disclosure is small interfering RNA (siRNA). In this case, the oligonucleotide conjugate of the present invention is an siRNA conjugate. In the context of the present description, siRNA conjugates in these embodiments are also referred to as siRNA conjugates of the present invention for convenience of description only. It is not implied that the oligonucleotide in the oligonucleotide conjugate according to the present invention can be only siRNA, on the contrary, the oligonucleotide and even the active drug can be additional alternatives described in this application or known to the specialist. It is expected that, based on the detailed description of the siRNA conjugate, other active drugs or functional oligonucleotides will act similarly when conjugated to the conjugating molecules proposed in this application.

[184] Specialists in this field know that miRNA contains nucleotide groups as structural units. The nucleotide group, in turn, contains a phosphate group, a ribose group, and a base. Typically, an active siRNA, ie, a functional siRNA, can be about 12-40 nucleotides long, and in some embodiments, it is about 15-30 nucleotides long. Each nucleotide in an siRNA can independently be a modified or unmodified nucleotide. For increased stability, at least one nucleotide in the siRNA is a modified nucleotide.

[185] The present inventors have found that the siRNAs described in the following embodiments exhibit higher activity and/or stability and therefore can be used as siRNAs for the purposes described herein.

[186] In some embodiments, each nucleotide in an siRNA of an siRNA conjugate as described herein (hereinafter also referred to as siRNA as described herein) is independently a modified or unmodified nucleotide. Said siRNA contains a sense strand and an antisense strand, wherein the sense strand contains nucleotide sequence 1 and the antisense strand contains nucleotide sequence 2. Both nucleotide sequence 1 and nucleotide sequence 2 are 10, 11, 12, 13, 14, 15, 16 in length. , 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, and are at least partially reversely complementary to form a double-stranded complementary region. The nucleotide sequence 2 is complementary to the first fragment of the nucleotide sequence, which refers to the fragment of the nucleotide sequence in the target mRNA.

[187] In some embodiments, an siRNA as described herein refers to an siRNA capable of inhibiting at least 50% of HBV gene expression, at least 50% of ANGPTL3 gene expression, or at least 50% of APOC3 gene expression at a concentration of 3 mg/kg. In some embodiments, an siRNA as described herein refers to an siRNA capable of inhibiting at least 55%, 60%, 65%, 70%, 75%, or 80% of HBV gene, ANGPTL3 gene, or APOC3 gene expression at a concentration of 3 mg/kg.

[188] In some embodiments, nucleotide sequence 1 is the same length and differs by no more than 3 nucleotides from the first fragment of the nucleotide sequence; nucleotide sequence 2 has the same length and differs by no more than 3 nucleotides from nucleotide sequence B, which refers to a nucleotide sequence that is fully inversely complementary to the first fragment of the nucleotide sequence. Without wishing to be bound by any theory, these particular nucleotide differences will not significantly reduce the repressive power of the siRNA conjugate and are therefore within the scope of this disclosure.

[189] In some embodiments, nucleotide sequence 1 is substantially reversely complementary, substantially reversely complementary, or fully reversely complementary to nucleotide sequence 2.

[190] In some embodiments, nucleotide sequence 1 contains no more than 1 nucleotide different from the first fragment of the nucleotide sequence; and/or nucleotide sequence 2 contains at most 1 nucleotide different from nucleotide sequence B. In some embodiments, nucleotide differences between nucleotide sequence 2 and nucleotide sequence B include a difference in the position of the first nucleotide Z' in nucleotide sequence 2 from the 5' end towards the 3' end. In some embodiments, the last nucleotide Z in nucleotide sequence 1 5' to 3' is a nucleotide complementary to Z'.

[191] In some embodiments, the sense strand also contains the nucleotide sequence 3, and the antisense strand also contains the nucleotide sequence 4. The nucleotide sequences 3 and 4 are the same length of 1-4 nucleotides. The nucleotide sequence 3 is linked to the 5' end of the nucleotide sequence 1 and the nucleotide sequence 4 is linked to the 3' end of the nucleotide sequence 2. The nucleotide sequence 4 is complementary to the second nucleotide sequence fragment, which refers to the nucleotide sequence adjacent to the first nucleotide sequence fragment and having the same length as nucleotide sequence 4 in the target mRNA. In some embodiments, nucleotide sequence 3 is substantially reverse complementary or fully reverse complementary to nucleotide sequence 4. Therefore, in some embodiments, the sense strand and antisense strand may be 19-23 nucleotides in length.

[192] In some embodiments, the siRNA of the present disclosure also contains a nucleotide sequence of 5, which is 1-3 nucleotides in length and linked to the 3' end of the antisense strand, thus forming the 3' overhang of the antisense strand. In some embodiments, the nucleotide sequence 5 is 1 or 2 nucleotides long. Therefore, in some embodiments, the ratio of the length of the sense strand to the length of the antisense strand in siRNA according to the present description may be 19/20, 19/21, 20/21, 20/22, 21/22, 21/23, 22/23, 22/ 24, 23/24 or 23/25.

[193] In some embodiments, the length of the nucleotide sequence 5 is 2 nucleotides. Moreover, the nucleotide sequence 5 is 2 consecutive thymidine deoxynucleotides or 2 consecutive uridine deoxynucleotides in the 5' to 3' direction, or is complementary to the third fragment of the nucleotide sequence, which refers to the nucleotide sequence adjacent to the first or second fragment nucleotide sequence in the target mRNA and having the same length as nucleotide sequence 5. In some embodiments, the ratio of sense strand length to antisense strand in siRNA as described herein is 19/21 or 21/23. Here, the siRNA according to the present disclosure exhibits significant silencing activity directed at mRNA in hepatocytes.

[194] In some embodiments, each of the nucleotides in an siRNA as described herein is independently a modified or unmodified nucleotide. In some embodiments, an siRNA as described herein does not contain modified nucleotides. In some embodiments, the siRNA according to the present description contains a modified nucleotide group.

[195] To date, there are many tools in the art that can be used to modify siRNAs, including backbone modification (or internucleotide bond modification such as phosphate group modification), ribose group modification, base modification, etc. (See, for example, Watts, J.K., G.F. Deleavey and M.J.Damha, Chemically Modified siRNA: tools and applications. Drug Discov Today, 2008,13(19-20): pp. 842-55, which is incorporated herein in its entirety by links).

[196] As used herein, the term "modified nucleotide" as used herein includes a nucleotide in which the ribose group is modified, such as nucleotides formed by substitution of the 2'-hydroxy group of the ribose group with other groups, a nucleotide analog, or a nucleotide with a modified basis.

[197] In some embodiments, according to the present description, at least one nucleotide in the sense or antisense strand is a modified nucleotide, and/or at least one phosphate is a phosphate group with modified groups. In other words, at least a portion of the phosphate and/or ribose group in the ribose phosphate backbone of at least one single strand of the sense strand and the antisense strand is a phosphate and/or ribose group with modified groups (or modified phosphate and/or modified ribose). In some embodiments as described herein, all nucleotides in the sense strand and/or antisense strand are modified nucleotides.

[198] In some embodiments, each nucleotide in the sense strand and antisense strand is independently a fluorine-modified nucleotide or a non-fluorine-modified nucleotide.

[199] "Fluorine-modified (fluorine-modified) nucleotide" refers to a nucleotide formed by substitution of a 2'-hydroxy group of a ribose group with fluorine as represented in formula (207).

[200] "Non-fluorine-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxy group of a ribose group with a non-fluorine group, or a nucleotide analog. In some embodiments, each non-fluorine-modified nucleotide is independently a nucleotide formed by replacing the 2'-hydroxy group of its ribose group with a non-fluorine-containing group or a nucleotide analog.

[201] The nucleotide formed by replacing the 2'-hydroxy group of a ribose group with a non-fluoro group is well known in the art, for example, 2'-alkoxy-modified nucleotides, 2'-alkoxy-substituted nucleotides, 2'-alkyl modified nucleotides, 2'-alkyl substituted nucleotides, 2'-amine modified nucleotides, 2'-amine substituted nucleotides or 2'-deoxynucleotides.

[202] In some embodiments, the 2′-alkoxy-modified nucleotide is a methoxy-modified nucleotide represented by formula (208). In some embodiments, the substituted 2'-alkoxy-modified nucleotide is a 2'-O-methoxyethoxy-modified nucleotide represented by formula (209). In some embodiments, the 2'-amine modified nucleotide is represented by formula (210). In some embodiments, the 2'-deoxynucleotide (DNA) is represented by formula (211).

[203] "A nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid and is different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. In some embodiments, a nucleotide analog may be an isonucleotide, a bridged nucleic acid (BNA) nucleotide, or an acyclic nucleotide.

[204] A MNC nucleotide is a nucleotide that is conformationally restricted or unavailable. MNCs can contain a bridge structure with a 5-, 6-membered or even 7-membered ring with a "fixed" C3'-endo deviation from the plane of the sugar ring. The bridge is usually located between the 2' and 4' positions of the ribose ring to form a 2', 4'-MNA nucleotide, such as a locked nucleic acid (LNA), an ethylene-bridged nucleic acid (ENA), and an ethyl-restricted MNA (oET), which are represented by formulas (212), (213) and (214), respectively.

[205] An acyclic nucleotide is a nucleotide in which the ribose ring is open, such as an unlocked nucleic acid (NNA) nucleotide and a glycerol nucleic acid (GNA) nucleotide, which are respectively represented by formulas (215) and (216).

where R represents H, OH or alkoxy (O-alkyl).

[206] An isonucleotide is a nucleotide in which the position of the base on the ribose ring changes, for example, a compound in which the base is moved from 1' to 2' or 3' on the ribose ring, represented by formulas (217) or (218), respectively.

where the base is the base of the nucleic acid A, U, G, C or T; R is H, OH, F, or a non-fluoro group as described above.

[207] In some embodiments, the nucleotide analog is an isonucleotide, LNA, NNA, oET, NNA, or GNA. In some embodiments, each non-fluoro-modified nucleotide is a methoxy-modified nucleotide, which refers to a nucleotide formed by replacing the 2'-hydroxy group of a ribose group with a methoxy group.

[208] As used herein, "a fluorine-modified (fluorine-modified) nucleotide", "a 2'-fluorine-modified nucleotide", "a nucleotide in which the 2'-hydroxy group of the ribose group is replaced by fluorine", and "a nucleotide with a 2'-fluorine fluororibosyl" have the same meanings as a nucleotide in which the 2'-hydroxy group of the nucleotide is substituted with fluorine to form the structure represented by formula (207). "Methoxy-modified nucleotide", "2'-methoxy-modified nucleotide", "nucleotide in which the 2'-hydroxy group of the ribose group is replaced by a methoxy group", and "nucleotide with 2'-methoxyribosyl" have the same meanings. , which is the same as the nucleotide in which the 2'-hydroxy group of the ribose group in the nucleotide is replaced by a methoxy group to form the structure represented by formula (208).

[209] In some embodiments, an siRNA as described herein is an siRNA with the following modifications: in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 of nucleotide sequence 1 in the siRNA sense strand are fluorine-modified ( non-fluorine-modified) nucleotides, and nucleotides at other positions in the sense strand are methoxy-modified nucleotides; and/or the nucleotides at positions 2, 6, 14 and 16 of nucleotide sequence 2 in the antisense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides. In some embodiments, an siRNA according to the present disclosure is an siRNA with the following modifications: in the 5' to 3' direction, the nucleotides at positions 5, 7, 8, and 9 of nucleotide sequence 1 in the siRNA sense strand are fluorine-modified nucleotides, and nucleotides at other positions in the sense strand are methoxy-modified nucleotides; and/or the nucleotides at positions 2, 6, 8, 9, 14 and 16 of the nucleotide sequence 2 in the antisense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are 2'-methoxy-modified nucleotides. In some embodiments, an siRNA as described herein is an siRNA with the following modifications: in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 of nucleotide sequence 1 in the siRNA sense strand are fluorine-modified nucleotides, and the nucleotides in other positions in the sense chain, they are methoxy-modified nucleotides; and/or in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence 2 in the antisense strand of the miRNA are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified - group of nucleotides.

[210] In some embodiments of miRNAs as described herein, the nucleotide contains modifications on phosphate groups. As used herein, the modification on the phosphate group, in some embodiments, is a phosphorothioate modification represented by formula (201) below, that is, the replacement of a non-bridging oxygen atom in a phosphodiester bond with a sulfur atom such that the phosphodiester bond changes to a phosphorothioate-diester bond. In some embodiments, this modification stabilizes the siRNA structure and retains high specificity and high base pairing affinity.

(201)

[211] According to some embodiments of the present description, in miRNA, the phosphorothioate bond is present at at least one of the following positions: between the first and second nucleotides from either end of the sense or antisense strand, between the second and third nucleotides from either end of the sense strand or antisense strand , or any combination of them. In some embodiments, the phosphorothioate bond is present at all of the above positions except for the 5' end of the sense strand. In some embodiments, the phosphorothioate bond is present at all of the above positions except for the 3' end of the sense strand. In some embodiments, the phosphorothioate bond is present at at least one of the following positions:

- between the first and second nucleotides from the 5' end of the sense chain;

- between the second and third nucleotides from the 5' end of the sense chain;

- between the first and second nucleotides from the 3'-end of the sense chain;

- between the second and third nucleotides from the 3' end of the sense chain;

- between the first and second nucleotides from the 5' end of the antisense strand;

- between the second and third nucleotides from the 5' end of the antisense strand;

- between the first and second nucleotides from the 3' end of the antisense strand; And

- between the second and third nucleotides from the 3' end of the antisense strand.

[212] According to some embodiments of the present description, the 5'-terminal nucleotide in the sequence of the antisense strand of the siRNA molecule is a nucleotide with a 5'-phosphate or a modified nucleotide with a 5'-phosphate analog.

[213] In some embodiments, the 5'-phosphate nucleotide has the following structure represented by formula (202):

Common types of 5'-phosphate analog modified nucleotides are well known to those skilled in the art, such as the following 4 nucleotides represented by formulas (203) to (206) described in Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3): 238-48:

where R is a group selected from the group consisting of H, OH, F and methoxy;

[214] "base" is a base selected from A, U, C, G, or T.

[215] In some embodiments, the 5'-phosphate nucleotide or 5'-phosphate analog-modified nucleotide is a vinyl phosphate (VP) modified nucleotide represented by formula (203), a 5'-phosphate nucleotide represented by formula (202), or a 5'-phosphorothioate-modified nucleotide represented by formula (205).

[216] The present inventors surprisingly found that the siRNA conjugate of the present disclosure exhibits significantly improved serum stability while the silencing activity of the target mRNA is not significantly impaired, resulting in an excellent in vivo inhibitory effect on gene expression. The in vivo delivery of these siRNA conjugates as described herein has been shown to be more efficient. According to some variants of implementation of the present description, the oligonucleotide conjugates according to the present description, therefore, are siRNA conjugates containing such siRNAs, which are presented in table 1A - table 1F.

Table 1. miRNA sequences.

Table 1A.

No. Sequence direction 5' - 3' SEQID NO siHBa1 *WITH CCUUGAGGCAUACUUCAAAA 1 AC UUUGAAGUAUGCCUCAAGGUU 2 siHBa2 WITH GACCUUGAGGCAUACUUCAAAA 3 AC UUUGAAGUAUGCCUCAAGGUCGG 4 siHBa1M1 WITH CmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 5 AC UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmUm 6 siHBa1M2 WITH CmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 7 AC UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmUm 8 siHBa2M1 WITH GmAmCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 9 AC UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmGmGm 10 siHBa2M2 WITH GmAmCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm eleven AC UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmGmGm 12 siHBa1M1S WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 14 siHBa1M2S WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 15 AC UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm 16 siHBa2M1S WITH GmsAmsCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 17 AC UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm 18 siHBa2M2S WITH GmsAmsCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 19 AC UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm 20 siHBa1M1P1 WITH CmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 5 AC P1-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmUm 21 siHBa1M2P1 WITH CmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 7 AC P1-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmUm 22 siHBa2M1P1 WITH GmAmCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 9 AC P1-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmGmGm 23 siHBa2M2P1 WITH GmAmCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm eleven AC P1-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmGmGm 24 siHBa1M1SP1 WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC P1-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 25 siHBa1M2SP1 WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 15 AC P1-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm 26 siHBa2M1SP1 WITH GmsAmsCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 17 AC P1-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm 27 siHBa2M2SP1 WITH GmsAmsCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 19 AC P1-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm 28

Table 1B

No. Sequence direction 5' - 3' SEQID NO siHBb1 WITH UGCUAUGCCUCAUCUUCUA 29 AC UAGAAGAUGAGGCAUAGCAGC thirty siHBb2 WITH UGCUAUGCCUCAUCUUCUA 29 AC UAGAAGAUGAGGCAUAGCAUU 31 siHBb1M1 WITH UmGmCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 32 AC UmAfGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmGmCm 33 siHBb2M1 WITH UmGmCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 32 AC UmAfGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmUmUm 34 siHBb1M2 WITH UmGmCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 35 AC UmAfGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmGmCm 36 siHBb2M2 WITH UmGmCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 35 AC UmAfGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmUmUm 37 siHBb1M1S WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsGmsCm 39 siHBb2M1S WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 40 siHBb1M2S WITH UmsGmsCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 41 AC UmsAfsGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmsGmsCm 42 siHBb2M2S WITH UmsGmsCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 41 AC UmsAfsGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmsUmsUm 43 siHBb1M1P1 WITH UmGmCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 32 AC P1-UmAfGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmGmCm 44 siHBb2M1P1 WITH UmGmCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 32 AC P1-UmAfGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmUmUm 45 siHBb1M2P1 WITH UmGmCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 35 AC P1-UmAfGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmGmCm 46 siHBb2M2P1 WITH UmGmCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 35 AC P1-UmAfGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmUmUm 47 siHBb1M1SP1 WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC P1-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsGmsCm 48 siHBb2M1SP1 WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC P1-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 49 siHBb1M2SP1 WITH UmsGmsCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 41 AC P1-UmsAfsGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmsGmsCm 50 siHBb2M2SP1 WITH UmsGmsCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 41 AC P1-UmsAfsGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmsUmsUm 51

Table 1C

No. Sequence direction 5' - 3' SEQID NO siHBc1 WITH UCUGUGCCUUCUCAUCUGA 52 AC UCAGAUGAGAAGGCACAGACG 53 siHBc1M1 WITH UmCmUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 54 AC UmCfAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmCmGm 55 siHBc1M2 WITH UmCmUmGmUfGmCfCfUfUmCmUmCmAmUmCmUmGmAm 56 AC UmCfAmGmAmUfGmAfGfAmAmGmGmCfAmCfAmGmAmCmGm 57 siHBc1M1S WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 59 siHBc1M2S WITH UmsCmsUmGmUfGmCfCfUfUmCmUmCmAmUmCmUmGmAm 60 AC UmsCfsAmGmAmUfGmAfGfAmAmGmGmCfAmCfAmGmAmsCmsGm 61 siHBc1M1P1 WITH UmCmUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 54 AC P1-UmCfAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmCmGm 62 siHBc1M2P1 WITH UmCmUmGmUfGmCfCfUfUmCmUmCmAmUmCmUmGmAm 56 AC P1-UmCfAmGmAmUfGmAfGfAmAmGmGmCfAmCfAmGmAmCmGm 63 siHBc1M1SP1 WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC P1-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 64 siHBc1M2SP1 WITH UmsCmsUmGmUfGmCfCfUfUmCmUmCmAmUmCmUmGmAm 60 AC P1-UmsCfsAmGmAmUfGmAfGfAmAmGmGmCfAmCfAmGmAmsCmsGm 65

Table 1D

No. Sequence direction 5' - 3' SEQID NO siHBd1 WITH CGUGUGCACUUCGCUUCAA 66 AC UUGAAGCGAAGUGCACACGGU 67 siHBd1M1 WITH CmGmUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 68 AC UmUfGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmGmUm 69 siHBd1M2 WITH CmGmUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm 70 AC UmUfGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmGmUm 71 siHBd1M1S WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 73 siHBd1M2S WITH CmsGmsUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm 74 AC UmsUfsGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmsGmsUm 75 siHBd1M1P1 WITH CmGmUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 68 AC P1-UmUfGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmGmUm 76 siHBd1M2P1 WITH CmGmUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm 70 AC P1-UmUfGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmGmUm 77 siHBd1M1SP1 WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC P1-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 78 siHBd1M2SP1 WITH CmsGmsUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm 74 AC P1-UmsUfsGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmsGmsUm 79

Table 1E

No. Sequence direction 5' - 3' SEQID NO siAN1 WITH CCAAGAGCACCAAGAACUA 80 AC UAGUUCUUGGUGCUCUUGGCU 81 siAN2 WITH AGCCAAGAGCACCAAGAACUA 82 AC UAGUUCUUGGUGCUCUUGGCUUG 83 siAN1M1 WITH CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 84 AC UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUm 85 siAN2M1 WITH AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 86 AC UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUmUmGm 87 siAN1M2 WITH CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 84 AC UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm 88 siAN2M2 WITH AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 86 AC UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmUmGm 89 siAN1M3 WITH CmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 90 AC UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm 88 siAN2M3 WITH AmGmCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 91 AC UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmUmGm 89 siAN1M1S WITH CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 92 AC UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmsCmsUm 93 siAN2M1S WITH AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 94 AC UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 95 siAN1M2S WITH CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 92 AC UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 96 siAN2M2S WITH AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 94 AC UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 97 siAN1M3S WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 96 siAN2M3S WITH AmsGmsCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 99 AC UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 97 siAN1M1P1 WITH CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 84 AC P1-UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUm 100 siAN2M1P1 WITH AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 86 AC P1-UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUmUmGm 101 siAN1M2P1 WITH CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 84 AC P1-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm 102 siAN2M2P1 WITH AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 86 AC P1-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmUmGm 103 siAN1M3P1 WITH CmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 90 AC P1-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm 102 siAN2M3P1 WITH AmGmCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 91 AC P1-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmUmGm 103 siAN1M1SP1 WITH CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 92 AC P1-UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmsCmsUm 104 siAN2M1SP1 WITH AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 94 AC P1-UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 105 siAN1M2SP1 WITH CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 92 AC P1-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 106 siAN2M2SP1 WITH AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 94 AC P1-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 107 siAN1M3SP1 WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC P1-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 106 siAN2M3SP1 WITH AmsGmsCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 99 AC P1-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 107

Table 1F

No. Sequence direction 5' - 3' SEQID NO siAP1 WITH CAAUAAAGCUGGACAAGAA 108 AC UUCUUGUCCAGCUUUAUUGGG 109 siAP2 WITH CCCAAUAAAGCUGGACAAGAA 110 AC UUCUUGUCCAGCUUUAUUGGGAG 111 siAP1M1 WITH CmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 112 AC UmUfCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGm 113 siAP2M1 WITH CmCmCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 114 AC UmUfCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGmAmGm 115 siAP1M2 WITH CmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 116 AC UmUfCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGm 117 siAP2M2 WITH CmCmCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 118 AC UmUfCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmAmGm 119 siAP1M1S WITH CmsAmsAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 120 AC UmsUfsCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmsGmsGm 121 siAP2M1S WITH CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 122 AC UmsUfsCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm 123 siAP1M2S WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 125 siAP2M2S WITH CmsCmsCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 126 AC UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm 127 siAP1M1P1 WITH CmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 112 AC P1-UmUfCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGm 128 siAP2M1P1 WITH CmCmCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 114 AC P1-UmUfCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGmAmGm 129 siAP1M2P1 WITH CmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 116 AC P1-UmUfCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGm 130 siAP2M2P1 WITH CmCmCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 118 AC P1-UmUfCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmAmGm 131 siAP1M1SP1 WITH CmsAmsAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 120 AC P1-UmsUfsCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmsGmsGm 132 siAP2M1SP1 WITH CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 122 AC P1-UmsUfsCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm 133 siAP1M2SP1 WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC P1-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 134 siAP2M2SP1 WITH CmsCmsCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 126 AC P1-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm 135

*С: semantic chain; AS: antisense strand

[217] In the above tables, the capital letters C, G, U, and A indicate the composition of the bases in the nucleotides; a lowercase m indicates that the nucleotide adjacent to the left of the m is a 2'-methoxy-modified nucleotide; a lowercase f indicates that the nucleotide adjacent to the left of f is a 2'-fluorine-modified nucleotide; a lowercase s indicates a phosphorothioate bond between two nucleotides adjacent on both sides of the s; P1 indicates that the nucleotide adjacent to the right of P1 is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide, and in some embodiments is a vinyl phosphate modified nucleotide (designated VP in the examples below) modified with phosphate a nucleotide (denoted P in the examples below) or a phosphorothioate modified nucleotide (denoted Ps in the examples below).

[218] It is well known to those skilled in the art that a modified nucleotide group can be incorporated into an siRNA as described herein via the nucleoside monomer with appropriate modification. Methods for obtaining a nucleoside monomer containing the appropriate modification and introducing the modified nucleotide group into siRNA are also well known to those skilled in the art. The modified nucleoside monomers are either commercially available or can be prepared using known methods.

Obtaining oligonucleotide conjugates.

[219] Oligonucleotide conjugates according to the present description can be obtained using any suitable synthetic routes. For example, an oligonucleotide conjugate of the present invention can be prepared by a method comprising sequentially joining nucleoside monomers in a 3' to 5' direction according to the nucleotide type and oligonucleotide sequence, respectively, under the conditions of solid phase phosphoramidite synthesis, wherein the attachment of each nucleoside monomer comprises four-step reaction: deprotection, coupling, capping and oxidation or sulfonation. In some embodiments, said method further comprises contacting a compound represented by formula (321) with a nucleoside monomer or nucleotide sequence bound to a solid phase support under coupling reaction conditions in the presence of a coupling agent, thereby binding the compound represented by formula (321 ), with the nucleotide sequence through a coupling reaction.

[220] In some embodiments, said method further includes the step of deprotection and cleavage from the solid phase support, isolation, and purification.

[221] In some embodiments, the oligonucleotide is a double-stranded oligonucleotide and the method of preparation includes the steps of: contacting a compound represented by formula (321) with a nucleoside monomer at the 3' end of the sense or antisense strand under coupling reaction conditions in the presence of an agent coupling reactions, thereby linking the compound represented by formula (321) to the first nucleotide in the sequence, the 3' to 5' sequence of nucleoside monomers to synthesize the sense or antisense strand of a double-stranded oligonucleotide, where the compound of formula (321) is a compound, wherein R ₄ has a protected hydroxy group as a first functional group and a group represented by formula (C1') or (C3') as a second functional group, the compound of formula (321) is deprotected prior to coupling with the first nucleoside monomer, and said addition of each nucleoside monomer includes a four-step reaction: deprotection, coupling, capping, and oxidation or sulfonation, thereby producing a sense or antisense strand associated with the conjugating molecule; sequential connection of nucleoside monomers from 3' to 5' to synthesize another strand of a double-stranded oligonucleotide, and the addition of each nucleoside monomer includes a four-step reaction: deprotection, connection, capping and oxidation or sulfonation; deprotection and cleavage from the solid phase support; obtaining a sense strand and an antisense strand by isolation and purification; and annealing.

[222] In some embodiments, the oligonucleotide is a double-stranded oligonucleotide, and the method of preparation includes the following steps: sequential connection of nucleoside monomers from 3' to 5', to synthesize the sense strand and antisense strand of the double-stranded oligonucleotide, the attachment of each nucleoside monomer includes a four-step reaction: removal protecting groups, coupling, capping and oxidation or sulfonation, thus obtaining a sense strand associated with the solid phase support and an antisense strand associated with the solid phase support; contacting a compound represented by formula (321) with a sense strand associated with a solid phase support or an antisense strand associated with a solid phase support under coupling reaction conditions in the presence of a coupling agent, thereby binding the compound represented by formula (321), with a sense or antisense chain, where the compound of formula (321) is a compound in which R ₄ includes a phosphoramidite group as the first functional group; deprotection and cleavage from the solid phase support, obtaining the sense strand and antisense strand of the oligonucleotide by isolation and purification, and annealing the sense or antisense strand of the oligonucleotide to the conjugating molecule.

[223] In some embodiments, the P atom in formula A59 is linked to the 3' end of the sense strand in the siRNA, and the method for preparing the siRNA conjugate as described herein includes:

(1) removing the protecting group R _k in the compound of formula (321) associated with a solid phase support as described above (hereinafter also referred to as an L-conjugating molecule associated with a solid phase support); contacting an L-conjugating molecule bound to the solid phase support with a nucleoside monomer to obtain a nucleoside monomer bound to the solid-phase support by the L-conjugating molecule under coupling reaction conditions in the presence of a coupling agent;

(2) synthesizing the sense strand of the siRNA from 3' to 5' by the phosphoramidite solid phase synthesis method, starting from the nucleoside monomer bound to the solid phase support by an L-conjugating molecule;

(3) synthesis of the antisense strand of miRNA by the phosphoramidite method of solid phase synthesis; And

(4) isolating the sense strand and the antisense strand of the siRNA and annealing it to obtain an siRNA conjugate as described herein.

[224] Moreover, in step (1), the method for removing the protecting group R _k from an L-conjugating molecule binding to a solid phase support comprises contacting a compound of formula (321) with a deprotecting agent under deprotection reaction conditions. Deprotection reaction conditions include a temperature of 0 to 50°C, and in some embodiments, 15 to 35°C, and a reaction time of 30 to 300 seconds, and in some embodiments, 50 to 150 seconds. The deprotecting agent can be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid, and in some embodiments, is dichloroacetic acid. The molar ratio of the deprotecting agent to the compound represented by formula (322) may be from 10:1 to 1000:1, and in some embodiments is from 50:1 to 500:1.

[225] The coupling reaction conditions and the coupling reaction agent may be any of the conditions and agents suitable for the coupling reaction described above. In some embodiments, the same condition and agent is used as in the coupling reaction in the applied solid phase synthesis process.

[226] In some embodiments, the coupling reaction conditions include a reaction temperature of 0 to 50°C, and in some embodiments, 15 to 35°C. The molar ratio of compound of formula (321) to nucleoside monomer can be from 1:1 to 1:50, and in some embodiments is from 1:2 to 1:5. The molar ratio of the compound of formula (322) to the coupling agent can be from 1:1 to 1:50 and in some embodiments is from 1:3 to 1:10. The reaction time may be 200-3000 seconds and in some implementations is 500-1500 seconds. The coupling agent may be selected from one or more of 1H-tetrazole, 5-ethylthio-1H-tetrazole, and 5-benzylthio-1H-tetrazole, and in some embodiments it is 5-ethylthio-1H-tetrazole. The coupling reaction can be carried out in an organic solvent. The organic solvent can be selected from one or more of anhydrous acetonitrile, anhydrous DMF, and anhydrous dichloromethane, and in some embodiments it is anhydrous acetonitrile. The amount of organic solvent may be 3-50 L/mol, and in some embodiments is 5-20 L/mol, depending on the compound represented by formula (321).

[227] In step (2), the C sense strand of the siRNA conjugate is synthesized in the 3' to 5' direction by the phosphoramidite solid phase synthesis method, starting with the nucleoside monomer bound to the solid phase support by the L-conjugate molecule obtained in the above steps. In this case, the L-conjugating molecule is linked to the 3' end of the resulting sense strand.

[228] Other conditions of the solid phase synthesis described in steps (2) and (3) include the deprotection reaction conditions for the nucleoside monomer, the type and amount of the deprotecting agent, the coupling reaction conditions, the type and amount of the coupling reaction agent, the condition capping reactions, type and amount of capping agent, oxidation reaction conditions, type and amount of oxidizing agent, sulfonation reaction conditions, and type and amount of sulfonating agent, various agents, amounts and conditions commonly used in the art are used in the present invention.

[229] In some implementations, for example, in the solid phase synthesis described in steps (2) and (3), you can use the following conditions.

[230] Deprotection reaction conditions for the nucleoside monomer include a temperature of 0 to 50°C and in some embodiments 15 to 35°C and a reaction time of 30 to 300 seconds and in some embodiments 50 to 150 seconds. The deprotecting agent can be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid, and in some embodiments, is dichloroacetic acid. The molar ratio of deprotecting agent to 4,4'-dimethoxytrityl protecting group on the solid phase support can be from 2:1 to 100:1, and in some embodiments is from 3:1 to 50:1.

[231] the Reaction conditions of the coupling include a temperature of from 0 to 50°C and in some implementations of 15 to 35°C. The molar ratio of the nucleic acid sequence bound to the solid phase support to the nucleoside monomer can be from 1:1 to 1:50, and in some embodiments is from 1:5 to 1:15. The molar ratio of the nucleic acid sequence bound to the solid phase support to the coupling agent can be from 1:1 to 1:100, and in some embodiments is from 1:50 to 1:80. The reaction time and the coupling agent are selected as described above.

[232] Capping reaction conditions include a temperature of 0 to 50°C, and in some embodiments 15 to 35°C, and a reaction time of 5 to 500 seconds, and in some embodiments 10 to 100 seconds. The capping agent is selected as described above. The molar ratio of total capping agent to nucleic acid sequence bound to the solid phase support can be from 1:100 to 100:1, and in some embodiments is from 1:10 to 10:1. When equimolar acetic anhydride and N-methylimidazole are used as the capping agent, the molar ratio of acetic anhydride, N-methylimidazole and the nucleic acid sequence bound to the solid phase support may be 1:1:10 to 10:10:1 and in some implementations is 1:1:2 - 2:2:1.

[233] Oxidation reaction conditions include a temperature of 0 to 50°C, and in some embodiments 15 to 35°C, and a reaction time of 1 to 100 seconds, and in some embodiments 5 to 50 seconds. In some embodiments, the oxidizing agent is iodine (and in additional embodiments is provided as iodine water). The molar ratio of oxidant to nucleic acid sequence bound to the solid phase support during the coupling step can be from 1:1 to 100:1, and in some embodiments is from 5:1 to 50:1. In some embodiments, the oxidation reaction is carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1 - 1:1:3. Sulfonation reaction conditions include a temperature of 0 to 50°C, and in some embodiments 15 to 35°C, and a reaction time of 50 to 2000 seconds, and in some embodiments 100 to 1000 seconds. In some embodiments, the sulfonating agent is xanthan hydride. The molar ratio of sulfonating agent to nucleic acid sequence associated with the solid phase support during the coupling step can be from 10:1 to 1000:1 and in some embodiments is from 10:1 to 500:1. In some embodiments, the sulfonation reaction is carried out in a mixed solvent of acetonitrile:pyridine = 1:3 - 3:1.

[234] According to the method proposed in this application, this method further includes the selection of the sense strand and antisense strand miRNA after connection of all nucleoside monomers and before annealing. Isolation methods are well known to those skilled in the art and generally include removing the synthesized nucleotide sequence from the solid phase support, deprotecting the bases, phosphate groups and ligands, and purifying and desalting.

[235] The synthesized nucleotide sequence can be cleaved from the solid phase support and the protecting groups on the bases, phosphate groups, and ligands removed, in accordance with conventional cleavage and deprotection techniques in siRNA synthesis. For example, the resulting nucleotide sequence associated with a solid phase support is brought into contact with concentrated aqueous ammonia; at the time of deprotection, the YCOO ^- protecting group in the A46 to A54 groups is converted into a hydroxy group, thus the S ₁ groups are converted into the corresponding M ₁ groups to obtain a conjugate represented by formula (1). In this case, concentrated aqueous ammonia may be aqueous ammonia at a concentration of 25 to 30% by weight. The amount of concentrated aqueous ammonia can be 0.2 ml/μmol - 0.8 ml/μmol in relation to the target siRNA sequence.

[236] If the synthesized nucleotide sequence has at least one 2'-TBDMS protection, said method further comprises contacting the nucleotide sequence removed from the solid phase support with triethylamine trihydrofluoride to remove the 2'-TBDMS protection. In this case, the resulting target siRNA sequence will contain a free 2'-hydroxy group in the corresponding nucleoside. The amount of pure triethylamine trihydrofluoride relative to the target siRNA sequence can be 0.4 ml/μmol - 1.0 ml/μmol. In this way, an siRNA conjugate according to the present disclosure can be obtained.

[237] Cleaning and desalting methods are well known to those skilled in the art. For example, purification of nucleic acids can be accomplished using a preparative purification column using ion exchange chromatography eluting with a gradient of NaBr or NaCl; after collection and pooling of the product, a reversed-phase chromatography purification column can be used for desalting.

[238] During the synthesis, the purity and molecular weight of the nucleic acid sequence can be determined at any time to more conveniently control the quality of the synthesis. Such methods are well known to those skilled in the art. For example, the purity of the nucleic acid can be determined using ion exchange chromatography and the molecular weight can be determined using liquid chromatography/mass spectrometry (LC/MS).

[239] Annealing techniques are also well known to those skilled in the art. For example, the synthesized sense strand (C strand) and antisense strand (AC strand) can simply be mixed in water for injection in equimolar ratios, heated to 70-95°C, and then cooled at room temperature to form a double-stranded hydrogen bond structure. Accordingly, siRNA conjugates according to the present invention can be prepared in this way.

[240] After obtaining the conjugate of the present invention, in some embodiments, the siRNA conjugate synthesized in this way can also be characterized using devices such as LC/MS devices using means such as molecular weight detection tools to confirm that the synthesized the siRNA conjugate is the designed target siRNA conjugate and the synthesized siRNA sequence is the desired siRNA sequence, eg one of the sequences listed in Table 1 above.

The use of the conjugate according to the present invention.

[241] This application describes that the conjugate can be used to deliver some active agent to a cell to treat or prevent a disease or condition that may require such delivery. Without wishing to be bound by any theory, it is believed that the spatial configuration of the conjugating molecule is particularly effective in targeting a receptor on the cell surface and therefore bringing the loaded active agent into contact with the cell. In some embodiments, such a conjugate is an oligonucleotide conjugate that targets a hepatocyte.

[242] In some embodiments, the oligonucleotide conjugate of the present invention has excellent liver targeting specificity and therefore can effectively deliver the conjugated functional oligonucleotide to the liver, thereby effectively regulating the expression of certain genes in hepatocytes. Therefore, the oligonucleotide conjugate of the present invention has a wide range of applications.

[243] In some embodiments of the present description, the use of an oligonucleotide conjugate of the present invention is provided for the preparation of a medicament for the treatment and/or prevention of pathological conditions or diseases caused by the expression of certain genes in hepatocytes. The specific gene may be an endogenous gene expressed in the liver or a pathogenic gene that has proliferated in the liver. In some embodiments, said specific genes are ApoB, ApoC, ANGPTL3, PCSK9, SCD1, TIMP-1, Col1A1, FVII, STAT3, p53, HBV, or HCV genes. In some embodiments, the specified gene is an HBV gene, an ANGPTL3 gene, or an APOC3 gene. Accordingly, the diseases are selected from chronic liver disease, hepatitis, liver fibrosis, proliferative liver diseases, and dyslipidemia. In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia, or atherosclerosis.

[244] In some embodiments, the present description provides a method of treating pathological conditions or diseases caused by the expression of certain genes in hepatocytes, comprising the introduction of an oligonucleotide conjugate according to the present invention to a subject in need of this. In some embodiments, said specific genes are ApoB, ApoC, ANGPTL3, PCSK9, SCD1, TIMP-1, Col1A1, FVII, STAT3, p53, HBV, or HCV genes. In some embodiments, the specified gene is selected from the HBV gene, the ANGPTL3 gene, and the APOC3 gene. Accordingly, the diseases are selected from chronic liver disease, hepatitis, liver fibrosis, proliferative liver diseases, and dyslipidemia. In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia, or atherosclerosis. In some embodiments, the conjugate provided herein can also be used to treat other liver diseases, including diseases characterized by unwanted cell proliferation, blood diseases, metabolic diseases, and diseases characterized by inflammation. Proliferative liver diseases can be benign or malignant diseases such as cancer, hepatocellular carcinoma (HCC), liver metastases, or hepatoblastoma. Liver hematology or inflammatory diseases may be diseases involving clotting factors, complement-mediated inflammation, or fibrosis. Metabolic liver diseases include dyslipidemia and impaired glucose regulation. In some embodiments, said method comprises administering one or more oligonucleotides having a high degree of homology to gene sequences involved in liver diseases.

[245] In some embodiments, the present disclosure provides a method for inhibiting the expression of certain genes in hepatocytes, comprising contacting an siRNA conjugate as described herein with hepatocytes.

[246] The goals of preventing and/or treating pathological conditions or diseases caused by the expression of certain genes in hepatocytes can be achieved through a mechanism for regulating gene expression by administering an oligonucleotide conjugate of the present invention to a subject in need thereof. Therefore, the oligonucleotide conjugate according to the present invention can be used to prevent and/or treat the pathological conditions or diseases described in this application, or to obtain a drug for the prevention and/or treatment of the pathological conditions or diseases described in this application.

[247] In this application, the term "administration" and its grammatical equivalents refer to the delivery of a conjugate, such as an oligonucleotide conjugate, to a subject's body by a method or route that at least partially localizes the conjugate to the desired location to obtain the desired effect. Suitable routes of administration for the methods of the present disclosure include, but are not limited to, topical administration and systemic administration. Typically, topical administration results in the delivery of more oligonucleotide conjugates to a specific site compared to the subject's systemic circulation; while systemic administration results in delivery of the oligonucleotide conjugate into the patient's systemic circulation. In some embodiments, an administration method capable of delivering drugs to the liver is used, whereas it is an object of the present invention to provide agents for the prevention and/or treatment of pathological conditions or diseases caused by the expression of certain genes in hepatocytes.

[248] Administration to a patient may be by any suitable route known in the art, including but not limited to oral and parenteral routes such as intravenous, intramuscular, subcutaneous, transdermal, intratracheal (aerosol), lungs, nasal administration, rectal administration and topical administration (including buccal administration and sublingual administration). The frequency of administration may be one or more times per day, week, two weeks, month or year.

[249] The dose of the oligonucleotide conjugate of the present invention may be a dose customary in the art, which can be determined according to various parameters, especially the age, body weight, and gender of the patient. Toxicity and efficacy can be measured in cell cultures or experimental animals using standard pharmaceutical procedures, for example, by determining the LD50 (lethal dose that causes death of 50% of the population) and ED50 (the dose that can cause 50% of the intensity of the maximum response when quantifying the response , and which elicits a positive response in 50% of experimental subjects within a qualitative response). The dose range for humans can be established based on the results obtained from the analysis of cell cultures and animal studies.

[250] When administering the conjugate of the present invention to, for example, C57BL/6J or C3H/HeNCrlVr mice, males or females aged 6-12 weeks weighing 18-25 g, to deliver an oligonucleotide conjugate formed by a functional oligonucleotide and conjugating molecules, described in this application, the amount of oligonucleotide for delivery using the conjugate can be 0.001 - 100 mg / kg body weight and in some embodiments is 0.01 - 50 mg / kg body weight, and in additional implementations is 0.05 - 20 mg/kg of body weight, and in still additional embodiments is 0.1 - 15 mg/kg of body weight, and in still additional embodiments is 0.1 - 10 mg/kg of body weight, which is calculated from the amount of oligonucleotide in the oligonucleotide conjugate . When administering the oligonucleotide conjugate of the present invention, the above amounts are preferred.

[251] In addition, the goal of inhibiting the expression of certain genes in hepatocytes can also be achieved through the mechanism of regulation of gene expression by introducing the oligonucleotide conjugate of the present invention into hepatocytes with aberrant expression of certain genes. In some embodiments, the hepatocytes are hepatitis cells, and in some embodiments, they are HepG2.2.15 cells. In some embodiments, hepatocytes can be selected from hepatoma cell lines such as Hep3B, HepG2 or Huh7 and isolated primary liver cells, and in some embodiments they are Huh7 hepatoma cells.

[252] In the case where the expression of certain genes in hepatocytes is inhibited using the method proposed in the present description, the amount of functional oligonucleotide in the proposed oligonucleotide conjugate can be easily determined by those skilled in the art depending on the desired effect. For example, in some embodiments in which the oligonucleotide conjugate is an siRNA conjugate, the amount of siRNA in the proposed siRNA conjugate is an amount sufficient to reduce target gene expression and result in an extracellular concentration of 1 pM to 1 μM, or 0, 01 nM to 100 nM, or 0.05 nM to 50 nM, or 0.05 nM to about 5 nM. The amount needed to achieve such a local concentration will vary depending on various factors, including the method of delivery, the site of delivery, the number of cell layers between the site of delivery and the target cells or tissue, the route of delivery (topical or systemic), etc. The concentration at the site of delivery may be significantly higher than that at the surface of the target cells or tissue.

Helpful actions.

[253] In some embodiments, the conjugates provided herein deliver the oligonucleotide more efficiently in vivo, exhibit lower toxicity, better stability, and/or higher activity. In some embodiments, the conjugates described herein exhibit a degree of inhibition of target gene expression of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some embodiments, the conjugates described herein exhibit a degree of inhibition of HBV gene expression of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some embodiments, the conjugates described herein exhibit a degree of inhibition of HBV gene expression in the liver of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% . In some embodiments, the conjugates described herein exhibit a degree of inhibition of HBV gene expression in the liver in animal models of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90 % or 95%. In some embodiments, the conjugates described herein exhibit a degree of inhibition of HBV gene expression in humans of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% . In some embodiments, the conjugates described herein exhibit a degree of inhibition of HBV surface antigen expression of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some embodiments, the conjugates described herein exhibit a degree of inhibition of ANGPTL3 gene expression of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some embodiments, the conjugates described herein exhibit a degree of inhibition of ANGPTL3 gene expression in the liver of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% . In some embodiments, the conjugates described herein exhibit a degree of inhibition of ANGPTL3 gene expression in the liver in animal models of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90 % or 95%. In some embodiments, the conjugates described herein exhibit a degree of inhibition of ANGPTL3 gene expression in humans of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% . In some embodiments, the conjugates described herein exhibit a degree of inhibition of APOC3 gene expression of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. In some embodiments, the conjugates described herein exhibit a degree of inhibition of APOC3 gene expression in the liver of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% . In some embodiments, the conjugates described herein exhibit a degree of inhibition of APOC3 gene expression in the liver in animal models of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90 % or 95%. In some embodiments, the conjugates described herein exhibit a degree of inhibition of APOC3 gene expression in humans of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% . In some embodiments, the conjugates described in this application do not have a significant off-target effect. A side effect may be, for example, inhibition of the expression of a gene that is not the target gene. It is considered insignificant if the level of binding/inhibition of expression of the non-target gene is less than 50%, 40%, 30%, 20%, or 10% of that for the target action.

[254] According to some embodiments of the present description, the conjugates provided herein effectively deliver siRNA to the liver, and exhibit excellent property of inhibiting HBV gene expression, for example, the degree of inhibition of 87.4% - 92.2% of HBV gene expression in the liver HBV models in mice at a dose of 1 mg/kg, along with a low level of off-target effects. In some embodiments, the conjugates of the present disclosure effectively reduce HBV surface antigen expression in a mouse model of HBV and achieve an inhibition rate of 96.9% of HBV surface antigen expression and an inhibition rate of 95.4% of HBV DNA at a dose of 3 mg/kg. In some embodiments, the conjugates provided herein have an excellent inhibitory effect on HBV expression at low doses for up to 140 days.

[255] According to one embodiment of the present invention, the conjugates provided herein effectively deliver siRNA to the liver and exhibit excellent property of inhibiting HBV gene expression, such as an inhibition rate of at least 69.3% or 78.1% - 89.1% HBV gene expression in mouse HBV liver models at 1mg/kg along with low off-target activity. In some embodiments, the conjugates of the present disclosure effectively reduce HBV surface antigen expression in a mouse model of HBV and achieve an inhibition of 98.4% of HBV surface antigen expression and an inhibition of 95.8% of HBV DNA at a dose of 3 mg/kg. In some embodiments, specific conjugates provided herein provide superior inhibitory effect on HBV expression at low doses for up to 84 days compared to reference conjugates.

[256] According to one embodiment of the present invention, the conjugates provided herein effectively deliver siRNA to the liver and exhibit excellent property of inhibiting HBV gene expression, such as an inhibition rate of at least 48.5% or 76.8% - 80.0% HBV gene expression in mouse HBV liver models at 1mg/kg along with low off-target activity. In some embodiments, the conjugates of the present disclosure also effectively reduce HBV surface antigen expression in a mouse model of HBV and achieve an inhibition rate of 84.6% of HBV surface antigen expression and an inhibition rate of 85.6% of HBV DNA, even at a dose of equal to 3 mg/kg. In some embodiments, the conjugates provided herein have a greater inhibitory effect on HBV expression at low doses over a 21 day period than the reference conjugates.

[257] According to one embodiment of the present invention, the conjugates provided herein effectively deliver siRNA to the liver and exhibit excellent property of inhibiting HBV gene expression, e.g., an inhibition rate of at least 60.1%, or in some embodiments, 80 .7% - 84.5% expression of the HBV X gene region in the liver of mouse HBV models at a dose of 1 mg/kg, along with a low level of off-target effects. In some embodiments, the conjugates of the present disclosure also effectively reduce HBV surface antigen expression in a mouse model of HBV and achieve an inhibition rate of 94.8% of HBV surface antigen expression and an inhibition rate of 95.8% of HBV DNA, even at a dose of equal to 3 mg/kg. In some embodiments, the conjugates provided herein have an excellent inhibitory effect on HBV expression at low doses for up to 56 days compared to reference conjugates.

[258] According to one embodiment of the present invention, the conjugates provided herein can effectively deliver siRNA to the liver and exhibit excellent property of inhibiting ANGPTL3 gene expression, such as an inhibition rate of at least 57.3% of ANGPTL3 gene expression in the liver. model mice fed a high fat diet at 1 mg/kg and up to 90.4% at 3 mg/kg. In some embodiments, the conjugates provided herein exhibit superior inhibition of ANGPTL3 expression and exhibit lipid-lowering effects at low doses and low frequency of administration over a period of up to 49 days compared to reference conjugates.

[259] According to one embodiment of the present invention, the conjugates provided herein efficiently deliver siRNA to the liver, and exhibit excellent property of inhibiting APOC3 gene expression, such as an inhibition rate of at least 75% of APOC3 gene expression in the liver of model mice. fed a high-fat diet at a dose of 3 mg/kg. In some embodiments, the conjugates provided herein exhibit superior blood lipid inhibitory activity at low doses and low frequency of administration over a period of up to 65 days compared to reference conjugates.

[260] In some embodiments, the conjugates provided herein exhibit low toxicity in animal models, indicating sufficient safety. For example, in some embodiments, no overt toxic response is observed even when the conjugate of the present invention is administered to C57BL/6J mice at a concentration up to 100 times the effective concentration (3 mg/kg at the effective concentration).

[261] The examples above illustrate that the conjugates provided herein are effective for targeting cell surface receptors and delivering loaded active agents to cells expressing said receptors. It is envisaged that the conjugating molecules can be adapted for additional cell surface receptors and additional active agents to target the active agents to cells expressing these receptors.

Kit.

[262] In another aspect, the present application proposes a kit containing the conjugates described above.

[263] In some embodiments, the kits provided herein contain the conjugates in a single container. In some embodiments, the kits provided herein comprise a container containing pharmaceutically acceptable excipients. In some embodiments, the kits provided herein further contain pharmaceutically acceptable excipients such as stabilizers or preservatives. In some embodiments, the kits provided herein contain at least one additional therapeutic agent. In some embodiments, the kits contain at least one additional therapeutic agent in a container other than the container containing the conjugates proposed in this application. In some embodiments, the kits contain instructions for mixing said conjugates with pharmaceutically acceptable excipients or other ingredients (if present).

[264] In the kit according to the present description, the conjugates and/or pharmaceutically acceptable excipients can be provided in any form, for example, in liquid form, in dry form, or in lyophilized form. In some embodiments, the conjugates and/or pharmaceutically acceptable excipients are substantially pure and/or sterile. In some embodiments, sterile water may be provided in kits as described herein.

Examples

[265] Hereinafter, the present invention will be described in detail using examples. Unless otherwise noted, all reagents and culture media used in the following examples are commercially available and all manipulations used, such as nucleic acid electrophoresis and real-time PCR, are performed according to the methods described in Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)).

[266] HEK293A cells were provided by the Nucleic Acid Technology Laboratory of the Molecular Medicine Institute, Peking University, and cultured in complete DMEM (Hyclone) containing 20% fetal bovine serum (EBS, Hyclone), 0.2 % about. cyanomycin, dual resistant (penicillin-streptomycin, Gibco, Invitrogen), at 37° C. in a 5% CO2/95% air incubator.

[267] Huh7 cells were purchased from the Chinese Academy of Sciences Stem Cell Bank and cultured in complete DMEM (Hyclone) containing 10% fetal bovine serum (FBS, Hyclone), 1% non-essential amino acids (NEAA, Corning), at 37 °C in a thermostat containing 5% CO2/95% air.

[268] Unless otherwise indicated, Lipofectamine ^TM 2000 (Invitrogen) was used as a transfection reagent when cells were transfected with the siRNA conjugates synthesized in Preparation Examples 12-15 described below. Specific manipulations were carried out in accordance with the instructions provided by the manufacturer.

[269] Unless otherwise indicated, all ratios of the reagents below are calculated on a volume basis (v/v).

[270] Unless otherwise indicated, the animal models used are described below.

[271] C57BL/6J mice: purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[272] SD rats: provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.

[273] HBV transgenic C57B/6N-Tg (1.28 HBV)/Vst (genotype A) mice were purchased from Beijing Vitalstar Biotechnology Co., Ltd. Mice with COI>10 ⁴ (hereinafter referred to as 1.28-copy mice for brevity) were selected prior to experiments.

[274] HBV transgenic C57BL/6J-Tg (Alb1HBV) 44Bri/J mice: purchased from Laboratory Animal Research Department, Peking University Health Science Center. Mice with S/COV>10 were selected before experiments.

[275] HBV transgenic mice: named M-TgHBV, purchased from Animal Department, Shanghai Public Health Center. Methods for obtaining transgenic mice are described by Ren, J. et al., J. Medical Virology. 2006, 78:551-560.

[276] AAV-HBV transgenic mice: Obtained according to literature method (Xiaoyan Dong et al., Chin J Biotech 2010, May 25; 26(5): 679-686) using rAAV8-1.3HBV virus, type D (ayw) (purchased from Beijing FivePlus Molecular Medicine Institute Co. Ltd., 1×10 ¹² viral genome (vg)/ml, batch number 2016123011). rAAV8-1.3HBV was diluted to 5×10 ¹¹ vg/ml with sterile PBS. 200 μl of diluted rAAV8-1.3HBV was injected into each mouse, i.e., 1×10 ¹¹ i.g. on the mouse. Blood (approximately 100 µl) was taken from the eye sockets of all mice on Day 28 post-virus injection to collect serum for HBsAg and HBV DNA detection.

[277] AAV-HBV low concentration transgenic mice: Almost the same model preparation method as described above was used, the difference was that the virus was diluted to 1 x 10 ¹¹ vg/ml with sterile PBS before the experiment. 100 μl of virus was injected into each mouse, i.e., 1×10 ¹⁰ vg. on the mouse.

[278] BALB/c mice: 6-8 weeks old, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[279] Ob/ob mice: 6-8 weeks old, purchased from Changzhou Cavens Laboratory Animal Co., Ltd.

[280] Human APOC3 transgenic mice: B6; CBA-Tg(APOC3)3707Bres/J, purchased from Jackson Lab.

[281] Monkey with metabolic syndrome: all male, provided by the Center for Non-Human Primate Research, Institute of Molecular Medicine, Peking University.

Production Example 1 Preparation of Conjugation Molecule L-9 (Conjugation Molecule 1).

[282] In this preparation example, Conjugation molecule 1 (hereinafter also referred to as Conjugation molecule L-9) was synthesized according to the following method.

(1-1) Synthesis of GAL-5 (molecules at the terminal fragment of the Conjugating molecule L-9).

(1-1a) Synthesis of GAL-2.

[283] 100.0 g GAL-1 (N-acetyl-D-galactosamine hydrochloride, CAS Registry Number: 1772-03-8, purchased from Ning Bo hongxiang bio-chem Co., Ltd., 463.8 mmol) was dissolved in 1000 ml of anhydrous pyridine, to which was added 540 ml of acetic anhydride (purchased from Enox Inc., 5565.6 mmol) in an ice bath to carry out the reaction for 1.5 hours with stirring at room temperature. The resulting reaction solution was poured into 10 L of ice water, and suction filtered under reduced pressure. The residue was washed with 2 L of ice water, and then a mixed solvent of acetonitrile/toluene (v/v acetonitrile:toluene = 1:1) was added until complete dissolution. The solvent was evaporated to give 130.0 g of GAL-2 product as a white solid.

(1-1b) Synthesis of GAL-3.

[284] GAL-2 (35.1 g, 90.0 mmol) obtained in step (1-1a) was dissolved in 213 ml of anhydrous 1,2-dichloroethane, to which was added 24.0 g of TMSOTf (CAS no.: 27607-77-8, purchased from Macklin Inc., 108.0 mmol) in an ice bath under nitrogen atmosphere to carry out the reaction overnight at room temperature.

[285] 400 ml of dichloromethane was added to the dilution reaction solution, filtered with diatomaceous earth, and then 1 L of saturated sodium bicarbonate aqueous solution was added to the resulting reaction solution and stirred evenly. The organic phase was isolated. The remaining aqueous phase was extracted twice, each time with 300 ml of dichloroethane, and all organic phases were combined and washed with 300 ml of saturated aqueous sodium bicarbonate solution and 300 ml of saturated brine, respectively. The organic phase resulting from the washing was isolated and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give 26.9 g of GAL-3 product as a light yellow viscous syrup.

(1-1c) Synthesis of GAL-4.

[286] GAL-3 (26.9 g, 81.7 mmol) obtained in step (1-1b) was dissolved in 136 ml of anhydrous 1,2-dichloroethane, 30 g of molecular sieves with a pore size of 4 Å in as a dry powder, followed by 9.0 g of 5-hexen-1-ol (CAS no: 821-41-0, purchased from Adamas-beta Inc., 89.9 mmol) and stirred for 30 minutes at room temperature . 9.08 ml TMSOTf (40.9 mmol) was added in an ice bath with nitrogen protection to carry out the reaction overnight with stirring at room temperature. The 4Å molecular sieve powder was removed by filtration. 300 ml of dichloroethane was added to the dilution filtrate, filtered with diatomaceous earth, and then 500 ml of saturated sodium bicarbonate aqueous solution was added to the resulting reaction solution and stirred for 10 minutes to wash. The organic phase was isolated. The remaining aqueous phase was extracted once with 300 ml of dichloroethane. All organic phases were combined and washed with 300 ml of saturated aqueous sodium bicarbonate and 300 ml of saturated brine, respectively. The organic phase resulting from the washing was isolated and dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to obtain 41.3 g of GAL-4 product as a yellow syrup, which was directly used in the next oxidation reaction without purification.

(1-1d) Synthesis of GAL-5.

[287] GAL-4 (14.9 g, 34.7 mmol) obtained according to the method described in step (1-1c) was dissolved in a mixed solvent of 77 ml of dichloromethane and 77 ml of acetonitrile, 103 ml of deionized water and 29.7 g of sodium periodate (CAS no: 7790-28-5, purchased from Aladdin Inc., 138.8 mmol), respectively, and stirred in an ice bath for 10 minutes. Ruthenium trichloride (CAS No: 14898-67-0, available from Energy Chemical, 238 mg, 1.145 mmol) was added to carry out the reaction overnight at room temperature. The resulting reaction solution was diluted by adding 300 ml of water, stirred, and the pH was adjusted to about 7.5 by adding saturated sodium bicarbonate. The isolated organic phase was discarded. The remaining aqueous phase was extracted three times, each time with 200 ml of dichloromethane, and the organic phase resulting from the extraction was discarded. The pH of the aqueous phase resulting from the extraction was adjusted to approximately 3 with citric acid solids and extracted three times, each time with 200 ml of dichloromethane, and the organic phases were combined and dried with anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give 6.85 g of GAL-5 product as a white foamy solid.

[288] The conjugating molecule L-9 was synthesized using the compound GAL-5 obtained in accordance with the method described above using the following technological routes:

(1-2) Synthesis of M-11-T3:

[289] J-0 (1.883 g, 10 mmol, purchased from Alfa Aesar) was dissolved in 25 ml of acetonitrile, triethylamine (4.048 g, 40 mmol) was added thereto, and cooled to 0°C in an ice bath. Ethyl trifluoroacetate (5.683 g, 40 mmol) was added to carry out the reaction for 22 hours at room temperature. The solvent was evaporated under reduced pressure, and the foamy residue was dried with a vacuum oil pump for 18 hours to give 5.342 g of crude solid M-11-T3, which was directly used in the next reaction without further purification. Mass spectrometry (MS) m/z: C15H22F9N4O3, [M+H]+, calculated: 477.35, measured: 477.65.

(1-3) Synthesis of M-11-T3-Tr:

[290] The crude product M-11-T3 (5.342 g, 10 mmol) was dissolved in 50 ml of dichloromethane. To the resulting reaction solution were added TrCl (3.345 g, 12 mmol) and triethylamine (1.518 g, 15 mmol) to carry out the reaction for 20 hours with stirring at room temperature. The reaction solution was washed twice with 20 ml of saturated sodium bicarbonate and once with 20 ml of saturated brine. The organic phase was dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure and the foamy residue was dried with a vacuum oil pump overnight to give 7.763 g of crude solid M-11-T3-Tr. MS m/z: C34H36F9N4O3, [M+Na]+, calculated: 741.25, measured: 741.53. The crude M-11-T3-Tr solid was then used in the next step to synthesize M-18-Tr without purification.

(1-4) Synthesis of M-18-Tr.

[291] The crude product M-11-T3-Tr (7.763 g, 10 mmol) obtained in step (1-3) was dissolved in 100 ml of methanol, and 100 ml of an aqueous solution of methylamine (40% by mass) was added thereto to carry out the reaction for 23 hours with stirring at 50°C. Insoluble particles were removed by filtration. The solvent was evaporated under reduced pressure, and 200 ml of a mixed solvent of dichloromethane (DCM):methanol in a 1:1 v/v ratio was added to the residue, washed with 50 ml of saturated sodium bicarbonate. The resulting aqueous phase was extracted three times, each time with 50 ml of dichloromethane. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure, the foam dried with a vacuum oil pump overnight, and purified using a 200-300 mesh normal phase silica gel column. The column was filled with petroleum ether, 1% by mass of triethylamine was added to it to neutralize the acidity of the silica gel, and it was eluted with a gradient of dichloromethane:methanol:aqueous ammonia (25% by mass) = 1:1:0.05 - 1:1:0.25. The eluate was collected, the solvent was evaporated under reduced pressure, and the residue was dried in a foamy state using a vacuum oil pump to give 2.887 g of pure product M-18-Tr. Nuclear magnetic resonance on 1H nuclei (1H NMR) (400 MHz, DMSO) δ 7.47 - 7.39 (m, 6H), 7.32 - 7.24 (m, 6H), 7.19 - 7.12 (m, 3H), 2.60 - 2.47 (m, 4H), 2.46 - 2.19 (m, 13H), 1.70 - 1.55 (m, 4H), 1.40 (p , J = 6.8 Hz, 2H). MS m/z: C28H39N4, [M+H]+, calculated: 431.65, measured: 432.61.

(1-5) Synthesis of L-5-Tr:

[292] M-18-Tr (2.02 g, 4.69 mmol) obtained from step (1-4) and GAL-5 (6.93 g, 15.48 mmol) obtained from step (1 -1) were mixed and dissolved in 47 ml of acetonitrile, and N-methylmorpholine (3.13 g, 30.96 mmol) and 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM) were added thereto. , 4.28 g, 15.48 mmol) to carry out the reaction for 2 hours with stirring at room temperature. The resulting reaction solution was diluted with 200 ml of dichloromethane, washed with 100 ml of saturated sodium bicarbonate solution and 100 ml of saturated brine, dried with anhydrous sodium sulfate, and filtered. The solvent was then evaporated under reduced pressure to obtain a crude product. The crude product was purified using a normal phase silica gel column, 200-300 mesh. The column was filled with petroleum ether, 1% by weight of triethylamine was added thereto to neutralize the acidity of the silica gel, and eluted with a gradient of dichloromethane:methanol = 100:5 - 100:7. The eluate was collected and the solvent was evaporated to dryness under reduced pressure to give 7.49 g of pure L-5-Tr. 1H NMR (400 MHz, DMSO) δ 7.83 - 7.10 (m, 4H), 7.67 - 7.60 (m, 1H), 7.44 - 7.34 (m, 6H), 7, 33 - 7.24 (m, 6H), 7.20 - 7.15 (m, 3H), 5.22 (s, 3H), 4.97 (d, J = 11.3 Hz, 3H), 4 .49 (d, J = 8.4 Hz, 3H), 4.06 - 3.07 (m, 9H), 3.95 - 3.83 (m, 3H), 3.77 - 3.64 (m , 3H), 3.45 - 3.35 (m, 3H), 3.12 - 2.87 (m, 8H), 2.30 - 2.15 (m, 3H), 2.11 - 1.98 (m, 22H), 1.95 - 1.84 (m, 11H), 1.81 - 1.61 (m, 14H), 1.54 - 1.36 (m, 14H). MS m/z: C85H119N7O30, [M+H]+, calculated: 1718.81, measured: 1718.03.

(1-6) Synthesis of L-8:

[293] L-5-Tr (5.94 g, 3.456 mmol) obtained in step (1-5) was dissolved in 69 ml of dichloromethane, and dichloroacetic acid (13.367 g, 103.67 mmol) was added thereto to carry out the reaction for 2 hours at room temperature. The resulting reaction solution was diluted by adding 100 ml of dichloromethane, washed and adjusted to pH 7-8 with saturated sodium bicarbonate solution. The separated aqueous phase was extracted six times, each time with 30 ml of dichloromethane. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was then evaporated under reduced pressure to obtain a crude product. The crude product was purified using a normal phase silica gel column, 200-300 mesh, adding 10% by weight triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with 1‰ (by weight) triethylamine and eluted with a gradient of dichloromethane:methanol = 100:30 - 100:40. The eluate was collected and the solvent was evaporated under reduced pressure to give 4.26 g of pure product L-8. 1H NMR (400 MHz, DMSO) δ 7.84 (d, J = 9.0 Hz, 3H), 7.27 - 7.23 (m, 1H), 7.13 - 7.18 (m, 1H) , 5.22 (d, J = 3.1 Hz, 3H), 4.97 (dd, J = 11.3, 3.1 Hz, 3H), 4.48 (d, J = 8.4 Hz, 3H), 4.09 - 3.98 (m, 9H), 3.88 (dd, J = 19.3, 9.3 Hz, 3H), 3.75 - 3.66 (m, 3H), 3 .44 - 3.38 (m, 3H), 3.17 - 3.30 (m, 4H), 3.10 - 2.97 (m, 4H), 2.35 - 2.20 (m, 6H) , 2.15 - 2.08 (m, 9H), 2.07 - 1.98 (m, 13H), 1.94 - 1.87 (m, 9H), 1.81 - 1.74 (m, 9H), 1.65 - 1.42 (m, 18H). MS m/z: C85H119N7O30, [M+H]+, calculated: 1477.59, measured: 1477.23.

(1-7a) Synthesis A-1.

[294] DMTrCl (4,4'-dimethoxytrityl chloride, 38.12 g, 112.5 mmol) was dissolved in 450 mL of anhydrous pyridine (Py) and calcium DL-glycerate hydrate (12.88 g, 45.0 mmol) was added thereto. ) to carry out the reaction for 22 hours at 45°C. The resulting reaction solution was filtered. The residue was washed with 200 ml DCM and the filtrate was concentrated to dryness under reduced pressure. The residue was redissolved in 500 ml of dichloromethane and washed twice, each time with 200 ml of 0.5 M triethylamine phosphate (pH=7-8). The separated aqueous phase was extracted twice, each time with 200 ml of dichloromethane. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure and the residue was purified using a normal phase silica gel column, 200-300 mesh, eluted with a gradient of petroleum ether:ethyl acetate:dichloromethane:methanol = 1:1:1:0.35 - 1:1:1: 0.55. The eluate was collected and the solvent was evaporated under reduced pressure. The residue was redissolved in 500 ml dichloromethane and washed once with 200 ml 0.5 M triethylamine phosphate. The separated aqueous phase was extracted twice, each time with 200 ml of dichloromethane. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure and the residue was dried under reduced pressure with a vacuum oil pump to dryness overnight to give 20.7 g of product A-1 as a white solid. 1H NMR (400 MHz, DMSO-d6) δ 7.46 (ddd, J = 6.5, 2.3, 1.1 Hz, 1H), 7.40 - 7.28 (m, 7H), 6, 89 - 6.81 (m, 4H), 4.84 (d, J = 5.0 Hz, 1H), 4.36 - 4.24 (m, 1H), 4.29 (s, 6H), 3 .92 (dd, J = 12.4, 7.0 Hz, 1H), 3.67 (dd, J = 12.3, 7.0 Hz, 1H), 2.52 (q, J = 6.3 Hz, 6H), 1.03 (t, J = 6.3 Hz, 9H). MS m/z: C24H23O6, [M-H]-, calculated: 407.15, measured: 406.92.

(1-7b) Synthesis of L-7.

[295] L-8 (2.262 g, 1.532 mmol) obtained in step (1-6) and A-1 (2.342 g, 4.596 mmol) obtained in step (1-7a) were mixed and dissolved in 16 ml dichloromethane, 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizin-4(3H)-one (DEPBT, 1.375 g, 4.596 mmol) was added thereto, and diisopropylethylamine (1.188 g, 9.191 mmol) was further added to carry out the reaction for 2 hours with stirring at 25°C, washed with 10 ml of saturated sodium bicarbonate. The separated aqueous phase was extracted three times, each time with 10 ml of dichloromethane. All organic phases were combined and washed with 10 ml of saturated brine, and the separated aqueous phase was extracted twice, each time with 10 ml of dichloromethane, and the resulting organic phases were combined, dried with anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure, and the residue was foam dried overnight using a vacuum oil pump to give 4.900 g of a crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, 120 g, with 20 ml of triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with petroleum ether containing 1% by weight triethylamine and eluted with a gradient of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide = 1:1:1:0.5 - 1:1:1:0.6. The eluate was collected and the solvent was evaporated under reduced pressure to give 2.336 g of pure product L-7. 1H NMR (400 MHz, DMSO) δ 7.90 - 7.78 (m, 4H), 7.75 - 7.64 (m, 1H), 7.38 - 7.18 (m, 9H), 6, 91 - 6.83 (m, 4H), 5.25 - 5.10 (m, 4H), 4.97 (dd, J = 11.2, 3.2 Hz, 3H), 4.48 - 4, 30 (m, 4H), 4.02 (s, 9H), 3.93 - 3.84 (m, 3H), 3.76 - 3.66 (m, 9H), 3.45 - 3.35 ( m, 3H), 3.24 - 2.98 (m, 10H), 2.30 - 2.20 (m, 2H), 2.11 - 1.88 (m, 31H), 1.80 - 1, 40(m, 28H). MS m/z: C90H128N7O35, [M-DMTr]+, calculated: 1564.65, measured: 1564.88.

(1-8) Synthesis L-9:

[296] L-7 (2.300 g, 1.26 mmol) obtained in step (1-7b), succinic anhydride (0.378 g, 3.78 mmol) and 4-dimethylaminopyridine (DMAP, 0.462 g, 3.78 mmol ) was mixed and dissolved in 13 ml of dichloromethane, additional DIPEA (0.814 g, 6.30 mmol) was added thereto, and stirred for 24 hours at 25°C. The resulting reaction solution was washed with 5 ml of 0.5 M triethylamine phosphate. The separated aqueous phase was extracted three times, each time with 5 ml of dichloromethane. All organic phases were combined and the solvent was evaporated under reduced pressure to give 2.774 g of crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, 60 g, with 1% by weight triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with dichloromethane and eluted with a gradient: dichloromethane containing 1‰ (by weight) triethylamine:methanol = 100:18 - 100:20. The eluate was collected and the solvent was evaporated under reduced pressure to give 1.874 g of a pure product of conjugation molecule L-9 (Conjugation molecule 1). 1H NMR (400 MHz, DMSO) δ 8.58 (d, J = 4.2 Hz, 1H), 7.94 - 7.82 (m, 3H), 7.41 - 7.29 (m, 5H) , 7.22 (d, J = 8.1 Hz, 5H), 6.89 (d, J = 8.3 Hz, 4H), 5.49 - 5.37 (m, 1H), 5.21 ( d, J = 3.0 Hz, 3H), 4.97 (d, J = 11.1 Hz, 3H), 4.49 (d, J = 8.2 Hz, 3H), 4.02 (s, 9H), 3.88 (dd, J = 19.4, 9.4 Hz, 3H), 3.77 - 3.65 (m, 9H), 3.50 - 3.39 (m, 6H), 3 .11 - 2.90 (m, 5H), 2.61 - 2.54 (m, 4H), 2.47 - 2.41 (m, 2H), 2.26 - 2.17 (m, 2H) , 2.15 - 1.95 (m, 22H), 1.92 - 1.84 (m, 9H), 1.80 - 1.70 (m, 10H), 1.65 - 1.35 (m, 17H), 1.31 - 1.19 (m, 4H), 0.96 (t, J = 7.1 Hz, 9H). MS m/z: C94H132N7O38, [M-DMTr]+, calculated: 1664.72, measured: 1655.03. The structure of the resulting L-9 Conjugating Molecule is represented by formula (503).

Production Example 2 Preparation of Conjugating Molecule P-9 (Conjugating Molecule 2).

[297] In this preparation example, Conjugation molecule 2 (hereinafter also referred to as Conjugation molecule P-9) was synthesized according to the following method:

(2-1) Synthesis of GAL5-C4-1.

[298] GAL-5 (13.43 g, 30.0 mmol) obtained according to the method described in (1-1) above, tert-butyl 4-aminobutyrate hydrochloride (5.87 g, 30.0 mmol), O-benzotriazoletetramethyluronium hexafluorophosphate (13.65 g, 36.0 mmol) and diisopropylethylamine (11.63 g, 90.0 mmol) were added in 40 ml of N,N-dimethylformamide, dissolved until uniform, and then stirred at room temperature. temperature to carry out the reaction for 5 hours. 300 ml of a saturated aqueous sodium bicarbonate solution was added to the resulting reaction solution. The separated aqueous phase was extracted three times, each time with 200 ml of ethyl acetate. All organic phases were combined and washed once with 200 ml of saturated brine. The organic phases resulting from the washing were isolated and dried over anhydrous sodium sulfate. The solvent was evaporated to dryness under reduced pressure to obtain 30.3 g of crude product GAL5-C4-1 as an oil, which was directly used in the next reaction.

(2-2) Synthesis of GAL5-C4-2.

[299] The crude product GAL5-C4-1 (30.3 g, 30 mmol) obtained in step (2-1) was dissolved in 180 ml of formic acid and stirred at room temperature to react for 16 hours. The solvent was evaporated to dryness. The residue was purified by column chromatography (normal phase silica gel, 200-300 mesh, eluting with a gradient of dichloromethane:methanol=100:18-100:20). The eluate was collected and concentrated to remove solvents to give a total of 14.84 g of the desired GAL5-C4-2 product.

(2-3) Synthesis of P-6.

[300] M-18-Tr (2.02 g, 4.69 mmol), obtained in accordance with the method described in step (1-4), and GAL5-C4-2 (8.24 g, 15.48 mmol) obtained in step (2-2) was mixed and dissolved in 47 ml of acetonitrile, N-methylmorpholine (3.13 g, 30.96 mmol) was added thereto, followed by 4-(4,6-dimethoxytriazine-2 -yl)-4-methylmorpholine hydrochloride (DMTMM, 4.28 g, 15.48 mmol) to carry out the reaction for 2 hours with stirring at room temperature. The resulting reaction solution was diluted with 200 ml of dichloromethane. The resulting organic phase was washed with 100 ml of saturated sodium bicarbonate solution and 100 ml of saturated brine, respectively. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure to give a crude product which was purified using a 200-300 mesh normal phase silica gel column. The column was filled with petroleum ether, 1% by weight of triethylamine was added thereto to neutralize the acidity of the silica gel, and eluted with a gradient of dichloromethane:methanol = 100:5 - 100:7. The eluate was collected and the solvent was evaporated under reduced pressure to give a total of 8.27 g of pure product P-6.

(2-4) Synthesis of P-7.

[301] P-6 (6.82 g, 3.456 mmol) obtained in (2-3) above was dissolved in 69 ml of dichloromethane, and dichloroacetic acid (13.367 g, 103.67 mmol) was added thereto to carry out the reaction in for 2 hours at room temperature. The resulting reaction solution was diluted by adding 100 ml of dichloromethane, washed and adjusted to pH 7-8 with saturated sodium bicarbonate solution. The separated aqueous phase was extracted six times, each time with 30 ml of dichloromethane. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was then evaporated under reduced pressure to obtain a crude product. The crude product was purified using a normal phase silica gel column, 200-300 mesh, with 10% by weight triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with 1‰ (by weight) triethylamine and eluted with a gradient of dichloromethane:methanol = 100:30 - 100:40. The eluate was collected and the solvent was evaporated under reduced pressure to give a total of 4.82 g of P-7. MS m/z: C78H127N10O33, [M+H]+, calculated: 1732.91, measured: 1735.73.

(2-5) Synthesis of P-8.

(A-1)

[302] P-7 (2.653 g, 1.532 mmol) and A-1 (2.342 g, 4.596 mmol) were mixed and dissolved in 16 ml of dichloromethane, and 3-diethoxyphosphoryl-1,2,3-benzotriazole 4(3H )-one (DEPBT) (1.375 g, 4.596 mmol) followed by diisopropylethylamine (1.188 g, 9.191 mmol) to react for 2 hours with stirring at 25° C., washed with 10 ml of saturated sodium bicarbonate. The separated aqueous phase was extracted three times, each time with 10 ml of dichloromethane. All organic phases were combined and washed with 10 ml of saturated brine. The separated aqueous phase was extracted twice, each time with 10 ml of dichloromethane, and the resulting organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure, and the residue was foam dried overnight with an oil vacuum pump to give a crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, 120 g, with 20 ml of triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with petroleum ether containing 1% by weight triethylamine and eluted with a gradient of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide = 1:1:1:0.5 - 1:1:1:0.6. The eluate was collected and the solvent was evaporated under reduced pressure to give a total of 2.793 g of pure product P-8.

(2-6) Synthesis of P-9.

[303] P-8 (490 mg, 0.231 mmol), succinic anhydride (69 mg, 0.693 mmol) and 4-dimethylaminopyridine (DMAP, 68 mg, 0.554 mmol) were mixed and dissolved in 2.3 ml of dichloromethane, and added to them diisopropylethylamine (DIPEA, 149 mg, 1.155 mmol) to carry out the reaction for 21 hours with stirring at 25°C. 50 ml of dichloromethane was added to the resulting dilution reaction solution, and then washed with 100 ml of 0.5 M triethylamine phosphate. The separated aqueous phase was extracted three times, each time with 10 ml of dichloromethane. All organic phases were combined and the solvent was evaporated under reduced pressure to give the crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, 80 g, with 1% by weight triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with dichloromethane and eluted with a gradient: dichloromethane containing 1‰ (by weight) triethylamine:methanol = 100:18 - 100:20. The eluate was collected and the solvent was evaporated under reduced pressure to give a total of 200 mg of pure product Conjugation molecule P-9 (Conjugation molecule 2). MS m/z: C106H153N10O41, [M-DMTr]+, calculated: 1921.05, measured: 1920.97. The structure of the resulting P-9 Conjugating Molecule is represented by formula (504).

Production Example 3 Preparation of Conjugating Molecule R-4 (Conjugating Molecule 3).

[304] In this preparation example, Conjugation molecule 3 (hereinafter also referred to as Conjugation molecule R-4) was synthesized according to the following method:

(3-1) Synthesis of GAL-C7-1.

[305] GAL-3 (26.4 g, 80.2 mmol) obtained according to the method described in step (1-1b) was dissolved in 134 ml of anhydrous 1,2-dichloroethane and 60 g of 4Å molecular sieves were added as a powder and then 7-octen-1-ol (11.3 g, 88.2 mmol) to react for 10 minutes with stirring at room temperature. Trimethylsilyl trifluoromethanesulfonate (TMSOTf, 8.9 g, 40.1 mmol) was added in an ice bath and with nitrogen protection to carry out the reaction for 24 hours with stirring at room temperature. The 4Å molecular sieve powder was removed by filtration. 500 ml of saturated sodium bicarbonate aqueous solution was added to the filtrate for washing. The organic phase was isolated. The remaining aqueous phase was extracted once with 100 ml of dichloromethane. All organic phases were combined and washed once with 250 ml of saturated brine. The organic phase resulting from the washing was dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to dryness to give 33.3 g of GAL-C7-1 as a yellow syrup, which was directly used in the next oxidation reaction without purification.

(3-2) Synthesis of GAL-C7-2.

[306] GAL-C7-1 (33.3 g, 72.8 mmol) obtained in step (3-1) was dissolved in a mixed solvent of 160 ml of dichloromethane and 160 ml of acetonitrile, 216 ml of water and solid sodium periodate ( 62.3 g, 291.2 mmol), respectively, was stirred in an ice bath for 10 minutes, and the catalyst ruthenium trichloride (498 mg, 2.4 mmol) was added. The reaction mixture naturally warmed to room temperature and was stirred for 23 hours. The resulting reaction solution was diluted by adding 200 ml of water, stirred and adjusted to pH 7.5 by adding saturated sodium bicarbonate. The isolated organic phase was discarded. The remaining aqueous phase was extracted three times, each time with dichloromethane. The organic phases resulting from the extraction were discarded. The pH of the aqueous phase resulting from the extraction was adjusted to approximately 3 with solid citric acid, extracted three times, each time with 200 ml of dichloromethane, and the resulting organic phases were combined, dried with anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and then the residue was purified by column chromatography (normal phase silica gel, 200-300 mesh, eluting with dichloromethane:methanol=100:18-100:20 gradient) to give 22.4 g of GAL-C7 product. -2 as a white foamy solid. MS m/z: C21H32NO11, [M+H]+, calculated: 476.50, measured: 475.94.

(3-3) Synthesis of R-1.

[307] M-18-Tr (2.02 g, 4.69 mmol), obtained in accordance with the method described in step (1-4), and GAL-C7-2 (7.36 g, 15.48 mmol) was mixed and dissolved in 47 ml of acetonitrile, N-methylmorpholine (3.13 g, 30.96 mmol) was added, followed by 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM, 4 .28 g, 15.48 mmol) to carry out the reaction for 2 hours with stirring at room temperature. The resulting reaction solution was diluted with 200 ml of dichloromethane. The resulting organic phase was washed with 100 ml of saturated sodium bicarbonate solution and 100 ml of saturated brine, respectively. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure to give a crude product which was purified using a 200-300 mesh normal phase silica gel column. The column was filled with petroleum ether, 1% by weight of triethylamine was added thereto to neutralize the acidity of the silica gel, and eluted with a gradient of dichloromethane:methanol = 100:5 - 100:7. The eluate was collected and the solvent was evaporated under reduced pressure to give 7.82 g of pure product R-1.

(3-4) Synthesis of R-2.

[308] R-1 (6.23 g, 3.456 mmol) was dissolved in 69 ml of dichloromethane, and dichloroacetic acid (13.367 g, 103.67 mmol) was added thereto to carry out a reaction for 2 hours at room temperature. The resulting reaction solution was diluted by adding 100 ml of dichloromethane, washed and adjusted to pH 7-8 with saturated sodium bicarbonate solution. The separated aqueous phase was extracted six times, each time with 30 ml of dichloromethane. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was then evaporated under reduced pressure to obtain a crude product. The crude product was purified using a 200-300 mesh normal phase silica gel column with 10% by weight triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with 1‰ (by weight) triethylamine and eluted with a gradient of dichloromethane:methanol = 100:30 - 100:40. The eluate solvent was evaporated under reduced pressure to give 4.49 g of pure product R-2.

(3-5) Synthesis of R-3.

[309] R-2 (2.391 g, 1.532 mmol) and A-1 (2.342 g, 4.596 mmol) were mixed and dissolved in 16 mL of dichloromethane and 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizine-4( 3H)-one (DEPBT, 1.375 g, 4.596 mmol) followed by diisopropylethylamine (1.188 g, 9.191 mmol) to react for 2 hours with stirring at 25° C., washed with 10 ml of saturated sodium bicarbonate. The separated aqueous phase was extracted three times, each time with 10 ml of dichloromethane. All organic phases were combined and washed with 10 ml of saturated brine. The separated aqueous phase was extracted twice, each time with 10 ml of dichloromethane, and the resulting organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure, and the residue was foam dried overnight with an oil vacuum pump to give a crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, 120 g, with 20 ml of triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with petroleum ether containing 1% by weight triethylamine and eluted with a gradient of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide = 1:1:1:0.5 - 1:1:1:0.6. The solvent was evaporated under reduced pressure to give 2.642 g of pure product R-3.

(3-6) Synthesis of R-4.

[310] R-3 (795 mg, 0.4074 mmol), succinic anhydride (82 mg, 0.8148 mmol) and 4-dimethylaminopyridine (DMAP, 100 mg, 0.8148 mmol) were mixed and dissolved in 4 ml dichloromethane, and diisopropylethylamine (DIPEA, 100 mg, 0.8148 mmol) was added to carry out the reaction for 18 hours with stirring at 25°C. The resulting reaction solution was washed with 5 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted three times, each time with 5 ml of dichloromethane. All organic phases were combined and the solvent was evaporated under reduced pressure to give the crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, 30 g, with 1% by weight triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with dichloromethane and eluted with a gradient: dichloromethane containing 1‰ (by weight) triethylamine:methanol = 100:18 - 100:20. The eluate was collected and the solvent was evaporated under reduced pressure to give 505 mg of pure product, Conjugation Molecule R-4 (Conjugation Molecule 3). The structure of the resulting R-4 Conjugating Molecule is represented by formula (507).

Production Example 4 Preparation of LA-4 Conjugating Molecule (Conjugating Molecule 4)

[311] It is expected that Conjugation molecule 4 (hereinafter also referred to as Conjugation molecule LA-4) can be synthesized in accordance with the following technological route. The structure of the resulting LA-4 Conjugating Molecule is represented by formula (512).

[312] Conjugating molecule.

Production Example 5 Preparation of LB-4 Conjugation Molecule (Conjugation Molecule 5).

[313] In this preparation example, Conjugation molecule 5 (hereinafter also referred to as Conjugation molecule LB-4) was synthesized according to the following method:

(5-1) Synthesis of LB-1.

[314] L-8 (5.0 g, 3.386 mmol) obtained according to the method described in step (1-6), adipic anhydride (870 mg, 6.772 mmol) and 4-dimethylaminopyridine (DMAP, 827 mg, 6.772 mmol) was mixed and dissolved in 130 ml of dichloromethane, and diisopropylethylamine (DIPEA, 2.2 g, 16.931 mmol) was added thereto to carry out a reaction for 4 hours with stirring at 25°C. 70 ml of dichloromethane was added to the resulting dilution reaction solution, and then washed with 0.5 M triethylamine phosphate. The separated aqueous phase was extracted four times, each time with 10 ml of dichloromethane. All organic phases were combined and the solvent was evaporated under reduced pressure to give the crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, 120 g, with 1% by weight triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with dichloromethane and eluted with a gradient of petroleum ether:ethyl acetate:dichloromethane:methanol = 1:1:1:0.2 - 1:1:1:1. The solvent was evaporated under reduced pressure to give 4.267 g of pure LB-1 product.

(5-2) Synthesis of LB-2.

[315] LB-1 (4.697 g, 2.753 mmol, pool of 2 lots) prepared according to the method described in step (5-1), 3-amino-1,2-propanediol (313 mg, 3.442 mmol) 4 -(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM, 953 mg, 3.442 mmol) and N-methylmorpholine (700 mg, 6.884 mmol) were added successively to a mixture of 30 ml of acetonitrile and 3 ml of methanol to conduct reactions overnight with stirring at room temperature. The reaction mixture was transferred to an oil bath at 60°C and stirred for 18 hours. The solvent was evaporated to dryness and the residue was purified by column chromatography (normal phase silica gel, 200-300 mesh, eluting with a gradient of dichloromethane:methanol=1:0.07-1:0.5). The eluate was collected and concentrated to remove solvents to give 3.27 g of desired LB-2 product.

(5-3) Synthesis of LB-3.

[316] LB-2 (2.27 g, 1.353 mmol) was dissolved in 14 ml of anhydrous pyridine, and 4,4'-dimethoxytrityl chloride (688 mg, 2.03 mmol) was added thereto to carry out the reaction overnight with stirring at room temperature. temperature. The reaction was quenched by adding 150 ml of methanol. The solvent was evaporated to dryness and the residue was purified by column chromatography (normal phase silica gel, 200-300 mesh, eluting with a gradient of dichloromethane:methanol=1:0.05-1:0.2). The eluate was collected and concentrated to remove solvents to give 1.647 g of desired LB-3 product.

(5-4) Synthesis of LB-4.

[317] LB-3 (822 mg, 0.415 mmol), succinic anhydride (83 g, 0.83 mmol) and 4-dimethylaminopyridine (DMAP, 102 mg, 0.83 mmol) were mixed and dissolved in 4 ml dichloromethane, added to him DIPEA (270 mg, 2,075 mmol) and stirred at 25°C to carry out the reaction during the night. The resulting liquid reaction mixture was washed three times with 0.5 M triethylamine phosphate. The separated aqueous phase was extracted three times, each time with 2 ml of dichloromethane. All organic phases were combined and the solvent was evaporated under reduced pressure to give the crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, with 5% by weight triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with petroleum ether and eluted with a gradient: dichloromethane containing 1‰ (by weight) triethylamine:methanol = 100:5 - 100:20. The solvent was evaporated under reduced pressure to give 787 mg of pure product, LB-4 Conjugation Molecule (Conjugation Molecule 5). The structure of the resulting LB-4 Conjugating Molecule is represented by formula (513).

Production Example 6 Synthesis of Conjugation Molecule V-7 (Conjugation Molecule 6).

[318] It is expected that Conjugation Molecule 6 (hereinafter also referred to as Conjugation Molecule V-7) can be synthesized according to the following process route. The structure of the resulting V-7 Conjugating Molecule is represented by formula (514). conjugating molecule.

[319] Conjugating molecule.

Production Example 7 Preparation of Conjugating Molecule W-7 (Conjugating Molecule 7).

[320] In this preparation example, Conjugation molecule 7 (hereinafter also referred to as Conjugation molecule W-7) was synthesized according to the following method.

(7-1) Synthesis W-1.

[321] W-0 (2.024 g, 10 mmol) was dissolved in 25 ml of acetonitrile, triethylamine (4.048 g, 40 mmol) was added thereto and cooled to approximately 0°C in an ice bath. Ethyl trifluoroacetate (5.683 g, 40 mmol) was added to carry out the reaction for 22 hours at room temperature. The solvent was evaporated under reduced pressure, and the foamy residue was dried with a vacuum oil pump for 18 hours to give 5.835 g of crude solid W-1.

(7-2) Synthesis W-2.

[322] The crude product W-1 (5.835 g, 10 mmol) was dissolved in 50 ml of dichloromethane. TrCl (3.345 g, 12 mmol) and triethylamine (1.518 g, 15 mmol) were added to carry out the reaction for 20 hours with stirring at room temperature. The resulting liquid reaction mixture was washed twice with 20 ml of saturated sodium bicarbonate and once with 20 ml of saturated brine. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The organic solvent was evaporated under reduced pressure, and the foamy residue was dried with a vacuum oil pump overnight to give 8.012 g of crude W-2 solid. The crude W-2 solid was used in the next deprotection reaction without treatment.

(7-3) Synthesis W-3.

[323] The crude product W-2 (8.012 g, 10 mmol) was dissolved in 100 ml of methanol, and 100 ml of an aqueous solution of methylamine (40% by mass) was added thereto to carry out the reaction for 23 hours with stirring at 50°C. Insoluble particles were removed from the reaction mixture by filtration. The solvent was evaporated under reduced pressure. 200 ml of a mixed solvent of DCM:methanol in a 1:1 v/v ratio was added to the residue, and the resulting organic phase was washed with 50 ml of saturated sodium bicarbonate. The separated aqueous phase was extracted three times, each time with 50 ml of dichloromethane. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure, the foam dried with a vacuum oil pump overnight, and purified using a 200-300 mesh normal phase silica gel column. The column was filled with petroleum ether, 1% by mass of triethylamine was added to it to neutralize the acidity of the silica gel, and it was eluted with a gradient of dichloromethane:methanol:aqueous ammonia (25% by mass) = 1:1:0.05 - 1:1:0.25. The eluate was collected. The solvent was evaporated under reduced pressure, and the foamy residue was dried using a vacuum oil pump to give 3.062 g of pure product W-3.

(7-4) Synthesis of W-4.

[324] W-3 (675 mg, 1.517 mmol) and GAL-C7-2 (2.60 g, 5.46 mmol) were mixed and dissolved in 47 ml of acetonitrile, diisopropylethylamine (1.57 g, 12.14 mmol) was added ) followed by 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizin-4(3H)-one (DEPBT, 1.816 g, 6.04 mmol) to react for 2.5 hours with stirring at room temperature. The resulting liquid reaction mixture was diluted with 100 ml of dichloromethane. The resulting organic phase was washed with 80 ml of saturated sodium bicarbonate solution and 80 ml of saturated brine, respectively. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure to give a crude product which was purified using a 200-300 mesh normal phase silica gel column. The column was filled with petroleum ether, 1% by weight of triethylamine was added thereto to neutralize the acidity of the silica gel, and eluted with a gradient of dichloromethane:methanol = 100:5 - 100:7. The eluate was collected and the solvent was evaporated under reduced pressure to give 1.610 g of pure product W-4.

(7-5) Synthesis of W-5.

[325] W-4 (1.61 g, 0.886 mmol) was dissolved in 125 ml of dichloromethane and dichloroacetic acid (3.5 ml, 42.43 mmol) was added to carry out the reaction for 1 hour at room temperature. The resulting liquid reaction mixture was neutralized by adding 150 ml of pyridine. The solvent was evaporated under reduced pressure to give a crude product. The crude product was purified using a 200-300 mesh normal phase silica gel column with 10% by weight triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with 1‰ (by weight) triethylamine and eluted with a gradient of dichloromethane:methanol = 100:30 - 100:40. The eluate was collected and the solvent was evaporated under reduced pressure to give 1.26 g of pure product W-5.

(7-6) Synthesis W-6.

[326] W-5 (1.25 g, 0.793 mmol) and A-1 (1.21 g, 2.38 mmol), obtained in accordance with the method described in step (1-7a), were mixed and dissolved in 12 ml dichloromethane, and 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizin-4(3H)-one (DEPBT, 0.712 g, 2.38 mmol) was added thereto, followed by diisopropylethylamine (0.615 g, 4.76 mmol) to carry out the reaction for 3 hours with stirring at 25°C, and washed with 80 ml of saturated sodium bicarbonate. The separated aqueous phase was extracted three times, each time with 10 ml of dichloromethane. All organic phases were combined and washed with 10 ml of saturated brine. The resulting organic phases were combined, dried over anhydrous sodium sulfate, and filtered. The solvent was evaporated under reduced pressure, and the residue was foam dried overnight with an oil vacuum pump to give a crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, 185 g, with 20 ml of triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with petroleum ether containing 1% by weight triethylamine and eluted with a gradient of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide = 1:1:1:0.1 - 1:1:1:0.7. The eluate was collected and the solvent was evaporated under reduced pressure to give 1.57 g of pure product W-6.

(7-7) Synthesis of W-7.

[327] W-6 (1.238 g, 0.63 mmol), succinic anhydride (0.189 g, 1.89 mmol) and 4-dimethylaminopyridine (DMAP, 0.231 g, 1.89 mmol) were mixed and dissolved in 7 ml dichloromethane, and DIEA (0.407 g, 3.15 mmol) was added thereto to carry out the reaction for 24 hours with stirring at 25°C. The resulting liquid reaction mixture was washed with 5 ml of 0.5 M triethylamine phosphate. The separated aqueous phase was extracted three times, each time with 5 ml of dichloromethane. All organic phases were combined and the solvent was evaporated under reduced pressure to give the crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, 30 g, with 1% by weight triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with dichloromethane and eluted with a gradient: dichloromethane containing 1‰ (by weight) triethylamine:methanol = 100:18 - 100:20. The eluate was collected and the solvent was evaporated under reduced pressure to give 1.033 g of pure product, Conjugation Molecule W-7 (Conjugation Molecule 7). MS m/z: C101H146N7O38, [M-DMTr]+, calculated: 1763.92, measured: 1763.21. The structure of the resulting W-7 Conjugating Molecule is represented by formula (515).

Production Example 8 Preparation of Conjugating Molecule X-7 (Conjugating Molecule 8).

[328] It is expected that Conjugation Molecule 8 (hereinafter also referred to as Conjugation Molecule X-7) can be synthesized according to the following process route. The structure of the resulting X-7 Conjugating Molecule is represented by formula (521). conjugating molecule.

conjugating molecule.

Production Example 9 Preparation of Conjugating Molecule K-3 (Comparable Conjugating Molecule 1).

[329] In this Preparation Example, Conjugating Molecule K-3 (hereinafter also referred to as Comparable Conjugating Molecule 1) was synthesized according to the following method:

(9-1) Synthesis of K-1.

[330] A-1 (3.0 g, 6.0 mmol), obtained in accordance with the method described in step (1-7a), PyBOP (6.2 g, 12.0 mmol), HOBt (1, 6 g, 2.0 mmol) and diisopropylethylamine (DIPEA, 3.9 g, 30.0 mmol) were added to 60 ml of dichloromethane to react for 10 minutes with stirring at room temperature. Then the solution described above was added to K-0 (5.6 g, 30.0 mmol) to carry out the reaction at room temperature for 1 hour and 50 minutes. The liquid reaction mixture was poured into 30 ml of saturated sodium bicarbonate solution. The separated aqueous phase was extracted three times, each time with 30 ml of dichloromethane. All organic phases were combined, washed with saturated sodium chloride solution, dried with anhydrous sodium sulfate, then filtered, concentrated and purified using a normal phase silica gel column, 200-300 mesh, eluting with a gradient of dichloromethane:methanol:aqueous ammonia (25% by weight ) = 10:2:0.1 - 4:4:1. The eluate was collected, concentrated to remove solvents, and foam dried with a vacuum oil pump to give 2.2 g of product K-1 as a white solid. 1H NMR (400 MHz, DMSO-d6) δ 8.02 (s, 1H), 7.43 (d, J = 7.8 Hz, 2H), 7.34 - 7.17 (m, 7H), 6 .87 (d, J = 8.6 Hz, 4H), 4.05 (d, J = 5.2 Hz, 1H), 3.74(s, 6H), 3.20 - 3.01 (m, 5H), 2.60 - 2.38 (m, 12H), 1.60 - 1.39 (m, 8H), 1.24 (s, 1H). MS m/z: C33H47N4O5, [M+H]+, calculated: 579.35, measured: 579.26.

(9-2) Synthesis of K-2.

[331] GAL-5 (483 mg, 1.08 mmol), obtained in accordance with the method described in step (1-1), 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizine-4(3H)- he (359 mg, 1.2 mmol) and diisopropylethylamine (DIPEA, 310 mg, 2.4 mmol) were added in 3 ml of dichloromethane and stirred at room temperature for 30 minutes. Then K-1 (174 mg, 0.3 mmol) was added to carry out the reaction at room temperature for 16 hours. The liquid reaction mixture was poured into 10 ml of saturated sodium bicarbonate solution. The separated aqueous phase was extracted three times, each time with 10 ml of dichloromethane. All organic phases were combined, washed with 10 ml saturated sodium chloride solution, dried with anhydrous sodium sulfate, then filtered, concentrated and purified using a normal phase silica gel column, 200-300 mesh, eluting with a dichloromethane:methanol = 20:1 gradient. The eluate was collected, concentrated to remove solvents, and foam dried with a vacuum oil pump to give 205 mg of product K-2 as a yellow solid.

(9-3) Synthesis of K-3.

[332] K-2 (205 mg, 0.11 mmol), succinic anhydride (22 mg, 0.22 mmol), 4-dimethylaminopyridine (DMAP, 27 mg, 0.22 mmol), and diisopropylethylamine (DIPEA, 71 mg, 0.55 mmol) was added in 1.1 ml of dichloromethane to carry out the reaction overnight with stirring at room temperature. The liquid reaction mixture was washed three times, each time with 0.5 ml of a 0.5 M triethylamine phosphate solution, and the aqueous phase resulting from each washing was back-extracted once with 0.5 ml of dichloromethane. All organic phases were combined, dried over anhydrous sodium sulfate, concentrated to remove solvent, and foam dried with a vacuum oil pump to give 218 mg of the product as a light yellow solid, Conjugate Molecule K-3 (Comparable Conjugate Molecule 1) .

Preparation Example 10 This preparation example is used to illustrate the synthesis of a (GalNAc)3 Conjugating Molecule (Comparable Conjugating Molecule 2).

[333] In this production example, compound 47 was synthesized according to the production method described in examples 1 to 4 of WO2014025805A1. The structure of Compound 47 is shown in the following formula and is referred to in this application as Conjugating Molecule (GalNAc)3 (Comparable Conjugating Molecule 2):

Production Example 11 This Production Example was used to illustrate the preparation of FIN-2 Conjugation Molecule (Comparable Conjugation Molecule 3).

[334] In this production example, the FIN-2 conjugation molecule (Comparable Conjugation Molecule 3) was synthesized based on the production method described in Rajeev et al., ChemBioChem 2015, 16, 903-908, according to the following workflow:

(11-1) Synthesis of compound PRO-10.

(11-1-1) Synthesis of PRO-7.

[335] 2.93 g PRO-6 (L-hydroxyproline, CAS number: 51-35-4, purchased from Energy Chemical, 22.4 mmol) was dissolved in 22.5 ml of 1,4-dioxane and 34 ml of 10% (by mass) aqueous solution of Na2CO3. 6.954 g of Fmoc-Cl (9-fluorenylmethyl chloroformate, CAS registry number: 28920-43-6, purchased from Energy Chemical, 26.8 mmol) was dissolved in 56.5 ml of 1,4-dioxane, added to the above reaction mixture on ice bath and naturally warmed to room temperature to carry out the reaction overnight. The liquid reaction mixture was poured into 150 ml of ice water and extracted three times, each time with 100 ml of methyl tert-butyl ether, the resulting organic phases were discarded. The pH of the remaining aqueous phase was adjusted to ≤ 5 with concentrated hydrochloric acid, extracted twice with 100 ml of ethyl acetate, and the resulting organic phases were combined and dried with anhydrous sodium sulfate. The solvent was evaporated under reduced pressure to give 7.83 g of PRO-7 product as a white foamy solid. 1H NMR (400 MHz, DMSO-d6) δ 7.91 (t, J = 7.2 Hz, 2H), 7.67 (d, J = 7.5 Hz, 2H), 7.48 - 7.39 (m, 2H), 7.38 - 7.27 (m, 2H), 5.17 (s, 1H), 4.27 (s, 2H), 4.23 - 4.11 (m, 2H), 3.55 - 3.41 (m, 3H), 2.31 - 2.10 (m, 1H), 2.08 - 1.88 (m, 1H). High resolution electrospray ionization mass spectrometry (HRMS) m/z calculated for C20H19NO5 [M-H]-352.1190, measured: 352.1033.

(11-1-2) Synthesis of PRO-8.

[336] 7.83 g of PRO-7 (22.2 mmol) was dissolved in 80 ml of THF, heated to 65°C in an oil bath, 36.6 ml of a 2 mol/l solution of BH3-Me2S in THF (CAS no. 13292) was added -87-0, purchased from J&K Scientific Ltd., 73.2 mmol) at the boil under reflux, and continuously heated under reflux to carry out the reaction for 3 hours. The liquid reaction mixture was poured out and the remaining solid was dissolved in methanol. Methanol was added to the resulting liquid reaction mixture with stirring until gas evolution ceased, and stirred continuously for 30 minutes. The solvent was evaporated under reduced pressure, and then the residue was purified three times, each time with petroleum ether, to give 7.1 g of PRO-8 product as a white solid. 1H NMR (400 MHz, DMSO-d6) δ 7.91 (t, J = 6.7 Hz, 2H), 7.67 (d, J = 7.2 Hz, 2H), 7.49 - 7.39 (m, 2H), 7.38 - 7.26 (m, 2H), 5.18 (dd, J = 6.1, 3.8 Hz, 1H), 4.28 (s, 2H), 4, 23-4.13(m, 2H), 3.55-3.38(m, 2H), 2.32-2.11(m, 1H), 2.08-1.89(m, 1H). HRMS (EMI) m/z calculated for C20H21NO4 [M+Na]+ 362.1368, measured: 362.1012.

(11-1-3) Synthesis of PRO-9.

[337] 7.1 g of PRO-8 (21 mmol) was dissolved in 100 ml of pyridine, and 14.2 g of DMTr-Cl (4,4'-dimethoxytrityl chloride, 42 mmol) was added thereto to carry out the reaction for 5 hours with stirring at room temperature. The solvent was removed by evaporation under reduced pressure. The resulting crude product was dissolved in ethyl acetate and filtered to remove salt impurities. The solvent was evaporated under reduced pressure, and then the residue was purified using a silica gel column. For purification, the crude product, dissolved in DCM, was loaded onto a silica gel column pretreated with pyridine to alkalize the column. DMTr-Cl was eluted with DCM containing 1% (v/v) pyridine and then the product was eluted with ethyl acetate. The eluate was collected and the solvent was evaporated under reduced pressure to give 8.2 g of PRO-9 product as a white solid. HRMS (EMI) m/z calculated for C41H39NO6 [M+Na]+ 664.2675, measured: 664.2348; C18 RP HPLC (batch number: JJS160324-1); purity: 94.20%.

(11-1-4) Synthesis of PRO-10.

[338] 8.2 g of PRO-9 (12.8 mmol) was dissolved in 64 ml of DMF and 40 ml of piperidine (384 mmol) was added to carry out the reaction for 30 minutes with stirring at room temperature. The liquid reaction mixture was poured into 300 ml of ice water and extracted three times, each time with 150 ml of ethyl acetate. The resulting organic phases were combined, washed with 200 ml of saturated brine, and the organic phases obtained by washing were dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and then the residue was purified using a silica gel column. For purification, the crude product, dissolved in DCM, was loaded onto a silica gel column pretreated with pyridine to alkalize the column. Fmoc was eluted with DCM containing 1% (v/v) pyridine and then the product was eluted with ethyl acetate. The eluate was collected and the solvent was evaporated under reduced pressure to give 4.65 g of PRO-10 product as a white solid. 1H NMR (400 MHz, DMSO-d6) δ 7.40 (d, J = 7.2 Hz, 2H), 7.35 - 7.18 (m, 7H), 6.93 - 6.84 (m, 4H), 4.56 (d, J = 3.9 Hz, 1H), 4.12 (s, 1H), 3.74 (s, 6H), 3.46 - 3.37 (m, 1H), 2.88 (ddd, J = 18.5, 10.0, 5.5 Hz, 2H), 2.75 (dd, J = 8.7, 5.8 Hz, 1H), 2.62 (dd, J = 11.0, 2.7 Hz, 1H), 1.74 - 1.65 (m, 1H), 1.40 (ddd, J = 12.9, 8.5, 5.9 Hz, 1H) ; HRMS (EMI) m/z calculated for C26H29NO4 [M+Na]+ 442.1994, measured: 442.1999; C18 RP HPLC (batch number: JJS160329-1), purity: 97.07%.

(11-2) Synthesis of FIN-1.

[339] GAL-5 (4.5 g, 10 mmol) obtained according to the method described in (1-1) was dissolved in 40 ml of DMF, 3.9 g of DIPEA (N,N- diisopropylethylamine, CAS number: 7087-68-5, purchased from Aladdin Inc., 30 mmol) and 3.8 g HBTU (benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate, CAS number: 94790 -37-2, purchased from Aladdin Inc., 11 mmol) and stirred at room temperature for 10 minutes to give a liquid reaction mixture. PRO-10 (4.2 g, 10 mmol) obtained in step (12-4) was dissolved in 40 ml of DMF, then added to the liquid reaction mixture obtained above. The resulting liquid reaction mixture was dried by adding anhydrous sodium sulfate and stirred at room temperature for 2 hours. The liquid reaction mixture was poured into 120 ml of ice water and extracted three times, each time with 60 ml of ethyl acetate. The resulting organic phases were combined, washed with 20 ml of water and 20 ml of saturated brine, respectively. The organic phase obtained by washing was isolated, dried over anhydrous sodium sulfate. The solvent was evaporated under reduced pressure, and then the residue was purified using a silica gel column. For purification, the sample was loaded onto a silica gel column pre-treated with pyridine to make the column alkaline and eluted with a dichloromethane (DCM) solution containing 1% (v/v) triethylamine and 1% (v/v) methanol. The eluate was collected and the solvent was evaporated under reduced pressure to give 6.5 g of FIN-1 product as a light yellow foamy solid. 1H NMR (400 MHz, DMSO-d6) δ 7.83 (d, J = 9.2 Hz, 1H), 7.32 (t, J = 6.6 Hz, 4H), 7.20 (td, J = 8.9, 3.5 Hz, 5H), 6.93 - 6.84 (m, 4H), 5.21 (d, J = 3.2 Hz, 1H), 5.04 - 4.90 ( m, 2H), 4.49 (s, 1H), 4.40 (d, J = 4.4 Hz, 0.8H), 4.31 (d, J = 5.0 Hz, 0.2H), 4.15 (s, 1H), 4.03 (s, 3H), 3.93 (s, 1H), 3.74 (s, 7H), 3.59 (dt, J = 12.0, 6, 0 Hz, 1H), 3.50 - 3.40 (m, 1H), 3.39 - 3.25 (m, 3H), 3.13 (dd, J = 8.9, 5.2 Hz, 1H ), 3.00 (dq, J = 9.3, 5.3, 4.3 Hz, 1H), 2.22 (s, 2H), 2.07 (s, 3H), 1.99 (s, 3H), 1.90 (s, 4H), 1.74 (s, 3H), 1.50 (s, 3H), 1.36 (s, 1H). C18 RP HPLC (batch number: LJ160422), purity: 95.45%.

(11-3) Synthesis of FIN-2.

[340] FIN-1 (3.0 g, 3.53 mmol) obtained in step (11-2) was dissolved in 10 ml of DMF, 2.13 g of PA (2-cyanoethyl-N,N, N',N'-tetraisopropylphosphorodiamidite, Adamas Inc., Product # 11356B, 7.06 mmol) and 346 mg tetrazole (CAS No: 288-94-8, purchased from Aladdin Inc., 4.94 mmol) under nitrogen atmosphere, and stirred to react at room temperature. 10 ml of DMF was added and stirred continuously to carry out the reaction for 1 hour. The solvent was removed by evaporation under reduced pressure, and then the residue was purified by silica gel column chromatography. For purification, the crude product, dissolved in DCM, was loaded onto a silica gel column pretreated with pyridine to make the column alkaline and eluted with ethyl acetate. The eluate was collected and the solvent was evaporated under reduced pressure to give 4.5 g of crude product as a colorless syrup. The crude product was completely dissolved in 50% (v/v) acetonitrile aqueous solution and purified using a medium pressure column (C-18, 330 g, 300 Å) pretreated with 1% (v/v) pyridine in acetonitrile to alkalize the column. . The product was collected by gradient elution and the solvent was evaporated under reduced pressure to give 2.2 g of product as a white powder - FIN-2 Conjugation Molecule (Comparable Conjugation Molecule 3). 31P NMR (162 MHz, CDCl3) δ 148.04, 147.94, 147.62, 147.19, 31P NMR purity: 92%; purity C18 RP HPLC: 90.54%.

Production Example 12 This Production Example was used to illustrate the preparation of Conjugation Molecule Z-4 (Conjugation Molecule 153).

[341] In this preparation example, Conjugation molecule 153 (hereinafter also referred to as Conjugation molecule Z-4) was synthesized according to the following method.

(12-1) Synthesis of Z-1.

[342] W-3 (1.50 g, 3.37 mmol) obtained in accordance with the method described in step (7-3) and GAL5-C4-2 (7.18 g, 13.48 mmol) , obtained in accordance with the method described in step (2-2), were mixed and dissolved in 34 ml of dichloromethane, diisopropylethylamine (3.48 g, 26.96 mmol) was added thereto, and then 3-(diethoxyphosphoryloxy)-1, 2,3-benzotrizin-4(3H)-one (DEPBT, 4.04 g, 13.48 mmol) to react for 4.5 hours with stirring at room temperature. The resulting liquid solution was diluted with 100 ml of dichloromethane, washed with 80 ml of saturated sodium bicarbonate solution and 80 ml of saturated brine, respectively. All organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure to give a crude product which was purified using a 200-300 mesh normal phase silica gel column. The column was filled with petroleum ether, 1% by mass of triethylamine was added thereto to neutralize the acidity of the silica gel, and eluted with a gradient of dichloromethane:methanol = 30:1-15:1. The eluate was collected and evaporated under reduced pressure to give 3.97 g of pure product Z-1. MS m/z: C98H143N10O33, [M+H]+, calculated: 1987.98, measured: 1987.90.

(12-2) Synthesis of Z-2.

[343] Z-1 (3.97 g, 2.00 mmol) obtained according to the method described in (12-1) was dissolved in 250 ml of dichloromethane, and dichloroacetic acid (10.941 g, 84.85 mmol) to carry out the reaction for 1 hour at room temperature. Pyridine was added to neutralize the resulting reaction solution to a neutral state. The solvent was evaporated under reduced pressure to give a crude product. The column was loaded with 200 g of normal phase silica gel, 200-300 mesh, and 10% by weight of pyridine to neutralize the acidity of the silica gel. The column was equilibrated with 1‰ (by weight) pyridine and eluted with a gradient of dichloromethane:methanol = 10:1 - 2:1. The eluate was collected and the solvent was evaporated under reduced pressure to give 3.49 g of pure product Z-2. MS m/z: C79H129N10O33, [M+H]+, calculated: 1746.94, measured: 1746.90.

(12-3) Synthesis of Z-3.

[344] Z-2 (3.49 g, 2.0 mmol) and A-1 (3.06 g, 6.0 mmol), obtained in accordance with the method described in step (1-7a), were mixed and dissolved in 30 ml dichloromethane and 3-(diethoxyphosphoryloxy)-1,2,3-benzotrizin-4(3H)-one (DEPBT, 1.80 g, 6.0 mmol) was added thereto, followed by diisopropylethylamine (1.55 g, 12.0 mmol) to carry out the reaction for 3 hours with stirring at 25°C. 100 ml of dichloromethane was added to the resulting reaction solution for dilution. The organic phase was washed twice with 30 ml of saturated sodium bicarbonate. The aqueous phase was extracted with 10 ml dichloromethane. All organic phases were combined and washed with 50 ml of saturated brine. The resulting organic phases were combined, dried over anhydrous sodium sulfate and filtered. The solvent was evaporated under reduced pressure, and the residue was foam dried overnight with an oil vacuum pump to give a crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, 200 g, with 20 ml of triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with petroleum ether containing 1% by weight of triethylamine and eluted with a dichloromethane:methanol = 25:1-15:1 gradient. The eluate was collected and the solvent was evaporated under reduced pressure to give 2.2 g of pure product Z-3. MS m/z: C103H151N10O38, [M+H]+, calculated: 2136.02, measured: 2136.20.

(12-4) Synthesis of Z-4.

[345] Z-3 (2.10 g, 0.983 mmol) was dissolved in 14.8 ml of dichloromethane containing DIEA (635 mg, 4.915 mmol), to the resulting solution was added 4-dimethylaminopyridine (DMAP, 240 mg, 1.966 mmol) and stirred until transparent. Succinic anhydride (197 mg, 1.966 mmol) was added to carry out the reaction for 18 hours with stirring at 25°C. To the resulting reaction solution was added 50 ml of dichloromethane to dilute, and washed with 80 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted twice with 50 ml dichloromethane. All organic phases were combined and the solvent was evaporated under reduced pressure to give the crude product. The crude product was subjected to column purification using normal phase silica gel, 200-300 mesh, 188 g, with 1% by weight triethylamine to neutralize the acidity of the silica gel. The column was equilibrated with dichloromethane and eluted with a gradient: dichloromethane containing 1‰ (by weight) triethylamine:methanol = 10:1 - 3:1. The eluate was collected and the solvent was evaporated under reduced pressure to give 1.95 g of pure product, conjugation molecule Z-4 (Conjugation molecule 12). MS m/z: C107H155N10O41, [M+H]+, calculated: 1935.07, measured: 1935.29. The structure of the resulting Z-4 Conjugating Molecule is represented by formula (422).

Production Example 13 Preparation of L10-siHBa1 Conjugate (Conjugate 9).

[346] In this preparation example, L10-siHBa1 Conjugate (hereinafter also referred to as Conjugate 9) was prepared from the L-9 conjugate molecule (Conjugate molecule 1) according to the following method.

(13-1) Synthesis of compound L-10.

[347] At this stage, the compound L-10 was obtained by connecting the Conjugating molecule L-9 with a solid phase support.

[348] Conjugating molecule L-9 (0.233 g, 0.1126 mmol) obtained in step (1-8), O-benzotriazoletetramethyluronium hexafluorophosphate (HBTU, 0.064 g, 0.1689 mmol) and diisopropylethylamine (DIPEA, 0.029 g, 0.2252 mmol) was mixed and dissolved in 19 ml of acetonitrile, and stirred at room temperature for 5 minutes. Aminomethyl resin (0.901 g, 100-200 mesh, amine loading: 400 µmol/g, purchased from Tianjin Nankai HECHENG S&T Co., Ltd.) was added to the liquid reaction mixture. The reaction was carried out on a shaker at 25°C and 220 rpm. for 15 hours and then filtered. The residue was washed twice with 30 ml DCM, three times with 30 ml of acetonitrile and once with 30 ml of ethyl ether and dried for 2 hours with a vacuum oil pump. The capping reaction was then carried out according to the charge ratio as shown in Table 2.

Table 2. Charge ratio of the capping reaction.

Raw Materials Quantity Level batch number Manufacturer Cap 1 20 ml - - - Cap 2 2.3 ml - - - DMAP 0.01 g analytically pure I1422139 Aladdin acetonitrile 2.3 ml spectroscopically pure O15161001 CINC (Shanghai) Co.,Ltd

[349] In the table above, Cap 1 and Cap 2 are solutions of capping reagents. Cap 1 is a solution of 20% v/v N-methylimidazole in a mixture of pyridine/acetonitrile, the volume ratio of pyridine to acetonitrile being 3:5. Cap 2 is a solution of 20% v/v acetic anhydride in acetonitrile.

[350] Cap 1, Cap 2, 4-dimethylaminopyridine (DMAP) and acetonitrile were added to the above reaction mixture. The reaction was carried out on a shaker at 25°C and 200 rpm. within 5 hours. The liquid reaction mixture was filtered. The residue was washed three times, each time with 30 ml of acetonitrile, the solvent was evaporated to dryness, and the mixture was dried overnight under reduced pressure using a vacuum oil pump to obtain 1.100 g of compound L-10 (i.e., conjugating molecule L-9, bound with a solid-phase support), with a load of 90.8 µmol/g. The structure of compound L-10 can be represented by formula (523).

(13-2) Synthesis of the sense strand of the L10-siHB1 conjugate.

[351] At this stage, the siRNA of the siRNA conjugate is the sequence number siHBa1:

siHBa1

sense strand: 5'- CCUUGAGGCAUACUUCAAA-3' (SEQ ID NO: 1),

antisense strand: 5'-UUUGAAGUAUGCCUCAAGGUU-3' (SEQ ID NO: 2).

[352] The nucleoside monomers were added one by one in the 3' to 5' direction according to the above sequence by the phosphoramidite solid phase synthesis method, starting from compound L-10 obtained in the above step. Attachment of each nucleoside monomer involved a four step reaction of deprotection, coupling, capping and oxidation. Synthesis conditions were as described below.

[353] Nucleoside monomers have been proposed in 0.1 M acetonitrile. Conditions were the same for each deprotection reaction, i.e., temperature 25°C, reaction time 70 seconds, a solution of dichloroacetic acid in dichloromethane (3% v/v) as deprotecting agent, and the molar ratio of dichloroacetic acid to protective group on a solid-phase substrate 4,4'-dimethoxytrityl was 5:1.

[354] Conditions were the same for each coupling reaction including temperature 25°C, molar ratio of nucleic acid sequence attached to solid phase support to nucleoside monomers 1:10, molar ratio of nucleic acid sequence attached to solid phase support to coupling agent 1:65, reaction time 600 seconds and 0.5 M acetonitrile solution of 5-ethylthio-1H-tetrazole as coupling agent.

[355] The conditions were the same for each capping reaction, including a temperature of 25°C and a reaction time of 15 seconds. The capping agent was a mixed solution of Cap 1 and Cap 2 in a 1:1 molar ratio; and the molar ratio of the capping reagent to the nucleic acid sequence attached to the solid phase support was as follows: acetic anhydride: N-methylimidazole: nucleic acid sequence attached to the solid phase support = 1:1:1.

[356] the Conditions were the same for each oxidation reaction, including a temperature of 25°C, a reaction time of 15 seconds and 0.05 M iodine water as an oxidizing reagent; and the molar ratio of iodine to the nucleic acid sequence attached to the solid phase support in the coupling step was 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1.

[357] The conditions for cleavage and deprotection were as follows. The synthesized nucleotide sequence bound to the substrate was added to 25% by weight aqueous ammonia to carry out the reaction for 16 hours at 55°C, and the aqueous ammonia was in the amount of 0.5 ml/μmol relative to the nucleotide sequence. The liquid was removed and the residue was concentrated to dryness in vacuo. After treatment with aqueous ammonia, the product was dissolved in N-methylpyrrolidone at 0.4 ml/μmol, and then 0.3 ml/μmol triethylamine and 0.6 ml/μmol triethylamine trihydrofluoride were added, relative to the amount of single-stranded nucleic acid, thereby deprotecting 2 '-TBDMS with ribose. Purification and desalting: Nucleic acid purification was performed using a preparative ion exchange chromatography column (Source 15Q) eluting with a NaCl gradient. In particular, eluent A: 20 mM sodium phosphate (pH 8.1), solvent: water/acetonitrile = 9:1 (v/v); eluent B: 1.5 M sodium chloride, 20 mM sodium phosphate (pH 8.1), solvent: water/acetonitrile = 9:1 (v/v); elution gradient: eluent A: eluent B = 100:0 - 50:50. The eluate was collected, combined and desalted using a reverse phase chromatography column. The peculiarity of the conditions was that a column with Sephadex was used for desalting, with Sephadex G25 being used as a filler, and deionized water was used for elution.

[358] Detection: Purity as determined by ion exchange chromatography (IO-HPLC) was 92.4%; and the molecular weight was analyzed by liquid chromatography/mass spectrometry (LC/MS), where the calculated value was 7253.96 and the measured value was 7253.12.

[359] Thus, at this stage, the L-9 Conjugation molecule was attached to the 3' end of the resulting sense strand, resulting in an siRNA sense strand (C) in which the L-9 Conjugation molecule was conjugated to the 3' end of the siRNA.

(13-3) Synthesis of the antisense strand.

[360] At this point, the antisense strand (AC) of the L10-siHB1 conjugate was synthesized using a universal solid phase support (UnyLinker™ loaded NittoPhase®HL solid supports, Kinovate Life Sciences Inc.). An siRNA antisense strand (AS) was prepared using the same conditions as those used to synthesize the sense strand, including deprotection, coupling, capping, and oxidation reaction conditions in a solid phase synthesis method, deprotection and cleavage conditions, and isolation conditions.

[361] Detection: Purity detected by IO-HPLC was 93.2%; and the molecular weight was analyzed by LC/MS, where the calculated value was 6675.04 and the measured value was 6674.50.

(13-4) Synthesis of L10-siHBa1 conjugate.

[362] The C chain and AC chain were dissolved in water for injection to obtain a solution of 40 mg/ml, respectively. They were mixed in equimolar ratios, heated for 15 min at 50°C, and then cooled to room temperature with the formation of a double-stranded structure by hydrogen bonds.

[363] After completion of the above synthesis, the conjugate was diluted to a concentration of 0.2 mg/mL using ultrapure water (in-house with a Milli-Q ultrapure water machine, resistivity 18.2 MΩ*cm (25°C) ). The molecular weight was measured with an LC/MS device (purchased from Waters Corp., model: LCT Premier). As a result, the calculated molecular weights for C and AC were 7253.96 and 6675.04, respectively, and the measured values for them were 7253.24 and 6674.61, respectively. The synthesized conjugate was confirmed to be the target designed double-stranded nucleic acid sequence with Conjugating molecule L9, since the measured values corresponded to the calculated values. The structure of the L10-siHBa1 conjugate (Conjugate 9) is represented by formula (3).

Preparation Example 14 Preparation of conjugates 16-18, 24-26, 42-43, 62, 78, 105, 109, 111, 115, 144 and 154-171.

[364] These conjugates were prepared using the same method as described in Preparation Example 13, except that: 1) the conjugated siRNAs have the sequences shown in Tables 3A-3G corresponding to conjugates 16-18, 24-26, 42 - 43, 62, 78, 105, 109, 111, 115, 144, 157 - 163 and 167 - 171; 2) if a phosphorothioate bond is present between two nucleotides in the target sequence, then the next sulfonation reaction step is used as a replacement for the oxidation reaction step during the joining of the last of the two nucleotides; the conditions were the same for each sulfonation reaction, including a temperature of 25°C, a reaction time of 300 seconds, and xanthan hydride as a sulfonating agent; the molar ratio of the sulfonating reagent to the nucleic acid sequence attached to the solid phase support in the coupling step was 120:1; The reaction was carried out in a mixed solvent of acetonitrile: pyridine = 1:1; and 3) if the 2' positions of all nucleotides in the target sequence are modified hydroxy groups, then the step of deprotecting the 2'-TBDMS from the ribose is not included in the cleavage and deprotection conditions. Thus, conjugates 16-18, 24-26, 42-43, 62, 78, 105, 109, 111, 115, 144, 157-163 are obtained according to the present description.

[365] In addition, conjugates 154-156 and 164-166 were prepared using the same method as described in Preparation Example 13, except that the following Conjugation Molecules were used to replace Conjugation Molecule L-9, respectively: Conjugate 164 was prepared from Conjugating Molecule P-9 (Conjugating Molecule 2) which was obtained in Preparation Example 2; Conjugates 155, 156, and 165 were prepared from Conjugation Molecule W-7 (Conjugation Molecule 7) which was prepared in Preparation Example 7; Conjugates 154 and 166 were obtained from Z-4 (Conjugate molecule 12) which was obtained in Preparation Example 12, and the conjugated siRNAs have the sequences shown in Tables 3A to 3G corresponding to conjugates 154 to 156 and 164 to 166, respectively, and the conjugates were numbered separately according to tables 3A - 3G. Their structures are represented by formula (3), formula (4), formula (15), and formula (22), respectively. The molecular weights of the conjugates were measured by LC/MS as described below:

Conjugate 142: Calculated values: C: 7649.55, AC: 6991.46,

- Measured values: C: 7649.1, AC: 6991;

Conjugate 170: Calculated values: C: 7649.55, AC: 6995.47,

- Measured values: C: 7648.8, AC: 6994.8;

Conjugate 171: Calculated values: C: 7649.55, AC: 7011.53,

- Measured values: C: 7648.8, AC: 7010.9;

Conjugate 115: Calculated values: C: 7584.5, AC: 7007.46,

- Measured values: C: 7584, AC: 7006.2;

Conjugate 109: Calculated values: C: 7584.5, AC: 6931.47,

- Measured values: C: 7584, AC: 6930.9;

Conjugate 106: Calculated values: C: 7572.47, AC: 6907.41,

- Measured values: C: 7571.8, AC: 6906.9;

Conjugate 113: Calculated values: C: 7584.5, AC: 7011.47,

- Measured values: C: 7584, AC: 7011.3;

Conjugate 17: Calculated values: C: 7504.34, AC: 6961.52,

- Measured values: C: 7503.4, AC: 6960.9;

Conjugate 25: Calculated values: C: 7504.34, AC: 7037.51,

- Measured values: C: 7503.6, AC: 7036.9;

Conjugate 18: Calculated values: C: 8218.83, AC: 7703.05,

- Measured values: C: 8218, AC: 7702.5;

Conjugate 16: Calculated values: C: 7516.37, AC: 6985.58,

- Measured values: C: 7516.5, AC: 6984.9;

Conjugate 159: Calculated values: C: 7504.34, AC: 7057.58,

- Measured values: C: 7503.6, AC: 7057;

Conjugate 160: Calculated values: C: 7504.34, AC: 7041.52,

- Measured values: C: 7503.6, AC: 7040.8;

Conjugate 161: Calculated values: C: 7516.37, AC: 7065.58,

- Measured values: C: 7516.6, AC: 7064.5;

Conjugate 162: Calculated values: C: 7504.34, AC: 7139.68,

- Measured values: C: 7515.6, AC: 7138.9;

Conjugate 163: Calculated values: C: 7516.37, AC: 7081.64,

- Measured values: C: 7515.6, AC: 7080.9;

Conjugate 62: Calculated values: C: 7485.3, AC: 7161.7,

- Measured values: C: 7484.4, AC: 7160.9;

Conjugate 78: Calculated values: C: 7423.22, AC: 7207.78,

- Measured values: C: 7422.6, AC: 7207.2;

Conjugate 42: Calculated values: C: 7407.22, AC: 7208.77,

- Measured values: C: 7406.4, AC: 7208.1;

Conjugate 43: Calculated values: C: 7407.22, AC: 7170.72,

- Measured values: C: 7406.5, AC: 7170.1,

and the measured values correspond to the calculated values.

Table 3A. miRNA conjugates.

Table 3A.

conjugate No. Sequence direction 5' - 3' SEQID NO Conjugate 10 L10-siHBa1 WITH* CCUUGAGGCAUACUUCAAAA 1 AC UUUGAAGUAUGCCUCAAGGUU 2 Conjugate 11 L10-siHBa2 WITH GACCUUGAGGCAUACUUCAAAA 3 AC UUUGAAGUAUGCCUCAAGGUCGG 4 Conjugate 12 L10-siHBa1M1 WITH CmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 5 AC UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmUm 6 Conjugate 13 L10-siHBa1M2 WITH CmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 7 AC UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmUm 8 Conjugate 14 L10-siHBa2M1 WITH GmAmCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 9 AC UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmGmGm 10 Conjugate 15 L10-siHBa2M2 WITH GmAmCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm eleven AC UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmGmGm 12 Conjugate 16 L10-siHBa1M1S WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 14 Conjugate 17 L10-siHBa1M2S WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 15 AC UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm 16 Conjugate 18 L10-siHBa2M1S WITH GmsAmsCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 17 AC UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm 18 Conjugate 19 L10-siHBa2M2S WITH GmsAmsCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 19 AC UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm 20 Conjugate 20 L10-siHBa1M1P WITH CmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 5 AC VP-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmUm 136 Conjugate 21 L10-siHBa1M2P WITH CmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 7 AC VP-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmUm 137 Conjugate 22 L10-siHBa2M1P WITH GmAmCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 9 AC VP-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmGmGm 138 Conjugate 23 L10-siHBa2M2P WITH GmAmCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm eleven AC VP-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmGmGm 139 Conjugate 24 L10-siHBa1M1SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Conjugate 25 L10-siHBa1M2SP WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 15 AC VP-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm 141 Conjugate 26 L10-siHBa2M1SP WITH GmsAmsCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 17 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm 142 Conjugate 27 L10-siHBa2M2SP WITH GmsAmsCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 19 AC VP-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm 143 Conjugate 28 L10-siHBa1M5SP WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 15 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Conjugate 29 L10-siHBa1M3SP WITH CmsCmsUmUmGmAmGfGmCfAmUfAmCmUmUmCmAmAmAm 144 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Conjugate 30 L10-siHBa1M4SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUfAmUmGmCmCmUfCmAfAmGmGmsUmsUm 145 Conjugate 31 P10-siHBa1M1SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Conjugate 32 R5-siHBa1M1SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Conjugate 33 LA5-siHBa1M1SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Conjugate 34 LB5-siHBa1M1SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Conjugate 35 V8-siHBa1M1SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Conjugate 36 W8-siHBa1M1SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Conjugate 37 X8-siHBa1M1SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Conjugate 154 Z5-siHBa1M2SP WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 15 AC VP-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm 141 Conjugate 155 W8-siHBa1M2SP WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 15 AC VP-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm 141 Comparable conjugate 4 K4-siHBa1M1SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Comparable conjugate 5 (GalNAc)3-siHBa1M1SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140 Comparable conjugate 6 FIN-siHBa1M1SP WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 13 AC VP-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 140

Table 3B.

conjugate No. Sequence direction 5' - 3' SEQID NO Conjugate 38 L10-siHBb1M1S WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsGmsCm 39 Conjugate 39 L10-siHBb2M1S WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 40 Conjugate 40 L10-siHBb1M2 WITH UmGmCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 35 AC UmAfGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmGmCm 36 Conjugate 41 L10-siHBb2M2 WITH UmGmCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 35 AC UmAfGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmUmUm 37 Conjugate 42 L10-siHBb1M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsGmsCm 146 Conjugate 43 L10-siHBb2M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 147 Conjugate 44 L10-siHBb1M2SP WITH UmsGmsCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 41 AC VP-UmsAfsGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmsGmsCm 148 Conjugate 45 L10-siHBb2M2SP WITH UmsGmsCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 41 AC VP-UmsAfsGmAmAmGfAmUfGfAmGmGmCmAfUmAfGmCmAmsUmsUm 149 Conjugate 46 L10-siHBb1M5SP WITH UmGmCmUmAfUmGfCfCfUmCmAmUmCmUmUmCmUmAm 41 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsGmsCm 146 Conjugate 47 L10-siHBb1M3SP WITH UmsGmsCmUmAfUmGfCmCfUmCmAmUmCmUmUmCmUmAm 150 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsGmsCm 146 Conjugate 48 L10-siHBb1M4SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUfGmAmGmGmCmAfUmAfGmCmAmsGmsCm 151 Conjugate 49 L10-siHBb4M1SP WITH GmsCmsUmGmCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 152 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmGmCmsGmsCm 153 Conjugate 50 L10-siHBb1 WITH UGCUAUGCCUCAUCUUCUA 29 AC UAGAAGAUGAGGCAUAGCAGC thirty Conjugate 51 L10-siHBb2 WITH UGCUAUGCCUCAUCUUCUA 29 AC UAGAAGAUGAGGCAUAGCAUU 31 Conjugate 52 P10-siHBb2M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 147 Conjugate 53 R5-siHBb2M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 147 Conjugate 54 LA5-siHBb2M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 147 Conjugate 55 LB5-siHBb2M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 147 Conjugate 56 V8-siHBb2M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 147 Conjugate 57 W8-siHBb2M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 147 Conjugate 58 X8-siHBb2M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 147 Comparable conjugate 7 K4-siHBb2M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 147 Comparable conjugate 8 GalNAc-
siHBb2M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 147 Comparable conjugate 9 FIN-siHBb2M1SP WITH UmsGmsCmUmAmUmGfCfCfUmCmAmUmCmUmUmCmUmAm 38 AC VP-UmsAfsGmAmAmGfAmUmGmAmGmGmCmAfUmAfGmCmAmsUmsUm 147

Table 3C.

conjugate No. Sequence direction 5' - 3' SEQID NO Conjugate 59 L10-siHBc1 WITH UCUGUGCCUUCUCAUCUGA 52 AC UCAGAUGAGAAGGCACAGACG 53 Conjugate 60 L10-siHBc1M1 WITH UmCmUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 54 AC UmCfAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmCmGm 55 Conjugate 61 L10-siHBc1M2 WITH UmCmUmGmUfGmCfCfUfUmCmUmCmAmUmCmUmGmAm 56 AC UmCfAmGmAmUfGmAfGfAmAmGmGmCfAmCfAmGmAmCmGm 57 Conjugate 62 L10-siHBc1M1SP WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC VP-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 154 Conjugate 63 L10-siHBc1M2SP WITH UmsCmsUmGmUfGmCfCfUfUmCmUmCmAmUmCmUmGmAm 60 AC VP-UmsCfsAmGmAmUfGmAfGfAmAmGmGmCfAmCfAmGmAmsCmsGm 155 Conjugate 64 L10-siHBc1M3SP WITH UmsCmsUmGmUfGmCfCmUfUmCmUmCmAmUmCmUmGmAm 156 AC VP-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 154 Conjugate 65 L10-siHBc1M4SP WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC VP-UmsCfsAmGmAmUfGmAfGmAmAmGmGmCfAmCfAmGmAmsCmsGm 157 Conjugate 66 L10-siHBc1M5SP WITH UmsCmsUmGmUfGmCfCfUfUmCmUmCmAmUmCmUmGmAm 60 AC VP-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 154 Conjugate 67 L10-siHBc2M1SP WITH CmsGmsUmCmUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 158 AC VP-UmsCfsAmGmAmUfGmAfGfAmAmGmGmCfAmCfAmGmAmsCmsGmGmGm 159 Conjugate 68 P10-siHBc1M1SP WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC VP-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 154 Conjugate 69 R5-siHBc1M1SP WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC VP-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 154 Conjugate 70 LA5-siHBc1M1SP WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC VP-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 154 Conjugate 71 LB5-siHBc1M1SP WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC VP-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 154 Conjugate 72 V8-siHBc1M1SP WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC VP-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 154 Conjugate 73 W8-siHBc1M1SP WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC VP-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 154 Conjugate 74 X8-siHBc1M1SP WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC VP-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 154 Comparable conjugate 10 K4-siHBc1M1SP WITH UmsCmsUmGmUmGmCfCfUfUmCmUmCmAmUmCmUmGmAm 58 AC VP-UmsCfsAmGmAmUfGmAmGmAmAmGmGmCfAmCfAmGmAmsCmsGm 154

Table 3D.

conjugate No. Sequence direction 5' - 3' SEQID NO Conjugate 75 L10-siHBd1 WITH CGUGUGCACUUCGCUUCAA 66 AC UUGAAGCGAAGUGCACACGGU 67 Conjugate 76 L10-siHBd1M1 WITH CmGmUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 68 AC UmUfGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmGmUm 69 Conjugate 77 L10-siHBd1M2 WITH CmGmUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm 70 AC UmUfGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmGmUm 71 Conjugate 78 L10-siHBd1M1SP WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 160 Conjugate 79 L10-siHBd1M2SP WITH CmsGmsUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm 74 AC VP-UmsUfsGmAmAmGfCmGfAfAmGmUmGmCfAmCfAmCmGmsGmsUm 161 Conjugate 80 L10-siHBd1M3SP WITH CmsGmsUmGmUfGmCfAmCfUmUmCmGmCmUmUmCmAmAm 162 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 160 Conjugate 81 L10-siHBd1M4SP WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC VP-UmsCfsAmGmAmUfGmAfGmAmAmGmGmCfAmCfAmGmAmsCmsGm 163 Conjugate 82 L10-siHBd1M5SP WITH CmsGmsUmGmUfGmCfAfCfUmUmCmGmCmUmUmCmAmAm 74 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 160 Conjugate 83 L10-siHBd2M1SP WITH AmsCmsCmGmUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 164 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmGmUmsCmsCm 165 Conjugate 84 P10-siHBd1M1SP WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 160 Conjugate 85 R5-siHBd1M1SP WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 160 Conjugate 86 LA5-siHBd1M1SP WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 160 Conjugate 87 LB5-siHBd1M1SP WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 160 Conjugate 88 V8-siHBd1M1SP WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 160 Conjugate 89 W8-siHBd1M1SP WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 160 Conjugate 90 X8-siHBd1M1SP WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 160 Comparable conjugate 11 K4-siHBd1M1SP WITH CmsGmsUmGmUmGmCfAfCfUmUmCmGmCmUmUmCmAmAm 72 AC VP-UmsUfsGmAmAmGfCmGmAmAmGmUmGmCfAmCfAmCmGmsGmsUm 160

Table 3E.

conjugate No. Sequence direction 5' - 3' SEQID NO Conjugate 91 L10-siAN1 WITH CCAAGAGCACCAAGAACUA 80 AC UAGUUCUUGGUGCUCUUGGCU 81 Conjugate 92 L10-siAN2 WITH AGCCAAGAGCACCAAGAACUA 82 AC UAGUUCUUGGUGCUCUUGGCUUG 83 Conjugate 93 L10-siAN1M1 WITH CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 84 AC UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUm 85 Conjugate 94 L10-siAN2M1 WITH AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 86 AC UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUmUmGm 87 Conjugate 95 L10-siAN1M2 WITH CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 84 AC UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm 88 Conjugate 96 L10-siAN2M2 WITH AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 86 AC UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmUmGm 89 Conjugate 97 L10-siAN1M3 WITH CmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 90 AC UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm 88 Conjugate 98 L10-siAN2M3 WITH AmGmCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 91 AC UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmUmGm 89 Conjugate 99 L10-siAN1M1P WITH CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 84 AC VP-UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUm 166 Conjugate 100 L10-siAN2M1P WITH AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 86 AC VP-UmAfGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUmUmGm 167 Conjugate 101 L10-siAN1M2P WITH CmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 84 AC VP-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm 168 Conjugate 102 L10-siAN2M2P WITH AmGmCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 86 AC VP-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmUmGm 169 Conjugate 103 L10-siAN1M3P WITH CmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 90 AC VP-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUm 168 Conjugate 104 L10-siAN2M3P WITH AmGmCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 91 AC VP-UmAfGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmUmGm 169 Conjugate 105 L10-siAN1M1S WITH CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 92 AC UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmsCmsUm 93 Conjugate 106 L10-siAN2M1S WITH AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 94 AC UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 95 Conjugate 107 L10-siAN1M2S WITH CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 92 AC UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 96 Conjugate 108 L10-siAN2M2S WITH AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 94 AC UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 97 Conjugate 109 L10-siAN1M3S WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 96 Conjugate 110 L10-siAN2M3S WITH AmsGmsCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 99 AC UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 97 Conjugate 111 L10-siAN1M1SP WITH CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 92 AC VP-UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmsCmsUm 170 Conjugate 112 L10-siAN2M1SP WITH AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 94 AC VP-UmsAfsGmUmUmCfUmUfGfGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 171 Conjugate 113 L10-siAN1M2SP WITH CmsCmsAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 92 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 172 Conjugate 114 L10-siAN2M2SP WITH AmsGmsCmCmAmAmGfAmGfCfAfCmCmAmAmGmAmAmCmUmAm 94 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 173 Conjugate 115 L10-siAN1M3SP WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 172 Conjugate 116 L10-siAN2M3SP WITH AmsGmsCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 99 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 173 Conjugate 117 L10-siAN1M4S WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC UmsAfsGmUmUmCfUmUfGmGmUmGmCmUfCmUfUmGmGmsCmsUm 174 Conjugate 118 L10-siAN1M4SP WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC VP-UmsAfsGmUmUmCfUmUfGmGmUmGmCmUfCmUfUmGmGmsCmsUm 175 Conjugate 119 L10-siAN1M5S WITH CmsCmsAmAmGfAmGfCmAfCmCmAmAmGmAmAmCmUmAm 176 AC UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 177 Conjugate 120 L10-siAN1M5SP WITH CmsCmsAmAmGfAmGfCmAfCmCmAmAmGmAmAmCmUmAm 176 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 178 Conjugate 121 P10-siAN1M3SP WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 172 Conjugate 122 R5-siAN1M3SP WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 172 Conjugate 123 LA5-siAN1M3SP WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 172 Conjugate 124 LB5-siAN1M3SP WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 172 Conjugate 125 V8-siAN1M3SP WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 172 Conjugate 126 W8-siAN1M3SP WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 172 Conjugate 127 X8-siAN1M3SP WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 172 Conjugate 156 W8-siAN1M3SPs WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC Ps-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 203 Conjugate 157 L10-siAN1M3SPs WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC Ps-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 203 Comparable conjugate 12 K4-siAN1M3SP WITH CmsCmsAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 98 AC VP-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmsCmsUm 172

Table 3F.

Conjugate No. Sequence direction 5' - 3' SEQID NO Conjugate 128 L10-siAP1 WITH CAAUAAAGCUGGACAAGAA 108 AC UUCUUGUCCAGCUUUAUUGGG 109 Conjugate 129 L10-siAP2 WITH CCCAAUAAAGCUGGACAAGAA 110 AC UUCUUGUCCAGCUUUAUUGGGAG 111 Conjugate 130 L10-siAP1M1 WITH CmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 112 AC UmUfCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGm 113 Conjugate 131 L10-siAP2M1 WITH CmCmCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 114 AC UmUfCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGmAmGm 115 Conjugate 132 L10-siAP1M2 WITH CmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 116 AC UmUfCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGm 117 Conjugate 133 L10-siAP2M2 WITH CmCmCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 118 AC UmUfCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmAmGm 119 Conjugate 134 L10-siAP1M1P WITH CmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 112 AC VP-UmUfCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGm 179 Conjugate 135 L10-siAP2M1P WITH CmCmCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 114 AC VP-UmUfCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGmAmGm 180 Conjugate 136 L10-siAP1M2P WITH CmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 116 AC VP-UmUfCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGm 181 Conjugate 137 L10-siAP2M2P WITH CmCmCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 118 AC VP-UmUfCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmAmGm 182 Conjugate 138 L10-siAP1M1S WITH CmsAmsAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 120 AC UmsUfsCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmsGmsGm 121 Conjugate 139 L10-siAP2M1S WITH CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 122 AC UmsUfsCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm 123 Conjugate 140 L10-siAP1M2S WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 125 Conjugate 141 L10-siAP2M2S WITH CmsCmsCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 126 AC UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm 127 Conjugate 142 L10-siAP1M1SP WITH CmsAmsAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 120 AC VP-UmsUfsCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmsGmsGm 183 Conjugate 143 L10-siAP2M1SP WITH CmsCmsCmAmAmUmAfAmAfGfCfUmGmGmAmCmAmAmGmAmAm 122 AC VP-UmsUfsCmUmUmGfUmCfCfAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm 184 Conjugate 144 L10-siAP1M2SP WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 185 Conjugate 145 L10-siAP2M2SP WITH CmsCmsCmAmAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 126 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmGmGmsAmsGm 186 Conjugate 146 P10-siAP1M2SP WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 185 Conjugate 147 R5-siAP1M2SP WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 185 Conjugate 148 LA5-siAP1M2SP WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 185 Conjugate 149 LB5-siAP1M2SP WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 185 Conjugate 150 V8-siAP1M2SP WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 185 Conjugate 151 W8-siAP1M2SP WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 185 Conjugate 152 X8-siAP1M2SP WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 185 Comparable conjugate 13 K4-siAP1M3SP WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 124 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 185

Table 3G.

conjugate No. Sequence direction 5' - 3' SEQID NO Conjugate 158 L10-simTTR WITH AfsAmsCfAmGfUmGfUmUfCfUfUmGfCmUfCmUfAmUfAmAf 204 AC UmsUfsAmUfAmGfAmGfCmAfAmGmAmAfCmAfCmUfGmUfUmsUmsUm 205 Conjugate 159 L10-siHBa1M2Sps WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 206 AC ps-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm 207 Conjugate 160 L10-siHBa1M2Sp WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 208 AC p-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm 209 Conjugate 161 L10-siHBa1M1Sp WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 210 AC p-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 211 Conjugate 162 L10-siHBa1M1SpsT WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 212 AC ps-TmoesUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 213 Conjugate 163 L10-siHBa1M1Sps WITH CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm 214 AC ps-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm 215 Conjugate 164 P10-siHBa1M2SP WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 216 AC VP-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm 217 Conjugate 165 W8-siHBa1M2SP WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 218 AC VP-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm 219 Conjugate 166 Z5-siHBa1M2SP WITH CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm 220 AC VP-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm 221 Conjugate 167 L10-siP1M1Sp WITH GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 222 AC p-UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm 223 Conjugate 168 L10-siP1M1SP WITH GmsAmsAmAmGmUmAfUfGfUmCmAmAmCmGmAmAmUmAm 224 AC VP-UmsAfsUmUmCmGfUmUmGmAmCmAmUmAfCmUfUmUmCmsUmsUm 225 Conjugate 169 L10-siAN2M1Sp WITH AmsGmsCmCmAmAmGmAmGfCfAfCmCmAmAmGmAmAmCmUmAm 226 AC p-UmsAfsGmUmUmCfUmUmGmGmUmGmCmUfCmUfUmGmGmCmUmsUmsGm 227 Conjugate 170 L10-siAP1M1Sp WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 228 AC p-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 229 Conjugate 171 L10-siAP1M1Sps WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 230 AC ps-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 231 Comparable conjugate 14 K4-simTTR WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 232 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 233 Comparable conjugate 15 AD-66810 WITH CmsAmsAmUmAmAmAfGfCfUmGmGmAmCmAmAmGmAmAm 234 AC VP-UmsUfsCmUmUmGfUmCmCmAmGmCmUmUfUmAfUmUmGmsGmsGm 235 Comparable conjugate 16 AD-65695 WITH AmsCmsAmUmAmUmUfUmGfAfUfCmAmGmUmCmUmUmUmUmUm 195 AC AmsAfsAmAmAmGfAmCmUmGmAmUmCmAfAmAfUmAmUmGmUmsUmsGm 196 Comparable conjugate 17 AD-69535 WITH GmsCmsUmUmAmAmAmAmGfGmGfAmCmAmGmUmAmUmUmCmAm 197 AC UmsGfsAmAmUmAmCmUmGmUmCmCfCmUfUmUmUmAmAmGmCmsAmsAm 198 Comparable miRNA 18 X2M2 WITH CmCmUmUmGAGGCmAUmACmUmUmCmAAAdTsdT 236 AC UfUmUfGAAGUfAUGCCUfCAAGGdTsdT 237

*C: semantic chain; AS: antisense strand

Note: capital letters C, G, U and A indicate the composition of the bases of the nucleotides; dT indicates the nucleotide deoxythymine; a lowercase m indicates that the nucleotide adjacent to the left of the m is a 2'-methoxy-modified nucleotide; a lowercase f indicates that the nucleotide adjacent to the left of f is a 2'-fluorine-modified nucleotide; a lowercase s indicates a phosphorothioate bond between two nucleotides adjacent to the s on both sides; VP indicates that the nucleotide adjacent to the right of the letters VP is a vinyl phosphate-modified nucleotide; P indicates that the nucleotide adjacent to the right of the letter P is a phosphate-modified nucleotide; Ps indicates that the nucleotide adjacent to the right of the letters Ps is a phosphorothioate-modified nucleotide; Tmoe refers to the nucleotide thymine modified with a 2'-methoxy group.

[366] Vinyl phosphate and 2'-methoxy-modified uridine monomer (VP-Um) was synthesized according to the following method:

(14-1) Synthesis of VP-U-2.

[367] The VP-U-2 molecule was synthesized according to the following method:

[368] 2'-methoxy-modified nucleoside uracil (2'-OMe-U, 51.30 g, 91.6 mmol), tert-butyl diphenylchlorosilane (TBDPSCl, 50.35 g, 183.2 mmol) and imidazole (12.47 g, 183.2 mmol) was mixed and dissolved in 450 ml of N,N-dimethylformamide (DMF) to react for 20 hours with stirring at room temperature. The DMF was removed by evaporation and the residue was dissolved with 600 ml of dichloromethane and washed with 300 ml of saturated sodium bicarbonate. The separated aqueous phase was extracted three times, each time with 300 ml of dichloromethane. All organic phases were combined, washed with 5% oxalic acid until the pH of the aqueous phase was <5. The solvent was evaporated to dryness to give the crude product VP-U-1, which was directly used in the subsequent synthesis of VP-U-2.

[369] The crude product VP-U-1 was dissolved in 100 ml of dichloromethane, and then stirred for 10 minutes in an ice bath. 450 ml of a 2% solution of p-toluenesulfonic acid (with a mixed solvent of methanol and dichloromethane in a 3:7 v/v ratio) pre-cooled in a refrigerator at 4°C was added to carry out a reaction for 10 minutes. The reaction was quenched by adding 200 ml of saturated sodium bicarbonate. The resulting organic phase was washed with saturated sodium bicarbonate solution until pH = 8. The aqueous phases were combined and extracted twice with 200 ml of dichloromethane. All organic phases were combined and washed once with 200 ml of saturated brine. The solvent was evaporated and the residue was purified using a normal phase silica gel column, 200-300 mesh. The column was filled with petroleum ether and eluted with a gradient of petroleum ether:ethyl acetate:dichloromethane:methanol = 1:1:1:0.05 - 1:1:1:0.25. The eluate was collected, the solvent was evaporated under reduced pressure, and the residue was foam dried using a vacuum oil pump to give a total of 40.00 g of pure VP-U-2 product. 1H NMR (400 MHz, DMSO-d6) δ 7.96 (d, J = 7.8 Hz, 1H), 7.64 (dtd, J = 5.1, 4.0, 2.2 Hz, 4H) , 7.41-7.30 (m, 6H), 6.79 (d, J = 4.7 Hz, 1H), 5.73 (d, J = 7.6 Hz, 1H), 4.94 ( t, J = 7.0 Hz, 1H), 4.12 (td, J = 4.6, 3.9 Hz, 1H), 4.05 (dd, J = 4.8, 4.0 Hz, 1H ), 3.96 (t, J = 4.7 Hz, 1H), 3.68 (ddd, J = 11.8, 7.0, 4.6 Hz, 1H), 3.57 - 3.46 ( m, 1H), 3.39 (s, 3H), 1.05 (s, 8H). MS m/z: C26H33N2O6Si, [M+H]+, calculated: 497.21, measured: 497.45.

(14-2) Synthesis of VP-U-4.

[370] VP-U-2 (19.84 g, 40.0 mmol), dicyclohexylcarbodiimide (DCC, 16.48 g, 80.0 mmol), pyridine (4.20 g, 53.2 mmol), and trifluoroacetic acid (6.61 g, 53.2 mmol) was mixed and dissolved in 200 ml of dimethyl sulfoxide (DMSO) to react for 20 hours with stirring at room temperature to obtain a liquid reaction mixture. Separately, tetraethylmethylene diphosphate (21.44 g, 74.4 mmol) was dissolved in 120 ml of THF, cooled in an ice bath, t-BuOK (11.36 g, 101.2 mmol) was added at ice bath temperature to carry out the reaction for 10 min, heated to room temperature to carry out the reaction for 0.5 h, and added to the above liquid reaction mixture for approximately 1 h. 18 hours The reaction was quenched by adding water. The separated aqueous phase was extracted three times, each time with 200 ml of dichloromethane. All organic phases were combined and washed once with 200 ml of saturated brine. The solvent was evaporated to dryness and the residue was purified using a normal phase silica gel column, 200-300 mesh. The column was filled with petroleum ether and eluted with a gradient of petroleum ether: ethyl acetate = 1:1 - 1:4. The eluate was collected, the solvent was evaporated under reduced pressure, and the residue was dried in a foamy state using a vacuum oil pump to give a total of 14.00 g of pure VP-U-4 product. 1H NMR (400 MHz, DMSO-d6) δ 7.96 (d, J = 7.8 Hz, 1H), 7.64 (dtd, J = 5.1, 4.0, 2.2 Hz, 4H) , 7.41 - 7.30 (m, 6H), 6.82 - 6.71 (m, 2H), 5.90 (ddd, J = 25.9, 15.0, 1.0 Hz, 1H) , 5.73 (d, J = 7.6 Hz, 1H), 4.36 - 4.21 (m, 3H), 4.18 (t, J = 4.9 Hz, 1H), 4.05 ( ddq, J = 9.7, 8.5, 6.9 Hz, 2H), 3.87 (t, J = 4.8 Hz, 1H), 3.39 (s, 3H), 1.32 (td , J = 6.9, 0.7 Hz, 6H), 1.05 (s, 8H). MS m/z: C31H42N2O8PSi, [M+H]+, calculated: 629.24, measured: 629.51.

(14-3) Synthesis of VP-U-5.

VP-U-4 (14.00 g, 22.29 mmol) was dissolved in 100 ml of tetrahydrofuran, triethylamine trihydrofluoride (17.96 g, 111.45 mmol) was added and stirred at room temperature for 20 hours to completely react . The crude product was obtained by direct evaporation of the solvent to dryness, followed by dissolution in dichloromethane and evaporation to dryness twice, using 50 ml of dichloromethane. The crude product was purified using a normal phase silica gel column, 200-300 mesh. The column was filled with petroleum ether and eluted with a gradient of petroleum ether:ethyl acetate:dichloromethane:methanol = 1:1:1:0.05 - 1:1:1:0.25. The eluate was collected, the solvent was evaporated under reduced pressure, and the residue was dried in a foamy state using a vacuum oil pump to give a total of 6.70 g of pure VP-U-5 product. 1H NMR (400 MHz, DMSO-d6) δ 7.96 (d, J = 7.8 Hz, 1H), 6.77 (dd, J = 15.0, 6.2 Hz, 1H), 5.99 - 5.82 (m, 2H), 5.73 (d, J = 7.6 Hz, 1H), 5.27 (d, J = 5.1 Hz, 1H), 5.10 (dd, J = 5.3, 4.7 Hz, 1H), 4.29 (ddq, J = 9.8, 8.6, 7.0 Hz, 2H), 4.17 (ddd, J = 6.2, 5, 2, 1.0 Hz, 1H), 4.12 - 3.98 (m, 3H), 3.39 (s, 2H), 1.32 (td, J = 6.9, 0.6 Hz, 6H ). MS m/z: C15H24N2O8P, [M+H]+, calculated: 391.13, measured: 391.38.

(14-4) Synthesis of VP-U-6.

[371] VP-U-5 (391 mg, 1.0 mmol), pyridine trifluoroacetate (0.232 g, 1.2 mmol), N-methylimidazole (0.099 g, 1.2 mmol) and 2-cyanoethyl-N,N ,N',N'-tetraisopropylphosphorodiamidite (0.452 g, 1.5 mmol) was added to 10 ml of anhydrous dichloromethane under argon to carry out the reaction for 5 hours with stirring at room temperature. The solvent was evaporated to dryness and then the residue was purified by column chromatography (normal phase silica gel, 200-300 mesh, eluting with a dichloromethane:acetonitrile gradient (containing 0.5% by weight triethylamine)=3:1-1:3). The eluate was collected and concentrated to remove the solvent, giving a total of 508 mg of the desired product VP-U-6. 31P NMR (161 MHz, DMSO-d6) δ 150.34, 150.29, 17.07, 15.50. MS m/z: C24H41N4O9P2, [M+H]+, calculated: 591.23, measured: 591.55. This indicates that VP-U-6 is the target product of VP-Um, which is involved in the synthesis of RNA chains as a nucleoside monomer.

[372] The 5'-phosphate ester modification was attached to the 5' end using the following method.

[373] A phosphorylated structural monomer with the following structure of formula CPR-I was used as a starting material (purchased from Suzhou GenePharma Inc. under catalog number 13-2601-XX):

(CPR-I)

[374] After all the nucleosides of the antisense strand were attached, the monomer of formula (CPR-I) was attached to the 5' end of the antisense strand by a four step deprotection, coupling, capping and oxidation reaction according to the phosphoramidite solid phase nucleic acid synthesis method, followed by cleavage and deprotection according to the conditions below, thus obtaining an antisense strand.

[375] The synthesized nucleotide sequence bound to the substrate was added in 25% by weight aqueous ammonia to react for 16 hours at 55°C, and the amount of aqueous ammonia was 0.5 ml/μmol relative to the nucleotide sequence. The liquid was removed and the residue was concentrated to dryness in vacuo. After treatment with aqueous ammonia, the product was dissolved in N-methylpyrrolidone at 0.4 ml/μmol, and then 0.3 ml/μmol triethylamine and 0.6 ml/μmol triethylamine trihydrofluoride were added, relative to the amount of single-stranded nucleic acid, thereby deprotecting 2 '-TBDMS on ribose. Purification and desalting: Nucleic acid purification was performed using a preparative ion exchange chromatography column (Source 15Q) eluting with a NaCl gradient. In particular, eluent A: 20 mM sodium phosphate (pH 8.1), solvent: water/acetonitrile = 9:1 (v/v); eluent B: 1.5 M sodium chloride, 20 mM sodium phosphate (pH 8.1), solvent: water/acetonitrile = 9:1 (v/v); elution gradient: eluent A: eluent B = 100:0 - 50:50. The eluate was collected, combined and desalted using a reverse phase chromatography column. The peculiarity of the conditions was that a column with Sephadex was used for desalting, with Sephadex G25 being used as a filler, and deionized water was used for elution.

[376] In the case where the target product contained a 5'-phosphorothioate modification, the same procedure as described above was used, except that the above-described oxidation reaction conditions were changed to sulfonation reaction conditions upon addition, thereby carrying out the sulfonation reaction.

[377] For the sense strand and antisense strand synthesized as described above, the purity was determined by ion exchange chromatography (IO-HPLC), the molecular weight was analyzed by LC/MS, and the synthesized nucleic acid sequence was confirmed to correspond to the corresponding siRNAs in the examples and comparable examples described in table 5.

Preparation Example 15 Preparation of the remaining conjugates shown in Tables 3A - 3G.

[378] In other cases, it is expected that the remaining conjugates presented in tables 3A - 3G can be obtained using the same method as described in Preparation Example 13, except that: 1) in relation to Conjugates 31 - 37, 52 - 58, 68 - 74, 84 - 90, 121 - 127 and 146 - 152, Comparative conjugates 4 - 5, 7 - 8 and 10 - 13, Conjugate molecule L-9 was changed to Conjugate molecules 2 - 8 or 12 and Comparative conjugates molecules 1 to 2 obtained in examples 2 to 10 or 12 (for example, when Conjugation molecule L-9 was changed to Conjugation molecule P-9 (Conjugation molecule 2)), it is expected that conjugates 31, 52, 68, 84, 121 and 146, which are numbered as P10 conjugate. When Conjugation molecule L-9 was changed to Conjugation molecule R-4 (Conjugation molecule 3), it is expected that conjugates 32, 53, 69, 85, 122 and 147 can be obtained, which are numbered as R5 conjugate, and so on; 2) conjugated miRNAs have sequences presented in tables 3A - 3G corresponding to conjugates 10 - 15, 19 - 23, 27 - 41, 44 - 61, 63 - 77, 79 - 104, 106 - 108, 110, 112 - 114, 116-141 and 143-152 and comparative conjugates 4-5, 7-8 and 10-17; 3) if there is a phosphorothioate bond between two nucleotides in the target sequence, then the sulfonation reaction step described in Preparation Example 13 is used to replace the oxidation reaction step during the joining of the last of the two nucleotides; and 4) if the 2' positions of all nucleotides in the target sequence are modified hydroxy groups, then the ribose 2'-TBDMS deprotection step was not included in the cleavage and deprotection conditions. Therefore, it is expected that conjugates 10-15, 19-23, 27-41, 44-61, 63-77, 79-104, 106-108, 110, 112-114, 116-141 and 143-152 and comparative conjugates 4 - 5, 7 - 8 and 10 - 17, and these conjugates were numbered separately in accordance with tables 3A - 3G. Conjugates according to the present description are represented by formulas (3), (4), (7), (12), (13), (14), (15), (21) and (22), respectively, and comparative conjugates are represented by formulas ( 901) and (902), respectively:

Formula (901)

Formula (902)

where Nu is the siRNA in comparative conjugates 4-5, 7-8 and 10-13.

Production Example 16 Synthesis of Comparative Conjugates 6 and 9.

[379] Comparative conjugates 6 and 9 were synthesized using FIN-2 obtained in the above step (11-3). The conditions for solid-phase RNA synthesis and deprotection are the same as for the solid-phase nucleic acid synthesis described in the above step (11-2). The only difference is that FIN_FIN_FIN was first conjugated to the 3' end of the RNA sense strand via three rounds of reaction with FIN-2 followed by solid phase synthesis using a universal solid phase support (NittoPhase®HL solid phase supports loaded with UnyLinker™).

[380] The attachment of the FIN_FIN_FIN conjugating group was performed according to the method described in Rajeev et al., Chem Bio Chem 2015, 16, 903-908. Specifically, the hydroxy protecting group was first removed from the above universal solid phase support, and the solid phase support was subsequently contacted and coupled with a FIN-2 conjugation molecule under coupling reaction conditions and with a coupling agent, and a FIN conjugation molecule coupled to the solid phase substrate, was obtained after the reaction of capping and oxidation. Moreover, the hydroxy DMTr protecting group was removed from the FIN conjugation molecule coupled to the solid phase support, and the solid phase support was further contacted and coupled with another FIN-2 conjugation molecule, followed by a capping and oxidation reaction. After another additional cycle of deprotection-coupling-capping-oxidation, a third FIN-2 conjugation molecule was attached, and thus a conjugation group (FIN_FIN_FIN) coupled to the solid phase support was obtained. After that, starting from the conjugation group connected to the solid phase support, the nucleotide monomers were sequentially attached and finally a sense strand of RNA was obtained with the conjugation group (FIN_FIN_FIN) conjugated to the 3' end.

[381] In the reactions described above, the conditions, solvents and deprotecting, coupling, capping and oxidizing agents are those of the solid phase RNA synthesis described in step (11-2).

[382] Then, cleavage and deprotection, purification and desalting, detection, and annealing were carried out using the same method as described in Preparation Example 12 to finally obtain comparative conjugates 6 and 9 (sometimes hereinafter in this application also simply are called FIN conjugates). The molecular weight was measured with an LC/MS device (purchased from Waters Corp., model: LCT Premier). The synthesized FIN-siHBa1M1SP conjugate was confirmed to be the target compound developed because the measured values were consistent with the theoretical values. Its structure is the structure represented by formula (903):

Formula (903)

where Nu is the siRNA in comparative conjugates 6 or 9.

[383] After obtaining the conjugates described above, they were lyophilized to obtain a solid powder using a standard process and stored until use. When required, they can be dissolved, for example, with water for injection or normal saline, to obtain a solution with the desired concentration.

Experimental Example 1 This experiment illustrates the toxicity of siRNA conjugates as described herein.

[384] Conjugate 24 was administered subcutaneously to each C57BL/6J mouse, respectively, at a single dose of 100 mg/kg or 200 mg/kg (as siRNA, as 0.9% by weight aqueous NaCl solution, each administered 10 ml/kg). kg at a concentration of 10 mg/ml or 20 mg/ml). During the administration period, there was no animal death under continuous observation, no clinical symptoms associated with adverse drug responses were observed, and no abnormalities were detected in the analysis of clinical pathology or post-mortem examination, both of which were performed 24 hours after administration. Thus, the above results indicate a relatively low toxicity of the conjugates according to the present description at the animal level.

Experimental Example 2 This experiment illustrates the stability of the conjugates as described herein.

Experimental Example 2-1. Stability in lysosome lysate in vitro.

[385] Conjugates 24, 25, 42, 43, 62, 78 and Comparable Sequence 1 (each proposed in 0.9 wt% aqueous NaCl at a concentration of 20 μM in relation to siRNA, 12 μl for each group, respectively) separately good was mixed with 27.2 µl of sodium citrate aqueous solution (pH 5.0), 4.08 µl of deionized water and 2.72 µl of rat tritosomes (purchased from Xenotech Inc., cat. R0610LT, no. 1610069, at a final concentration of 0.2 mU/µl) and incubated at a constant temperature of 37°C. 5 µl of samples were taken at each time point of 0 h, 5 min, 15 min, 30 min, 1 h, 2 h, 4 h and 8 h, respectively, each was added to 15 µl of 9 M urea aqueous solution for denaturation, 4 µl of loading buffer (purchased from Solarbio Inc., cat. no. 20160830), then immediately cryopreserved in a -80°C freezer to quench the reaction. 0 h represents the point in time when the samples were well mixed with the lysosome lysate and removed immediately. Samples not treated with lysosome lysate, 1.5 µl for each of the conjugates described above, in equal moles (20 µM) were well mixed with 7.5 µl of aqueous sodium citrate solution (pH 5.0) and 1 µl of deionized water, each of these were added to 15 μl of 9 M aqueous urea solution for denaturation, 4 μl of loading buffer (purchased from Solarbio Inc., cat. no. 20160830) was added, then immediately cryopreserved in a freezer at -80°C to quench the reaction. Control samples for each conjugate were designated Cont. on the electropherogram. A 16% by weight non-denaturing polyacrylamide gel was obtained. Each whole cryopreserved sample was mixed with 4 µl of loading buffer (purchased from Solarbio Inc., an aqueous solution of 20 mM EDTA, 36% by weight of glycerol and 0.06% by weight of bromophenol blue), and then 20 µl of the mixture was loaded onto the gel for electrophoresis for 10 minutes at 20 mA followed by 30 minutes at 40 mA. After electrophoresis was completed, the gel was stained with Gelred (BioTium, cat. no. 13G1203) for 10 minutes and then visualized. The results are shown in FIG. 1A. Comparable sequence 1 is shown below: sense: 5'-CCUUGAGGCAUACUUCAAA-3' (SEQ ID NO: 250); antisense strand: 5'-UUUGAAGUAUGCCUCAAGGUU-3' (SEQ ID NO: 251).

[386] Following the same method, the stability of conjugates 105, 109, 111 and 115 was measured for 6 hours and the result is presented in FIG. 1b.

[387] FIG. 1A and 1B show a semi-quantitative result of an in vitro tritosome stability assay of siRNA conjugates. It has been demonstrated that the conjugates according to the present disclosure can remain undegraded for a long time in the tritosome, showing good stability.

Experimental Example 2-2. Stability in human plasma in vitro.

[388] Conjugates 24, 25, 42, 43, 62, 78 and Comparable Sequence 1 (each proposed in 0.9 wt% aqueous NaCl at 20 μM for siRNA, 12 μl for each group) were separately well mixed with 108 μl of 90% human plasma (diluted in PBS) and incubated at a constant temperature of 37°C. 10 µl of samples were taken at each time point of 0 h, 2 h, 4 h, 6 h, 8 h, 24 h, 48 h and 72 h, respectively, and immediately frozen in liquid nitrogen and cryopreserved in a freezer at -80°C for further use. In the meantime, each of the above conjugates in equal moles (2 μM, 2 μl) was mixed well with 8 μl of 1x PBS, thereby obtaining 10 μl of samples not treated with human plasma (indicated by Contr.) A 20% by weight non-denaturing polyacrylamide gel was obtained . Each whole cryopreserved sample was mixed with 4 µl of loading buffer (aqueous solution of 20 mM EDTA, 36% by weight of glycerol and 0.06% by weight of bromophenol blue) and then loaded onto the gel for electrophoresis for 60 minutes at a constant current of 80 mA . After electrophoresis was completed, the gel was stained with 1x Sybr Gold (Invitrogen, cat. no. 11494) for 15 minutes and then visualized. The results are shown in FIG. 2A. Comparable sequence 1 is shown below: sense: 5'-CCUUGAGGCAUACUUCAAA-3' (SEQ ID NO: 250); antisense strand: 5'-UUUGAAGUAUGCCUCAAGGUU-3' (SEQ ID NO: 251).

[389] Following the same method, the stability of conjugates 105, 109, 111 and 115 was measured over 72 hours and the results are presented in FIG. 2b.

[390] FIG. 2A and 2B show a semi-quantitative result of an in vitro stability analysis of the studied siRNA conjugates in human plasma. In human plasma, the conjugates of the present disclosure have been shown to remain undegraded for up to 72 hours, showing good stability in human plasma.

Experimental example 2-3. Stability in monkey plasma in vitro.

[391] Conjugates 24, 25, 42, 43, 62, 78 and Comparable Sequence 2 (each offered in 0.9% by weight aqueous NaCl solution at a concentration of 20 μM, respectively, in relation to siRNA, 12 μl for each group, and Comparable sequence 2 is an siRNA with a sense strand having the sequence shown in SEQ ID NO: 80 and an antisense strand having the sequence shown in SEQ ID NO: 81, and not conjugated to any conjugating molecule) separately good was mixed with 108 μl of 90% cynomolgus plasma (Monkey Plasma, purchased from HONGQUAN Bio, Cat. No. HQ70082, diluted in PBS) and incubated at a constant temperature of 37°C. 10 µl of samples were taken at each time point of 0 h, 2 h, 4 h, 6 h, 8 h, 24 h, 48 h and 72 h, respectively, and immediately frozen in liquid nitrogen and cryopreserved in a freezer at -80°C . After sampling at each time point, each sample was diluted 5 times with 1×PBS (pH 7.4) and then taken in a volume of 10 μl for further use. In the meantime, each of the above conjugates in equal moles (2 μM, 2 μl) was well mixed with 8 μl of 1x PBS, thereby obtaining 10 μl of samples not treated with monkey plasma (indicated Contr.). A 20% by weight non-denaturing polyacrylamide gel was prepared. Each of the diluted samples was mixed whole with 4 µl of loading buffer (an aqueous solution of 20 mM EDTA, 36% by weight of glycerol and 0.06% by weight of bromophenol blue) and then loaded onto the electrophoresis gel for 60 minutes at a constant current of 80 ma. After electrophoresis was completed, the gel was stained with 1x Sybr Gold (Invitrogen, cat. no. 11494) for 15 minutes and then visualized. The results are shown in FIG. 3A.

[392] The stability of conjugates 105, 109, 111 and 115 over 72 hours was measured following the same method and the result is presented in FIG. 3b.

[393] FIG. 3A and 3B show a semi-quantitative result of in vitro monkey plasma stability analysis of the studied siRNA conjugates. In cynomolgus monkey plasma, the conjugates of the present disclosure have been shown to remain undegraded for up to 72 hours, showing good stability in monkey plasma.

Experimental Example 3 This experiment illustrates the pharmacokinetics of conjugates 24 and 25 in rats in vivo.

[394] In this experimental example, Conjugates 24 and 25 were administered to rats in each experimental group (10 rats in each group, half female and half male) by subcutaneous injection, respectively, with a single dose of 10 mg/kg and 50 mg/kg . Then the drug concentration in plasma, liver tissue and kidney of rats was measured at each time point.

[395] First, SD rats were randomly divided into groups according to their body weight and sex using the PRISTIMA 7.2.0 data system, and then, respectively, the conjugates were administered according to the developed dosage. Drug dosages for all animals were calculated according to body weight. A single dose was administered subcutaneously, the dosage was 10 mg/kg and 50 mg/kg, respectively, as 1 mg/ml and 5 mg/ml of 0.9% aqueous NaCl solution and in a volume of 10 ml/kg. Whole blood of rats was collected from the jugular vein before and after 5 minutes (±30 seconds), 30 minutes (±1 minute), 1 hour (±2 minutes), 2 hours (±2 minutes), 6 hours (±5 minutes) , 24 hours (±10 minutes), 48 hours (±20 minutes), 72 hours (±20 minutes), 120 hours (±30 minutes) and 168 hours (±30 minutes) after administration. Whole blood samples were then centrifuged at 2-8°C at 1800 x g for 10 minutes to separate plasma. Approximately 70 μl volume of plasma sample was placed in one tube and the remainder of the same sample was placed in another, both of which were cryopreserved at -70°C to -86°C for control. Liver and kidney tissues of rats were collected approximately 24, 48, 72, 120 and 168 hours after administration using a method involving analgesia of rats with sodium pentobarbital according to their body weight (by intraperitoneal injection of 60 mg/kg), killing rats by collecting blood from the abdominal aorta and conducting a pathoanatomical study. A sample was taken from the liver and kidney of each rat and stored in a 1 ml cryovial at a temperature below -68°C until measurement and analysis.

[396] The concentrations of conjugates 24 and 25 in plasma, liver tissue and kidney of rats were quantitatively measured using high performance liquid chromatography with a fluorimetric detector (HPLC-FLD) in accordance with the following steps:

(1) grinding until tissue pieces weighing no more than 80 mg are obtained, then adding tissue and cell lysing solution (supplier: Epicentre, cat. no. MTC096H) to obtain a tissue homogenate at a concentration of 66.7 mg/ml;

(2) sonicating the tissue homogenate (150 W, 30 s) to disrupt the cells;

(3) for each group of tissue samples, add 75 µl of tissue samples to a 96-well PCR plate, add 5 µl of proteinase K (supplier: Invitrogen, cat. no. 25530-015) and 10 µl of a mixed aqueous solution of 10% w/w acetonitrile and 0.01% by weight tween 20;

for each group of plasma samples, adding 20 µl of plasma to a 96-well PCR plate, adding 45 µl of tissue and cell lysing solution, 5 µl of proteinase K and 20 µl of a mixed liquid of 10 wt% acetonitrile and 0.01 wt% tween 20;

(4) plugging the plates, placing them in a PCR machine (supplier: Applied Biosystems, Model: GeneAmp® 9700 PCR System) and incubating at 65° C. for 45 minutes;

(5) after the end of the incubation, add 10 µl of 3 M aqueous KCl solution (supplier: Sigma-aldrich cat. no. 60135-250ML), shake well and centrifuge at 3200 rcf at 4°C for 15 minutes;

(6) for each group of tissue samples, add 80 µl of supernatant to 120 µl of hybridization mixture (composition: 0.5 ml of 6 µM PNA probe (supplier: TAHE-PNA), 1 ml of 200 mM Trizma/pH = 8.5 ml 8 M aqueous urea solution, 3.5 ml H ₂ O, 2 ml acetonitrile);

for each group of plasma samples, adding 40 µl of supernatant to 160 µl of hybridization mixture (composition: 0.5 ml of 6 µM PNA probe, 1 ml of 200 mM Trizma/pH = 8.5 ml of 8 M urea aqueous solution, 7.5 ml H ₂ O, 2 ml acetonitrile);

(7) capping the plates and placing them in the PCR machine, incubating at 95°C for 15 minutes, then immediately placing them on ice for 5 minutes;

(8) transfer samples to new 96-well conical bottom plates, shake well and centrifuge at 3200 rcf for 1 minute;

(9) introducing samples for measurement and quantification using HPLC-FLD (liquid phase system supplier: Thermo Fisher, chromatograph model: Ultimate 3000).

[397] The results of the analysis can be found in FIG. 4-11. In FIG. 4-7 show metabolic profiles over time of rat plasma PK/TK and rat liver and kidney PK/TK for Conjugate 24, respectively; In FIG. 8-11 show the metabolic profiles over time of rat plasma PK/TK concentrations and rat liver and kidney tissue PK/TK concentrations for Conjugate 25, respectively. In particular:

In FIG. 4 is a metabolic profile over time showing PK/TK rat plasma concentrations for Conjugate 24 at a dosage of 10 mg/kg.

In FIG. 5 is a metabolic profile over time showing PK/TK tissue concentrations for Conjugate 24 in rat liver and kidney at 10 mg/kg.

In FIG. 6 is a metabolic profile over time showing PK/TK rat plasma concentrations for Conjugate 24 at a dosage of 50 mg/kg.

In FIG. 7 is a metabolic profile over time showing PK/TK tissue concentrations for Conjugate 24 in rat liver and kidney at 50 mg/kg.

In FIG. 8 is a metabolic profile over time showing rat plasma PK/TK concentrations for rat Conjugate 25 at 10 mg/kg.

In FIG. 9 is a metabolic profile over time showing PK/TK tissue concentrations for Conjugate 25 in rat liver and kidney at 10 mg/kg.

In FIG. 10 is a metabolic profile over time showing rat plasma PK/TK concentrations for rat Conjugate 25 at a dosage of 50 mg/kg.

In FIG. 11 is a metabolic profile over time showing PK/TK tissue concentrations for Conjugate 25 in rat liver and kidney at 50 mg/kg.

[398] As can be seen from the results in FIG. 4-11, the concentrations of Conjugates 24 and 25 in rat plasma fell rapidly below the detection limit within a few hours, while their concentrations were maintained at a relatively stable level for at least 168 hours in rat liver tissue, as at a low dose (10 mg /kg), and at a relatively high dosage (50 mg/kg). This shows that the siRNA conjugate obtained by conjugation of Conjugating Molecule L-9 can specifically and significantly accumulate in the liver and remain stable, showing a high degree of targeting.

Experimental Example 4 This experiment demonstrates the inhibitory effect of target mRNA induced by conjugates formed from various conjugated molecules in C57BL/6J mice.

[399] First, C57BL/6J mice (all females) were randomly divided into groups. Experimental groups were numbered: Conjugate 158 (5 mice), Comparable Conjugate 14 (5 mice), and PBS control group (8 mice), respectively. All animals were dosed according to body weight, and various single doses of 1 mg/kg or 0.1 mg/kg were administered subcutaneously. The volume of the administered dose was 5 ml/kg. For various doses, the conjugates were dissolved in 0.9% aqueous sodium chloride solution at a concentration of 0.2 mg/ml and 0.02 mg/ml. Animals were sacrificed 72 hours after administration and livers were harvested; liver tissue was homogenized with a tissue homogenizer and total RNA was extracted with RNAVzol (VIGOROUS, lot: 161G) according to standard total RNA extraction procedure.

[400] The expression level of TTR mRNA in liver tissue was detected by fluorescence-based quantitative real-time PCR. In particular, the extracted total RNA was subjected to reverse transcription to obtain cDNA using a reverse transcription system (Promega, Lot No. 0000223677, No. A3500) following the instructions. A quantitative fluorescent PCR device (ABI step One) was then used to detect the effectiveness of the inhibitory effect of siRNA on mTTR mRNA expression in liver tissue. In this detection method, the GAPDH gene was used as an internal control gene, and expression of mTTR and GAPDH was detected using TTR primers and GAPDH primers, respectively.

[401] The sequences of the detection primers are shown in Table 4.

Table 4. Detection primer sequences.

gene Direct primer reverse primer mTTR 5'-CCGTCTGTGCCTTCTCATCT-3'
(SEQ ID NO: 187) 5'-TAATTCTCCTCCCCCAACTCC-3'
(SEQ ID NO: 188) GAPDH 5'- AGAAGGCTGGGGCTCATTTG- 3'
(SEQ ID NO: 189) 5'-AGGGGCCATCCACAGTCTTC-3'
(SEQ ID NO: 190)

[402] In this real-time PCR method, mTTR mRNA expression is expressed as a percentage of the remaining amount of TTR gene expression and is calculated as follows:

Remaining TTR gene expression value = (TTR gene copy number in the test group/GAPDH copy number in the test group)/(TTR gene copy number in the control group/GAPDH copy number in the control group) × 100%

[403] The degree of mRNA inhibition by the conjugate was then calculated according to the following formula:

[404] mRNA inhibition coefficient = (1 - remaining value of TTR gene expression) × 100%,

[405] Wherein the control group was the mice that were injected with PBS in this experiment, and each test group was the group of mice that were injected with different siRNA conjugates. The results are presented in table 5.

Table 5. Effect of mTTR mRNA inhibition in mice.

miRNA conjugate Sample serial number mRNA inhibition ratio (%) 1 mg/kg 0.1 mg/kg Conjugate 158 L10-simTTR 94 51 Comp. conjugate 14 K4-simTTR 74 18

[406] The result demonstrates that despite the same siRNA sequences and modifications, the coefficient of inhibition of the target mRNA by conjugate 158 was significantly higher than that of Comparable conjugate 14.

[407] In the following Experimental Examples 5 to 11, the properties and actions of the siRNA conjugates shown in Tables 3A to 3F were experimentally tested according to the relationship of siRNA target position and sequence.

Experimental example 5. Experiment to test the action of siRNA conjugates presented in table 3A.

Experimental Example 5-1. Experiment to test the off-target actions of the conjugate 26.

[408] According to the method described by Kumico Ui-Tei et al., Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008, 36(7), 2136-2151, designed and co-transfected detection plasmids into HEK293A cells with the siRNA conjugates to be detected; and the expression level of the luciferase double reporter gene was measured using a luciferase double reporter detection kit. Specific steps are described below.

[409] Construction of plasmids for detection.

[410] Four recombinant plasmids were constructed using psiCHECK™-2 plasmid (Promega™) in which GSCM was expressed as the target plasmid; and PSCM, GSSM and PSSM were expressed as non-target plasmids:

[411] (1) A GSCM containing a target sequence, the target sequence is fully complementary paired with all 21 nucleotide sequences of the antisense strand in the conjugate to be detected.

[412] (2) PSCM containing the target sequence, the target sequence is fully complementary paired with all 21 nucleotide sequences of the sense strand in the conjugate to be detected.

[413] (3) GSSM containing the target sequence, the target sequence is fully complementary paired with the sequence of nucleotides at positions 1 to 8 from the 5' end of the antisense strand in the conjugate to be detected. The nucleotide sequence at positions 9-21 from the 5' end of the antisense strand in the conjugate to be detected is not complementary to the corresponding target sequence. Mismatch rule: A G, C, A, or U nucleotide at any position between 9 and 21 from the 5' end of the antisense strand in the conjugate to be detected, respectively, does not match a T, A, C, or G nucleotide at the corresponding position in the target sequence.

[414] (4) PSSM containing the target sequence, the target sequence is fully complementary paired with the sequence of nucleotides at positions 1 to 8 from the 5' end of the sense strand in the conjugate to be detected. The nucleotide sequence at positions 9-21 from the 5' end of the sense strand in the conjugate to be detected is not complementary to the corresponding target sequence. Mismatch rule: A G, C, A, or U nucleotide at any position between 9 and 21 from the 5' end of the sense strand in the conjugate to be detected, respectively, does not match a T, A, C, or G nucleotide at the corresponding position in the target sequence.

[415] The target sequence was inserted into the Xho I/Not I site of psiCHECK ^TM -2 plasmid.

[416] Transfection.

[417] In a 96-well plate, siRNA and each of the plasmids described above were co-transfected following the instructions for Lipofectamine ^TM 2000 (Invitrogen), each plasmid with 11 groups of the corresponding siRNAs at specific concentrations, respectively. Specifically, 10 ng of plasmid per well was transfected; and the final concentration per well of co-transfected siRNA was 100 nM to 0.0001 nM (4-fold serial dilutions), 3 replicate wells per group, 0.2 μl of Lipofectamine ^TM 2000 was used per well.

[418] Detection.

[419] 24 hours after co-transfection, HEK293A cells were lysed using the luciferase double reporter gene assay kit (Promega, cat. no. E2940), according to the instructions for use, to detect the expression level of the luciferase double reporter gene. For each test group at a specific concentration, untreated conjugate samples were used as control (counter). The level of Renilla luciferase (Ren) protein was normalized to the level of firefly (light) luciferase protein. Dose-response curves were plotted from activity results measured at various siRNA concentrations, and these curves were plotted using the log(inhibitor) function versus response - variable slope in Graphpad 5.0 software, expressed by the formula below:

Where

Y is the expression level of the remaining mRNA,

X is the logarithm of the concentration of transfected siRNA,

Bot is the Y value below the asymptote,

Top is the Y value above the asymptote,

LogIC ₅₀ is the X value at which Y is median between the top and bottom of the asymptote, and HillSlope is the slope of the curve.

[420] The IC ₅₀ of the conjugate to be detected corresponding to GSCM was determined by calculation based on the dose-response curve and then compared with that of PSCM, GSSM or PSSM.

[421] For Conjugate 24, the results are shown in Figures 12A-12D, and the IC ₅₀ value of conjugate 24 corresponding to GSCM was calculated as 0.0019 nM; compared to PSCM, GSSM, or PSSM, Conjugate 24 showed no significant inhibitory effect at each siRNA concentration, indicating that the siRNA conjugate of the present disclosure has relatively high in vitro activity and low off-target activity.

Experimental Example 5-2. This experiment illustrates the efficacy of the siRNA conjugates shown in Table 3A to inhibit HBV mRNA expression in vivo.

[422] In this experimental example, the effectiveness of conjugates 16 and 24 inhibition of HBV mRNA expression in HBV transgenic C57BL/6J-Tg (Alb1HBV) 44Bri/J mice was investigated.

[423] First, C57BL/6J-Tg (Alb1HBV) 44Bri/J mice were randomly divided into groups based on serum HBsAg content (all females, 4 mice per group) and labeled as Conjugate 16 and Conjugate 24 respectively, and a group was added which was injected with physiological saline (FR), as a control group. Drug dosages for all animals were calculated according to body weight. A single dose was administered subcutaneously, the dosage was 1 mg/kg, respectively, at a conjugate concentration of 0.2 mg/ml and 0.02 mg/ml in 0.9% by weight aqueous NaCl solution and a dose volume of 5 ml/kg. Animals were sacrificed on Day 14 post-administration. The liver was harvested and stored in RNA later (Sigma Aldrich) and the liver tissue was homogenized with a tissue homogenizer. Total RNA was then extracted and obtained using Trizol following the standard procedure for extracting total RNA.

[424] The level of expression of HBV mRNA in liver tissue was measured using fluorescent quantitative real-time PCR. In particular, the extracted total RNA was reverse transcribed to obtain cDNA using the ImProm-II™ Reverse Transcription Kit (Promega) according to the kit instructions, and then the effectiveness of the siRNA molecules' inhibition of HBV mRNA expression in liver tissue was measured using the fluorescent kit. quantitative PCR (Beijing Cowin Biosicences Co., Ltd). In this fluorescent qPCR method, the β-actin gene was used as an internal control gene, HBV and β-actin were detected using primers for HBV and β-actin, respectively.

[425] The primer sequences for detection are shown in Table 5A.

Table 5A. Detection primer sequences.

Genes Forward primers Reverse primers HBV 5'-CCGTCTGTGCCTTCTCATCT-3'
(SEQ ID NO: 187) 5'-TAATTCTCCTCCCCCAACTCC-3'
(SEQ ID NO: 188) β-actin 5'-AGCTTCTTGCAGCTCCTTCGTTG-3' (SEQ ID NO: 191) 5'-TTCTGACCCATTCCCACCATCACA-3'
(SEQ ID NO: 192)

[426] In this fluorescent qPCR method, HBV mRNA expression was expressed as the remaining HBV gene expression and calculated using the following equation:

Remaining HBV gene expression = (number of copies of the HBV gene in the test group/number of copies of the β-actin gene in the test group)/(number of copies of the HBV gene in the control group/number of copies of the β-actin gene in the control group) × 100%, which is indicated as HBV X/β-actin mRNA expression.

[427] Then, the degree of inhibition of the conjugate against mRNA was calculated in accordance with the following equation:

The degree of inhibition in relation to mRNA = (1 - the remaining expression of the HBV gene) × 100%,

where the control group was a group of control mice that were injected with FR, in this experiment, and each test group was a group of mice that were injected with different siRNA conjugates, respectively. The results are shown in FIG. 13.

[428] In other experiments, two further assays were performed following the protocol below:

the method described above was used, except that the conjugated siRNA that was introduced for analysis was changed to Conjugate 17, 25, 159 and 160, and data was collected on day 7; And

the method described above was used, except that the conjugated siRNA that was administered for analysis was changed to Conjugate 24, 161, 162, and 163, and data was collected on day 28, and each conjugate was administered at dosages of 1 mg/kg and 0 .3 mg/kg (and the volume of the dose remained the same, while the concentration of the conjugate solution was changed accordingly). The results of these analyzes are respectively shown in FIG. 14 and 15.

[429] From the results described above, it can be seen that in several experiments with different testing time points, all of the conjugates described above according to the present description showed a high inhibitory activity against the expression of HBV mRNA in mice in vivo.

Experimental Example 5-3. This experiment illustrates the effectiveness of siRNA conjugates with various conjugating molecules shown in Table 3A to inhibit HBsAg and HBV DNA expression in the serum of HBV transgenic mice.

[430] According to the method described in Experimental Example 4, conducted on HBV 44Bri mice, the detection sequences from Table 5A were used as primers to measure the inhibition efficiency of conjugates 25, 164, 165 and 166 against the target mRNA. The results of this experiment, respectively, are presented in table 6A.

Table 6A. Efficiency of inhibition by siRNA conjugates in relation to the target mRNA.

miRNA conjugate No. mRNA inhibition efficiency (%) 1 mg/kg 0.1 mg/kg Conjugate 25 L10-siHBa1M2SP 91 40 Conjugate 164 P10-siHBa1M2SP 92 65 Conjugate 165 W8-siHBa1M2SP 96 74 Conjugate 166 Z5-siHBa1M2SP 96 78

[431] In Table 6A, it can be seen that the siRNA conjugates formed by various conjugating molecules according to the present disclosure exhibit excellent inhibitory efficacy against the target mRNA in mice in vivo.

Experimental Example 5-4. This experiment illustrates a time-dependence analysis of the inhibition efficacy of the siRNA conjugates shown in Table 3A against HBsAg and HBV DNA in serum from HBV transgenic mice.

[432] An AAV-HBV mouse model was used. After successful establishment of animal models, these mice were randomly divided into groups based on serum HBsAg content (5 mice per group). Conjugates 24, 25 and Comparable Conjugate 15, respectively, were administered to each group, and FR was used as a blank control. Drug dosages for all animals were calculated according to body weight. A single dose was administered subcutaneously at a dosage of 3 mg/kg, and was provided at a concentration of 0.6 mg/ml in 0.9% by weight aqueous NaCl solution and a volume of 5 ml/kg. Blood was taken from the mouse orbital venous plexus before administration and on Days 7, 14, 21, 28, 56, 84, 112, 140, 154, 168 and 182 after administration, and serum HBsAg levels were measured at each time point. During this experiment, the analysis of the subject was terminated after the content of HBsAg in the serum was close to or greater than the initial value of his test result.

[433] The amount of blood taken from the eye sockets was approximately 100 µl each time, and the amount of serum was at least 20 µl after centrifugation. Serum HBsAg expression level was measured using the HBsAg CLIA kit (Autobio, CL0310). The level of HBV DNA expression was measured by extracting DNA from serum, following the instructions for the QIAamp 96 DNA Blood DNA Extraction Kit, followed by quantitative PCR.

[434] Normalized expression of HBsAg = (HBsAg content after administration/HBsAg content before administration) × 100%.

The degree of inhibition against HBsAg = (1 - content of HBsAg after administration/content of HBsAg before administration) × 100%, where the content of HBsAg is expressed in equivalents (IU) of HBsAg per milliliter (ml) of serum.

[435] Normalized expression of HBV DNA = (content of HBV DNA after administration/content of HBV DNA before administration) × 100%.

The degree of inhibition against HBV DNA = (1 - content of HBV DNA after administration / content of HBV DNA before administration) × 100%,

where the content of HBV DNA is expressed in copies of HBV DNA per milliliter (ml) of serum.

[436] The results are shown in FIG. 16 and 17. Based on the results shown in FIG. 16, it can be seen that for the negative control group, which was injected with FR, no inhibitory effect was detected at various time points after administration; in contrast, both Conjugates 24 and 25 showed excellent inhibitory activity against HBsAg at various time points after administration. In particular, Conjugate 24 at a dose of 3 mg/kg stably showed a high degree of serum HBsAg inhibition for a period of up to 140 days, indicating that it can stably and effectively inhibit HBV gene expression for a longer period.

[437] Based on the results shown in FIG. 17, it can be seen that the siRNA conjugate in each example also exhibited effective inhibition against HBV DNA expression and maintained a relatively high degree of inhibition for up to 84 days.

[438] In contrast, although Comparative Conjugates 15 achieve approximately the same mRNA inhibitory activity as in each example in the first 28 days, thereafter their inhibitory activities markedly decrease, thus the duration of their inhibitory activity shown in FIG. 16 and FIG. 17 is significantly shorter than that of conjugates 24 and 25 at the same dose level.

[439] Following the same methods as described above, four additional tests were performed in which serum HBsAg was measured, except that:

Mouse models with low concentrations of AAV-HBV were dosed at 3 mg/kg and 1 mg/kg of conjugate 25, respectively, FR was used as a control, the test was continued until day 140, and the results are shown in FIG. 18;

The M-Tg models were dosed at 3 mg/kg and 1 mg/kg of Conjugates 17 and 25, respectively, PBS was administered as a control, the test continued until day 70, and the results are shown in FIG. 19;

M-Tg models were dosed at 5 mg/kg, 1 mg/kg, and 0.2 mg/kg Conjugate 26 and 5 mg/kg Comparable Conjugate 15, respectively, PBS was administered as a control, the test was continued until day 78, and the results are presented. in fig. 20;

The 1.28-copy models were dosed at 3 mg/kg and 1 mg/kg of Conjugate 24, respectively, the test continued until day 210, and the results are shown in FIG. 21.

[440] For the various dosages indicated above, each conjugate was administered in the same dose volume, while the concentration of the conjugate solution was changed individually to introduce the appropriate dose.

[441] Based on the results shown in FIG. 18-21, it can be seen that the siRNA conjugates of the present invention exhibited long-lasting and effective inhibitory efficacy against serum HBsAg in various animal models and showed a regular dose-dependence.

Experimental Example 6 An experiment to test the effect of the siRNA conjugates shown in Tables 3B-3D.

Experimental Example 6-1. Analysis of off-target action of Conjugates 43, 62 and 78.

According to the methods described in Experimental Example 5-1, the off-target activity of conjugates 43, 62, and 78 was separately investigated, except that: of the target GSCM plasmid, while target sequences that completely match the antisense strand sequence, complementary pair to positions 1-8 of the antisense strand, or match positions 1-8 of the siRNA antisense strand in the respective conjugate, respectively, were used to construct non-target GSSM plasmids, PSCM and PSSM. The results are shown in FIG. 22 - 24, respectively. Based on the results shown in FIG. 22-24, it can be seen that all of the conjugates described above not only have an excellent inhibitory effect on the target mRNA, but also show a low level of off-target effects.

Experimental Example 6-2. This experiment illustrates the effectiveness of the conjugates as described herein to inhibit HBV mRNA expression in mice in vivo.

[442] In this experimental example, the inhibition efficiencies of conjugates 25, 42, 43, 62 and 78 of HBV mRNA expression in HBV transgenic C57BL/6J-Tg (Alb1HBV) 44Bri/J mice were investigated.

[443] First, C57BL/6J-Tg (Alb1HBV) 44Bri/J mice were randomly divided into groups based on serum HBsAg content (all females, 4 mice per group) and labeled separately, and the FR group was added as a control group. Drug dosages for all animals were calculated according to body weight. A single dose of conjugate 24 or 42 was administered subcutaneously, each at a dosage of 1 mg/kg or 0.1 ml/kg, respectively, as 0.2 mg/ml and 0.02 mg/ml conjugate in 0.9% by weight of aqueous NaCl solution and a dose volume of 5 ml/kg. Animals were sacrificed on Day 7 after administration. The liver was harvested and stored in RNA later (Sigma Aldrich) and the liver tissue was homogenized with a tissue homogenizer. Total RNA was then extracted and obtained using Trizol following the standard procedure for extracting total RNA.

[444] The expression level of HBV mRNA in liver tissue was measured using fluorescent quantitative real-time PCR. In particular, the extracted total RNA was reverse transcribed to obtain cDNA using the ImProm-II™ Reverse Transcription Kit (Promega) according to the kit instructions, and then the efficiency of inhibition of HBV mRNA expression in liver tissue by the siRNA molecules was measured using the fluorescent kit. quantitative PCR (Beijing Cowin Biosicences Co., Ltd). In this fluorescent qPCR method, the β-actin gene was used as an internal control gene, HBV and β-actin were detected using primers for HBV and β-actin, respectively.

[445] Detection primer sequences are shown in Table 5A.

[446] In this fluorescent qPCR method, the calculation of HBV mRNA expression as well as the degree of mRNA inhibition for the conjugates were as in Experimental Example 5-2,

where the control group was a group of control mice that were injected with FR in this experiment, and each test group was a group of mice that were injected with different siRNA conjugates, respectively. The results are shown in FIG. 25.

[447] In other experiments, two further assays were performed following the protocol below:

[448] used the method described above, except that the conjugated siRNA that was administered for analysis was changed to Conjugate 43, 62, 78, and 25, and data was collected on day 7, the results are shown in FIG. 26; And

[449] used the method described above, except that the conjugated siRNA that was administered for analysis was changed to Conjugate 42, 43, and 25, and Conjugates 42 and 25 were each administered at dosages of 1 mg/kg and 0.1 mg/kg (and the volume of the dose remained the same, while the concentration of the conjugate solution was changed accordingly). Moreover, the detection primer sequences were changed to those shown in Table 5B. The results are shown in FIG. 27.

Table 5B. Detection primer sequences.

Genes Forward primers Reverse primers HBV 5'-CCGTCTGTGCCTTCTCATCT-3'
(SEQ ID NO: 187) 5'-TAATTCTCCTCCCCCAACTCC-3'
(SEQ ID NO: 188) β-actin 5'-AGCTTCTTGCAGCTCCTTCGTTG-3' (SEQ ID NO: 191) 5'-TTCTGACCCATTCCCACCATCACA-3'
(SEQ ID NO: 192)

[450] FIG. 26 and 27, it can be seen that all of the conjugates described above, according to the present description, showed a high inhibitory activity against the expression of HBV mRNA in mice in vivo. Moreover, their inhibitory effect on different types of HBV mRNA remains almost the same.

Experimental Example 6-3. This experiment illustrates a time-dependence analysis of the effectiveness of inhibition by the siRNA conjugates presented in Table 3B of HBsAg and HBV DNA expression in serum of HBV transgenic mice.

[451] A mouse model with a low concentration of AAV-HBV was used. After successful establishment of animal models, these mice were randomly divided into groups based on serum HBsAg content (5 mice per group). Conjugate 43 was respectively administered to each group and PBS was used as a blank control. Drug dosages for all animals were calculated according to body weight. A single dose was administered subcutaneously, while the dosage was 3 mg/kg or 1 mg/kg at a concentration of 0.6 mg/ml or 0.2 mg/ml of the conjugate in 0.9% by weight of an aqueous solution of NaCl and a volume of 5 ml/kg . Blood was taken from the mouse orbital venous plexus prior to administration and on Days 7, 14, 21, 28, 56, 84, 112, 126 and 140 after administration, and serum HBsAg levels were measured at each time point.

[452] The amount of blood taken from the eye sockets was approximately 100 µl each time, and the amount of serum was at least 20 µl after centrifugation. Serum HBsAg was measured using the HBsAg CLIA kit (Autobio, CL0310).

[453] Normalized expression of HBsAg = (HBsAg content after administration/HBsAg content before administration) × 100%.

The degree of inhibition against HBsAg = (1 - content of HBsAg after administration/content of HBsAg before administration) × 100%, where the content of HBsAg is expressed in equivalents (IU) of HBsAg per milliliter (ml) of serum.

[454] The results are shown in FIG. 28. Based on the results shown in FIG. 28, it can be seen that in the negative control group injected with FR, no inhibitory effect was detected at various time points after administration; conversely, Conjugate 43 showed excellent HBsAg inhibitory activity at various time points after administration, and stably exhibited a high degree of serum HBsAg inhibition for a period of up to 100 days, indicating that it can stably and effectively inhibit HBV gene expression. over a longer period.

[455] In additional experiments, according to the methods described above, the M-tg mouse models were dosed with 3 mg/kg and 1 mg/kg of Conjugates 24, 62 and 78, respectively, at a concentration of 0.6 mg/ml or 0.2 mg/ml of the conjugate in 0.9% by weight of an aqueous solution of NaCl and a volume of 5 ml/kg. The test continued until day 85 and the results are shown in FIG. 29 and 30.

[456] Based on the results in FIG. 29 it can be seen that all Conjugates 24, 62 and 78 showed long lasting and effective inhibition efficacy against serum HBsAg for up to 85 days. According to the results in Fig. 30, Day 85 post-administration Conjugates 24 and 78 at 3 mg/kg still showed 68.6% and 62% inhibition of HBV mRNA, respectively.

[457] In additional experiments, according to the methods described above, mice of the 1.28-copy model were dosed with a dose of 3 mg/kg and 1 mg/kg of Conjugate 43, respectively, at a concentration of 0.6 mg/ml or 0.2 mg/ml conjugate in 0.9% by weight of an aqueous solution of NaCl and a volume of 5 ml/kg. The test continued until day 85. HBsAg and HBV DNA inhibitory activity was measured according to Experimental Example 5-4, and the results are shown in FIG. 31 and 32.

[458] Based on the results shown in FIG. 31 and 32, it can be seen that in a 1.28 copy mouse model, Conjugate 43 exhibited continuous effective inhibition of HBV expression as well as HBV DNA for up to 85 days.

Experimental example 7. Experiment to test the effect of conjugates 167 and 168.

Experimental Example 7-1. This experiment illustrates that the siRNA conjugate of the present disclosure not only exhibits relatively high in vitro activity, but also exhibits low off-target activity.

[459] In this experimental example, Conjugate 168 was examined in the in vitro psiCHECK system to identify target activity and off-target activity. More specifically, the activity of Conjugate 168 was examined in relation to targeting a fully matched target sequence (where the nucleotide sequence is fully complementary or identical to the nucleotide sequence along the entire length of the antisense strand of Conjugate 168) or targeting a primer region corresponding to the target sequence (where the nucleotide sequence complementary or identical to the sequence of nucleotides in positions 1-8 of the antisense strand of conjugate 168).

[460] Conjugate 168 was tested according to the methods described in Experimental Example 5-1, except that a target sequence fully complementary to the siRNA antisense strand sequence in Conjugate 168 was used to construct the target GSCM plasmid, while the target sequences , fully matching the antisense strand, complementary-pairing positions 1-8 of the antisense strand, or matching positions 1-8 of the siRNA antisense strand in Conjugate 168, respectively, were used to construct non-target plasmids GSSM, PSCM, and PSSM. From the test results, it can be seen that all of the conjugates described above not only have an excellent inhibitory effect on the target mRNA (with an IC ₅₀ = 0.0513 nM), but also show a low level of off-target effects.

Experimental Example 7-2. This experiment illustrates the stability of miRNA conjugates in lysosome lysate in vitro.

[461] Conjugates 167 and Comparative Sequence 1 prepared in Preparation Example 1 (each proposed in 0.9% by weight aqueous NaCl at 20 μM in relation to siRNA, 6 μl for each group, respectively, and Comparative Sequence 1 were designated OK ), separately mixed well with 27.2 µl of aqueous sodium citrate solution (pH 5.0), 4.08 µl of deionized water and 2.72 µl of rat tritosomes (purchased from Xenotech Inc., cat. no. R0610LT, at a final concentration of 0 ,2 mU/µl) and incubated at a constant temperature of 37°C. 5 µl of samples were taken at each time point of 0 h, 1 h, 2 h, 6 h and 24 h, respectively, each of them was added to 15 µl of 9 M aqueous urea solution for denaturation, and immediately cryopreserved in a freezer at -80° C for further use, with 0 h being the point in time at which the siRNA conjugate was well mixed with the lysosome lysate and immediately removed for testing. Meanwhile, for Conjugate 167 and Comparable Sequence 1, an equal molar ratio of siRNA (20 μM, 1.5 μl) was separately well mixed with 7.5 μl of sodium citrate aqueous solution (pH 5.0) and 1 μl of deionized water, then added to 30 µl of 9 M aqueous urea solution for denaturation, and then mixed well with 8 µl of 6x loading buffer (aqueous solution of 20 mM EDTA, 36% by weight of glycerol and 0.06% by weight of bromophenol blue), and immediately cryopreserved in a freezer at -80°C to quench the reaction, thus obtaining test samples that are not treated with lysosome lysate (denoted by M on the electrophoregram). A 16% by weight non-denaturing polyacrylamide gel was obtained. 20 µl of each test sample was separately loaded onto the electrophoresis gel for 60 minutes at a constant current of 80 mA. After the end of electrophoresis, the gel was stained 1x with Sybr Gole (Invitrogen, cat. no. 11494) for 15 minutes and then visualized. The results are shown in FIG. 33.

[462] Stability in rat-derived lysosome lysate, Conjugate 167, and Comparative Sequence 1 (denoted OK in FIG. 34) was measured following the same method, except that human-derived lysosome lysate was changed to lysosome lysate, obtained from rats (rat liver tritosomes were purchased from Xenotech Inc., cat. no. R0610.LT, at a final concentration of 0.2 mU/µl). The result is presented in Fig. 34.

[463] FIG. 33 and 34 show that the conjugates of the present disclosure can remain undegraded for at least 24 hours in both human and rat lysosome lysates, showing good stability.

Experimental Example 7-3. This experiment illustrates the effectiveness of the conjugates as described herein to inhibit HBV mRNA expression in mice in vivo.

[464] In this experimental example, the effectiveness of conjugates 167 and 168 inhibition of HBV mRNA expression in HBV transgenic C57BL/6J-Tg (Alb1HBV) 44Bri/J mice was investigated.

[465] First, C57BL/6J-Tg (Alb1HBV) 44Bri/J mice were randomly divided into groups based on serum HBsAg (all females, 5 mice per group) and PBS group, and Conjugates 167 and 168 were administered separately. 5 mg/kg 1x PBS was administered subcutaneously to each animal in the PBS group. For Conjugates 167 or 168, a single dose of the conjugate was administered subcutaneously, each at a dosage of 1 mg/kg as 0.2 mg/ml of the conjugate in 0.9% by weight aqueous NaCl solution and in a dose volume of 5 ml/kg. Animals were sacrificed on Day 28 post-administration. The liver was harvested and stored in RNA later (Sigma Aldrich) and the liver tissue was homogenized with a tissue homogenizer. Total RNA was then extracted and obtained using Trizol following the standard procedure for extracting total RNA.

[466] The expression level of HBV mRNA in liver tissue was measured using fluorescent quantitative real-time PCR. In particular, the extracted total RNA was reverse transcribed to obtain cDNA using the ImProm-II™ Reverse Transcription Kit (Promega) according to the kit instructions, and then the efficiency of inhibition of HBV mRNA expression in liver tissue by the siRNA molecules was measured using the fluorescent kit. quantitative PCR (Beijing Cowin Biosicences Co., Ltd). In this fluorescent qPCR method, the β-actin gene was used as an internal control gene, HBV and β-actin were detected using primers for HBV and β-actin, respectively.

[467] The primer sequences for detection are shown in Table 5G.

Table 5G. Detection primer sequences.

Genes Forward primers Reverse primers HBV 5'-GTCTTTTTGGGTTTTGCTGCC-3'
(SEQ ID NO: 238) 5'- GCAACGGGGTAAAGGTTCAG-3'
(SEQ ID NO: 239) β-actin 5'-GGTCGGAGTCAACGGATTT-3'
(SEQ ID NO: 240) 5'-CCAGCATCGCCCCACTTGA-3'
(SEQ ID NO: 241)

[468] In this fluorescent quantitative PCR method, the calculation of HBV mRNA expression as well as the degree of mRNA inhibition for the conjugates corresponded to those in Experimental Example 5-2. The results are presented in table 6G.

[469] In other experiments, the method described above was used, except that the conjugated siRNA that was introduced for analysis was changed to Conjugate 167 and 168, and the dosage of administration was changed, the results are presented in table 6G.

Table 6G. Inhibition of HBV mRNA expression by siRNA conjugates in mouse liver.

conjugate Dose (mg/kg) HBV mRNA inhibition in the liver (%) -- n/a 0 Conjugate167 1 77.41 Conjugate 168 1 88.27 Conjugate 168 0.3 57.95

[470] From the results above, it can be seen that all of the above described conjugates according to the present description showed high inhibitory activity against HBV mRNA expression in mice in vivo, illustrating the good in vivo delivery efficiency of the siRNA conjugates according to the present description.

Experimental Example 7-4. This experiment illustrates a time-dependence analysis of the effectiveness of inhibition by the siRNA conjugates presented in Table 3B of HBsAg and HBV DNA expression in serum of HBV transgenic mice.

[471] In the 1.28-copy data models, mice were randomly divided into groups (6 mice per group, half female and half male). Each group was injected with normal saline and various dosages of conjugate 168, respectively, and the PR groups were injected subcutaneously with 5 ml/kg of normal saline. For groups administered with the conjugate, drug dosages for all animals were calculated according to body weight. A single dose was administered subcutaneously, while the dosage was 3 mg / kg or 1 mg / kg, at a concentration of 0.6 mg / ml or 0.2 mg / ml of the conjugate in 0.9% by weight of an aqueous solution of NaCl and a volume of 5 ml / kg. Blood was taken from the ophthalmic venous plexus of the mouse before administration and on Days 7, 13, 21, 28, 42, 56, 70, 84, 98, 112, 126, 140, and 154 after administration, and serum levels of HBsAg, HBeAg, and also HBV DNA at each time point.

[472] The amount of blood taken from the eye sockets was approximately 100 µl each time, and the amount of serum was at least 20 µl after centrifugation. Serum HBsAg was measured using the HBsAg CLIA kit (Autobio, CL0310). Serum HBeAg content was measured using the HBeAg CLIA kit (Autobio, CL0310). The level of HBV DNA expression was measured by extracting DNA from serum, following the instructions for the QIAamp 96 DNA Blood kit, followed by quantitative PCR.

[473] Normalized expression of HBsAg = (HBsAg content after administration/HBsAg content before administration) × 100%.

The degree of inhibition against HBsAg = (1 - content of HBsAg after administration/content of HBsAg before administration) × 100%, where the content of HBsAg is expressed in equivalents (IU) of HBsAg per milliliter (ml) of serum.

[474] Normalized expression of HBeAg = (HBeAg content after administration/HBeAg content before administration) × 100%.

The degree of inhibition against HBeAg = (1 - content of HBeAg after administration/content of HBeAg before administration) × 100%, where the content of HBeAg is expressed in equivalents (IU) of HBeAg per milliliter (ml) of serum.

[475] Normalized expression of HBV DNA = (content of HBV DNA after administration/content of HBsAg before administration) × 100%.

The degree of inhibition against HBV DNA = (1 - content of HBV DNA after administration / content of HBV DNA before administration) × 100%,

and the content of HBV DNA is expressed in copies of HBV DNA per milliliter (ml) of serum.

[476] The results are shown in FIG. 35-37. Based on the results shown in FIGS. 35, it can be seen that the negative control group injected with FR showed no inhibitory effect at various time points after administration; in contrast, both groups of conjugate 168 showed excellent HBsAg inhibitory activity at various time points after administration, especially the 3mg/kg group stably showed a degree of inhibition of more than 90% against serum HBsAg for a period of up to 100 days , indicating that this conjugate can stably and effectively inhibit HBV gene expression for a longer period.

[477] Based on the results shown in FIG. 36, it can be seen that siRNA conjugates can also inhibit HBeAg expression. Moreover, both groups of 3 mg/kg stably showed a degree of inhibition of more than 50% against HBsAg in serum for a period of up to 70 days.

[478] Based on the results in FIG. 37, it can be seen that the conjugates also exhibited effective efficacy in inhibiting HBV DNA expression and exhibited a relatively high degree of HBV DNA inhibition over a period of up to 154 days.

Experimental example 8. Experiment to test the action of siRNA conjugates presented in table 3E.

Experimental Example 8-1. This experiment illustrates the effectiveness of the siRNA conjugates shown in Table 3E to inhibit ANGPTL3 mRNA expression in vivo.

[479] In this experimental example, the inhibition ratios for Conjugates 105, 109, 111, and 115 of ANGPTL3 expression level in liver tissue of normal BALB/c mice were examined.

[480] Normal BALB/c mice (6-8 weeks old, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were randomly divided into groups (5 mice per group). Conjugates 105, 109, 111, 115 and PBS were administered separately to mice in each group. Drug dosages for all animals were calculated according to body weight. A single dose was administered subcutaneously, the dosage was 3 mg/kg and 0.3 mg/kg (by number of siRNA) as 0.3 mg/ml and 0.03 mg/ml of 0.9% by weight aqueous NaCl solution and in a dose volume of 10 ml/kg for miRNA conjugates. Mice were sacrificed in groups, respectively, on Day 14 and Day 28 after administration. The liver was harvested and stored in RNA later (Sigma Aldrich) and the liver tissue was homogenized with a tissue homogenizer. Total RNA was then extracted and obtained using Trizol (Thermo Fisher) following the standard procedure for extracting total RNA.

[481] The expression level of ANGPTL3 mRNA in liver tissue was measured by real-time fluorescent quantitative PCR. In particular, the extracted total RNA was reverse transcribed to obtain cDNA using the ImProm-II™ Reverse Transcription Kit (Promega) according to the kit instructions, and then the efficiency of inhibition of ANGPTL3 mRNA expression in liver tissue by the siRNA molecules was measured using the fluorescence quantitation kit. PCR (Beijing Cowin Biosicences Co., Ltd). In this fluorescent quantitative PCR method, the GAPDH gene was used as an internal control gene, and ANGPTL3 and GAPDH were detected using primers for ANGPTL3 and GAPDH, respectively.

[482] The primer sequences for detection are shown in Table 5E.

Genes Forward primers Reverse primers Mouse ANGPTL3 5'-GAGGAGCAGCTAACCAACTTAAT-3'
(SEQ ID NO: 199) 5'-TCTGCATGTGCTGTTGACTTAAT-3'
(SEQ ID NO: 200) Mouse GAPDH 5'-AACTTTGGCATTGTGGAAGGGCTC-3'
(SEQ ID NO: 201) 5'-TGGAAGAGTGGGAGTTGCTGTTGA-3'
(SEQ ID NO: 202)

[483] ANGPTL3 mRNA expression was calculated using the equation: ANGPTL3 mRNA expression = (ANGPTL3 mRNA expression in test group / GAPDH mRNA expression in test group) / (ANGPTL3 mRNA expression in control group / GAPDH mRNA expression in control group) × 100%.

[484] The ratio of inhibition of ANGPTL3 mRNA by the conjugates was calculated using the equation: ANGPTL3 mRNA expression = (1 - ANGPTL3 mRNA expression in the test group / GAPDH mRNA expression in the test group) / (ANGPTL3 mRNA expression in the control group / GAPDH mRNA expression in the control group) × 100%. The control group was a group of control mice that were injected with PBS in this experiment, and each test group was a group of mice that were injected with different siRNA conjugates, respectively. The results are shown in FIG. 38A and 38B.

[485] Based on the results in FIG. 38A and 38B, it can be seen that all of the siRNA conjugates described above exhibit excellent inhibitory activity on ANGPTL3 mRNA expression.

[486] Blood (approximately 100 μl) was taken from the eye sockets of the experimental subjects described above and centrifuged to obtain serum. The content of total cholesterol (TC) and triglycerides (TG) in serum was additionally measured using a fully automatic biochemical serum analyzer PM1P000/3 (SABA, Italy). The results for blood lipids were normalized, and the ratio of inhibition in relation to blood lipid levels was calculated using the equation: ratio of inhibition = (1 - blood lipids in the test group after administration/blood lipids in the test group before administration) × 100%. Blood lipids refer to total cholesterol or triglyceride. The test results are shown in Fig. 39A and 39B.

[487] Based on the results in FIG. 39A and 39B, it can be seen that in the serum of mice treated with various dosages of Conjugates 105, 109, 111, and 115, both cholesterol (TC) and triglyceride (TG) levels were significantly reduced, and a decrease in blood lipid levels was observed for up to at least 28 days after administration.

Experimental Example 8-2. This experiment illustrates the effect on blood lipids of siRNA conjugates according to the present description.

[488] Tg(APOC3)3707Bres mice were randomly divided into groups based on TG content > 2 mmol/L (5 mice in each group), and each group was separately injected with PBS negative control and Conjugate 115. Drug dosages for all animals were calculated in according to body weight. A single dose of the conjugates was administered subcutaneously, each at a dosage of 3 mg/kg or 1 mg/kg, each in the form of 0.6 mg/ml or 0.2 mg/ml of the conjugate in 0.9% by weight of an aqueous solution of NaCl and in the volume of the dose 5 ml/kg. Blood was taken from the eye sockets of mice before administration and 7, 14, 21, 28, 35, 56, 70, 84, 98, 112, 126, 140, 154, and 168 days after administration, and serum TC and TG levels were measured.

[489] The amount of blood taken from the eye sockets was approximately 0.1 ml each time, and the amount of serum was at least 20 μl after centrifugation. The content of total cholesterol (TC) and triglycerides (TG) in serum was measured using a fully automatic biochemical serum analyzer PM1P000/3 (SABA, Italy).

[490] The results for blood lipids were normalized: normalized blood lipid levels = (blood lipids in the test group after administration/blood lipids in the test group before administration), and the ratio of inhibition in relation to blood lipid levels = (1 - blood lipids in test group after administration/blood lipid content in the test group before administration) × 100%. The test results are shown in Fig. 40A and 40B.

[491] Based on the results in FIG. 40A and 40B, it can be seen that, at various time points post-administration, Conjugate 115 showed a significant effect in reducing TG and TC for up to 168 days, indicating stable and effective long-term inhibition of ANGPTL3 gene expression in mice in vivo.

[492] In other experiments, the method described above was used, except that: an ob/ob mouse model was used; Conjugates 111, 115 and Comparable Conjugate 16 were administered separately, each at a dosage of 3 mg/kg and 1 mg/kg; and data were collected on days 0, 7, 14, 21, 28, 35 and 41 post-administration. The results are shown in FIG. 41A - 41B.

[493] Based on the results in FIG. 41A-41B, it can be seen that Conjugates 111 and 115 according to the present disclosure can continuously lower blood lipids in ob/ob mice in vivo for 41 days, showing excellent inhibitory activity.

[494] In other experiments, the method described above was used, except that: Conjugate 111 and Comparable Conjugate 16 were administered separately, each at a dosage of 3 mg/kg and 1 mg/kg, respectively, as 0.6 mg/ml and 0.2 mg/ml of 0.9% by weight aqueous NaCl solution, and the dose volume was 5 ml/kg; and TC and TG values were checked on days 0, 7, 14, 21, 28, 35, 42, 56 and 70 after administration. The results are shown in FIG. 42A - 42D.

[495] Based on the results in FIG. 42A-42D, it can be seen that Conjugate 111 of the present disclosure can better continuously lower blood lipids for 70 days compared to Comparable Conjugate 16 at the same dosage level.

Experimental Example 8-3. This experiment illustrates the effectiveness of siRNA conjugates with various conjugating molecules shown in Table 3A to inhibit ANGPTL3 mRNA expression and influence blood lipids in non-human primates.

[496] Regarding monkeys with metabolic syndrome (all males), 12 animals were divided into the following groups: 8 in the experimental group, which were dosed with Conjugate 169, and 4 in the control group, which were dosed with Conjugate 25; checked the baseline data for these monkeys and observed them for 3 weeks, took weekly blood, measured the level of blood lipids (TG, TC, HDL). Subsequently, Conjugate 169 and Conjugate 25 were introduced (as a comparable conjugate, since the siRNA in it targets a completely foreign mRNA). Drug dosages for all animals were calculated according to body weight. A single dose was administered subcutaneously, the dosage was 9 mg/kg (by number of siRNA) as 100 mg/ml of 0.9% by weight aqueous NaCl solution and in a dose volume of not more than 2 ml for each injection site. Blood was taken before and after 7, 14, 21, 28 and 35 days after administration, the level of TG and TC in serum was examined at each time point.

[497] The results for blood lipids were normalized, normalized blood lipid levels = (blood lipids in the test group after administration/blood lipids in the test group before administration), and the ratio of inhibition in relation to blood lipid levels = (1 - blood lipids in test group after administration/blood lipid content in the test group before administration) × 100%. Meanwhile, the blood lipid content of the test group prior to administration is the mean blood lipid value for 3 weeks prior to administration and is noted in D0 in FIG. 43A and 43B.

[498] On day 0 (the day of administration itself) and day 28, a percutaneous transhepatic biopsy was performed to measure the expression level of ANGPTL3 mRNA in the liver tissue. The liver was harvested and stored in RNA later (Sigma Aldrich) and the liver tissue was homogenized with a tissue homogenizer. Total RNA was then extracted and obtained using Trizol following the standard procedure for extracting total RNA.

[499] The expression level of ANGPTL3 mRNA in liver tissue was measured by real-time fluorescent quantitative PCR. In particular, the extracted total RNA was reverse transcribed to obtain cDNA using the ImProm-II™ Reverse Transcription Kit (Promega) according to the kit instructions, and then the effectiveness of the inhibition of ANGPTL3 mRNA expression in liver tissue by the siRNA molecules was measured using the fluorescent kit. quantitative PCR (Beijing Cowin Biosicences Co., Ltd). In this fluorescent qPCR method, the GAPDH gene was used as an internal control gene, ANGPTL3 and GAPDH were detected using primers for HBV and GAPDH, respectively.

[500] The sequence of primers for detection are presented in table 6E.

Table 6E. Detection primer sequences.

Genes Forward primers (5'-3') Reverse primers (5'-3') ANGPTL3 monkeys CTGGTGGTGGCATGATGAGT
(SEQ ID NO: 242) CTCTTCTCCGCTCTGGCTTAG
(SEQ ID NO: 243) GAPDH monkeys GGGAGCCAAAAGGGTCATCA
(SEQ ID NO: 244) CGTGGACTGTGGTCATGAGT
(SEQ ID NO: 245)

[501] The calculation of ANGPTL3 mRNA expression and the ratio of inhibition of ANGPTL3 mRNA corresponded to Experimental Example (8-1). The control group was a group of control monkeys that were injected with PBS in this experiment, and each test group was a group of monkeys that were injected with different siRNA conjugates, respectively. The results are shown in FIG. 43A - 43C.

[502] Based on the results in FIG. 43A-43C, it can be seen that Conjugate 169 showed a significant decrease in TG levels and inhibition of ANGPTL3 gene expression, and reduced 82.7% of ANGPTL3 mRNA levels on Day 28 post-administration.

Experimental example 9. Experiment to test the effect of siRNA conjugates presented in table 3F.

Experimental Example 9-1. This experiment illustrates the efficacy of the siRNA conjugates shown in Table 3F to inhibit APOC3 mRNA expression in vivo.

[503] In this Experimental Example, the ratios of inhibition for Conjugate 144 were examined in relation to the expression level of APOC3 in liver tissue of human APOC3 transgenic mice (B6; CBA-Tg(APOC3)3707Bres/J, purchased from Jackson Lab) in vivo.

[504] Human APOC3 transgenic mice (age 6-8 weeks, triglyceride > 2 mmol/l) were randomly divided into groups (5 mice per group). Conjugates 144 and Conjugate 25 (as a comparable conjugate since the siRNA in it targets the completely foreign mRNA) were administered to mice in each group, respectively. Drug dosages for all animals were calculated according to body weight. A single dose was administered subcutaneously, the dosage was 1 mg/kg and 0.1 mg/kg (by number of siRNA), respectively, as 0.2 mg/ml and 0.02 mg/ml 0.9% by weight of aqueous NaCl solution and at a dose volume of 5 ml/kg for miRNA conjugates. Mice were sacrificed on Day 14 post-administration. The liver was harvested and stored in RNA later (Sigma Aldrich) and the liver tissue was homogenized with a tissue homogenizer. Total RNA was then extracted and obtained using Trizol (Thermo Fisher) following the standard procedure for extracting total RNA.

[505] The expression level of APOC3 mRNA in liver tissue was measured by real-time fluorescence quantitative PCR. In particular, the extracted total RNA was reverse-transcribed to obtain cDNA using the ImProm-II™ Reverse Transcription Kit (Promega) according to the kit instructions, and then the efficiency of inhibition of APOC3 mRNA expression in liver tissue by the siRNA molecules was measured using the fluorescent kit. quantitative PCR (Beijing Cowin Biosicences Co., Ltd). In this fluorescent qPCR method, the β-actin gene was used as an internal control gene, and APOC3 and β-actin were detected using primers for APOC3 and β-actin, respectively.

[506] The primer sequences for detection are shown in Table 7F.

Table 7F. Detection primer sequences.

Genes Forward primers Reverse primers APOC3 human 5'- GTGACCGATGGCTTCAGTTC-3'
(SEQ ID NO: 248) 5'-ATGGATAGGCAGGTGGACTT-3'
(SEQ ID NO: 249) mouse β-actin 5'-AGCTTCTTTGCAGCTCCTTCGTTG-3'
(SEQ ID NO: 246) 5'-TTCTGACCCATTCCCACCATCACA-3'
(SEQ ID NO: 247)

[507] APOC3 mRNA expression was calculated using the equation: APOC3 mRNA expression = (APOC3 mRNA expression in test group/β-actin mRNA expression in test group)/(APOC3 mRNA expression in control group/β-actin mRNA expression in control group) × 100%.

[508] The ratio of inhibition for the conjugates in relation to APOC3 mRNA expression was calculated using the equation: inhibition ratio = [1-(expression of APOC3 mRNA in the test group/expression of β-actin mRNA in the test group)/(expression of APOC3 mRNA in the control group/expression mRNA of β-actin in the control group) × 100%. Here, the control group was a group of control mice that were injected with PBS in this experiment, and each test group was a group of mice that were injected with different siRNA conjugates, respectively. The results are shown in FIG. 44A.

[509] Based on the results shown in FIG. 44A, it can be seen that the 144 Conjugates showed excellent inhibitory activity on human APOC3 gene expression in transgenic mice in vivo.

Experimental Example 9-2. This experiment illustrates the effect of the siRNA conjugate in Conjugates 144 on blood lipids in vivo.

[510] In this experimental example, the in vivo effect of the siRNA conjugate in Conjugate 144 on the content of total cholesterol (TC) and triglycerides (TG) in the serum of human APOC3 transgenic mice (B6; CBA-Tg(APOC3)3707Bres/J, purchased in Jackson Lab.

[511] Human APOC3 transgenic mice (age 6-8 weeks, TG content > 2 mmol/l) were randomly divided into groups (7 mice in each group): (1) FR control group; (2) the 3 mg/kg group of Conjugate 144; (3) 1 mg/kg Conjugate 144 group. Drug dosages for all animals were calculated according to body weight. A single dose was administered subcutaneously, respectively, as 0.6 mg/ml and 0.2 mg/ml of 0.9% by weight aqueous NaCl solution in a volume of 5 ml/kg for the siRNA conjugate.

[512] Blood (approximately 100 µl) was taken from the eye sockets before administration (recorded as Day 0) and on Days 7, 14, 21, 28, 35, 42, 49, 63, 77, 91, 112, 133, 147, 154 , 161, 175 and 189 after injection, respectively, and centrifuged to obtain serum. The content of total cholesterol (TC) and triglycerides (TG) in serum was additionally measured using a fully automatic biochemical serum analyzer PM1P000/3 (SABA, Italy). The results for blood lipids were normalized, and the normalized blood lipid levels as well as the inhibition ratio for blood lipid levels were the same as in Experimental Example 8-3. The test results are shown in Fig. 44B and 44C.

[513] FIG. 44B and 44C it can be seen that Conjugate 144 had a significant lowering effect on TH and serum TC levels in mice for up to 189 days, indicating long-term, stable and effective inhibition of human APOC3 gene expression.

[514] In other experiments, the method described above was used, except that Conjugate 170 was administered, each at a dosage of 0.1, 0.3, 1, 3, and 9 mg/kg (with the same dose volume and the concentration of conjugates changed accordingly in solution); and data was collected up to 112 days after administration. The results are shown in FIG. 45A and 45B.

[515] Based on the results in FIG. 45A and 45B, it can be seen that 170 Conjugates can continuously reduce blood lipids and ANGPTL3 mRNA in transgenic mice in vivo for up to 112 days, and this reduction shows a significant dose-dependence.

[516] In other experiments, the method described above was used to measure the content of total cholesterol (TC) and triglycerides (TG) in the serum of mice, except that Conjugates 144, 170 and 171 were administered, as well as Comparable Conjugate 4, each at a dosage of 1 mg/kg and 3 mg/kg (with the same dose volume and the concentration of conjugates in the solution changed accordingly); and data was collected up to 112 days after administration. The results are shown in FIG. 46A-46D.

[517] Based on the results in FIG. 46A-46D, it can be seen that Conjugates 144, 170 and 171 were able to continuously lower blood lipids in transgenic mice for up to 112 days, and the duration of such reduction was generally better compared to Comparable Conjugate 4.

[518] The embodiments of the present invention have been described above in detail, but the present invention is not limited to the specific details of the embodiments described above. Various simple variations of the technical solution of the present invention can be made within the scope of the technical principle of the present invention, and these simple variations are within the scope of the present invention.

[519] It is worth noting that each of the specific technical features described in the embodiments above can be combined in any suitable way, as long as it does not cause conflict. In order to avoid unnecessary repetition, the various possible combinations are no longer described here.

[520] In addition, many different embodiments of the present invention can also be carried out in any combination, as long as it does not contradict the idea of the present invention, which should also be regarded as a disclosure of the present invention.

--->

SEQUENCE LIST

<110> Suzhou Ribo Life Science Co.,Ltd.

<120> CONJUGATES AND THEIR PRODUCTION AND USE

<130> DP1P182407ZX

<150> CN201711479058.9

<151> 2017-12-29

<150> CN201811165363.5

<151> 2018-09-30

<160> 251

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBa1

<400> 1

ccuugaggca uacuucaaa 19

<210> 2

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa1

<400> 2

uuugaaguau gccucaaggu u 21

<210> 3

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBa2

<400> 3

gaccuugagg cauacuucaa a 21

<210> 4

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa2

<400> 4

uuugaaguau gccucaaggu cgg 23

<210> 5

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBa1M1

<400> 5

ccuugaggca uacuucaaa 19

<210> 6

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa1M1

<400> 6

uuugaaguau gccucaaggu u 21

<210> 7

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBa1M2

<400> 7

ccuugaggca uacuucaaa 19

<210> 8

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa1M2

<400> 8

uuugaaguau gccucaaggu u 21

<210> 9

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBa2M1

<400> 9

gaccuugagg cauacuucaa a 21

<210> 10

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa2M1

<400> 10

uuugaaguau gccucaaggu cgg 23

<210> 11

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBa2M2

<400> 11

gaccuugagg cauacuucaa a 21

<210> 12

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa2M2

<400> 12

uuugaaguau gccucaaggu cgg 23

<210> 13

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBa1M1S

<400> 13

ccuugaggca uacuucaaa 19

<210> 14

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa1M1S

<400> 14

uuugaaguau gccucaaggu u 21

<210> 15

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBa1M2S

<400> 15

ccuugaggca uacuucaaa 19

<210> 16

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa1M2S

<400> 16

uuugaaguau gccucaaggu u 21

<210> 17

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBa2M1S

<400> 17

gaccuugagg cauacuucaa a 21

<210> 18

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa2M1S

<400> 18

uuugaaguau gccucaaggu cgg 23

<210> 19

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBa2M2S

<400> 19

gaccuugagg cauacuucaa a 21

<210> 20

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa2M2S

<400> 20

uuugaaguau gccucaaggu cgg 23

<210> 21

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa1M1P1

<400> 21

uuugaaguau gccucaaggu u 21

<210> 22

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa1M2P1

<400> 22

uuugaaguau gccucaaggu u 21

<210> 23

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa2M1P1

<400> 23

uuugaaguau gccucaaggu cgg 23

<210> 24

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa2M2P1

<400> 24

uuugaaguau gccucaaggu cgg 23

<210> 25

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa1M1SP1

<400> 25

uuugaaguau gccucaaggu u 21

<210> 26

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa1M2SP1

<400> 26

uuugaaguau gccucaaggu u 21

<210> 27

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa2M1SP1

<400> 27

uuugaaguau gccucaaggu cgg 23

<210> 28

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBa2M2SP1

<400> 28

uuugaaguau gccucaaggu cgg 23

<210> 29

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBb1

<400> 29

ugcuaugccu caucuucua 19

<210> 30

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb1

<400> 30

uagaagauga ggcauagcag c 21

<210> 31

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb2

<400> 31

uagaagauga ggcauagcau u 21

<210> 32

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBb1M1

<400> 32

ugcuaugccu caucuucua 19

<210> 33

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb1M1

<400> 33

uagaagauga ggcauagcag c 21

<210> 34

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb2M1

<400> 34

uagaagauga ggcauagcau u 21

<210> 35

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBb1M2

<400> 35

ugcuaugccu caucuucua 19

<210> 36

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb1M2

<400> 36

uagaagauga ggcauagcag c 21

<210> 37

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb2M2

<400> 37

uagaagauga ggcauagcau u 21

<210> 38

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBb1M1S

<400> 38

ugcuaugccu caucuucua 19

<210> 39

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb1M1S

<400> 39

uagaagauga ggcauagcag c 21

<210> 40

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb2M1S

<400> 40

uagaagauga ggcauagcau u 21

<210> 41

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBb1M2S

<400> 41

ugcuaugccu caucuucua 19

<210> 42

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb1M2S

<400> 42

uagaagauga ggcauagcag c 21

<210> 43

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb2M2S

<400> 43

uagaagauga ggcauagcau u 21

<210> 44

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb1M1P1

<400> 44

uagaagauga ggcauagcag c 21

<210> 45

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb2M1P1

<400> 45

uagaagauga ggcauagcau u 21

<210> 46

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb1M2P1

<400> 46

uagaagauga ggcauagcag c 21

<210> 47

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb2M2P1

<400> 47

uagaagauga ggcauagcau u 21

<210> 48

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb1M1SP1

<400> 48

uagaagauga ggcauagcag c 21

<210> 49

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb2M1SP1

<400> 49

uagaagauga ggcauagcau u 21

<210> 50

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb1M2SP1

<400> 50

uagaagauga ggcauagcag c 21

<210> 51

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBb2M2SP1

<400> 51

uagaagauga ggcauagcau u 21

<210> 52

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBc1

<400> 52

ucugugccuu cucaucuga 19

<210> 53

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBc1

<400> 53

ucagaugaga aggcacagac g 21

<210> 54

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBc1M1

<400> 54

ucugugccuu cucaucuga 19

<210> 55

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBc1M1

<400> 55

ucagaugaga aggcacagac g 21

<210> 56

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBc1M2

<400> 56

ucugugccuu cucaucuga 19

<210> 57

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBc1M2

<400> 57

ucagaugaga aggcacagac g 21

<210> 58

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBc1M1S

<400> 58

ucugugccuu cucaucuga 19

<210> 59

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBc1M1S

<400> 59

ucagaugaga aggcacagac g 21

<210> 60

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBc1M2S

<400> 60

ucugugccuu cucaucuga 19

<210> 61

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBc1M2S

<400> 61

ucagaugaga aggcacagac g 21

<210> 62

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBc1M1P1

<400> 62

ucagaugaga aggcacagac g 21

<210> 63

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBc1M2P1

<400> 63

ucagaugaga aggcacagac g 21

<210> 64

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBc1M1SP1

<400> 64

ucagaugaga aggcacagac g 21

<210> 65

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBc1M2SP1

<400> 65

ucagaugaga aggcacagac g 21

<210> 66

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBd1

<400> 66

cgugugcacu ucgcuucaa 19

<210> 67

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBd1

<400> 67

uugaagcgaa gugcacacgg u 21

<210> 68

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBd1M1

<400> 68

cgugugcacu ucgcuucaa 19

<210> 69

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBd1M1

<400> 69

uugaagcgaa gugcacacgg u 21

<210> 70

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBd1M2

<400> 70

cgugugcacu ucgcuucaa 19

<210> 71

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBd1M2

<400> 71

uugaagcgaa gugcacacgg u 21

<210> 72

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic string for siHBd1M1S

<400> 72

cgugugcacu ucgcuucaa 19

<210> 73

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBd1M1S

<400> 73

uugaagcgaa gugcacacgg u 21

<210> 74

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siHBd1M2S

<400> 74

cgugugcacu ucgcuucaa 19

<210> 75

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBd1M2S

<400> 75

uugaagcgaa gugcacacgg u 21

<210> 76

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBd1M1P1

<400> 76

uugaagcgaa gugcacacgg u 21

<210> 77

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBd1M2P1

<400> 77

uugaagcgaa gugcacacgg u 21

<210> 78

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBd1M1SP1

<400> 78

uugaagcgaa gugcacacgg u 21

<210> 79

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siHBd1M2SP1

<400> 79

uugaagcgaa gugcacacgg u 21

<210> 80

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAN1

<400> 80

ccaagagcac caagaacua 19

<210> 81

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN1

<400> 81

uaguucuugg ugcucuuggc u 21

<210> 82

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAN2

<400> 82

agccaagagc accaagaacu a 21

<210> 83

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN2

<400> 83

uaguucuugg ugcucuuggc uug 23

<210> 84

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAN1M1

<400> 84

ccaagagcac caagaacua 19

<210> 85

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN1M1

<400> 85

uaguucuugg ugcucuuggc u 21

<210> 86

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAN2M1

<400> 86

agccaagagc accaagaacu a 21

<210> 87

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN2M1

<400> 87

uaguucuugg ugcucuuggc uug 23

<210> 88

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN1M2

<400> 88

uaguucuugg ugcucuuggc u 21

<210> 89

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN2M2

<400> 89

uaguucuugg ugcucuuggc uug 23

<210> 90

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAN1M3

<400> 90

ccaagagcac caagaacua 19

<210> 91

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAN2M3

<400> 91

agccaagagc accaagaacu a 21

<210> 92

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAN1M1S

<400> 92

ccaagagcac caagaacua 19

<210> 93

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN1M1S

<400> 93

uaguucuugg ugcucuuggc u 21

<210> 94

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAN2M1S

<400> 94

agccaagagc accaagaacu a 21

<210> 95

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN2M1S

<400> 95

uaguucuugg ugcucuuggc uug 23

<210> 96

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN1M2S

<400> 96

uaguucuugg ugcucuuggc u 21

<210> 97

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN2M2S

<400> 97

uaguucuugg ugcucuuggc uug 23

<210> 98

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAN1M3S

<400> 98

ccaagagcac caagaacua 19

<210> 99

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAN2M3S

<400> 99

agccaagagc accaagaacu a 21

<210> 100

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN1M1P1

<400> 100

uaguucuugg ugcucuuggc u 21

<210> 101

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN2M1P1

<400> 101

uaguucuugg ugcucuuggc uug 23

<210> 102

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN1M2P1

<400> 102

uaguucuugg ugcucuuggc u 21

<210> 103

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN2M2P1

<400> 103

uaguucuugg ugcucuuggc uug 23

<210> 104

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN1M1SP1

<400> 104

uaguucuugg ugcucuuggc u 21

<210> 105

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN2M1SP1

<400> 105

uaguucuugg ugcucuuggc uug 23

<210> 106

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN1M3SP1

<400> 106

uaguucuugg ugcucuuggc u 21

<210> 107

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAN2M3SP1

<400> 107

uaguucuugg ugcucuuggc uug 23

<210> 108

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAP1

<400> 108

caauaaagcu ggacaagaa 19

<210> 109

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP1

<400> 109

uucuugucca gcuuuuugg g 21

<210> 110

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAP2

<400> 110

cccaauaaag cuggacaaga a 21

<210> 111

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP2

<400> 111

uucuugucca gcuuuuugg gag 23

<210> 112

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAP1M1

<400> 112

caauaaagcu ggacaagaa 19

<210> 113

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP1M1

<400> 113

uucuugucca gcuuuuugg g 21

<210> 114

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAP2M1

<400> 114

cccaauaaag cuggacaaga a 21

<210> 115

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP2M1

<400> 115

uucuugucca gcuuuuugg gag 23

<210> 116

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAP1M2

<400> 116

caauaaagcu ggacaagaa 19

<210> 117

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP1M2

<400> 117

uucuugucca gcuuuuugg g 21

<210> 118

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAP2M2

<400> 118

cccaauaaag cuggacaaga a 21

<210> 119

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP2M2

<400> 119

uucuugucca gcuuuuugg gag 23

<210> 120

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAP1M1S

<400> 120

caauaaagcu ggacaagaa 19

<210> 121

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP1M1S

<400> 121

uucuugucca gcuuuuugg g 21

<210> 122

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAP2M1S

<400> 122

cccaauaaag cuggacaaga a 21

<210> 123

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP2M1S

<400> 123

uucuugucca gcuuuuugg gag 23

<210> 124

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAP1M2S

<400> 124

caauaaagcu ggacaagaa 19

<210> 125

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP1M2S

<400> 125

uucuugucca gcuuuuugg g 21

<210> 126

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for siAP2M2S

<400> 126

cccaauaaag cuggacaaga a 21

<210> 127

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP2M2S

<400> 127

uucuugucca gcuuuuugg gag 23

<210> 128

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP1M1P1

<400> 128

uucuugucca gcuuuuugg g 21

<210> 129

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP2M1P1

<400> 129

uucuugucca gcuuuuugg gag 23

<210> 130

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP1M2P1

<400> 130

uucuugucca gcuuuuugg g 21

<210> 131

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP2M2P1

<400> 131

uucuugucca gcuuuuugg gag 23

<210> 132

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP1M1SP1

<400> 132

uucuugucca gcuuuuugg g 21

<210> 133

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP2M1SP1

<400> 133

uucuugucca gcuuuuugg gag 23

<210> 134

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP1M2SP1

<400> 134

uucuugucca gcuuuuugg g 21

<210> 135

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for siAP2M2SP1

<400> 135

uucuugucca gcuuuuugg gag 23

<210> 136

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa1M1P

<400> 136

uuugaaguau gccucaaggu u 21

<210> 137

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa1M2P

<400> 137

uuugaaguau gccucaaggu u 21

<210> 138

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa2M1P

<400> 138

uuugaaguau gccucaaggu cgg 23

<210> 139

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa2M2P

<400> 139

uuugaaguau gccucaaggu cgg 23

<210> 140

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa1M1SP

<400> 140

uuugaaguau gccucaaggu u 21

<210> 141

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa1M2SP

<400> 141

uuugaaguau gccucaaggu u 21

<210> 142

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa2M1SP

<400> 142

uuugaaguau gccucaaggu cgg 23

<210> 143

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa2M2SP

<400> 143

uuugaaguau gccucaaggu cgg 23

<210> 144

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siHBa1M3SP

<400> 144

ccuugaggca uacuucaaa 19

<210> 145

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa1M4SP

<400> 145

uuugaaguau gccucaaggu u 21

<210> 146

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBb1M1SP

<400> 146

uagaagauga ggcauagcag c 21

<210> 147

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBb2M1SP

<400> 147

uagaagauga ggcauagcau u 21

<210> 148

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBb1M2SP

<400> 148

uagaagauga ggcauagcag c 21

<210> 149

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBb2M2SP

<400> 149

uagaagauga ggcauagcau u 21

<210> 150

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siHBb1M3SP

<400> 150

uagaagauga ggcauagcag c 21

<210> 151

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBb1M4SP

<400> 151

uagaagauga ggcauagcag c 21

<210> 152

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siHBb4M1SP

<400> 152

gcugcuaugc cucaucuucu a 21

<210> 153

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBb4M1SP

<400> 153

uagaagauga ggcauagcag cgc 23

<210> 154

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBc1M1SP

<400> 154

ucagaugaga aggcacagac g 21

<210> 155

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBc1M2SP

<400> 155

ucagaugaga aggcacagac g 21

<210> 156

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siHBc1M3SP

<400> 156

ucugugccuu cucaucuga 19

<210> 157

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBc1M4SP

<400> 157

ucagaugaga aggcacagac g 21

<210> 158

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siHBc2M1SP

<400> 158

cgucugugcc uucucaucaug a 21

<210> 159

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBc2M1SP

<400> 159

ucagaugaga aggcacagac ggg 23

<210> 160

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBd1M1SP

<400> 160

uugaagcgaa gugcacacgg u 21

<210> 161

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBd1M2SP

<400> 161

uugaagcgaa gugcacacgg u 21

<210> 162

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siHBd1M3SP

<400> 162

cgugugcacu ucgcuucaa 19

<210> 163

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBd1M4SP

<400> 163

ucagaugaga aggcacagac g 21

<210> 164

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siHBd2M1SP

<400> 164

accgugugca cuucgcuuca a 21

<210> 165

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBd2M1SP

<400> 165

uugaagcgaa gugcacacgg ucc 23

<210> 166

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN1M1P

<400> 166

uaguucuugg ugcucuuggc u 21

<210> 167

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN2M1P

<400> 167

uaguucuugg ugcucuuggc uug 23

<210> 168

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN1M2P

<400> 168

uaguucuugg ugcucuuggc u 21

<210> 169

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN2M2P

<400> 169

uaguucuugg ugcucuuggc uug 23

<210> 170

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN1M1SP

<400> 170

uaguucuugg ugcucuuggc u 21

<210> 171

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN2M1SP

<400> 171

uaguucuugg ugcucuuggc uug 23

<210> 172

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN1M2SP

<400> 172

uaguucuugg ugcucuuggc u 21

<210> 173

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN2M2SP

<400> 173

uaguucuugg ugcucuuggc uug 23

<210> 174

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN1M4S

<400> 174

uaguucuugg ugcucuuggc u 21

<210> 175

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN1M4SP

<400> 175

uaguucuugg ugcucuuggc u 21

<210> 176

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siAN1M5S

<400> 176

ccaagagcac caagaacua 19

<210> 177

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN1M5S

<400> 177

uaguucuugg ugcucuuggc u 21

<210> 178

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN1M5SP

<400> 178

uaguucuugg ugcucuuggc u 21

<210> 179

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAP1M1P

<400> 179

uucuugucca gcuuuuugg g 21

<210> 180

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAP2M1P

<400> 180

uucuugucca gcuuuuugg gag 23

<210> 181

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAP1M2P

<400> 181

uucuugucca gcuuuuugg g 21

<210> 182

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAP2M2P

<400> 182

uucuugucca gcuuuuugg gag 23

<210> 183

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAP1M1SP

<400> 183

uucuugucca gcuuuuugg g 21

<210> 184

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAP2M1SP

<400> 184

uucuugucca gcuuuuugg gag 23

<210> 185

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAP1M2SP

<400> 185

uucuugucca gcuuuuugg g 21

<210> 186

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAP2M2SP

<400> 186

uucuugucca gcuuuuugg gag 23

<210> 187

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> forward primer for mTTR

<400> 187

ccgtctgtgc cttctcatct 20

<210> 188

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> reverse primer for mTTR

<400> 188

taatctcctc ccccaactcc 20

<210> 189

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> forward primer for GAPDH

<400> 189

agaaggctggggctcatttg 20

<210> 190

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> reverse primer for GAPDH

<400> 190

aggggccatc cacagtcttc 20

<210> 191

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> b-actin forward primer

<400> 191

agcttctttg cagctccttc gttg 24

<210> 192

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> b-actin reverse primer

<400> 192

ttctgaccca ttcccaccat caca 24

<210> 193

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> HBV forward primer

<400> 193

cgtttctcct ggctcagttt a 21

<210> 194

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> HBV reverse primer

<400> 194

cagcggtaaa aagggactca a 21

<210> 195

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for AD-65695

<400> 195

acauauuuga ucagucuuuu u 21

<210> 196

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for AD-65695

<400> 196

aaaaagacug aucaaauauug uug 23

<210> 197

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for AD-69535

<400> 197

gcuuaaaagg gacaguauuc a 21

<210> 198

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for AD-69535

<400> 198

ugaauacugu cccuuuuaag caa 23

<210> 199

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> forward primer for ANGPTL3 mouse

<400> 199

gaggagcagc taaccaactt aat 23

<210> 200

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> ANGPTL3 mouse reverse primer

<400> 200

tctgcatgtg ctgttgactt aat 23

<210> 201

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> mouse GAPDH forward primer

<400> 201

aactttggca ttgtggaagg gctc 24

<210> 202

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> mouse GAPDH reverse primer

<400> 202

tggaagagtg ggagttgctg ttga 24

<210> 203

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for W8-siAN1M3SPs

<400> 203

uaguucuugg ugcucuuggc u 21

<210> 204

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-simTTR

<400> 204

aacaguguuc uugcucuaua a 21

<210> 205

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-simTTR

<400> 205

uuuuagagca agaacacugu uuu 23

<210> 206

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siHBa1M2Sps

<400> 206

ccuugaggca uacuucaaa 19

<210> 207

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa1M2Sps

<400> 207

uuugaaguau gccucaaggu u 21

<210> 208

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10- siHBa1M2Sp

<400> 208

ccuugaggca uacuucaaa 19

<210> 209

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa1M2Sp

<400> 209

uuugaaguau gccucaaggu u 21

<210> 210

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siHBa1M1Sp

<400> 210

ccuugaggca uacuucaaa 19

<210> 211

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa1M1Sp

<400> 211

uuugaaguau gccucaaggu u 21

<210> 212

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10- siHBa1M1SpsT

<400> 212

ccuugaggca uacuucaaa 19

<210> 213

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa1M1SpsT

<400> 213

uugaaguaug ccucaagguu 20

<210> 214

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siHBa1M1Sps

<400> 214

ccuugaggca uacuucaaa 19

<210> 215

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siHBa1M1Sps

<400> 215

uuugaaguau gccucaaggu u 21

<210> 216

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for P10-siHBa1M2SP

<400> 216

ccuugaggca uacuucaaa 19

<210> 217

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for P10-siHBa1M2SP

<400> 217

uuugaaguau gccucaaggu u 21

<210> 218

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for W8-siHBa1M2SP

<400> 218

ccuugaggca uacuucaaa 19

<210> 219

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for W8-siHBa1M2SP

<400> 219

uuugaaguau gccucaaggu u 21

<210> 220

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for Z5-siHBa1M2SP

<400> 220

ccuugaggca uacuucaaa 19

<210> 221

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for Z5-siHBa1M2SP

<400> 221

uuugaaguau gccucaaggu u 21

<210> 222

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siP1M1Sp

<400> 222

gaaaguaugu caacgaaua 19

<210> 223

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siP1M1Sp

<400> 223

uauucguuga cauacuuucu u 21

<210> 224

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siP1M1SP

<400> 224

gaaaguaugu caacgaaua 19

<210> 225

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siP1M1SP

<400> 225

uauucguuga cauacuuucu u 21

<210> 226

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siAN2M1Sp

<400> 226

agccaagagc accaagaacu a 21

<210> 227

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAN2M1Sp

<400> 227

uaguucuugg ugcucuuggc uug 23

<210> 228

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siAP1M1Sp

<400> 228

caauaaagcu ggacaagaa 19

<210> 229

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAP1M1Sp

<400> 229

uucuugucca gcuuuuugg g 21

<210> 230

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for L10-siAP1M1Sps

<400> 230

caauaaagcu ggacaagaa 19

<210> 231

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for L10-siAP1M1Sps

<400> 231

uucuugucca gcuuuuugg g 21

<210> 232

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for K4-simTTR

<400> 232

caauaaagcu ggacaagaa 19

<210> 233

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for K4-simTTR

<400> 233

uucuugucca gcuuuuugg g 21

<210> 234

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for AD-66810

<400> 234

caauaaagcu ggacaagaa 19

<210> 235

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for AD-66810

<400> 235

uucuugucca gcuuuuugg g 21

<210> 236

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for X2M2

<400> 236

ccuugaggca uacucaaat t 21

<210> 237

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for X2M2

<400> 237

uuugaaguau gccucaaggt t 21

<210> 238

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> HBV forward primer

<400> 238

gtcttttggg ttttgctgcc 20

<210> 239

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> HBV reverse primer

<400> 239

gcaacggggt aaaggttcag 20

<210> 240

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> b-actin forward primer

<400> 240

ggtcggagtc aacggattt 19

<210> 241

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> b-actin reverse primer

<400> 241

ccagcatcgc cccacttga 19

<210> 242

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> forward primer for ANGPTL3 monkey

<400> 242

ctggtggtgg catgatgagt 20

<210> 243

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> monkey ANGPTL3 reverse primer

<400> 243

ctcttctccg ctctggctta g 21

<210> 244

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> monkey GAPDH forward primer

<400> 244

ggggccaaa agggtcatca 20

<210> 245

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> monkey GAPDH reverse primer

<400> 245

cgtggactgt ggtcatgagt 20

<210> 246

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> forward primer for mouse b-actin

<400> 246

agcttctttg cagctccttc gttg 24

<210> 247

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> mouse b-actin reverse primer

<400> 247

ttctgaccca ttcccaccat caca 24

<210> 248

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> forward primer for human APOC3

<400> 248

gtgaccgatg gcttcagttc 20

<210> 249

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> human APOC3 reverse primer

<400> 249

atggataggc aggtggactt 20

<210> 250

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> Semantic sequence for matched sequence 1

<400> 250

ccuugaggca uacuucaaa 19

<210> 251

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> Antisense sequence for match sequence 1

<400> 251

uuugaaguau gccucaaggu u 21

<---

Claims (197)

1. A compound having the structure represented by formula (321):

Formula (321) Where n1 is an integer from 1 to 3, and n3 is an integer from 0 to 4; each of m1, m2 and m3 is independently an integer from 2 to 10; each of R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ is independently selected from H, methyl and ethyl; R ₄ is a group capable of being associated with an active drug or active agent by a covalent bond, where the active drug or active agent is an oligonucleotide and the bond is a phosphodiester bond; each L ₁ is a linear alkylene from 1 to 70 carbon atoms in which one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH =N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, and L ₁ is optional substituted by any one or more elements of the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen, OH , -SH, NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl)(C ₁ -C ₁₀ alkylphenyl), NH(C ₁ -C ₁₀ alkylphenyl), cyano, nitro, CO ₂ H, C(O)OC ₁ -C ₁₀ alkyl, CON(C ₁ -C ₁₀ alkyl)( C ₁ -C ₁₀ alkyl), CONH (C ₁ -C ₁₀ alkyl), CONH ₂ , NHC (O) (C ₁ -C ₁₀ alkyl), NHC (O) (phenyl), N (C ₁ -C ₁₀ alkyl )C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), C (O) C ₁ -C ₁₀ alkyl, C (O) C ₁ -C ₁₀ alkylphenyl, C(O)C ₁ -C ₁₀ haloalkyl, OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH(C ₁ -C ₁₀ alkyl), SO ₂ NH(phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl), where L ₁ is a combined combination of at least two of the groups A1, A4, A8, A10 and A11:

where each j1 is independently an integer from 1 to 20; each j2 is independently an integer from 1 to 20; each Rb is independently C ₁ -C ₁₀ alkyl; And

represents the point of attachment of the group to the rest of the molecule; each S ₁ is independently M ₁ in which any active hydroxyl, if any, is protected by a hydroxyl protecting group; each M ₁ is a ligand capable of binding to asialoglycoprotein receptors on the surface of liver cells (ASGPR). 2. The compound according to claim 1, characterized in that the length L ₁ is from 3 to 25 atoms, and the length L ₁ refers to the number of chain-forming atoms in L ₁ in the longest chain of atoms formed from the atom bonded to the N atom on nitrogenous backbone, to the atom associated with S ₁ ; or the length L ₁ is from 4 to 15 atoms. 3. Connection under item 1, characterized in that each of m1, m2 and m3 independently represents an integer from 2 to 5; or m1 = m2 = m3. 4. The compound according to claim 1, characterized in that each M ₁ is independently selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N -acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2 -deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl -α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl-2,3,4-tris-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio- β-D-galactopyranose, ethyl-3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose and L-4-thioribose. 5. The compound according to claim 1, characterized in that R ₄ contains the first functional group that can react with a group on the oligonucleotide or nucleotide to form a phosphoester bond; or R ₄ further contains a second functional group that is capable of forming a covalent bond with a hydroxy group or an amino group, or is a solid phase support attached to the rest of the molecule by a covalent bond formed by a hydroxy group or an amino group. 6. The compound according to claim 5, characterized in that the first functional group is phosphoramidite, hydroxy or protected hydroxy. 7. A compound according to claim 5, characterized in that the second functional group is a phosphoramidite group, a carboxyl or a carboxylate. 8. A compound according to claim 5, characterized in that said compound has a structure represented by formula (403) - (442):

, (403)

, (404)

, (405)

, (406)

, (407)

, (408)

, (409)

, (410)

, (411)

, (412)

, (413)

, (414)

, (415)

, (416)

, (417)

, (418)

, (419)

, (420)

, (421)

, (422)

, (423)

, (424)

, (425)

, (426)

, (427)

(428)

(429)

(430)

(431)

(432)

(433)

(434)

(435)

(436)

(437)

(438)

(439)

(440)

(441)

, (442) where X is O or NH, M ⁺ is a cation, R _k is a hydroxy protecting group, SPS is a solid phase support. 9. The compound according to claim 8, characterized in that M ⁺ is an alkali metal cation, an ammonium cation, a cation formed from a tertiary amine, or a quaternary ammonium cation, R _k is trityl, 4-methoxytrityl, 4,4'- dimethoxytrityl or 4,4',4''-trimethoxytrityl, and SPS is a resin. 10. The compound according to claim 1, characterized in that the receptor is a receptor on the surface of hepatocytes; or the receptor is further an asialoglycoprotein receptor on human hepatocytes. 11. A conjugate having a structure represented by formula (1):

Formula 1), Where n1 is an integer from 1 to 3, and n3 is an integer from 0 to 4; each of m1, m2 and m3 is independently an integer from 2 to 10; each of R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ is independently selected from H, methyl and ethyl; R ₃ is an active drug, and R ₃ includes a functional oligonucleotide; or R ₃ is a group having the structure represented by formula A59:

(A59), where E ₁ is OH, SH or BH ₂ and Nu is a functional oligonucleotide; R ₂ is a linear alkylene from 1 to 20 carbon atoms in which one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH= N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, and where R ₂ is optionally substituted with any one or more elements of the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ -C ₁₀ alkylphenyl , -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen, OH, - SH, NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkylphenyl), NH (C ₁ -C ₁₀ alkylphenyl), cyano, nitro, CO ₂ H, C (O) OC ₁ -C ₁₀ alkyl, CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), CONH(C ₁ -C ₁₀ alkyl), CONH ₂ , NHC(O)(C ₁ -C ₁₀ alkyl), NHC(O)(phenyl), N(C ₁ -C ₁₀ alkyl)C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), C (O) C ₁ -C ₁₀ alkyl, C (O) C ₁ -C ₁₀ alkylphenyl , C (O) C ₁ -C ₁₀ haloalkyl, OC (O) C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH (C ₁ -C ₁₀ alkyl), SO ₂ NH (phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl); each L ₁ is independently a linear alkylene from 1 to 70 carbon atoms in which one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O) ₂ , C ₂ -C ₁₀ alkenylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, while L ₁ optionally substituted by any one or more members of the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ - C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen, OH, -SH, NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkylphenyl), NH (C ₁ -C ₁₀ alkylphenyl), cyano, nitro, CO ₂ H, C (O) OC ₁ -C ₁₀ alkyl, CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), CONH (C ₁ -C ₁₀ alkyl), CONH ₂ , NHC (O) (C ₁ -C ₁₀ alkyl), NHC (O) (phenyl), N (C ₁ -C ₁₀ alkyl) C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), C (O) C ₁ -C ₁₀ alkyl, C (O) C ₁ - C ₁₀ alkylphenyl, C (O) C ₁ -C ₁₀ haloalkyl, OC (O) C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH (C ₁ -C ₁₀ alkyl), SO ₂ NH (phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl), where L ₁ is a combined combination of at least two of the groups A1, A4, A8, A10 and A11:

where each j1 is independently an integer from 1 to 20; each j2 is independently an integer from 1 to 20; each Rb is independently C ₁ -C ₁₀ alkyl; And

represents the point of attachment of the group to the rest of the molecule; each M ₁ is a ligand capable of binding to asialoglycoprotein receptors on the surface of liver cells (ASGPR). 12. The conjugate according to claim 11, characterized in that the length L ₁ is from 3 to 25 atoms; or the length L ₁ is from 4 to 15 atoms. 13. The conjugate according to claim 11, characterized in that each of m1, m2 and m3 independently represents an integer from 2 to 5; or m1 = m2 = m3. 14. The conjugate of claim. 11, characterized in that each M ₁ independently represents a monosaccharide, disaccharide, trisaccharide or polysaccharide; or each M ₁ is independently selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D -mannofuranoses, β-D-mannofuranoses, α-D-mannopyranoses, β-D-mannopyranoses, α-D-glucopyranoses, β-D-glucopyranoses, α-D-glucofuranoses, β-D-glucofuranoses, α-D-fructofuranoses , α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β -D-glucopyranose, methyl-2,3,4-tris-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl-3,4 ,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L -ribose and L-4-thioribose. 15. The conjugate according to claim 11, characterized in that R ₂ forms a phosphoester bond with the P atom in R ₃ . 16. The conjugate according to claim 11, characterized in that the conjugate has a structure represented by the formula (3), (4), (5), (6), (7), (8), (9), (10), (11), (12), (13), (14), (15), (16), (17), (18), (19), (20), (21) or (22):

Formula (3)

Formula (4)

Formula (5)

Formula (6)

Formula (7)

Formula (8)

Formula (9)

Formula (10)

Formula (11)

Formula (12)

Formula (13)

Formula (14)

Formula (15)

Formula (16)

Formula (17)

Formula (18)

Formula (19)

Formula (20)

Formula (21)

. Formula (22) 17. The conjugate according to claim 11, characterized in that the functional oligonucleotide is selected from the group consisting of small interfering RNA, miRNA, anti-miRNA, microRNA antagonist, microRNA mimetics, oligonucleotide trap, immunostimulator, G-quadruplex, splicing-altering, single-stranded RNA , antisense nucleic acid, nucleic acid aptamer, stem-loop RNA, mRNA fragments, activating RNA or DNA. 18. The conjugate according to claim 17, characterized in that the functional oligonucleotide is a single-stranded oligonucleotide, the P atom in formula A59 is linked to the 3' end of the single-stranded oligonucleotide; or a functional oligonucleotide is a double-stranded oligonucleotide containing a sense strand and an antisense strand, the P atom in formula A59 is linked to the 3' end of the sense strand. 19. The conjugate according to claim 17, characterized in that each nucleotide in miRNA is independently a modified or unmodified nucleotide; said siRNA contains a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence of 1 and the antisense strand comprises a nucleotide sequence of 2, both of which are 19 nucleotides in length and which are at least partially reversely complementary to form a double-stranded complementary region; nucleotide sequence 2 is at least partially complementary to the first fragment of the nucleotide sequence, which refers to a nucleotide fragment in the target mRNA; and target mRNA refers to the mRNA of a gene that is aberrantly expressed in hepatocytes. 20. Conjugate according to claim 19, characterized in that the target mRNA is an mRNA corresponding to ApoB, ApoC, ANGPTL3, PCSK9, SCD1, TIMP-1, Col1A1, FVII, STAT3, p53, HBV or HCV. 21. The conjugate according to claim 19, characterized in that the nucleotide sequence 1 has the same length as the first fragment of the nucleotide sequence and differs by no more than 3 nucleotides from the first fragment of the nucleotide sequence; the nucleotide sequence 2 has the same length as the nucleotide sequence B and differs by no more than 3 nucleotides from the nucleotide sequence B, which refers to a nucleotide sequence that is fully inversely complementary to the first fragment of the nucleotide sequence. 22. The conjugate of claim 21, wherein the nucleotide differences between nucleotide sequence 2 and nucleotide sequence B include a difference in the position of the first nucleotide Z' in nucleotide sequence 2 in a 5' to 3' direction. 23. The conjugate of claim 22, characterized in that the sense strand further comprises a nucleotide sequence of 3, and the antisense strand further comprises a nucleotide sequence of 4; the sequences of nucleotides 3 and 4 have an identical length of 1 to 4 nucleotides; nucleotide sequence 3 is linked to the 5' end of nucleotide sequence 1 and nucleotide sequence 4 is linked to the 3' end of nucleotide sequence 2; nucleotide sequence 4 is complementary to the second fragment of the nucleotide sequence; the second nucleotide sequence fragment refers to the nucleotide sequence adjacent to the first nucleotide sequence fragment in the target mRNA and has the same length as nucleotide sequence 4; and nucleotide sequence 3 is substantially reverse complementary or fully reverse complementary to nucleotide sequence 4. 24. The conjugate according to claim 19 or 23, characterized in that the siRNA additionally contains a nucleotide sequence of 5, which is 1 to 3 nucleotides in length and is linked to the 3' end of the antisense strand, thus forming the 3' sticky end of the antisense strand . 25. The conjugate of claim 19, wherein each nucleotide in the sense and antisense strands is independently a fluorine-modified nucleotide or a non-fluorine-modified nucleotide, where the fluorine-modified nucleotide refers to a nucleotide formed by substitution of a 2'-hydroxy group its ribose group with a fluorine-containing group; wherein a non-fluoro-modified nucleotide refers to a nucleotide formed by replacing the 2'-hydroxy group of its ribose group with a group other than fluorine, or a nucleotide analog, wherein said nucleotide analog refers to a group capable of replacing a nucleotide in a nucleic acid, wherein having a structure other than any one of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. 26. The conjugate according to claim 25, characterized in that both the sense and antisense strands contain fluorine-modified and non-fluorine-modified nucleotides, said fluorine-modified nucleotides are present in nucleotide sequence 1 and nucleotide sequence 2, no more than 5 fluorine-modified nucleotides are present in nucleotide sequence 1, and in the 5' to 3' direction, the nucleotides at positions 7, 8 and 9 in nucleotide sequence 1 are fluorine-modified nucleotides; no more than 7 fluorine-modified nucleotides are present in nucleotide sequence 2, and in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 in nucleotide sequence 2 are fluorine-modified nucleotides. 27. The conjugate according to claim 25, characterized in that each non-fluorine-modified nucleotide is a methoxy-modified nucleotide, wherein the methoxy-modified nucleotide refers to a nucleotide formed by replacing the 2'-hydroxy group of its ribose group with a methoxy group . 28. The conjugate according to claim 19, characterized in that in miRNA at least one phosphate group is a phosphothioate group, and the phosphorothioate bond is present in at least one of the following positions: between the first nucleotide and the second nucleotide from the 5' end of the sense strand; between the second nucleotide and the third nucleotide from the 5' end of the sense strand; between the first nucleotide and the second nucleotide from the 3' end of the sense strand; between the second nucleotide and the third nucleotide from the 3' end of the sense strand; between the first nucleotide and the second nucleotide from the 5' end of the antisense strand; between the second nucleotide and the third nucleotide from the 5' end of the antisense strand; between the first nucleotide and the second nucleotide from the 3' end of the antisense strand; And between the second nucleotide and the third nucleotide from the 3' end of the antisense strand. 29. A conjugate according to claim 19, characterized in that the nucleotide at the 5' end of the antisense strand is a nucleotide with a 5'-phosphate or a nucleotide modified with a 5'-phosphate analog. 30. The use of a conjugate according to any one of paragraphs. 11-29 to obtain a drug for the treatment and/or prevention of a pathological condition or disease caused by the expression of a certain gene in hepatocytes. 31. Use according to claim 30, characterized in that the specified gene is selected from the group consisting of the hepatitis B virus gene, the angiopoietin-like protein 3 gene, and the apolipoprotein C3 gene. 32. Use according to claim 30, characterized in that the disease is selected from the group consisting of chronic liver disease, hepatitis, liver fibrosis, proliferative liver diseases and dyslipidemia. 33. Use according to claim 32, characterized in that the dyslipidemia is hypercholesterolemia, hypertriglyceridemia or atherosclerosis. 34. The method of inhibiting the expression of a particular gene in hepatocytes, including bringing into contact the conjugate according to any one of paragraphs. 11-29 with hepatocytes. 35. The method according to claim 34, characterized in that the particular gene is ApoB, ApoC, ANGPTL3, PCSK9, SCD1, TIMP-1, Col1A1, FVII, STAT3, p53, HBV, or HCV.

Images