RU2782211C2 - Nucleic acid, composition and conjugate containing it, as well as method for their production and use - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology, in particular to new antisense conjugates; it can be used in medicine. The invention allows for the production of a conjugate for inhibition of expression of a hepatitis B virus gene, containing small interfering RNA (siRNA), which is modified nucleotide aimed at a target gene, and targeting ligand, which is capable of binding to asialoglycoprotein receptors (ASGP-R) on the surface of mammalian hepatocytes.

EFFECT: invention can be used in medical practice as a drug in the treatment of pathological conditions or diseases caused by an infection of a hepatitis B virus (HBV), for example chronic liver diseases, hepatitis, liver fibrosis, and proliferative liver diseases.

25 cl, 6 ex, 4 tbl, 28 dwg

Description

BACKGROUND OF THE INVENTION

[1] Viral hepatitis type B (also known as hepatitis B or hepatitis B) is a class of infectious diseases that are a serious threat to the world, particularly China. Currently, the two main types of internationally recognized drugs for the prevention/treatment of hepatitis B are interferons and nucleoside analogs; however, such drugs have various disadvantages (eg, tend to develop drug resistance after use or have limited utility). For example, interferons tend to cause unwanted reactions; and disadvantages of nucleoside analogs are drug resistance and disease recurrence after drug withdrawal. Thus, if the expression of the genes of the virus can be suppressed at the gene level to block the production and replication of the hepatitis B virus (HBV), which will significantly reduce the metabolism of the virus and the infection of liver cells, this will undoubtedly be the most excellent treatment for hepatitis B. RNA (siRNA) can inhibit or block the expression of any target gene of interest, such as a gene that starts a disease such as cancer, in a sequence-specific manner based on the mechanism of RNA interference (RNAi), which will achieve the goal of treating diseases.

[2] Stabilized siRNA modification and its delivery system are two key technologies in the development of drugs based on small RNAs.

SUMMARY OF THE INVENTION

[3] According to some embodiments of the present invention, an siRNA conjugate is provided having the structure represented by Formula (1):

wherein

n1 is an integer from 1 to 3 and n3 is an integer from 0 to 4;

each of m1, m2 and m3 is independently an integer from 2 to 10;

each of R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ independently represents H or is selected from the group consisting of C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl and C ₁ -C ₁₀ alkoxy ;

R ₃ is a group having the structure represented by Formula A59:

(A59),

in which E ₁ represents HE, SH or BH ₂ ; and

Nu is miRNA.

[4] Each nucleotide in siRNA is independently a modified or unmodified nucleotide. The miRNA contains a sense strand and an antisense strand, wherein the sense strand contains nucleotide sequence 1 and the antisense strand contains nucleotide sequence 2; nucleotide sequence 1 and nucleotide sequence 2 are at least partially reverse complementary to form a double-stranded region; nucleotide sequence 1 has the same length as the nucleotide sequence shown in SEQ ID NO:155 and differs from it by no more than 3 nucleotides; and nucleotide sequence 2 is the same length as the nucleotide sequence shown in SEQ ID NO:156 and differs from it by no more than 3 nucleotides:

5'-CCUUGAGGCAUACUUCAAZ-3' (SEQ ID NO: 155);

5'-Z'UUUGAAGUAUGCCUCAAGG-3' (SEQ ID NO: 156);

in which

Z is A; Z' is U;

nucleotide sequence 1 contains the nucleotide Z _A at the position corresponding to Z;

nucleotide sequence 2 contains the nucleotide _Z'B at the position corresponding to Z'; nucleotide Z' _B is the first nucleotide from the 5' end of the antisense strand;

R ₂ is a linear alkylene of 1 to 20 carbon atoms in length, with one or more carbon atoms optionally substituted by any one or more of the group consisting of: C(O), NH, O, S, CH=N, S( O) ₂ , C ₂ -C ₁₀ alkylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, wherein R ₂ is optionally substituted by any one or more from the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, -OC ₁ -C ₁₀ alkyl, -OC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-OH, -OC ₁ -C ₁₀ haloalkyl, -SC ₁ -C ₁₀ alkyl, -SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-SH, -SC ₁ -C ₁₀ haloalkyl, halogen, -OH, -SH, -NH ₂ , -C ₁ -C ₁₀ alkyl-NH ₂ , -N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -NH (C ₁ - C ₁₀ alkyl), cyano, nitro, -CO ₂ H, -C (O) OC ₁ -C ₁₀ alkyl, -CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -CONH (C ₁ -C ₁₀ alkyl), -CONH ₂ , -NHC(O)(C ₁ -C ₁₀ alkyl), -NHC(O)(phenyl), -N(C ₁ -C ₁₀ alkyl)C(O)(C ₁ -C ₁₀ alkyl), -N (C ₁ -C ₁₀ alkyl )C (O) (phenyl), -C (O) C ₁ -C ₁₀ alkyl, -C (O) C ₁ -C ₁₀ alkylphenyl, -C (O) C ₁ -C ₁₀ haloalkyl, -OC (O) C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , -SO ₂ NH (C ₁ -C ₁₀ alkyl), -SO ₂ NH(phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and -NHSO ₂ (C ₁ -C ₁₀ haloalkyl);

each L ₁ is independently a linear alkylene of 1 to 70 carbon atoms in length, with one or more carbon atoms optionally substituted by any one or more of the group consisting of: C(O), NH, O, S, CH=N, S(O) ₂ , C ₂ -C ₁₀ alkylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, and L ₁ is optionally substituted by any one or more from the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C1 ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, -OC ₁ -C ₁₀ alkyl, -OC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-OH, -OC ₁ -C ₁₀ haloalkyl, -SC ₁ -C ₁₀ alkyl, -SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-SH, -SC ₁ - C ₁₀ haloalkyl, halogen, -OH, -SH, -NH ₂ , -C ₁ -C ₁₀ alkyl-NH ₂ , -N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -NH (C ₁ -C ₁₀ alkyl), cyano, nitro, -CO ₂ H, -C (O) OC ₁ -C ₁₀ alkyl, -CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -CONH ( C ₁ -C ₁₀ alkyl), -CONH ₂ , -NHC(O)(C ₁ -C ₁₀ alkyl), -NHC(O)(phenyl), -N(C ₁ -C ₁₀ alkyl)C(O)( C ₁ -C ₁₀ alkyl), -N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), -C (O) C ₁ -C ₁₀ alkyl, -C (O) C ₁ -C ₁₀ alkylphenyl, -C (O) C ₁ - C ₁₀ haloalkyl, -OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , -SO ₂ NH (C ₁ -C ₁₀ alkyl), -SO ₂ NH (phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and -NHSO ₂ (C ₁ - C ₁₀ haloalkyl);

представляет собой положение, в котором группа присоединена к остальной части молекулы;

is the position at which the group is attached to the rest of the molecule;

M ₁ is a targeting group.

[5] According to some embodiments of the present invention, a method for producing a conjugate is provided, including the sequential connection of nucleoside monomers in the direction from 3' to 5' in accordance with the type and nucleotide sequence of the sense strand and the antisense strand of miRNA, respectively, under the condition of solid-phase phosphoamidite synthesis, and the connection of each nucleoside monomer includes a four-step reaction of deprotection, binding, capping, and oxidation or sulfurization; isolation of the sense strand and antisense strand of miRNA; and renaturation; wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide; miRNA contains a sense strand and an antisense strand, wherein the sense strand contains nucleotide sequence 1 and the antisense strand contains nucleotide sequence 2; nucleotide sequence 1 and nucleotide sequence 2 are at least partially reverse complementary, allowing the formation of a double-stranded region;; nucleotide sequence 1 has the same length as the nucleotide sequence shown in SEQ ID NO: 155 and differs from it by no more than 3 nucleotides; and nucleotide sequence 2 is the same length as the nucleotide sequence shown in SEQ ID NO: 156 and differs from it by no more than 3 nucleotides:

5'-CCUUGAGGCAUACUUCAAZ-3' (SEQ ID NO: 155);

5'-Z'UUUGAAGUAUGCCUCAAGG-3' (SEQ ID NO: 156);

in which

Z is A; Z' is U;

nucleotide sequence 1 contains the nucleotide Z _A at the position corresponding to Z;

nucleotide sequence 2 contains the nucleotide _Z'B at the position corresponding to Z'; nucleotide Z' _B is the first nucleotide from the 5' end of the antisense strand.

[6] In addition, the method further includes bringing the compound represented by Formula (321) into contact with a nucleoside monomer or a nucleotide sequence coupled to a solid phase support in a coupling reaction condition in the presence of a coupling reagent, thereby allowing the compound represented by Formula ( 321), with the nucleotide sequence due to the binding reaction. Hereinafter, the compound represented by Formula (321) is also referred to as a conjugating molecule,

wherein

R ₄ is a group capable of binding to siRNA represented by Nu; in some embodiments of the present invention, R ₄ is a group capable of binding to an siRNA represented by Nu through a covalent bond; in some embodiments of the present invention, R ₄ is a group containing any functional group that can be conjugated to the siRNA represented by Nu through a phosphodiester bond via a reaction;

each S ₁ is independently a group in M ₁ formed by substituting all of the active hydroxyl with a group represented by the formula YCOO-, where each Y is independently selected from the group consisting of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl and alkylphenyl;

definitions and variants of n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ and M ₁ , respectively, are described above.

[7] In some embodiments, the present invention provides an siRNA capable of inhibiting hepatitis B virus (HBV) gene expression, said siRNA comprising a sense strand and an antisense strand, both of which contain fluorine-modified and non-fluorine-modified nucleotides; wherein the sense chain contains a segment of the nucleotide sequence I; the antisense strand contains a segment of the nucleotide sequence II; the nucleotide sequence of I and the nucleotide sequence of II are at least partially reverse complementary, which allows the formation of a double-stranded region; wherein the nucleotide sequence I contains the nucleotide sequence A, which has the same length as the nucleotide sequence shown in SEQ ID NO: 155, and differs from it by no more than 3 nucleotides; and nucleotide sequence II contains nucleotide sequence B, which has the same length as the nucleotide sequence shown in SEQ ID NO: 156 and differs from it by no more than 3 nucleotides:

5'-CCUUGAGGCAUACUUCAAZ-3' (SEQ ID NO: 155);

5'-Z'UUUGAAGUAUGCCUCAAGG-3' (SEQ ID NO: 156);

in which

Z is A; Z' is U;

the nucleotide sequence A contains the nucleotide Z _A at the position corresponding to Z;

nucleotide sequence _B contains the nucleotide Z'B at the position corresponding to Z'; nucleotide Z' _B is the first nucleotide from the 5' end of the antisense strand; and

fluorine-modified nucleotides are located within the nucleotide sequences A and B;

in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 of nucleotide sequence 1 are fluorine-modified nucleotides; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence 2 are fluorine-modified nucleotides.

[8] In some embodiments, the present invention provides a pharmaceutical composition comprising the siRNA disclosed herein and a pharmaceutically acceptable carrier.

[9] According to some embodiments of the present invention, an siRNA conjugate is provided that comprises an siRNA disclosed herein and a conjugating group conjugated to the siRNA; miRNA contains a sense strand and an antisense strand, both of which contain fluorine-modified nucleotides and non-fluorine-modified nucleotides; moreover, the sense chain contains a segment of the nucleotide sequence I; the antisense strand contains a segment of the nucleotide sequence II; nucleotide sequence I and nucleotide sequence II are at least partially reverse complementary, allowing the formation of a double-stranded region; wherein the nucleotide sequence I contains the nucleotide sequence A, which has the same length as the nucleotide sequence shown in SEQ ID NO: 155, and differs from it by no more than 3 nucleotides; and nucleotide sequence II contains nucleotide sequence B, which has the same length as the nucleotide sequence shown in SEQ ID NO: 156 and differs from it by no more than 3 nucleotides:

5'-CCUUGAGGCAUACUUCAAZ-3' (SEQ ID NO: 155);

5'-Z'UUUGAAGUAUGCCUCAAGG-3' (SEQ ID NO: 156);

wherein

Z is A; Z' is U;

the nucleotide sequence A contains the nucleotide Z _A at the position corresponding to Z;

nucleotide sequence _B contains the nucleotide Z'B at the position corresponding to Z'; nucleotide Z' _B is the first nucleotide from the 5' end of the antisense strand; and

fluorine-modified nucleotides are located within the nucleotide sequences A and B;

in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 of nucleotide sequence 1 are fluorine-modified nucleotides; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence 2 are fluorine-modified nucleotides.

[10] In some embodiments, the present invention provides the use of an siRNA and/or a pharmaceutical composition and/or an siRNA conjugate of the present invention in the manufacture of a medicament for the treatment and/or prevention of pathological conditions or diseases caused by hepatitis B virus (HBV) infection.

[11] According to some embodiments of the present invention, there is provided a method for treating and/or preventing pathological conditions or diseases caused by hepatitis B virus (HBV) infection, comprising administering an effective amount of an siRNA and/or a pharmaceutical composition and/or an siRNA conjugate according to the present invention to a patient who needs it.

[12] In some embodiments, the present invention provides a method for inhibiting HBV gene expression, comprising contacting an effective amount of the modified siRNA and/or pharmaceutical composition and/or siRNA conjugate of the present invention with hepatitis B infected cells infected with HBV.

[13] According to some embodiments of the present invention, there is provided a kit containing an siRNA and/or a pharmaceutical composition and/or an siRNA conjugate according to the present invention.

INCLUSION BY LINK

[14] All publications, patents, and patent applications referred to in this specification are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application were specifically and individually indicated for inclusion by reference. .

BRIEF DESCRIPTION OF THE DRAWINGS

[15] FIG. 1 shows a semi-quantitative result of testing the stability of the tested siRNA conjugates in tritosome under in vitro conditions.

[16] FIG. 2 shows a semi-quantitative result of testing the stability of the tested siRNA conjugates in tritosome under in vitro conditions.

[17] FIG. 3 shows a semi-quantitative result of testing the stability of the tested siRNA conjugates in human plasma under in vitro conditions.

[18] FIG. 4 shows a semi-quantitative in vitro stability test result of the tested siRNA conjugates in monkey plasma.

[19] FIG. 5 shows the result of testing the stability of the tested siRNA conjugate in rat liver tritosomes.

[20] FIG. 6 shows the result of testing the stability of the tested siRNA conjugate in human liver lysosomes.

[21] FIG. 7 shows a time-dependent metabolic curve showing plasma concentration pharmacokinetics/toxicokinetics (PK/TK) for Conjugate 1 at 10 mg/kg in rat plasma.

[22] FIG. 8 shows a metabolic curve versus time showing tissue concentration PK/TK for Conjugate 1 at 10 mg/kg in rat liver and kidney.

[23] FIG. 9 is a metabolic curve versus time showing plasma concentration PK/TK for conjugate 1 at 50 mg/kg in rat plasma.

[24] FIG. 10 is a metabolic curve versus time showing tissue concentration PK/TK for Conjugate 1 at 50 mg/kg in rat liver and kidney.

[25] FIG. 11 is a metabolic curve versus time showing plasma concentration PK/TK for conjugate 6 at 10 mg/kg in rat plasma.

[26] FIG. 12 is a metabolic curve versus time showing tissue concentration PK/TA for Conjugate 6 at 10 mg/kg in rat liver and kidney.

[27] FIG. 13 is a metabolic curve versus time showing plasma concentration PK/TK for conjugate 6 at 50 mg/kg in rat plasma.

[28] FIG. 14 is a metabolic curve versus time showing tissue concentration PK/TK for conjugate 6 at 50 mg/kg in rat liver and kidney.

[29] FIG. 15 shows the inhibitory efficacy of conjugates 5 and 7 on HBV mRNA expression in a 44Bri mouse model.

[30] FIG. 16 shows the inhibitory efficacy of conjugates 1 and 6 on HBV mRNA expression in a 44Bri mouse model.

[31] FIG. 17 shows the inhibitory efficacy of conjugates 5 and 6 on HBV mRNA expression in a 44Bri mouse model.

[32] FIG. 18 shows the inhibitory efficacy of conjugates 5, 6, 9 and 10 on HBV mRNA expression in a 44Bri mouse model.

[33] FIG. 19 shows the inhibitory efficacy of conjugates 1, 2, 3 and 4 on HBV mRNA expression in a 44Bri mouse model.

[34] FIG. 20 shows the inhibitory efficacy of conjugate 1 on HBV mRNA expression in a 44Bri mouse model.

[35] FIG. 21 shows time dependence testing of the inhibitory efficacy of siRNA in siRNA conjugates 1 and 6 on serum HBsAg expression in a mouse model of AAV-HBV.

[36] FIG. 22 shows time-dependent testing of the inhibitory efficacy of siRNA in siRNA conjugates 1 and 6 against HBV DNA in a mouse model of AAV-HBV.

[37] FIG. 23 shows a time dependence test of the inhibitory efficacy of conjugate 6 on serum HBsAg expression in a low AAV-HBV mouse model.

[38] FIG. 24 shows time dependence testing of the inhibitory efficacy of conjugates 5 and 6 on serum HBsAg expression in the M-Tg model.

[39] FIG. 25 shows time-dependence testing of the inhibitory efficacy of conjugates 6 and 11 on serum HBsAg expression in the M-Tg model.

[40] FIG. 26 shows a time dependence test of the inhibitory efficacy of conjugate 1 on serum HBsAg expression in a 1.28 copy model.

[41] FIG. 27 shows time dependence testing of the inhibitory efficacy of conjugate 1 against HBV DNA in a 1.28 copy model.

[42] FIG. 28A-28D show the IC50 values for Conjugate 1 when targeting GSCM, GSSM, PSCM and PSSM, respectively.

DETAILED DESCRIPTION OF THE INVENTION

[43] Specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only intended to illustrate and explain the present invention and are not intended to limit the present invention in any respect.

Definitions

[44] As used in the present invention, an HBV gene refers to a gene having the DNA sequence shown under Genbank Accession No. NC_003977.1.

[45] In relation to the present invention, unless otherwise indicated, C, G, U, A and T denote the composition of the bases of nucleotides; d means that one nucleotide to the right of the letter d is a deoxyribonucleotide; the letter m means that the nucleotide to the left of the letter m is a methoxy-modified nucleotide; f denotes that the nucleotide to the left of the letter f is a fluorine-modified nucleotide; s means that the two nucleotides on either side of the letter s are connected by a phosphothioate bond; P1 indicates that the nucleotide adjacent to the right side of P1 is a 5'-phosphate nucleotide or a nucleotide modified with a 5'-phosphate analog, in particular a modified vinyl phosphate nucleotide (represented as VP in the examples below), a 5'-phosphate nucleotide (represented as P in the examples below) or a 5'-thiophosphate modified nucleotide (represented as Ps in the examples below).

[46] As used in the present invention, the term "fluorine-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl of a ribose group of a nucleotide with fluorine. The term "non-fluorine-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl of the ribose group of a nucleotide with a group other than a fluoro group, or a nucleotide analog. "Nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid that is structurally different from an adenine ribonucleotide, a guanine ribonucleotide, a cytosine ribonucleotide, a uracil ribonucleotide, or a thymine deoxyribonucleotide, such as an isonucleotide, a bridging nucleic acid (BNA) nucleotide, or an acyclic nucleotide. A methoxy-modified nucleotide refers to a nucleotide formed by replacing the 2'-hydroxyl of a ribose group with a methoxy group.

[47] In the context of the present invention, the terms "complementary" and "reverse complementary" can be used interchangeably and have a well-known meaning in the art, namely, bases in one strand are complementary paired with bases in the other strand of a double-stranded nucleic acid molecule. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); and the purine base guanine (G) is always paired with the pyrimidine base cytosine (C). Each base pair contains a purine and a pyrimidine. If adenines in one strand are always paired with thymines (or uracils) in the other strand, and guanines are always paired with cytosines, the two strands are said to be complementary to each other; and the sequence of a strand can be inferred from the sequence of its complementary strand. Accordingly, "mismatch" means that in a double-stranded nucleic acid, the bases at the respective sites (positions) are not presented as complementary pairs.

[48] In the context of the present invention, unless otherwise indicated, “predominantly reverse complementary” means that no more than 3 mismatches are present between two nucleotide sequences. "Essentially reverse complementary" means that no more than 1 mismatch is present between two nucleotide sequences. "Completely complementary" means that there are no mismatched bases between two nucleotide sequences.

[49] In the context of the present invention, if a nucleotide sequence has a "nucleotide difference" from another nucleotide sequence, the bases of the nucleotides at the same position between them are changed. For example, if the nucleotide base in the second sequence is A and the nucleotide base at the same position in the first sequence is U, C, G, or T, the two nucleotide sequences are considered to have a nucleotide difference at that position. According to some embodiments of the present invention, if a nucleotide at a position is replaced by a nucleotide lacking a nitrogenous base or a nucleotide analog, the nucleotide difference is also considered to exist at that position.

[50] With reference to the present invention, in particular, in the description of the method for producing a conjugating molecule or siRNA conjugate according to the present invention, unless otherwise indicated, the term "nucleoside monomer" refers, according to the type and sequence of nucleotides in the siRNA or siRNA conjugate, which must be prepared, to "unmodified or modified RNA phosphoamidites used in solid phase phosphoamidite synthesis" (RNA phosphoamidites also referred to as nucleoside phosphoamidites elsewhere). Solid phase phosphoamidite synthesis is an RNA synthesis method well known to those skilled in the art. The nucleoside monomers used in the present invention may be commercially available.

[51] In the context of the present invention, unless otherwise indicated, "conjugation" refers to two or more chemical groups, each of which has a specific function, connected to each other by a covalent bond. Accordingly, "conjugate" refers to a compound formed by covalent bonding of separate chemical groups. In addition, "miRNA conjugate" is a compound formed by covalent attachment of siRNA and one or more chemical groups, each of which has specific functions. In this case, the siRNA conjugate disclosed herein is sometimes abbreviated as "conjugate". An siRNA conjugate is to be understood in accordance with the context as a generic term for siRNA conjugates, first siRNA conjugate, or second siRNA conjugate. In the context of the present invention, the term "conjugating molecule" should be understood as a specific compound that can be conjugated to an siRNA through reactions to ultimately produce an siRNA conjugate according to the present invention.

[52] herein, a dash ("-") that is not located between two letters or symbols is used to indicate the attachment position of a substituent. For example, C ₁ -C ₁₀ alkyl-NH ₂ is attached at the expense of C ₁ -C ₁₀ alkyl.

[53] As used herein, the term "optional" or "optional" means that the subsequently described event or condition may or may not occur, and that the description includes instances where the event or condition may or may not occur. For example, "optionally substituted alkyl" includes both "alkyl" and "substituted alkyl" as defined below. Those skilled in the art will appreciate, with respect to any group containing one or more substituents, that such groups are not intended to introduce any substitution or substitution profiles that are sterically impractical, synthetically impracticable, and/or unstable in nature.

[54] As used herein, the term "alkyl" refers to a straight chain and a branched chain containing the specified number of carbon atoms, typically 1 to 20 carbon atoms, such as 1 to 10 carbon atoms, such as 1 to 8 or 1 up to 6 carbon atoms. For example, C ₁ -C ₆ alkyl includes both linear and branched alkyl containing from 1 to 6 carbon atoms. The designation of an alkyl moiety containing a certain number of carbon atoms is intended to include all branched and straight chain forms containing that number of carbon atoms; thus, for example, "butyl" means n-butyl, sec-butyl, isobutyl and tert-butyl; "propyl" includes n-propyl and isopropyl. Alkylene is a subgroup of alkyl referring to the same residues as alkyl, but having two attachment positions.

[55] as used herein, the term "alkenyl" refers to an unsaturated branched or linear alkyl group having at least one carbon-carbon double bond, which is obtained by appropriate removal of one hydrogen molecule from two adjacent carbon atoms of the parent alkyl. The group may be in the cis or trans double bond configuration. Exemplary alkenyl groups include, but are not limited to, ethenyl; propenyls such as prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl (allyl), prop-2-en-2-yl; butenyls such as but-1-en-1-yl, but-1-en-2-yl, 2-methylprop-1-en-1-yl, but-2-en-1-yl, but-2- en-2-yl, buta-1,3-dien-1-yl, buta-1,3-dien-2-yl; etc. In certain embodiments of the present invention, the alkenyl group contains 2 to 20 carbon atoms, and in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkenylene is a subgroup of alkenyl having the same residues as alkenyl, but having two attachment positions.

[56] as used herein, the term "alkynyl" refers to an unsaturated branched or linear alkyl group having at least one carbon-carbon triple bond, which is obtained by appropriate removal of two hydrogen molecules from two adjacent carbon atoms of the parent alkyl. Exemplary alkynyl groups include, but are not limited to, ethynyl; propynyls such as prop-1-yn-1-yl, prop-2-yn-1-yl; butynyls such as but-1-yn-1-yl, but-1-yn-3-yl, but-3-yn-1-yl; etc. In certain embodiments of the present invention, the alkynyl group contains 2 to 20 carbon atoms, and in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkynylene is a subgroup of alkynyl, referring to the same residues as alkynyl, but having two attachment positions.

[57] As used herein, the term "alkoxy" refers to an alkyl group with the indicated number of carbon atoms attached via an oxygen bridge, such as, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy , pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, 3-methylpentyloxy and the like. Alkoxy groups typically contain 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms attached via an oxygen bridge.

[58] as used herein, the term "aryl" refers to a radical derived from an aromatic monocyclic or polycyclic hydrocarbon ring system by removal of a hydrogen atom from a ring carbon atom. An aromatic monocyclic or polycyclic hydrocarbon ring system contains only hydrogen and carbon, including six to eighteen carbon atoms, with at least one ring in the ring system being completely unsaturated, i.e. it contains a cyclic delocalized (4n+2) π-electron system in accordance with Hückel's theory. Aryl groups include, but are not limited to, phenyl, fluorenyl, naphthyl, and the like. Arylene is a subgroup of aryl, referring to the same residues as aryl, but having two attachment positions.

[59] in this document, the term "cycloalkyl" refers to a non-aromatic carbon ring, usually containing from 3 to 7 ring carbon atoms. The ring may be saturated or may contain one or more carbon-carbon double bonds. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl and cyclohexenyl, as well as bridging and backbone ring groups such as norbornane.

[60] in this document, the term "halo substituent" or "halogen" refers to fluoro, chloro, bromo and iodo, and the term "halogen" includes fluorine, chlorine, bromine and iodine.

[61] As used herein, the term "haloalkyl" refers to an alkyl as defined above with the indicated number of carbon atoms, substituted with one or more halogen atoms, up to the maximum allowable number of halogen atoms. Examples of haloalkyl include, but are not limited to, trifluoromethyl, difluoromethyl, 2-fluoroethyl, and pentafluoroethyl.

[62] "Heterocyclyl" refers to a stable 3-18 membered non-aromatic ring radical that contains two to twelve carbon atoms and one to six heteroatoms selected from nitrogen, oxygen and sulfur. Unless otherwise indicated in the description, heterocyclyl is a monocyclic, bicyclic, tricyclic or tetracyclic ring system, which may contain fused or bridged ring systems. The heteroatoms in the heterocyclyl radical may optionally be oxidized. One or more nitrogen atoms, if present, are optionally quaternized. The heterocyclyl is partially or fully saturated. The heterocyclyl may be attached to the rest of the molecule at any ring atom. Examples of such heterocyclyl include, but are not limited to, dioxanyl, thienyl[1,3]disulfonyl, decahydroisoquinolyl, imidazolinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxapiperazinyl, 2-oxapiperidinyl, 2-oxapyrimidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, trisulfonyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxathiomorpholinyl and 1,1-dioxathiomorpholinyl.

[63] "Heteroaryl" refers to a radical derived from a 3-18 membered aromatic ring radical that contains two to seventeen carbon atoms and one to six heteroatoms selected from nitrogen, oxygen and sulfur, herein heteroaryl may represent is a monocyclic, bicyclic, tricyclic or tetracyclic ring system, wherein at least one ring in the ring system is completely unsaturated, i.e. contains a cyclic delocalized (4n+2) π-electron system in accordance with Hückel's theory. Heteroaryl includes fused or bridged ring systems. The heteroatom in the heteroaryl radical is optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. Heteroaryl is connected to the rest of the molecule through any ring atom. Examples of such heteroaryls include, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzdolyl, 1,3-benzodioxazolyl, benzofuranyl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxazolyl, benzo[b ][1,4]oxazolyl, 1,4-benzodioxazolyl, benzonaphthofuranyl, benzodiazolyl, benzodioxaphenyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl, benzothieno[3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[ 1,2-a] pyridinyl, carbazolyl, cinnolinyl, cyclopenta[d]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]-thieno[2,3-d]-pyrimidinyl, 5,6-dihydrobenzo[ h]quinazolinyl, 5,6-dihydrobenzo[h]cinnolinyl, 6,7-dihydro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofuranyl, dibenzothienyl, furanyl, furanonyl, furo[3, 2-c]pyridinyl, 5,6,7,8,9,10-hexahydrocyclohepta[d]pyrimidinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridazinyl, 5,6,7,8, 9,10-hexahydrocycloocta[d]pyridinyl, isothiazolyl, indazolyl, imidazolyl, indolyl, isoindolyl, indolinyl, isoindoles nil, isoquinolyl, indolizinyl, isoxazolyl, 5,8-methano-5,6,7,8-tetrahydroquinazolinyl, naphthyridinonyl, 1,6-naphthyridinonyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxalyl, 5,6,6a,7, 8,9,10,10a-octahydrobenzo[h]quinazolinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridinyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quinazolinyl, quinoxalinyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, 5,6,7,8-tetrahydroquinazolinyl, 5, 6,7,8-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6,7,8,9-tetrahydro-5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7,8-tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno[3,2-d]pyrimidinyl, thieno[ 2,3-c]pridinyl and thienyl.

[64] Various hydroxyl protecting groups can be used in the present invention. In general, protecting groups render chemical functional groups inert to particular reaction conditions and can be attached to and removed from such functional groups in a molecule without significant damage to the rest of the molecule. Exemplary hydroxyl protecting groups are disclosed in Beaucage, et al., Tetrahedron 1992, 48, 2223-2311, and also in Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2nd ed., John Wiley & Sons, New York, 1991 , each of which is hereby incorporated by reference in its entirety. In some embodiments of the present invention, the protecting group is stable under basic conditions but can be removed under acidic conditions. According to some embodiments of the present invention, non-exclusive examples of hydroxyl protecting groups used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthen-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthen-9-yl (Mox ). According to some embodiments of the present invention, non-exclusive examples of hydroxyl protecting groups used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), and TMTr (4,4',4'' -trimethoxytrityl).

[65] As used herein, the term "subject" refers to any animal, such as a mammal or marsupial. A subject of the present invention includes, but is not limited to, human, non-human primate (e.g., rhesus monkey or other macaque species), mouse, pig, horse, donkey, cow, sheep, rat, and any kind of poultry.

[66] as used herein, "treat" or "treat" or "reduce" or "improve" are used interchangeably herein. These terms refer to the manner in which a preferred or intended result is obtained, including, but not limited to, therapeutic benefit. "Therapeutic benefit" means the elimination or improvement of the potential disorder being treated. Also, therapeutic benefit is achieved by eliminating or reducing one or more of the physiological symptoms associated with the potential disorder, such that the patient is improved despite the fact that the patient may still be affected by the potential disorder.

[67] In this application, "prevention" and "prevent" are used interchangeably. These terms refer to the manner in which a preferred or intended result is obtained, including but not limited to prophylactic benefit. To obtain a "prophylactic benefit", the conjugate or composition may be administered to a patient at risk for developing a particular disease, or to a patient reporting one or more physiological symptoms of a disease, even if the disease has not been diagnosed.

Modified siRNA

[68] MiRNA according to the present invention contains nucleotides as the main building blocks. It is well known to those skilled in the art that a nucleotide contains a phosphate group, a ribose group, and a base. Detailed illustrations relating to such groups are not presented in this document.

[69] CN 102140458 B discloses an siRNA that specifically inhibits the HBV gene and explores various strategies for chemically modifying the siRNA. This study found that different modification strategies have very different effects on miRNA parameters such as stability, biological activity, and cytotoxicity. In this study, seven effective modification methods were proven. Compared to unmodified siRNA, siRNA produced by one of the seven modification methods showed increased blood stability while maintaining essentially the same inhibitory activity as unmodified siRNA.

[70] According to the present invention, a modified siRNA capable of inhibiting HBV gene expression is provided, which contains a sense strand and an antisense strand, wherein each nucleotide in the siRNA is a modified nucleotide, while the sense strand and the antisense strand both contain fluorine-modified nucleotides and nucleotides with non-fluorine modification; the sense strand contains the nucleotide sequence I; the antisense strand contains the nucleotide sequence II; the nucleotide sequence of I and the nucleotide sequence of II are at least partially reversely complementary, which allows the formation of a double-stranded region; moreover, the nucleotide sequence I contains the nucleotide sequence A, which has the same length as the nucleotide sequence shown in SEQ ID NO: 155, and differs from it by no more than 3 nucleotides; and nucleotide sequence II contains nucleotide sequence B, which has the same length as the nucleotide sequence shown in SEQ ID NO: 156 and differs from it by no more than 3 nucleotides:

5'-CCUUGAGGCAUACUUCAAZ-3' (SEQ ID NO: 155);

5'-Z'UUUGAAGUAUGCCUCAAGG-3' (SEQ ID NO: 156);

in which

Z is A; Z' is U;

the nucleotide sequence A contains the nucleotide Z _A at the position corresponding to Z;

nucleotide sequence _B contains the nucleotide Z'B at the position corresponding to Z'; nucleotide Z' _B is the first nucleotide from the 5' end of the antisense strand;

fluorine-modified nucleotides are located within the nucleotide sequences A and B;

in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 of the nucleotide sequence A are fluorine-modified nucleotides; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence B are fluorine-modified nucleotides. In some embodiments of the present invention, no more than 5 fluorine-modified nucleotides are present in nucleotide sequence A; and no more than 7 fluorine-modified nucleotides are present in nucleotide sequence B.

[71] In this case, the term "corresponding site" (corresponding position) means being in the same position in the nucleotide sequence when counting from the same end of the nucleotide sequence. For example, the first nucleotide at the 3' end of nucleotide sequence A is the nucleotide at the position corresponding to the first nucleotide at the 3' end of SEQ ID NO: 155.

[72] According to some embodiments of the present invention, the sense strand consists solely of the nucleotide sequence I, and the antisense strand consists solely of the nucleotide sequence II.

[73] According to some embodiments of the present invention, the nucleotide sequence A contains no more than 1 nucleotide different from the nucleotide sequence shown in SEQ ID NO: 155; and/or nucleotide sequence B contains no more than 1 nucleotide different from the nucleotide sequence shown in SEQ ID NO: 156.

[74] According to some embodiments of the present invention, the nucleotide difference between the nucleotide sequence B and the nucleotide sequence shown in SEQ ID NO: 156 includes a difference in position Z' _B , and Z' _B is selected from A, C or G. According to some embodiments of the present invention, the nucleotide difference is a difference in the position of Z' _B , and Z' _B is selected from A, C or G. In some embodiments of the present invention, Z _A is a nucleotide complementary to Z' _B . These nucleotide differences will not significantly reduce the ability of the siRNA to inhibit the target gene, and such siRNAs containing nucleotide differences are also included within the scope of the present invention.

[75] According to some embodiments of the present invention, nucleotide sequence A is predominantly reverse complementary, substantially reverse complementary, or fully reverse complementary to nucleotide sequence B. "Predominantly reverse complementary" refers to no more than 3 mismatches in two nucleotide sequences. "Substantially reverse complementary" refers to no more than 1 mismatch in two nucleotide sequences. "Completely reverse complementary" refers to the absence of mismatched bases in two nucleotide sequences.

[76] According to some embodiments of the present invention, the nucleotide sequence A is the nucleotide sequence shown in SEQ ID NO: 1; and nucleotide sequence B is the nucleotide sequence shown in SEQ ID NO: 2:

5'-CCUUGAGGCAUACUUCAAZ _A -3' (SEQ ID NO: 1);

5'-Z' _B UUGAAGUAUGCCUCAAGG-3' (SEQ ID NO: 2);

in which Z' _B represents the first nucleotide from the 5' end of the antisense strand; Z _A is selected from A, U, G or C; and Z' _B is a nucleotide complementary to Z _A ; and, in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 of the nucleotide sequence A are fluorine-modified nucleotides; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence B are fluorine-modified nucleotides.

[77] According to some embodiments of the present invention, the siRNA contains a sense strand and an antisense strand; moreover, the sense strand contains a segment of the nucleotide sequence I, and the antisense strand contains a segment of the nucleotide sequence II; the nucleotide sequence I and the nucleotide sequence II are reverse complementary, which allows the formation of a double-stranded region;; the nucleotide sequence of I contains the nucleotide sequence shown in SEQ ID NO: 1; and the nucleotide sequence II contains the nucleotide sequence shown in SEQ ID NO: 2:

5'-CCUUGAGGCAUACUUCAAZ _A -3' (SEQ ID NO: 1);

5'-Z' _B UUGAAGUAUGCCUCAAGG-3' (SEQ ID NO: 2);

in which Z' _B represents the first nucleotide from the 5' end of the antisense strand; Z _A is selected from A, U, G or C; and Z' _B is a nucleotide complementary to Z _A ; in some embodiments, Z _A is A; and _Z'B is U; and in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 of SEQ ID NO: 1 in the siRNA sense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the siRNA sense strand are nucleotides with non-fluorine modification; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of SEQ ID NO: 2 in the antisense strand of the siRNA are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand of the siRNA are are nucleotides with non-fluorine modification.

[78] The sense strand and the antisense strand are the same or different lengths. The sense strand is 19-23 nucleotides long and the antisense strand is 20-26 nucleotides long. Thus, the ratio of the length of the sense strand to the length of the antisense strand in miRNA according to the present invention can be 19/20, 19/21, 19/22, 19/23, 19/24, 19/25, 19/26, 20/20, 20/21, 20/22, 20/23, 20/24, 20/25, 20/26, 21/20, 21/21, 21/22, 21/23, 21/24, 21/25, 21/ 26, 22/20, 22/21, 22/22, 22/23, 22/24, 22/25, 22/26, 23/20, 23/21, 23/22, 23/23, 23/24, 23/25 or 23/26. In some embodiments of the present invention, the ratio of sense strand length to antisense strand length in the siRNA of the present invention is 19/21, 21/23, or 23/25.

[79] According to one embodiment of the present invention, the sense strand and the antisense strand are the same length. The nucleotide sequence I further comprises the nucleotide sequence III; and the nucleotide sequence II further comprises the nucleotide sequence IV. Each of nucleotide sequence III and nucleotide sequence IV is independently 1-4 nucleotides in length; the nucleotide sequence III is connected to the 5' end of the nucleotide sequence A; the nucleotide sequence IV is connected to the 3' end of the nucleotide sequence B; and the nucleotide sequence III and the nucleotide sequence IV are the same length.

[80] The nucleotide sequence III may or may not be complementary to the nucleotide sequence IV. To increase the stability of the siRNA, according to some embodiments of the present invention, the nucleotide sequence III is at least partially complementary to the nucleotide sequence IV; in some embodiments of the present invention, the nucleotide sequence III is more than 80% or 90% complementary to the bases in the nucleotide sequence IV; in some embodiments of the present invention, the nucleotide sequence III is substantially reverse complementary or fully reverse complementary to the nucleotide sequence IV; "substantially reverse complementary" refers to no more than 1 mismatch in two nucleotide sequences; "completely reverse complementary" refers to the absence of mismatched bases in two nucleotide sequences; and according to some embodiments of the present invention, the nucleotide sequence III is fully inversely complementary to the nucleotide sequence IV. As such, the sense strand and antisense siRNA strand are the same length, and their length ratio is 20/20, 21/21, 22/22, or 23/23. In some embodiments of the present invention, the ratio of sense strand length to antisense strand length in siRNA is 21/21 or 23/23.

[81] According to some embodiments of the present invention, the nucleotide sequence III and the nucleotide sequence IV are both 1 nucleotide in length. The base of nucleotide sequence III is A and the base of nucleotide sequence IV is U; in this case, the ratio of sense strand length to antisense strand length is 20/20; in another embodiment, the nucleotide sequence III and the nucleotide sequence IV are both 2 nucleotides long; in the 5' to 3' direction, the base composition of nucleotide sequence III is GA and the base composition of nucleotide sequence IV is UC; in this case, the ratio of the length of the sense strand to the length of the antisense strand is 21/21; in another embodiment, nucleotide sequence III and nucleotide sequence IV are both 3 nucleotides long; in the 5' to 3' direction, the base composition of nucleotide sequence III is CGA and the base composition of nucleotide sequence IV is UCG; in this case, the ratio of sense strand length to antisense strand length is 22/22; in another embodiment, nucleotide sequence III and nucleotide sequence IV are both 4 nucleotides in length; in the 5' to 3' direction, the base composition of nucleotide sequence III is CCGA and the base composition of nucleotide sequence IV is UCGG; in this case, the ratio of sense strand length to antisense strand length is 23/23. In some embodiments of the present invention, nucleotide sequence III and nucleotide sequence IV are both 2 nucleotides in length; in the 5' to 3' direction, the base composition of nucleotide sequence III is GA and the base composition of nucleotide sequence IV is UC; in this case, the ratio of sense strand length to antisense strand length is 21/21.

[82] According to some embodiments of the present invention, the nucleotide sequence III is the same length as the nucleotide sequence IV and is fully inversely complementary to it. Thus, if a nucleotide sequence base III is proposed, a nucleotide sequence base IV is also specified.

[83] According to some embodiments of the present invention, the sense strand and the antisense strand are of different lengths. The nucleotide sequence II further comprises the nucleotide sequence V, which is 1-3 nucleotides in length and is fused to the 3' end of the antisense strand to form the 3' overhang of the antisense strand. Thus, the ratio of the length of the sense strand to the length of the antisense strand in miRNA according to the present invention can be 19/20, 19/21, 19/22, 20/21, 20/22, 20/23, 21/22, 21/23, 21/24, 22/23, 22/24, 22/25, 23/24, 23/25 or 23/26. In some embodiments of the present invention, the V nucleotide sequence is 2 nucleotides in length. Thus, the ratio of sense strand length to antisense strand length in an siRNA according to the present invention may be 19/21, 21/23, or 23/25.

[84] Each nucleotide in the V nucleotide sequence can be any nucleotide. According to some variants of implementation of the present invention, the nucleotide sequence of V is 2 continuous thymidine deoxyribonucleotide (TT) or 2 continuous uridine ribonucleotide (UU); in some embodiments of the present invention, the V nucleotide sequence is complementary to the nucleotides at the corresponding positions in the target mRNA.

[85] According to some embodiments of the present invention, the siRNA sense strand contains the nucleotide sequence shown in SEQ ID NO: 1, and the antisense siRNA strand contains the nucleotide sequence shown in SEQ ID NO: 3:

5'-CCUUGAGGCAUACUUCAAZ _A -3' (SEQ ID NO: 1);

5'-Z' _B UUGAAGUAUGCCUCAAGGUU-3' (SEQ ID NO: 3);

according to another variant, the siRNA sense strand contains the nucleotide sequence shown in SEQ ID NO: 1, and the antisense siRNA strand contains the nucleotide sequence shown in SEQ ID NO: 4:

5'-CCUUGAGGCAUACUUCAAZ _A -3' (SEQ ID NO: 1);

5'-Z' _B UUGAAGUAUGCCUCAAGGUC-3' (SEQ ID NO: 4);

in which the nucleotide Z' _B is the first nucleotide from the 5' end of the antisense strand; Z _A is selected from A, U, G or C; and Z' _B is a nucleotide complementary to Z _A .

[86] According to some embodiments of the present invention, the siRNA of the present invention is siHBa1 or siHBa2:

siHBa1

Sense strand: 5'-CCUUGAGGCAUACUUCAAA-3' (SEQ ID NO: 5),

Antisense strand: 5'-UUUGAAGUAUGCCUCAAGGUU-3' (SEQ ID NO: 6)

siHBa2

Sense strand: 5'-GACCUUGAGGCAUACUUCAAA-3' (SEQ ID NO: 7),

Antisense strand: 5'-UUUGAAGUAUGCCUCAAGGUCGG-3' (SEQ ID NO: 8).

[87] As described above, all nucleotides in the siRNA according to the present invention are modified nucleotides. Such modifications on the nucleotides will not cause a significant reduction or loss of function of the siRNA conjugate of the present invention to inhibit HBV gene expression. For example, the modified nucleotides disclosed by J.K. Watts, G.F. Delavey and M.J. Damha, Chemically Modified siRNA: tools and applications. Drug Discov Today, 2008. 13(19-20): p. 842-55.

[88] According to some embodiments of the present invention, in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 or 5, 7, 8, and 9 of the A nucleotide sequence in the sense strand are fluorine-modified nucleotides , and the nucleotides in the remaining positions in the sense chain are nucleotides with non-fluorine modification; and nucleotides at positions 2, 6, 14 and 16 or 2, 6, 8, 9, 14 and 16 of nucleotide sequence B in the antisense strand are fluorine-modified nucleotides, and nucleotides at other positions in the antisense strand are non-fluorine modified nucleotides.

[89] As used in the present invention, a fluorine-modified nucleotide refers to a nucleotide formed by replacing the 2'-hydroxyl of its ribose group with a fluoro group, which has the structure represented by Formula (107). A nucleotide with a non-fluorine modification refers to a nucleotide formed by replacing the 2'-hydroxyl of a ribose group with a group other than fluorine, or a nucleotide analog. In some embodiments of the present invention, each non-fluorine modified nucleotide is independently selected from the group consisting of a nucleotide formed by replacing the 2'-hydroxyl of its ribose group with a group other than fluorine and a nucleotide analog.

[90] A nucleotide formed by replacing the 2'-hydroxyl of a ribose group with a group other than fluorine is well known to those skilled in the art and can be selected from one of 2'-alkoxy-modified nucleotide, 2'-substituted alkoxy-modified nucleotide , 2'-alkyl-modified nucleotide, 2'-substituted alkyl-modified nucleotide, 2'-amino-modified nucleotide, 2'-substituted amino-modified nucleotide and 2'-deoxynucleotide.

[91] According to some embodiments of the present invention, the 2'-alkoxy-modified nucleotide is a methoxy-modified nucleotide (2'-OMe) represented by Formula (108). According to some embodiments of the present invention, the 2'-substituted alkoxy-modified nucleotide is, for example, a 2'-O-methoxyethoxy-modified nucleotide (2'-MOE) represented by Formula (109). In some embodiments of the present invention, the 2'-amino modified nucleotide (2'-NH ₂ ) is that represented by Formula (110). According to some embodiments of the present invention, the 2'-deoxynucleotide (DNA) is that represented by Formula (111).

[92] A "nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid that is structurally different from an adenine ribonucleotide, a guanine ribonucleotide, a cytosine ribonucleotide, a uracil ribonucleotide, or a thymine deoxyribonucleotide. In some embodiments, the nucleotide analog may be an isonucleotide, a bridged nucleic acid (BNA) nucleotide, or an acyclic nucleotide.

[93] BNA is a nucleotide that is limited or unavailable. The BNA may contain a 5-, 6-, or even 7-membered ring bridging structure with a "fixed" C3'-endo sugar wrinkling. The bridge is typically inserted at the 2' and 4' position of the ribose to give a 2',4'-BNA nucleotide. According to some embodiments of the present invention, the BNA may be LNA, ENA and cET BNA, which are represented by Formulas (112), (113) and (114), respectively.

[94] An acyclic nucleotide is a nucleotide in which the ribose ring is open. According to some embodiments of the present invention, the acyclic nucleotide may be an unlocked nucleic acid (UNA) nucleotide and a glycerol-based nucleic acid (GNA) nucleotide, which are represented by Formulas (115) and (116), respectively.

in which R represents H, OH or alkoxy (O-alkyl).

[95] An isonucleotide is a nucleotide in which the position of the base on the ribose ring changes. According to some embodiments of the present invention, the isonucleotide may be a compound in which the base has been moved from position -1' to position -2' or -3' on the ribose ring represented by Formulas (117) or (118), respectively.

where "base" is a base such as A, U, G, C or T; R is H, OH, F, or a group other than fluoro as described above.

[96] According to some embodiments of the present invention, the nucleotide analog is selected from the group consisting of isonucleotide, LNA, ENA, cET, UNA, and GNA. In some embodiments of the present invention, each non-fluorine-modified nucleotide is a methoxy-modified nucleotide. As used herein, a methoxy-modified nucleotide refers to a nucleotide formed by replacing the 2'-hydroxyl of a ribose group with a methoxy group.

[97] In the present invention, the terms "fluorine-modified nucleotide", "2'-fluoro-modified nucleotide", "nucleotide in which the 2'-hydroxyl of the ribose group is replaced by fluorine", and "2'-fluororibosyl" have the same meaning, referring to a nucleotide formed by replacing the 2'-hydroxyl of a ribose group with fluorine, having the structure represented by Formula (107). "Methoxy-modified nucleotide", "2'-methoxy-modified nucleotide", "nucleotide in which the 2'-hydroxyl of the ribose group is substituted with methoxy", and "2'-methoxyribosyl" have the same meaning, referring to a nucleotide in which the 2' -hydroxyl of the ribose group in the nucleotide is substituted with methoxy having the structure represented by Formula (108).

[98] According to some embodiments of the present invention, the fluorine-modified nucleotides are located within the nucleotide sequences A and B; no more than 5 fluorine-modified nucleotides are present in nucleotide sequence A, and, in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 in nucleotide sequence A are fluorine-modified nucleotides; no more than 7 fluorine-modified nucleotides are present in nucleotide sequence B, and the nucleotides at positions 2, 6, 14, and 16 in nucleotide sequence B are fluorine-modified nucleotides.

[99] According to some embodiments of the present invention, in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 or 5, 7, 8, and 9 of the nucleotide sequence A in the sense strand are fluorine-modified nucleotides , and the nucleotides in the remaining positions in the sense chain are nucleotides with non-fluorine modification; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 or 2, 6, 8, 9, 14, and 16 of nucleotide sequence B in the antisense strand are fluorine-modified nucleotides, and nucleotides at other positions in the antisense strand are non-fluorine modified nucleotides.

[100] According to some embodiments of the present invention, the siRNA of the present invention is an siRNA with the following modifications: in the direction from the 5'end to the 3'end, nucleotides at positions 7, 8 and 9 or 5, 7, 8 and 9 of the nucleotide the A sequences in the siRNA sense strand are fluorine-modified nucleotides, and the nucleotides at other positions in the siRNA sense strand are methoxy-modified nucleotides; and nucleotides at positions 2, 6, 14, and 16 or 2, 6, 8, 9, 14, and 16 of nucleotide sequence B in the antisense strand are fluorine-modified nucleotides, and nucleotides at other positions in the antisense siRNA strand are methoxy-modified nucleotides . [101] According to some embodiments of the present invention, the siRNA of the present invention is an siRNA with the following modifications: 5' to 3' direction, nucleotides at positions 5, 7, 8, and 9 of the A nucleotide sequence in the siRNA sense strand are fluorine-modified nucleotides, and nucleotides at other positions in the siRNA sense strand are methoxy-modified nucleotides; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 8, 9, 14, and 16 of nucleotide sequence B in the antisense miRNA strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand miRNAs are methoxy-modified nucleotides;

according to another variant, in the direction from the 5'-end to the 3'-end, the nucleotides at positions 5, 7, 8 and 9 of the nucleotide sequence A in the sense strand of miRNA are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the sense strand of miRNA are are methoxy-modified nucleotides; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence B in the antisense strand of the siRNA are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand of the siRNA are methoxy -modified nucleotides;

according to another variant, in the direction from the 5'-end to the 3'-end, the nucleotides at positions 7, 8 and 9 of the nucleotide sequence A in the sense strand of miRNA are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the sense strand of miRNA are methoxy -modified nucleotides; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence B in the antisense strand of the siRNA are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand of the siRNA are methoxy -modified nucleotides.

[102] In other words, the ribose groups in the phosphate-ribose backbone of miRNA, respectively, have the following modifying groups: in the direction from the 5'-end to the 3'-end, the ribose groups of the nucleotides at positions 5, 7, 8 and 9 of the nucleotide sequence A in the sense strand of miRNAs are 2'-fluororibosyl, and the ribose groups of nucleotides in the remaining positions in the sense strand of miRNAs are 2'-methoxyribosyl; and, in the 5' to 3' direction, the ribose groups of the nucleotides at positions 2, 6, 8, 9, 14, and 16 of the B nucleotide sequence in the miRNA antisense strand are 2'-fluororibosyl, and the ribose groups of the nucleotides at the remaining positions in the antisense strand of siRNA are 2'-methoxyribosyl;

according to another variant, in the direction from the 5'-end to the 3'-end, the ribose groups of nucleotides in positions 5, 7, 8 and 9 of the nucleotide sequence A in the sense strand of miRNA are 2'-fluororibosyl, and the ribose groups of nucleotides in the remaining positions in the sense strand, miRNAs are 2'-methoxyribosyl; and, in the direction from the 5' end to the 3' end, the ribose groups of the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence B in the antisense miRNA strand are 2'-fluororibosyl, and the ribose groups of the nucleotides at the remaining positions in the antisense miRNA chains are 2'-methoxyribosyl;

according to another variant, in the direction from the 5'-end to the 3'-end, the ribose groups of nucleotides in positions 7, 8 and 9 of the nucleotide sequence A in the sense strand of miRNA are 2'-fluororibosyl, and the ribose groups of nucleotides in the remaining positions in the sense miRNA chains are 2'-methoxyribosyl; and, in the direction from the 5' end to the 3' end, the ribose groups of the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence B in the antisense miRNA strand are 2'-fluororibosyl, and the ribose groups of the nucleotides at the remaining positions in the antisense miRNA chains are 2'-methoxyribosyl.

[103] According to some embodiments of the present invention, the siRNA of the present invention is siHBa1M1, siHBa1M2, siHBa2M1, or siHBa2M2:

siHBa1M1

Sense strand: 5'-CmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 9),

Antisense strand: 5'-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmUm-3' (SEQ ID NO: 10)

siHBa1M2

Sense strand: 5'-CmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 11),

Antisense strand: 5'-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmUm-3' (SEQ ID NO: 12)

siHBa2M1

Sense strand: 5'-GmAmCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 13),

Antisense strand: 5'-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmGmGm-3' (SEQ ID NO: 14)

siHBa2M2

Sense strand: 5'-GmAmCmCmUmUmGfAmGfGfCfAmUmCmUmUmCmAmAmAm-3' (SEQ ID NO: 15),

Antisense strand: 5'-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmGmGm-3' (SEQ ID NO: 16)

in which C, G, U and A denote the composition of the bases of nucleotides; m means that the nucleotide to the left of the letter m is a 2'-methoxy-modified nucleotide; f denotes that the nucleotide adjacent to the left side of the letter f is a 2'-fluoro-modified nucleotide. MiRNAs with these modifications can not only be provided at a lower cost, but also reduce the propensity of ribonucleases to cleave the nucleic acid in the blood so as to increase the stability of the nucleic acid and make the nucleic acid more resistant to hydrolysis by nucleases.

[104] According to some embodiments of the present invention, at least a portion of the phosphate groups in the phosphate-ribose backbone of at least one single strand in the sense strand and antisense strand of the siRNA of the present invention are phosphate groups with modified groups. In some embodiments of the present invention, the group-modified phosphate groups are phosphothioate groups formed by replacing at least one oxygen atom in a phosphodiester bond in the phosphate groups with a sulfur atom; and according to some embodiments of the present invention, the group-modified phosphate groups are phosphothioate groups having the structure represented by Formula (101):

[105] This modification stabilizes the double-stranded siRNA structure, which maintains high specificity and high affinity of base pairing.

[106] According to some embodiments of the present invention, in the siRNA of the present invention, the phosphothioate bond is present at at least one of the following positions: a position between the first and second nucleotides at either end of the sense or antisense strand, a position between the second and third nucleotides at either end of the sense or antisense strand, or any combination thereof. In some embodiments of the present invention, the phosphothioate bond is present at all of the above positions except for the 5' end of the sense strand. In some embodiments of the present invention, the phosphothioate bond is present at all of the above positions except for the 3' end of the sense strand. According to some embodiments of the present invention, the phosphothioate bond is present in at least one of the following positions:

the position between the first and second nucleotides at the 5' end of the sense strand;

the position between the second and third nucleotides at the 5' end of the sense strand;

the position between the first and second nucleotides at the 3' end of the sense strand;

the position between the second and third nucleotides at the 3' end of the sense strand;

the position between the first and second nucleotides at the 5' end of the antisense strand;

the position between the second and third nucleotides at the 5' end of the antisense strand;

the position between the first and second nucleotides at the 3' end of the antisense strand; and

position between the second and third nucleotides at the 3' end of the antisense strand.

[107] According to some embodiments of the present invention, the siRNA of the present invention is siHBa1M1S, siHBa1M2S, siHBa2M1S, or siHBa2M2S:

siHBa1M1S

Sense strand: 5'-CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-(SEQ ID NO: 17),

Antisense strand: 5'-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmsGmsUmsUm-3' (SEQ ID NO: 18)

siHBa1M2S

Sense strand: 5'-CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 19),

Antisense strand: 5'-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm-3' (SEQ ID NO: 20)

siHBa2M1S Sense strand: 5'-GmsAmsCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 21),

Antisense strand: 5'-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm-3' (SEQ ID NO: 22)

siHBa2M2S

Sense strand: 5'-GmsAmsCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 23),

Antisense strand: 5'-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm-3' (SEQ ID NO: 24)

in which C, G, U and A denote the composition of the bases of nucleotides; m means that the nucleotide to the left of the letter m is a methoxy-modified nucleotide; f denotes that the nucleotide to the left of the letter f is a fluorine-modified nucleotide; s denotes a phosphothioate bond between two nucleotides on either side of the letter.

[108] According to some embodiments of the present invention, the 5'-terminal nucleotide in the antisense siRNA strand is a 5'-phosphate nucleotide or a nucleotide modified with a 5'-phosphate analog.

[109] The usual types of 5'-phosphate nucleotides or nucleotides modified with a 5'-phosphate analog are well known to those skilled in the art; for example, 5'-phosphate nucleotides may have the following structure:

as another example, disclosed in Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3): 238-48, the following four nucleotides are given that are modified with a 5'-phosphate analog:

where

R is a group selected from the group consisting of H, OH, methoxy and F; "Base" is a base selected from A, U, C, G, or T.

[110] According to some embodiments of the present invention, the 5'-phosphate nucleotide is a nucleotide with a 5'-phosphate modification represented by Formula (102); the 5'-phosphate analog modified nucleotide is a 5'-(E)-vinylphosphonate (E-VP) modified nucleotide represented by Formula (103) or a phosphothioate modified nucleotide represented by Formula (105).

[111] According to some embodiments of the present invention, the siRNA of the present invention is any one selected from the group consisting of siHBa1M1P1, siHBa1M2P1, siHBa2M1P1, siHBa2M2P1, siHBa1M1SP1, siHBa1M2SP1, siHBa2M1SP1, and siHBa2M2SP1:

siHBa1M1P1

Sense strand: 5'-CmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 25),

Antisense strand: 5'-P1-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmUm-3' (SEQ ID NO: 26), siHBa1M2P1

Sense strand: 5'-CmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 27),

Antisense strand: 5'-P1-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmUm-3' (SEQ ID NO: 28)

siHBa2M1P1

Sense strand: 5'-GmAmCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAm-3' (SEQ ID NO: 29),

Antisense strand: 5'-P1-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmGmGm-3' (SEQ ID NO: 30)

siHBa2M2P1

Sense strand: 5'-GmAmCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3'(SEQ ID NO: 31),

Antisense strand: 5'-P1-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmGmGm-3' (SEQ ID NO: 32)

siHBa1M1SP1

Sense strand: 5'-CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 33),

Antisense strand: 5'-P1-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm-3' (SEQ ID NO: 34)

siHBa1M2SP1

Sense strand: 5'-CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 35),

Antisense strand: 5'-P1-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm-3' (SEQ ID NO: 36)

siHBa2M1SP1

Sense strand: 5'-GmsAmsCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 37),

Antisense strand: 5'-P1-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm-3' (SEQ ID NO: 38)

siHBa2M2SP1

Sense strand: 5'-GmsAmsCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 39),

Antisense strand: 5'-P1-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm-3' (SEQ ID NO: 40)

in which C, G, U and A denote the composition of the bases of nucleotides; m means that the nucleotide to the left of the letter m is a 2'-methoxy-modified nucleotide; f denotes that the nucleotide to the left of the letter f is a 2'-fluoro-modified nucleotide; s means that the two nucleotides on either side of the letter s are connected by a phosphothioate bond; P1 means that the nucleotide adjacent to the right side of P1 is a 5'-phosphate nucleotide or a nucleotide modified with a 5'-phosphate analog.

[112] The present inventors surprisingly found that the siRNAs of the present invention have significantly improved plasma and lysosome stability, reduced off-target effects, while maintaining higher gene silencing activity.

[113] The siRNAs of the present invention can be prepared using conventional methods for producing siRNAs in the art, for example, using solid phase synthesis and liquid phase synthesis methods. At the same time, commercial services are already available for solid-phase synthesis according to customer requirements. Modified nucleotides can be introduced into siRNAs of the present invention using a nucleotide monomer having an appropriate modification, and methods for producing a nucleotide monomer having an appropriate modification and methods for introducing a modified nucleotide into siRNAs are also well known to those skilled in the art.

pharmaceutical composition

[114] The present invention provides a pharmaceutical composition comprising the siRNA described above as an active ingredient and a pharmaceutically acceptable carrier.

[115] A pharmaceutically acceptable carrier may be a carrier commonly used in the field of administration of siRNA, for example, but not limited to, one or more of magnetic nanoparticles (such as nanoparticles based on Fe ₃ O ₄ and Fe ₂ O ₃ ), carbon nanotubes , mesoporous silicon, calcium phosphate nanoparticles, polyethyleneimine (PEI), polyamidoamine dendrimer (PAMAM), poly-L-lysine (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), D- and L copolymer -lactic acid and glycolic acid (PLGA), poly-2-aminoethylethylene phosphate (PPEA), poly-2-dimethylaminoethyl methacrylate (PDMAEMA) and their derivatives.

[116] According to some implementation options, there are no special requirements for the content of siRNA and a pharmaceutically acceptable carrier in the pharmaceutical composition according to the present invention. In some embodiments of the present invention, the weight ratio of siRNA to pharmaceutically acceptable carrier is 1:(1-500) and in some embodiments of the present invention 1:(1-50).

[117] According to some embodiments of the present invention, the pharmaceutical composition of the present invention may also contain other pharmaceutically acceptable excipients, which may be one or more of various conventional formulations or compounds in the art. For example, these other pharmaceutically acceptable excipients may contain at least one of a pH buffer, a protective agent, and an osmotic pressure regulator.

[118] The pH buffer may be a tris-hydroxymethylaminomethane hydrochloride buffer pH=7.5-8.5 and/or a phosphate buffer pH=5.5-8.5, preferably a phosphate buffer pH=5, 5-8.5.

[119] The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. The content of the protective agent can be from 0.01 wt. % up to 30 wt. % based on the total weight of the pharmaceutical composition.

[120] The osmotic pressure regulator may be sodium chloride and/or potassium chloride. The content of the osmotic pressure regulator provides an osmotic pressure of the pharmaceutical composition of 200-700 milliosmol/kg. Depending on the target osmotic pressure, those skilled in the art can easily determine the content of the osmotic pressure regulator. [121] According to some embodiments of the present invention, the pharmaceutical composition may be a liquid formulation, for example, an injection solution; or a lyophilized powder for injection which is mixed with a liquid excipient to form a liquid formulation upon administration. The liquid formulation may be administered, but not limited to, by subcutaneous, intramuscular, or intravenous injection, and may also be administered, but not limited to, to the lungs by nebulization or other organs (such as the liver) through the lungs by nebulization. According to some embodiments of the present invention, the pharmaceutical composition is administered by intravenous injection.

[122] According to some embodiments of the present invention, the pharmaceutical composition may be in the form of a liposomal formulation. In some embodiments of the present invention, the pharmaceutically acceptable carrier used in the liposomal formulation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), an accessory lipid, and/or a pegylated lipid. Wherein, the organic amine, accessory lipid, and pegylated lipid may be selected, respectively, from one or more of the amine-containing transfection compounds or their pharmaceutically acceptable salts or derivatives, accessory lipids, and pegylated lipids described in CN 103380113 A, which is incorporated herein in its entirety. application by reference.

[123] According to some embodiments of the present invention, the organic amine may be a compound represented by Formula (201) described in CN 103380113 A, or a pharmaceutically acceptable salt thereof:

wherein:

X ₁₀₁ and X ₁₀₂ are independently selected from O, S, NA and C-A, where A is hydrogen or C ₁ -C ₂₀ hydrocarbon chain;

Y and Z are independently selected from C=O, C=S, S=O, CH-OH and SO ₂ ;

R ₁₀₁ , R ₁₀₂ , R ₁₀₃ , R ₁₀₄ , R ₁₀₅ , R ₁₀₆ and R ₁₀₇ are independently selected from hydrogen; a cyclic or acyclic, substituted or unsubstituted, branched or linear aliphatic group; a cyclic or acyclic, substituted or unsubstituted, branched or linear heteroaliphatic group; substituted or unsubstituted, branched or linear acyl group; a substituted or unsubstituted, branched or linear aryl group, or a substituted or unsubstituted, branched or linear heteroaryl group;

x is an integer from 1 to 10;

n is an integer from 1 to 3, m is an integer from 0-20, p is 0 or 1; wherein if tyr are both 0, then R ₁₀₂ is hydrogen, and if at least one of n or m is 2, then R ₁₀₃ and nitrogen in Formula (201) form the structure represented by Formula (202) or (203 ):

in which g, e and f independently of each other represent an integer of 1-6, "HCC" represents a hydrocarbon chain, and each *N represents a nitrogen atom shown in Formula (201).

[124] According to some embodiments of the present invention, R ₁₀₃ is a polyamine. According to other embodiments of the present invention, R ₁₀₃ is a ketal. According to some embodiments of the present invention, R ₁₀₁ and R ₁₀₂ in Formula (201) independently of each other represent any of substituted or unsubstituted, branched or linear alkyl or alkenyl groups that contain 3-20 carbon atoms (for example, 8-18 atoms carbon) and 0-4 double bonds (eg 0-2 double bonds).

[125] According to some embodiments of the present invention, if n and m are independently 1-3, R ₁₀₃ is any of the following formulas (204)-(213):

in which each of g, e and f is independently an integer from 1 to 6; each "HCC" represents a hydrocarbon chain and each * represents a potential point of attachment of R ₁₀₃ to the nitrogen atom in Formula (201), where each H in any * position can be substituted to effect attachment to the nitrogen atom in Formula (201).

[126] The compound shown in (201) can be produced as described in CN 103380113 A.

[127] According to some embodiments of the present invention, the organic amine may be an organic amine represented by Formula (214) and/or an organic amine represented by Formula (215):

[128] The accessory lipid is cholesterol, a cholesterol analog, and/or cholesterol derivatives.

[129] The PEGylated lipid is 1,2-dipalmitoyl-sn-glycero-3-phosphatidylethanolamine-N[methoxypolyethylene glycol]-2000.

[130] According to some embodiments of the present invention, the molar ratio between the organic amine, the accessory lipid, and the pegylated lipid in the pharmaceutical composition is (19.7-80):(19.7-80):(0.3-50); for example, the molar ratio may be (50-70):(20-40):(3-20).

[131] According to some embodiments of the present invention, pharmaceutical compositions formed by siRNAs of the present invention and the above amine-containing transfection agents have an average diameter of from about 30 nm to about 200 nm, typically from about 40 nm to about 135 nm, and more typically the average diameter of the liposome particles is from about 50 nm to about 120 nm, from about 50 nm to about 100 nm, from about 60 nm to about 90 nm, or from about 70 nm to about 90 nm, for example, the average diameter of the liposome particles is about 30, 40, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, 150 or 160 nm.

[132] According to some embodiments of the present invention, in a pharmaceutical composition formed by siRNA according to the present invention and the above amine-containing transfection agents, the ratio (mass/mass ratio) of siRNA to total lipids, for example, organic amines, accessory lipids and/or pegylated lipids, varies from about 1:1 to about 1:50, from about 1:1 to about 1:30, from about 1:3 to about 1:20, from about 1:4 to about 1:18, from about 1:5 to about 1:17, from about 1:5 to about 1:15, from about 1:5 to about 1:12, from about 1:6 to about 1:12, or from about 1:6 to about 1:10. For example, the ratio of siRNA according to the present invention to total lipids is approximately 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1: 14, 1:15, 1:16, 1:17 or 1:18 by weight.

[133] According to some embodiments of the present invention, the pharmaceutical composition may be sold with each component provided separately and may be administered in the form of a liquid formulation. According to some embodiments of the present invention, a pharmaceutical composition formed by the siRNA of the present invention and the above pharmaceutically acceptable carrier can be obtained using various known methods, with the exception of replacing the existing double-stranded siRNA oligonucleotide of the present invention. According to some variants of implementation of the present invention, the pharmaceutical composition can be obtained in accordance with the following method.

[134] Organic amines, auxiliary lipids and pegylated lipids are suspended in alcohol in the molar ratio described above and mixed until homogeneous to obtain a lipid solution; the alcohol is used in such an amount that the resulting lipid solution is present in a total weight concentration of 2 to 25 mg/ml (eg 8 to 18 mg/ml). The alcohol is a pharmaceutically acceptable alcohol, such as an alcohol that is in liquid form at about room temperature, such as one or more of ethanol, propylene glycol, benzyl alcohol, glycerol, PEG 200, PEG 300, PEG 400, preferably ethanol.

[135] MiRNA according to the present invention is dissolved in buffered saline to obtain an aqueous solution of miRNA. The buffered saline solution has a concentration of 0.05 to 0.5 M, such as 0.1 to 0.2 M. The pH of the buffered saline solution is adjusted to 4.0-5.5, such as 5.0 to 5, 2. Buffered saline is used in such an amount that the siRNA is present at a concentration of less than 0.6 mg/ml, for example, from 0.2 to 0.4 mg/ml. The buffer salt may be one or more selected from the group consisting of soluble acetate and soluble citrate such as sodium acetate and/or potassium acetate.

[136] The lipid solution and the aqueous siRNA solution are mixed. The product obtained after mixing, incubated at a temperature of from 40 to 60°C for at least 2 minutes (for example, from 5 to 30 minutes) to obtain an incubated lipid composition. The ratio of the volumes of the lipid solution to the aqueous solution of miRNA is 1:(2-5), for example, 1:4.

[137] The incubated lipid composition is concentrated or diluted, purified to remove impurities, and then sterilized to obtain a pharmaceutical composition according to the present invention, which has the following physicochemical parameters: pH 6.5 to 8, encapsulation percentage greater than 80%, size particles from 40 to 200 nm, polydispersity index less than 0.30 and osmotic pressure from 250 to 400 mOsm/kg; for example, the physicochemical parameters may be as follows: pH 7.2 to 7.6, encapsulation percentage greater than 90%, particle size 60 to 100 nm, polydispersity index less than 0.20, and osmotic pressure 300 to 400 mOsm/kg .

[138] In this case, the stage of concentration or dilution can be performed before, after or simultaneously with the stage of removing impurities. The method for removing impurities can be any of various existing methods such as ultrafiltration using a 100 kDa hollow fiber column, phosphate buffered saline (PBS) at pH=7.4 as the ultrafiltration exchange solution, and a tangential flow system. The sterilization method may be any of various existing methods such as sterilization by 0.22 µm filter filtration.

First miRNA conjugate

[139] According to one aspect of the present invention, a first siRNA conjugate is provided that contains the siRNA described above and a conjugating group attached thereto.

[140] The conjugating group typically contains at least one pharmaceutically acceptable targeting group and an optional linker. In addition, siRNA, linker and targeting group are connected in series. In some embodiments of the present invention, 1 to 6 targeting groups are present. In some embodiments of the present invention, 2 to 4 targeting groups are present. The siRNA molecule may be non-covalently or covalently conjugated to the conjugating group, for example, the siRNA molecule is covalently conjugated to the conjugating group. The conjugation position between the siRNA and the conjugating group may be at the 3' end or 5' end of the sense strand of the siRNA, or at the 5' end of the antisense strand, or in the internal sequence of the siRNA. In some embodiments of the present invention, the conjugation position between the siRNA and the conjugating group is at the 3' end of the sense strand of the siRNA.

[141] According to some embodiments of the present invention, the conjugating group is connected to a phosphate group, a 2'-hydroxy group, or a nucleotide base. According to some variants of implementation of the present invention, the conjugating group can be connected to the 3'-hydroxy group, if the nucleotides are connected by a 2'-5'-phosphodiester bond. If the conjugating group is connected to the end of the siRNA, the conjugating group is usually connected to the phosphate group of the nucleotide; if the conjugation group is connected to an internal siRNA sequence, the conjugation group is usually connected to a ribose ring or base. For specific compound types, reference may be made to: Muthiah Manoharan et al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytes. ACS Chemical biology, 2015, 10(5): 1181-7.

[142] According to some embodiments of the present invention, the siRNA and the conjugating group can be connected using an acid-labile or reducible chemical bond, and these chemical bonds can be broken in the acidic environment of the endosome of the cell, which brings the siRNA into a free state. For non-degradable conjugations, the conjugating group can be linked to the sense strand of the siRNA, minimizing the effect of the conjugation on the activity of the double-stranded oligonucleotide.

[143] According to some embodiments of the present invention, the pharmaceutically acceptable targeting group may be a conventional ligand at the site of administration of the double-stranded oligonucleotide, such as the various ligands described in WO 2009082607 A2, which is incorporated herein by reference in its entirety.

[144] According to some embodiments of the present invention, the pharmaceutically acceptable targeting group can be selected from one or more of the ligands formed by the following targeting molecules or their derivatives: lipophilic molecules such as cholesterol, bile acids, vitamins (such as vitamin E), molecules lipids with different chain lengths; polymers such as polyethylene glycol; polypeptides, such as a cell-penetrating peptide; aptamers; antibodies; quantum dots; saccharides such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid; or receptor ligands expressed in liver parenchymal cells such as asialoglycoprotein, asialo-sugar residue, lipoproteins (such as high density lipoprotein, low density lipoprotein), glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin and the like.

[145] In some embodiments of the present invention, each ligand is independently a ligand capable of binding to a cell surface receptor. In some embodiments of the present invention, at least one ligand is a ligand capable of binding to a hepatocyte surface receptor. In some embodiments of the present invention, at least one ligand is a ligand capable of binding to a mammalian hepatocyte surface receptor. In some embodiments of the present invention, the at least one ligand is a ligand capable of binding to a human hepatocyte surface receptor. In some embodiments of the present invention, at least one ligand is a ligand capable of binding to the hepatic surface asialoglycoprotein receptor (ASGP-R). The types of these ligands are well known to those skilled in the art, and they typically function to bind to specific receptors on the surface of the target cell, which mediates the delivery of the double-stranded ligand-bound oligonucleotide to the target cell.

[146] In some embodiments, the pharmaceutically acceptable targeting group can be any ligand that binds to asialoglycoprotein (ASGP-R) receptors on the surface of mammalian hepatocytes. In one embodiment of the present invention, each ligand is independently selected from an asialoglycoprotein such as asialorosomucoid (ASOR) or asialofetuin (ASF). In some embodiments of the present invention, the ligand is a saccharide or derivatives thereof.

[147] In some embodiments of the present invention, at least one ligand is a saccharide. In some embodiments of the present invention, each ligand is a saccharide. In some embodiments of the present invention, at least one ligand is a monosaccharide, a polysaccharide, a modified monosaccharide, a modified polysaccharide, or derivatives thereof. According to some variants of implementation of the present invention, at least one ligand may be a monosaccharide, disaccharide or trisaccharide. In some embodiments of the present invention, at least one ligand is a modified saccharide. In some embodiments of the present invention, each ligand is a modified saccharide. In some embodiments of the present invention, each ligand is independently selected from the group consisting of polysaccharides, modified polysaccharides, monosaccharides, modified monosaccharides, polysaccharide derivatives, and monosaccharide derivatives. According to some embodiments of the present invention, each ligand or at least one ligand may be independently selected from the group consisting of glucose and its derivatives, mannose and its derivatives, galactose and its derivatives, xylose and its derivatives, ribose and its derivatives, fucose and its derivatives, lactose and its derivatives, maltose and its derivatives, arabinose and its derivatives, fructose and its derivatives, and sialic acid.

[148] According to some embodiments of the present invention, each ligand can be independently selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D- galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β- D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine , N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2 -methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acids, 5-thio-β-D-glucopyranose, methyl-2,3,4-tris-O-a cetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl-3,4,6,7-tetra-O-acetyl-2-deoxy-1, 5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose. Other sets of ligands can be found, for example, in the disclosure of CN 105378082 A, which is incorporated into the present application by reference in its entirety.

[149] According to some embodiments of the present invention, the pharmaceutically acceptable targeting group in the first siRNA conjugate may be galactose or N-acetylgalactosamine, and the galactose or N-acetylgalactosamine molecules may be mono-, bi-, tri-, or tetravalent. It should be understood that the terms mono-, bi-, tri-, or tetravalent as described herein, respectively, mean that the molar ratio of the double-stranded oligonucleotide molecule to the galactose or N-acetylgalactosamine molecule in the oligonucleotide conjugate is 1:1, 1:2, 1:3 or 1:4, and the oligonucleotide conjugate is formed from a double-stranded oligonucleotide molecule and a conjugating group containing a molecule of galactose or N-acetylgalactosamine as a targeting group. In some embodiments of the present invention, the pharmaceutically acceptable targeting group is N-acetylgalactosamine. In some embodiments of the present invention, when the double stranded oligonucleotide of the present invention is conjugated to an N-acetylgalactosamine conjugating group, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments of the present invention, when the double stranded oligonucleotide of the present invention is conjugated to an N-acetylgalactosamine-containing conjugating group, the N-acetylgalactosamine molecule is trivalent.

[150] The targeting group can be connected to the siRNA molecule through an appropriate linker, and the appropriate linker can be selected by one of skill in the art according to the particular type of targeting group. The types of these linkers and targeting groups, as well as the types of connection with siRNA, can be found in the disclosure of WO 2015006740 A2, which is fully incorporated into the present application by reference.

[151] According to some embodiments of the present invention, if the targeting group is N-acetylgalactosamine, a suitable linker may have the following structure represented by Formula (301):

wherein

k is an integer from 1 to 3;

L ^A is an amide bond containing chain group which has the structure represented by Formula (302), with each L ^A appropriately linked to a targeting group and an L ^C group by an ether bond at its two ends:

L ^B is a chain group containing N-acylpyrrolidine, which has the structure represented by Formula (303), wherein the chain group contains a carbonyl group at one end and is connected to the L ^C group through an amide bond, and also contains a hydroxy group at the other end and connected to miRNA through a complex phosphoester bond:

L ^C is a divalent or tetravalent connecting group based on hydroxymethylaminomethane, dihydroxymethylaminomethane or trihydroxymethylaminomethane, wherein the L ^C group is connected to each of the L ^A groups via an ether bond at the oxygen atom and is connected to the L ^B group via an amide bond at the nitrogen atom.

[152] According to some embodiments of the present invention, if n=3 and L ^C is a tetravalent connecting group based on trihydroxymethylaminomethane, the first siRNA conjugate formed by connecting N-acetylgalactosamine molecules to the siRNA molecule due to -(L ^A ) ₃ -trihydroxymethylaminomethane -L ^B - as a linker, has the structure represented by Formula (304):

in which the double helix structure is miRNA.

[153] Similarly, the conjugation position between the siRNA and the conjugating group can be at the 3' end or 5' end of the sense strand of the siRNA, or at the 5' end of the antisense strand, or in the internal sequence of the siRNA.

[154] According to some embodiments of the present invention, the 3'-end of the sense strand of the siRNA according to the present invention is covalently conjugated to three molecules of N-acetylgalactosamine (GalNAc) through a linker -(L ^A ) ₃ -trihydroxymethylaminomethane-L ^B - to obtain the first siRNA conjugate , in which the molar ratio of the siRNA molecule to the GalNAc molecule is 1:3 (hereinafter referred to as (GalNAc) ₃ -siRNA), and this conjugate has the structure represented by Formula (305):

in which the structure of the double helix represents siRNA; and the linker is connected to the 3' end of the siRNA sense strand.

[155] According to some embodiments of the present invention, if the targeting group is N-acetylgalactosamine, a suitable linker may have the structure represented by Formula (306):

wherein,

1 is an integer from 0 to 3;

* represents the position connected to the targeting group by an ether bond on the linker; and

# is the position connected to the siRNA by a phosphoester bond on the linker.

[156] According to some specific embodiments of the present invention, if l=2, the siRNA conjugate has the structure represented by Formula (307):

in which the structure of the double helix denotes siRNA; and the linker is connected to the 3' end of the siRNA sense strand.

[157] The above conjugates can be synthesized in accordance with the method described in detail in the prior art. For example, WO 2015006740 A2 describes in detail the preparation of various conjugates. The first siRNA conjugate according to the present invention can be obtained using methods well known to those skilled in the art. As another example, WO 2014025805 A1 describes a process for preparing a conjugate having the structure represented by Formula (305). As an additional example, Rajeev et al., ChemBioChem 2015, 16, 903-908, described a method for preparing a conjugate having the structure represented by Formula (307).

Second miRNA conjugate

[158] According to some embodiments of the present invention, a second siRNA conjugate is provided that has the structure represented by Formula (1):

in which n1 is an integer from 1 to 3 and n3 is an integer from 0 to 4;

each of m1, m2 and m3 is independently an integer from 2 to 10;

each of R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ independently represents H or is selected from the group consisting of C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl and C ₁ -C ₁₀ alkoxy ;

R ₃ is a group having the structure represented by Formula (A59):

wherein

E ₁ is OH, SH or BH ₂ ;

Nu is miRNA;

each nucleotide in the siRNA represented by Nu is independently a modified or unmodified nucleotide. The miRNA represented by Nu contains a sense strand and an antisense strand, with the sense strand containing nucleotide sequence 1 and the antisense strand containing nucleotide sequence 2; nucleotide sequence 1 and nucleotide sequence 2 are at least partially reverse complementary, allowing the formation of a double-stranded region;; nucleotide sequence 1 has the same length as the nucleotide sequence shown in SEQ ID NO: 155 and differs from it by no more than 3 nucleotides; and nucleotide sequence 2 is the same length as the nucleotide sequence shown in SEQ ID NO: 156 and differs from it by no more than 3 nucleotides:

5'-CCUUGAGGCAUACUUCAAZ-3' (SEQ ID NO: 155);

5'-Z'UUUGAAGUAUGCCUCAAGG-3' (SEQ ID NO: 156);

wherein

Z is A; Z' is U;

nucleotide sequence 1 contains the nucleotide Z _A at the position corresponding to Z;

nucleotide sequence 2 contains the nucleotide Z' _B at the position corresponding to Z'; nucleotide Z' _B is the first nucleotide at the 5' end of the antisense strand;

R ₂ is a linear alkylene of 1 to 20 carbon atoms in length, with one or more carbon atoms optionally substituted with one or more groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O) ₂ , C ₂ -C ₁₀ alkylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, and R ₂ optionally contains one or more substituents selected from the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, -OC ₁ -C ₁₀ alkyl, -OC ₁ - C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-OH, -OC ₁ -C ₁₀ haloalkyl, -SC ₁ -C ₁₀ alkyl, -SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-SH, -SC ₁ -C ₁₀ haloalkyl, halogen, -OH, -SH, -NH ₂ , -C ₁ -C ₁₀ alkyl-KHg, -N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -NH ( C ₁ -C ₁₀ alkyl), cyano, nitro, -CO ₂ H, -C (O) OC ₁ -C ₁₀ alkyl, -CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -CONH (C ₁ -C ₁₀ alkyl), -CONH ₂ , -NHC (O) (C ₁ -C ₁₀ alkyl), -NHC (O) (phenyl), -N (C ₁ -C ₁₀ alkyl) C (O) (From ₁ - C ₁₀ alkyl), -N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), -C (O) C ₁ -C ₁₀ alkyl, -C (O) C ₁ -C ₁₀ alkylphenyl, -C ( O) C ₁ -C ₁₀ haloalkyl, -OC (O) C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl ), -SO ₂ NH ₂ , -SO ₂ NH (C ₁ -C ₁₀ alkyl), -SO ₂ NH (phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and -NHSO ₂ (C ₁ -C ₁₀ haloalkyl);

each L ₁ is independently a linear alkylene of 1 to 70 carbon atoms in length, with one or more carbon atoms optionally substituted with one or more groups selected from the group consisting of: C(O), NH, O, S, CH= N, S(O) ₂ , C ₂ -C ₁₀ alkylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, and L ₁ optionally contains one or more substituents selected from the group consisting of: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, -OC ₁ -C ₁₀ alkyl, -OC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-OH, -OC ₁ -C ₁₀ haloalkyl, -SC ₁ -C ₁₀ alkyl, -SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkyl-SH, -SC ₁ -C ₁₀ haloalkyl, halogen, -OH, -SH, -NH ₂ , -C ₁ -C ₁₀ alkyl-NH ₂ , -N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), -NH (C ₁ -C ₁₀ alkyl), cyano, nitro, -CO ₂ H, -C (O) OC ₁ -C ₁₀ alkyl, -CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl) , -CONH(C ₁ -C ₁₀ alkyl), -CONH ₂ , -NHC(O)(C ₁ -C ₁₀ alkyl), -NHC(O)(phenyl), -N(C ₁ -C ₁₀ alkyl) C (O) (C ₁ -C ₁₀ alkyl), -N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), -C (O) C ₁ -C ₁₀ alkyl, -C (O )C ₁ -C ₁₀ alkylphenyl, -C (O) C ₁ -C ₁₀ haloalkyl, -OC (O) C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl) , -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , -SO ₂ NH (C ₁ -C ₁₀ alkyl), -SO ₂ NH (phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl ), -NHSO ₂ (phenyl) and -NHSO ₂ (C ₁ -C ₁₀ haloalkyl).

[159] According to some embodiments of the present invention, L ₁ can be selected from the group consisting of groups A1-A26 and any combination thereof, with structures and definitions of A1-A26 as follows:

where each j1 is independently an integer from 1 to 20;

each j2 is independently an integer from 1 to 20;

R' is C ₁ -C ₁₀ alkyl;

Ra is selected from the group consisting of A27-A45 and any combination thereof:

Rb is C ₁ -C ₁₀ alkyl; and

представляет собой положение, в котором группа соединена с остальной частью молекулы.-

represents the position at which the group is attached to the rest of the molecule.

[160] Those skilled in the art will appreciate that while L ₁ is defined as linear alkyl for convenience, it cannot be a linear group or be referred to in any other way, such as an amine or alkenyl derived from the above substitution and/or substitution. For the purposes of the present invention, the length L ₁ is the number of atoms in the chain connecting two points of attachment. For this purpose, a ring obtained by substitution of a carbon atom of a linear alkylene such as heterocyclylene or heteroarylene is counted as one atom.

[161] M ₁ is a targeting group, the definitions and variants of which are similar to those described above. In some embodiments of the present invention, each M ₁ is independently selected from one of the ligands that have affinity for the asialoglycoprotein receptor on the surface of mammalian hepatocytes.

[162] If M ₁ is a ligand that has affinity for the asialoglycoprotein receptor (ASGP-R) on the surface of a mammalian hepatocyte, according to some embodiments of the present invention, n1 may be an integer from 1 to 3, and n3 may be an integer a number from 0 to 4 to ensure that the amount of M ₁ ligand in the conjugate can be at least 2. According to some embodiments of the present invention, n1+n3≥2, so the amount of M ₁ ligand in the conjugate can be at least 3, this provides easier binding of the M ₁ ligand to the asialoglycoprotein receptor on the surface of hepatocytes, which can facilitate endocytosis of the conjugate into cells. Experiments have shown that if the amount of M ₁ ligand exceeds 3, the ease of binding of the M ₁ ligand to the asialoglycoprotein receptor on the surface of hepatocytes does not increase significantly. Thus, considering various aspects such as convenience of synthesis, structure/method cost, and delivery efficiency, according to some embodiments of the present invention, n1 is an integer from 1 to 2, n3 is an integer from 0 to 1, and n1+ n3=from 2 to 3.

[163] According to some embodiments of the present invention, if m1, m2, and m3 are independently selected from an integer of 2-10, steric mutual positions among many M ₁ ligands may be appropriate for binding the M ₁ ligands to the asialoglycoprotein receptor on the surface of hepatocytes. . In order for the conjugate of the present invention to have a simpler structure, easier synthesis, and/or reduced cost, in some embodiments of the present invention, m1, m2, and m3 are independently integers 2-5, in some embodiments of the present invention inventions m1=m2=m3.

[164] Those skilled in the art will appreciate that if R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are independently H, C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl and C ₁ -C ₁₀ alkoxy, they will not change the properties of the conjugate according to the present invention, and all can achieve the object of the present invention. According to some embodiments of the present invention, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are independently selected from H, methyl and ethyl. According to some embodiments of the present invention, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are H.

[165] R ₃ is a group having the structure represented by Formula A59, where E ₁ is OH, SH, or BH ₂ and subject to the availability of starting materials, according to some embodiments of the present invention, E ₁ is OH or SH.

[166] According to some embodiments of the present invention, R ₂ is selected to provide a connection between the group represented by Formula (A59) and the N atom on the nitrogenous backbone. As used in the present invention, "nitrogen backbone" refers to a chain structure in which a carbon atom attached to R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ and N atoms are connected to each other. According to some embodiments of the present invention, R ₂ may be any connecting group capable of attaching the group represented by Formula (A59) to the N atom on the nitrogenous backbone by suitable means. According to some embodiments of the present invention, if the siRNA conjugate of the present invention is prepared by a solid phase synthesis method, the R ₂ group must have both a position connecting to the N atom on the nitrogenous backbone and a position connecting to the P atom in R ₃ . According to some embodiments of the present invention, in R ₂ the position connecting to the N atom on the nitrogenous backbone forms an amide bond to the N atom, and the position connecting to the P atom in R ₃ forms a phosphoester bond to the P atom. According to some embodiments of the present of the invention R ₂ is B5, B6, B5' or B6':

at which represents the position at which the group is attached

covalently;

q2 is an integer from 1 to 10; in some embodiments of the present invention, q2 is an integer from 1 to 5.

[167] L ₁ is used to connect the M ₁ ligand to the N atom on the nitrogenous backbone, which provides a liver targeting function for the second siRNA conjugate of the present invention. In some embodiments of the present invention, L ₁ is selected from conjugated combinations of one or more of Formulas A1-A26. In some embodiments of the present invention, L ₁ is selected from conjugated combinations of one or more of Formulas A1, A4, A5, A6, A8, A10, A11, and A13. In some embodiments of the present invention, L ₁ is selected from conjugated combinations of at least two of Formulas A1, A4, A8, A10, and A11. In some embodiments of the present invention, L ₁ is selected from conjugated combinations of at least two of Formulas A1, A8, and A10.

[168] According to some variants of implementation of the present invention, the length L ₁ can be from 3 to 25, from 3 to 20, from 4 to 15, or from 5 to 12 atoms. According to some embodiments of the present invention, L ₁ contains 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 , 24, 25, 30, 35, 40, 45, 50, 55, 60 atoms long.

[169] According to some embodiments of the present invention, j1 is an integer from 2 to 10, and in some embodiments of the present invention, is an integer from 3 to 5. j2 is an integer from 2 to 10, and in some embodiments of the present invention, is an integer from 3 to 5. R' is C ₁ -C ₄ alkyl and in some embodiments of the present invention is methyl, ethyl and isopropyl. Ra is one of A27, A28, A29, A30 and A31 and according to some embodiments of the present invention is A27 or A28. Rb is C ₁ -C ₅ alkyl and in some embodiments of the present invention is methyl, ethyl, isopropyl and butyl. According to some embodiments of the present invention, j1, j2, R', Ra, and Rb of Formulas A1-A26, respectively, are selected to provide bonding between the M ₁ ligands and the N atom on the nitrogenous backbone, as well as to create a steric relationship among the M ₁ ligands , more suitable for binding M ₁ ligands to the asialoglycoprotein receptor on the surface of hepatocytes.

[170] According to some embodiments of the present invention, the second siRNA conjugate of the present invention has the structure represented by Formula (3), (4), (5), (6), (7), (8), (9), (10 ), (11), (12), (13), (14), (15), (16), (17), (18), (19), (20), (21) or (22):

[171] According to some embodiments of the present invention, the P atom in Formula A59 can be connected to any possible position in the siRNA sequence (represented by Nu in the Formulas above), for example, the P atom in Formula A59 can be connected to any nucleotide in the sense or antisense miRNA chains. In some embodiments of the present invention, the P atom in Formula A59 is linked to any nucleotide in the sense strand of the siRNA. In some embodiments of the present invention, the P atom in Formula A59 may be connected to the end of the sense or antisense siRNA strand. In some embodiments of the present invention, the P atom in Formula A59 is connected to the end of the siRNA sense strand. The specified end refers to the first 4 nucleotides counted from one end of the sense or antisense strand. In some embodiments of the present invention, the P atom in Formula A59 is connected to either end of the sense strand or antisense strand of the siRNA. In some embodiments of the present invention, the P atom in Formula A59 is connected to the 3' end of the siRNA sense strand. If the P atom in Formula A59 is connected to the above position in the siRNA sense strand, after entering the cells, the conjugate of the present invention can release a separate siRNA antisense strand during unwinding, which blocks the translation of HBV mRNA into protein and inhibits the expression of the hepatitis B virus gene. (VGV).

[172] The P atom in Formula A59 can be connected to any possible nucleotide position in the siRNA represented by Nu, such as the 5', 2' or 3' position or to the base of the nucleotide. In some embodiments of the present invention, the P atom in Formula A59 may be connected to the 2', 3', or 5' position of the nucleotide in the siRNA by forming a phosphodiester bond. According to some embodiments of the present invention, the P atom in Formula A59 is connected to an oxygen atom formed by deprotonation of the 3'-hydroxyl of the nucleotide at the 3' end of the sense strand in siRNA, or the P atom in Formula A59 is connected to the nucleotide by replacing the hydrogen atom in 2 The '-hydroxyl of the nucleotide of the sense strand in siRNA, or the P atom in Formula A59, is connected to the nucleotide by replacing the hydrogen atom in the 5'-hydroxyl of the nucleotide at the 5' end of the sense strand in siRNA.

[173] According to some variants of implementation of the present invention, the nucleotide sequence 1 contains no more than 1 nucleotide different from the nucleotide sequence presented in SEQ ID NO: 1; and/or nucleotide sequence 2 contains no more than 1 nucleotide different from the nucleotide sequence shown in SEQ ID NO: 2.

[174] According to some embodiments of the present invention, nucleotide differences between nucleotide sequence 2 and the nucleotide sequence shown in SEQ ID NO: 2 include a difference in nucleotide position Z' _B and Z' _B is selected from A, C, or G; in some embodiments of the present invention, the nucleotide difference is the difference in nucleotide position Z' _B and Z' _B is selected from A, C, or G; in some embodiments of the present invention, Z _A is a nucleotide complementary to Z' _B . These certain nucleotide differences will not significantly reduce the ability of the second siRNA conjugate to inhibit the target gene, and therefore second siRNA conjugates containing certain nucleotide differences are also included within the scope of the present invention.

[175] According to some embodiments of the present invention, nucleotide sequence 1 is predominantly reverse complementary, substantially reverse complementary, or fully reverse complementary to nucleotide sequence 2. "Predominantly reverse complementary" refers to no more than 3 mismatches in two nucleotide sequences. "Substantially reverse complementary" refers to no more than 1 mismatch in two nucleotide sequences. "Completely reverse complementary" refers to the absence of mismatches in two nucleotide sequences.

[176] According to some embodiments of the present invention, the sense strand also comprises nucleotide sequence 3, and the antisense strand further comprises nucleotide sequence 4. Nucleotide sequences 3 and 4 are each independently 1-4 nucleotides in length. Nucleotides in nucleotide sequence 3 correspond to those at corresponding positions in nucleotide sequence 4. In some embodiments of the present invention, nucleotide sequence 4 is at least partially complementary to nucleotides at corresponding positions in the target mRNA. In some embodiments of the present invention, the nucleotide sequence 4 is fully complementary to the nucleotides at the corresponding positions in the target mRNA.

[177] In some embodiments, nucleotide sequence 3 is fused to the 5' end of nucleotide sequence 1 and nucleotide sequence 4 is fused to the 3' end of nucleotide sequence 2. In some embodiments, nucleotide sequence 3 is the same length as that nucleotide sequence 4 is and is inversely complementary to it. Thus, according to some embodiments of the present invention, the sense strand and the antisense strand may be 19-23 nucleotides in length.

[178] According to some embodiments of the present invention, nucleotide sequence 3 and nucleotide sequence 4 are both 1 nucleotide in length. The base of the nucleotide sequence 3 is A; in this case, the double-stranded region may be 20 nucleotides in length, ie. the ratio of the length of the sense strand to the length of the antisense strand is 20/20; in another embodiment, nucleotide sequence 3 and nucleotide sequence 4 are both 2 nucleotides long; in the direction from the 5'end to the 3'end, the bases of the nucleotide sequence 3 are G and A in sequence; in this case, the double-stranded region may be 21 nucleotides in length, i. e. the ratio of the length of the sense strand to the length of the antisense strand is 21/21; in another embodiment, nucleotide sequence 3 and nucleotide sequence 4 are both 3 nucleotides long; in the direction from the 5'-end to the 3'-end, the bases of the nucleotide sequence 3 are C, G and A in sequence; in this case, the double-stranded region may be 22 nucleotides in length, ie. the ratio of the length of the sense strand to the length of the antisense strand is 22/22; in another embodiment, nucleotide sequence 3 and nucleotide sequence 4 are both 4 nucleotides long; in the direction from the 5'end to the 3'end, the bases of the nucleotide sequence 3 are C, C, G and A in sequence; in this case, the double-stranded region may be 23 nucleotides in length, i. e. the ratio of sense strand length to antisense strand length is 23/23.

[179] According to some variants of implementation of the present invention, the nucleotide sequence 3 contains 2 nucleotides in length; in the direction from the 5' end to the 3' end, the bases of the nucleotide sequence 3 are G and G in sequence.

[180] It should be understood that nucleotide sequence 3 and nucleotide sequence 4 are of the same length and are complementary to each other. Thus, after providing the bases of the nucleotide sequence 3, the bases of the nucleotide sequence 4 are also determined.

[181] According to some embodiments of the present invention, the siRNA represented by Nu in Formula (1) further comprises a nucleotide sequence 5 that is 1-3 nucleotides in length and is fused to the 3' end of the antisense strand to form the 3' overhang of the antisense strand. . According to some variants of implementation of the present invention, the nucleotide sequence 5 contains 1 or 2 nucleotides in length. Thus, the ratio of the length of the sense strand to the length of the antisense strand in miRNA represented by Nu can be 19/20, 19/21, 20/21, 20/22, 21/22, 21/23, 22/23, 22/24 , 23/24 or 23/25.

[182] According to some variants of implementation of the present invention, the nucleotide sequence 5 contains 2 nucleotides in length. In addition, in the 5' to 3' direction, nucleotide sequence 5 is 2 consecutive thymidine deoxyribonucleotides, 2 consecutive uridine ribonucleotides, or 2 nucleotides complementary to the target mRNA. Thus, in some embodiments of the present invention, the ratio of sense strand length to antisense strand length in siRNA represented by Nu is 19/21 or 21/23. herein, the siRNA-containing conjugate exhibits better inhibitory activity against APOC3 mRNA.

[183] According to some embodiments of the present invention, the sense strand contains the nucleotide sequence shown in SEQ ID NO: 1, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4:

5'-CCUUGAGGCAUACUUCAAZA-3' (SEQ ID NO: 1),

5'-Z'BUUGAAGUAUGCCUCAAGGUU-3' (SEQ ID NO: 3),

5'-Z'BUUGAAGUAUGCCUCAAGGUC-3' (SEQ ID NO: 4),

in which the nucleotide Z' _B is the first nucleotide from the 5' end of the antisense strand; Z _A is selected from A, U, G or C; and Z' _B is a nucleotide complementary to Z _A .

[184] According to some embodiments of the present invention, the siRNA represented by Nu is siHBa1 or siHBa2:

siHBa1

Sense strand: 5'-CCUUGAGGCAUACUUCAAA-3' (SEQ ID NO: 5),

Antisense strand: 5'-UUUGAAGUAUGCCUCAAGGUU-3' (SEQ ID NO: 6)

siHBa2

Sense strand: 5'-GACCUUGAGGCAUACUUCAAA-3' (SEQ ID NO: 7),

Antisense strand: 5'-UUUGAAGUAUGCCUCAAGGUCGG-3' (SEQ ID NO: 8).

[185] As described above, each of the nucleotides in the siRNA represented by Nu in Formula (1) is independently modified or unmodified nucleotides. In some embodiments of the present invention, the nucleotides in the siRNA represented by Nu are unmodified nucleotides; in some embodiments of the present invention, some or all of the nucleotides in the siRNA represented by Nu are modified nucleotides. Such modifications on the nucleotides will not cause a significant reduction or loss of function of the second siRNA conjugate of the present invention in terms of inhibition of HBV gene expression.

[186] According to some embodiments of the present invention, the siRNA in the conjugate contains at least one modified nucleotide. As used herein, the term "modified nucleotide" as used herein refers to a nucleotide formed by replacing the 2'-hydroxyl of a ribose group with other groups, a nucleotide analog, or a base-modified nucleotide. Such modified nucleotides will not cause a significant reduction or loss of function of the siRNA conjugate to inhibit gene expression. For example, the modified nucleotides disclosed by J.K. Watts, G. F. Deleavey and M. J. Damha, Chemically Modified siRNA: tools and applications. Drug Discov Today, 2008.13(19-20): p. 842-55.

[187] According to some embodiments of the present invention, at least one nucleotide in the sense or antisense strand is a modified nucleotide, and/or at least one phosphate is a phosphate group with modified groups. In other words, at least a portion of the phosphate and/or ribose groups in the phosphate-ribose backbone of at least one single strand in the sense strand and the antisense strand are phosphate and/or ribose groups with modified groups.

[188] According to some embodiments of the present invention, all nucleotides in the sense strand and/or antisense strand are modified nucleotides. In some embodiments of the present invention, each nucleotide in the sense strand and antisense strand is independently a fluorine-modified or non-fluorine-modified nucleotide.

[189] The present inventors surprisingly found that the second siRNA conjugate disclosed herein achieved a high degree of balance between serum stability and gene silencing efficacy in animal experiments.

[190] According to some embodiments of the present invention, the fluorine-modified nucleotides are located within nucleotide sequences 1 and 2; and, in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 of nucleotide sequence 1 are fluorine-modified nucleotides; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence 2 are fluorine-modified nucleotides.

[191] According to some embodiments of the present invention, no more than 5 fluorine-modified nucleotides are present in nucleotide sequence 1; in some embodiments of the present invention, no more than 7 fluorine-modified nucleotides are present in nucleotide sequence 2.

[192] According to some embodiments of the present invention, in the 5' to 3' direction, the nucleotides at positions 7, 8, and 9 or 5, 7, 8, and 9 of nucleotide sequence 1 in the sense strand are fluorine-modified nucleotides , and the nucleotides in the remaining positions in the sense chain are nucleotides with non-fluorine modification; in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 or 2, 6, 8, 9, 14, and 16 of nucleotide sequence 2 in the antisense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are nucleotides with non-fluorine modification.

[193] Definitions and variants of fluorine-modified and non-fluorine-modified nucleotides, respectively, are described above.

[194] According to some embodiments of the present invention, in the 5' to 3' direction, the nucleotides at positions 5, 7, 8, and 9 of nucleotide sequence 1 in the siRNA sense strand represented by Nu are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the sense strand of the siRNA are methoxy-modified nucleotides; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 8, 9, 14, and 16 of nucleotide sequence 2 in the antisense strand of the siRNA represented by Nu are fluorine-modified nucleotides, while the nucleotides at the remaining positions in the antisense strand of miRNAs are methoxy-modified nucleotides;

according to another variant, in the direction from the 5'-end to the 3'-end, the nucleotides at positions 7, 8 and 9 of the nucleotide sequence 1 in the sense strand of miRNA represented by Nu are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the sense strand miRNAs are methoxy-modified nucleotides; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence 2 in the antisense siRNA strand represented by Nu are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand miRNAs are methoxy-modified nucleotides;

according to another variant, in the direction from the 5'-end to the 3'-end, the nucleotides at positions 5, 7, 8 and 9 of the nucleotide sequence 1 in the sense strand of miRNA represented by Nu are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the sense strand of miRNAs are methoxy-modified nucleotides; and, in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence 2 in the antisense siRNA strand represented by Nu are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand miRNAs are methoxy-modified nucleotides.

[195] According to some embodiments of the present invention, the nucleotide contains modifications on phosphate groups. According to some embodiments of the present invention, the modification on the phosphate group is a phosphothioate modification represented by Formula (101) below, i. replacing the non-bridging oxygen atom in the phosphodiester bond with a sulfur atom such that the phosphodiester bond changes to a phosphodiester bond. This modification stabilizes the siRNA structure while maintaining high specificity and high base pairing affinity.

[196] According to some embodiments of the present invention, in an siRNA represented by Nu, a phosphothioate bond is present at at least one of the following positions: between the first and second nucleotides from either end of the sense or antisense strand, between the second and third nucleotides from either end of the sense strand or antisense strand, or any combination thereof. In some embodiments of the present invention, the phosphothioate bond is present at all of the above positions except for the 5' end of the sense strand. In some embodiments of the present invention, the phosphothioate bond is present at all of the above positions except for the 3' end of the sense strand. According to some embodiments of the present invention, the phosphothioate bond is present in at least one of the following positions:

between the first and second nucleotides from the 5'-end of the sense chain;

between the second and third nucleotides from the 5' end of the sense chain;

between the first and second nucleotides from the 3'-end of the sense chain;

between the second and third nucleotides from the 3' end of the sense chain;

between the first and second nucleotides from the 5' end of the antisense strand;

between the second and third nucleotides from the 5' end of the antisense strand;

between the first and second nucleotides from the 3' end of the antisense strand; and

between the second and third nucleotides from the 3' end of the antisense strand.

[197] According to some embodiments of the present invention, the 5'-terminal nucleotide in the sequence of the antisense strand of the siRNA molecule represented by Nu is a 5'-phosphate nucleotide or a nucleotide modified with a 5'-phosphate analog.

[198] According to some embodiments of the present invention, the 5'-phosphate nucleotide or nucleotide modified with a 5'-phosphate analog is a 5'-phosphate modified nucleotide represented by Formula (102), a nucleotide containing an E-vinyl phosphonate modification (E- VP) represented by Formula (103), or a 5'-phosphothioate-modified nucleotide represented by Formula (105).

[199] The inventors of the present invention have surprisingly found that the second siRNA conjugate of the present invention exhibits a significantly improved serum stability and lower off-target effect without a significant decrease in suppression activity against HBV mRNA, and further exhibits a higher inhibitory effect on blood lipids. . Thus, according to some embodiments of the present invention, the siRNAs represented by Nu in the second siRNA conjugate of the present invention may be those shown in Table 1:

[200] In an siRNA or siRNA conjugate of the present invention, each pair of adjacent nucleotides is connected by a phosphodiester bond or a phosphodiester bond. The nonbridging oxygen or sulfur atom in a phosphodiester bond or phosphodiester bond is negatively charged and may be present in the form of hydroxyl or sulfhydryl. In addition, the hydrogen ion in the hydroxyl or sulfhydryl may be partially or completely replaced by a cation. The cation may be any cation such as a metal cation, an NH4 ⁺ ammonium cation, or an organic ammonium cation. In order to increase solubility, according to some embodiments of the present invention, the cation is selected from one or more of an alkali metal cation, an ammonium cation formed by a tertiary amine, and a quaternary ammonium cation. The alkali metal ion may be K ⁺ and/or Na ⁺ and the tertiary amine cation may be an ammonium cation formed by triethylamine and/or an ammonium cation formed by N,N-diisopropylethylamine. Thus, the siRNA or siRNA conjugate of the present invention may be at least partially present in the form of a salt. According to one embodiment of the present invention, the non-bridging oxygen atom or sulfur atom in the phosphodiester bond or phosphothiodiester bond is at least partially bound to a sodium ion, and thus the siRNA or siRNA conjugate of the present invention is or is partially present in the form of a sodium salt.

[201] It is well known to those skilled in the art that a modified nucleotide can be introduced into an siRNA according to the present invention using a nucleoside monomer with appropriate modification. Methods for obtaining a nucleoside monomer having an appropriate modification and methods for introducing a modified nucleotide into miRNAs are also well known to those skilled in the art. All modified nucleoside monomers may be commercially available or prepared using known methods. Preparation of the second siRNA conjugate

[202] The second siRNA conjugate described above can be obtained using any appropriate synthetic routes.

[203] According to some embodiments of the present invention, the second siRNA conjugate of the present invention can be obtained using the following method, including: sequential connection of nucleoside monomers in the direction from 3' to 5' in accordance with the type and sequence of nucleotides in the sense strand and antisense strand double-stranded oligonucleotide, respectively, under the condition of solid-phase phosphoamidite synthesis, and the stage of connection of each nucleoside monomer includes a four-step reaction of deprotection, binding, capping and oxidation or sulfurization; isolation of the sense strand and antisense strand of miRNA; and renaturation; wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide. The miRNA represented by Nu contains a sense strand and an antisense strand, with the sense strand containing nucleotide sequence 1 and the antisense strand containing nucleotide sequence 2; nucleotide sequence 1 and nucleotide sequence 2 are at least partially reverse complementary, allowing the formation of a double-stranded region;; nucleotide sequence 1 has the same length as the nucleotide sequence shown in SEQ ID NO: 155 and differs from it by no more than 3 nucleotides; and nucleotide sequence 2 is the same length as the nucleotide sequence shown in SEQ ID NO: 156 and differs from it by no more than 3 nucleotides:

5'-CCUUGAGGCAUACUUCAAZ-3' (SEQ ID NO: 155);

5'-Z'UUUGAAGUAUGCCUCAAGG-3' (SEQ ID NO: 156);

in which

Z is A; Z' is U;

nucleotide sequence 1 contains the nucleotide Z _A at the position corresponding to Z;

nucleotide sequence 2 contains the nucleotide _Z'B at the position corresponding to Z'; nucleotide Z' _B is the first nucleotide from the 5' end of the antisense strand.

[204] Further, the method further comprises: bringing the compound represented by Formula (321) into contact with a nucleoside monomer or a nucleotide sequence coupled to a solid phase support under a coupling reaction condition and in the presence of a coupling agent, resulting in binding of the compound represented by Formula (321), with the nucleotide sequence due to the binding reaction. Hereinafter, the compound represented by Formula (321) is also referred to as a conjugating molecule.

wherein

R ₄ is a group capable of binding to siRNA represented by Nu. In some embodiments of the present invention, R ₄ is a group capable of binding to an siRNA represented by Nu through a covalent bond; according to some embodiments of the present invention, R ₄ is a group containing any functional group that can be conjugated to miRNA through a complex phosphodiester bond using a reaction;

Each S ₁ is independently M ₁ which is a group formed by substitution of all active hydroxyl with a YCOO- group, where each Y is independently selected from the group consisting of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n -propyl, isopropyl, phenyl, halophenyl and alkylphenyl.

Definitions and variants of n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ , M ₁ , respectively, are described above.

[205] R ₄ is selected to provide bonding to the N atom on the nitrogenous backbone and to provide a suitable reaction site for the synthesis of the siRNA conjugate represented by Formula (1). In some embodiments of the present invention, R ₄ contains an R ₂ connecting group or a protected R ₂ connecting group and can form a functional group represented by Formula (A59) with siRNA by reaction.

[206] According to some embodiments of the present invention, R ₄ contains a first functional group that can react with a group on the siRNA or nucleoside monomer to form a phosphite ester, and a second functional group that can form a covalent bond with a hydroxy group or an amino group, or contains a solid phase a substrate attached by a covalent bond. In some embodiments of the present invention, the first functional group is phosphoamidite, hydroxyl, or protected hydroxyl. In some embodiments of the present invention, the second functional group is a phosphoamidite, carboxyl, or carboxylate salt. According to some variants of implementation of the present invention, the second functional group is a solid phase support, connected to the rest of the molecule through a covalent bond, which is formed by a hydroxy group or an amino group. In some embodiments of the present invention, the solid phase support is bonded through a phosphoester bond, a carboxyester bond, or an amide bond. In some embodiments of the present invention, the solid phase support is a resin.

[207] According to some embodiments of the present invention, the first functional group contains hydroxy, -OR _k , or a group represented by Formula (C3); the second functional group contains a group represented by Formula (C1), (C2), (C3), (C1') or (C3'):

представляет собой положение, в котором группа ковалентно соединена.in which q ₁ is an integer 1-4, X is O or NH, M ⁺ is a cation, R _k is a hydroxyl protecting group, SPS is a solid phase support, and

is the position at which the group is covalently bonded.

[208] According to some embodiments of the present invention, the first functional group contains a phosphoamidite functional group, such as the group represented by Formula (C3). The phosphoamidite group can form a phosphite ester with a hydroxyl at any position on the nucleotide (such as 2'- or 3'-hydroxy) by a coupling reaction, and the phosphite ester can form a phosphodiester bond or a phosphothioester bond represented by Formula (A59) , by oxidation or sulfurization, so as to conjugate the conjugating molecule to the siRNA. herein, even if the second functional group does not exist, the compound represented by Formula (321) can still be conjugated to a nucleotide without adversely affecting the preparation of the siRNA conjugate represented by Formula (1). Under such circumstances, after obtaining a sense or antisense siRNA strand by a method such as solid-phase phosphoamidite synthesis, the compound represented by Formula (321) is reacted with a hydroxyl at the terminal nucleotide of the nucleotide sequence, and the resulting phosphite ester forms a phosphodiester bond or a phosphothioate bond in the result of subsequent oxidation or sulfurization, which leads to the conjugation of the compound represented by Formula (321) with siRNA.

[209] According to some embodiments of the present invention, the first functional group contains a protected hydroxy group. According to some embodiments of the present invention, the second functional group contains a group that can react with a solid phase support to provide a conjugating molecule containing a solid phase support. According to some variants of implementation of the present invention, the second functional group contains a carboxyl, carboxylate or phosphoamidite, for example, a functional group represented by Formula (C1), (C2) or (C3). If the second functional group contains a carboxyl or carboxylate, the compound represented by Formula (321) can react by esterification or amidation reaction with a hydroxy or amino group on a solid phase support such as a resin to form a conjugating molecule containing a solid phase support attached by carboxylate ester bond or amide bond. If the second functional group contains a phosphoamidite functional group, the compound represented by Formula (321) can be bonded to a hydroxy group on a versatile solid phase support such as a resin and form a conjugating molecule having a solid phase support attached via a phosphodiester bond through oxidation. Then, starting from the above product coupled to a solid phase support, the nucleoside monomers are sequentially coupled by a solid phase phosphoamidite synthesis method, thereby obtaining a sense or antisense siRNA strand coupled to a conjugating group. During the solid phase phosphoamidite synthesis, the first functional group is deprotected and then coupled to the phosphoamidite group on the nucleoside monomer under a coupling reaction condition.

[210] According to some embodiments of the present invention, the first functional group contains a hydroxy group or a protected hydroxy group, and the second functional group contains a solid phase support attached through a carboxy ester bond, an amide bond, or a phospho ester bond, as represented by Formula (C1'), or ( C3'). Under such circumstances, starting from the compound represented by Formula (321), instead of a solid phase support, nucleoside monomers are sequentially coupled by a solid phase phosphoamidite synthesis method, thereby obtaining a sense or antisense strand of siRNA coupled to a conjugating group. According to some embodiments of the present invention, the carboxylate can be represented as -COO ^- M ⁺ , where M ⁺ is a cation, such as one of a metal cation, an ammonium cation NH ₄ ⁺ and an organic ammonium cation. According to one implementation variant of the present invention, the metal cation may be an alkali metal cation, such as K ⁺ or Na ⁺ . To improve solubility and facilitate reaction, in some embodiments of the present invention, the organic ammonium cation is an ammonium cation derived from a tertiary amine or a quaternary ammonium cation such as an ammonium cation derived from triethylamine or N,N-diisopropylethylamine. In some embodiments of the present invention, the carboxylate is triethylamine carboxylate or N,N-diisopropylethylamine carboxylate.

[211] According to some embodiments of the present invention, R ₄ contains the structure represented by Formula (B9), (B10), (B9'), (B10'), (B11), (B12), (B11'), or (B 12 '):

представляет собой положение, в котором группа ковалентно соединена.in which q ₁ is an integer from 1-4, q ₂ is an integer from 1 to 10, X is O or NH, M ⁺ is a cation, R _k is a hydroxyl protecting group, SPS is a solid phase support, and

is the position at which the group is covalently bonded.

In some embodiments of the present invention, q ₁ is equal to 1 or 2. In some embodiments of the present invention, q ₂ is an integer from 1 to 5. In some embodiments of the present invention, R ₄ contains the structure represented by Formula (B9) or (B10) . According to some embodiments of the present invention, R ₄ contains the structure represented by Formula (B11) or (B12).

[212] According to some embodiments of the present invention, R _k is one or more of Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), and TMTr (4,4',4''- trimethoxytrityl). According to some embodiments of the present invention, R _k may be DMTr, i. e. 4,4'-dimethoxytrityl.

[213] The definition of L ₁ is described above.

[214] According to some embodiments of the present invention, L ₁ is used to connect the M ₁ ligand to the N atom on the nitrogenous backbone, which provides a liver targeting function for the oligonucleotide conjugate. According to some embodiments of the present invention, L ₁ contains any of Formulas A1-A26 or a combination thereof.

[215] In accordance with the embodiments described above, those skilled in the art will readily appreciate that, compared to solid phase phosphoamidite synthesis methods well known in the art, an siRNA conjugate in which the conjugating molecule is linked to any possible position of the nucleotide sequence , can be obtained using the above first functional group and an optional second functional group. For example, the conjugating molecule is connected to the end of the nucleotide sequence or to each end of the nucleotide sequence. Accordingly, unless otherwise indicated, in the following description regarding the preparation of the conjugate, when referring to reactions such as "deprotection", "coupling", "capping", "oxidation", "sulfurization", it should be understood that these reactions will also be applicable reaction conditions and agents involved in the methods of solid phase phosphoamidite synthesis, well known in the art. Exemplary reaction conditions and agents will be described in detail below.

[216] According to some embodiments of the present invention, each S ₁ is independently M ₁ . According to some variants of implementation of the present invention, each S ₁ independently represents a group formed as a result of protection of at least one active hydroxyl in M ₁ using a protecting hydroxyl group. In some embodiments of the present invention, S ₁ is independently a group formed by protecting all active hydroxyls in M ₁ using hydroxyl protecting groups. According to some embodiments of the present invention, any hydroxyl protecting group known to those skilled in the art can be used to protect the active hydroxyl on M ₁ . According to some embodiments of the present invention, the protected hydroxyl is expressed by the Formula YCOO-, where each Y is independently selected from the group consisting of C ₁ -C ₁₀ alkyl and C ₆ -C ₁₀ ar yl, which is optionally substituted with one or more substituents selected from the group, consisting of halogen and C ₁ -C ₆ alkyl. In some embodiments of the present invention, each Y is independently selected from the group consisting of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and C ₁ -C ₆ alkylphenyl.

[217] According to some embodiments of the present invention, each S ₁ is independently selected from the group consisting of Formulas A46-A54:

[218] According to some embodiments of the present invention, S ₁ is Formula A49 or A50.

[219] According to some embodiments of the present invention, each Y is independently selected from one of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, monochloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and alkylphenyl. To simplify the conjugating molecule according to the present invention, according to some embodiments of the present invention, Y is methyl.

[220] As mentioned earlier, the method for producing the second siRNA conjugate further comprises the following step: synthesizing another siRNA strand (for example, if the siRNA sense strand connected to the conjugating molecule is synthesized in the above step, the method further comprises synthesizing the antisense siRNA strand by solid phase synthesis and vice versa); isolation of the sense strand and antisense strand; and renaturation. In particular, in the isolation step, the solid phase support attached to the nucleotide sequence and/or the conjugating molecule is cleaved off and at the same time the necessary protecting group is removed (in this case, each S ₁ group in the compound represented by Formula (321) is converted into the corresponding ligand M ₁ ), which provides the sense strand (or antisense strand) of the siRNA connected to the conjugating molecule and the corresponding antisense strand (or sense strand). The sense strand and the antisense strand are annealed to form a double-stranded RNA structure, which provides the siRNA conjugate represented by Formula (1).

[221] According to some embodiments of the present invention, a method for preparing a second siRNA conjugate includes the steps of: bringing the compound represented by Formula (321) into contact with a first nucleoside monomer at the 3' end of the sense or antisense strand under a binding reaction condition in the presence of a binding agent , which allows the compound represented by Formula (321) to bind to the first nucleotide in the sequence; sequential connection of nucleoside monomers in the direction from 3' to 5' for the synthesis of the sense or antisense miRNA strand in accordance with the required type and nucleotide sequence of the sense or antisense strand under the condition of solid-phase phosphoamidite synthesis; moreover, the compound of Formula (321) is a compound in which R ₄ contains a first functional group containing a protected hydroxy group, and a second functional group containing a group represented by Formula (C1') or (C3'), while before binding to the first nucleoside the monomer compound of Formula (321) is deprotected; and the connection of each nucleoside monomer includes a four-step reaction of deprotection, binding, capping and oxidation or sulfurization; thereby obtaining a sense or antisense nucleic acid strand coupled to a conjugating molecule; sequential connection of nucleoside monomers in the direction from 3' to 5' for the synthesis of the sense or antisense nucleic acid strand in accordance with the type and nucleotide sequence of the sense or antisense strand under the condition of solid-phase phosphoamidite synthesis; moreover, the connection of each nucleoside monomer includes a four-step reaction of deprotection, binding, capping and oxidation or sulfurization; removal of protective groups and cleavage of the solid phase support; isolating and purifying the sense strand and antisense nucleic acid strand; and renaturation.

[222] According to some embodiments of the present invention, a method for producing an siRNA conjugate includes the following steps: sequential connection of nucleoside monomers in a 3' to 5' direction to synthesize a sense strand or antisense strand in accordance with the type and nucleotide sequence of the sense or antisense strand in a double-stranded oligonucleotide ; and the connection of each nucleoside monomer includes a four-step reaction of deprotection, coupling, capping and oxidation or sulfurization, thus obtaining a sense strand connected to a solid phase support, and an antisense strand connected to a solid phase support; bringing the compound represented by Formula (321) into contact with a sense strand coupled to a solid phase support or an antisense strand coupled to a solid phase support in a coupling reaction condition in the presence of a coupling agent, resulting in binding of the compound represented by Formula (321), with sense strand or antisense strand; moreover, the compound of Formula (321) is a compound in which R ₄ contains a phosphoamidite group as the first functional group; removal of protective groups and cleavage of the solid phase support; respectively, isolation and purification of the sense or antisense miRNA strand; and renaturation; in this case, the sense or antisense strand of miRNA is connected to the conjugating molecule.

[223] According to some embodiments of the present invention, the P atom in Formula A59 is connected to the 3' end of the siRNA sense strand, and the method for preparing the siRNA conjugate of the present invention comprises:

(1) removing the hydroxyl protecting group R _k in the compound of Formula (321) (wherein the compound of Formula (321) is a compound in which R ₄ contains a first functional group and a second functional group, and the first functional group contains a protected hydroxy group OR _k and the second functional group contains the structure represented by Formula (C1') or (C3')); contacting the deprotected product with a nucleoside monomer to obtain a nucleoside monomer coupled to a solid phase support by a conjugating molecule under a coupling reaction condition in the presence of a coupling agent;

(2) starting from a nucleoside monomer coupled to a solid phase support by a conjugating molecule, synthesizing the siRNA sense strand in the 3' to 5' direction using the solid phase phosphoamidite synthesis method;

(3) synthesizing the antisense siRNA strand using the solid phase phosphoamidite synthesis method; and

(4) isolating the sense strand and antisense strand of the siRNA and renaturating them to obtain the siRNA conjugate of the present invention;

wherein in step (1), the method for removing the protecting group R _k in the compound of Formula (321) includes bringing the compound of Formula (321) into contact with a deprotecting agent under a deprotection condition. The deprotection condition includes a temperature of 0-50°C and, according to some embodiments of the present invention, 15-35°C, as well as a reaction time of 30-300 seconds and, according to some embodiments of the present invention, 50-150 seconds. The deprotectant may be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid, and in some embodiments of the present invention, the deprotectant is dichloroacetic acid. The molar ratio of the deprotectant to the compound represented by Formula (321) may be from 10:1 to 1000:1, and according to some embodiments of the present invention, from 50:1 to 500:1.

[224] The coupling reaction condition and the coupling agent may be any conditions and agents suitable for the above coupling reaction. In some embodiments of the present invention, the same conditions and agent can be used as in the coupling reaction in the solid phase synthesis process.

[225] In some embodiments of the present invention, the binding reaction condition includes a reaction temperature of 0-50°C and, in some embodiments of the present invention, 15-35°C. The molar ratio of the compound of Formula (321) to nucleoside monomer can be from 1:1 to 1:50 and, according to some embodiments of the present invention, from 1:2 to 1:5. The molar ratio of the compound of Formula (321) to the binding agent can be from 1:1 to 1:50 and, according to some embodiments of the present invention, from 1:3 to 1:10. The reaction time can be 200-3000 seconds and, according to some embodiments of the present invention, 500-1500 seconds. The binding agent can be selected from one or more of 1H-tetrazole, 5-ethylthio-1H-tetrazole, and 5-benzylthio-1H-tetrazole, and in some embodiments of the present invention is 5-ethylthio-1H-tetrazole. The coupling reaction may be carried out in an organic solvent. The organic solvent can be selected from one or more of anhydrous acetonitrile, anhydrous DMF, and anhydrous dichloromethane, and in some embodiments of the present invention is anhydrous acetonitrile. The amount of the organic solvent may be 3-50 L/mol, and according to some embodiments of the present invention, 5-20 L/mol with respect to the compound represented by Formula (321).

[226] In step (2), the S sense strand of the siRNA conjugate is synthesized in the 3' to 5' direction using the solid phase phosphoamidite synthesis method, starting from the nucleoside monomer coupled to the solid phase support by the conjugating molecule obtained in the previous step. In this case, the conjugating molecule is linked to the 3' end of the resulting sense strand.

[227] As other solid-state synthesis conditions in steps (2) and (3), including the deprotection condition of the nucleoside monomer, the type and amount of the deprotection agent, the coupling reaction condition, the type and amount of the coupling agent, the capping reaction condition, the type and the amount of capping agent, the oxidation reaction condition, the type and amount of the oxidizing agent, the sulfurization reaction condition, and the type and amount of the sulfurizing agent, various agents, amounts and conditions conventional in the art can be used.

[228] According to some embodiments of the present invention, for example, solid phase synthesis in steps (2) and (3), the following conditions can be applied:

[229] The deprotection condition for the nucleoside monomer includes a reaction temperature of 0-50°C and, in some embodiments of the present invention, 15-35°C, as well as a reaction time of 30-300 seconds and, in some embodiments of the present invention, 50 -150 seconds. The deprotecting agent can be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid, and in some embodiments of the present invention is dichloroacetic acid. The molar ratio of deprotectant to 4,4'-dimethoxytrityl protecting group on the solid phase support is 2:1 to 100:1 and, in some embodiments of the present invention, 3:1 to 50:1.

[230] The coupling reaction condition includes a reaction temperature of 0-50°C and, according to some embodiments of the present invention, 15-35°C. The molar ratio of the nucleic acid sequence attached to the solid phase support to the nucleoside monomer is from 1:1 to 1:50 and, according to some embodiments of the present invention, from 1:5 to 1:15. The molar ratio of the nucleic acid sequence attached to the solid phase support to the binding agent is from 1:1 to 1:100 and according to some embodiments of the present invention is from 1:50 to 1:80. The choice of reaction time and binding agent may be the same as above.

[231] The capping reaction condition includes a reaction temperature of 0-50°C and, in some embodiments of the present invention, 15-35°C, as well as a reaction time of 5-500 seconds and, in some embodiments of the present invention, 10-100 seconds . The choice of capping agent may be the same as above. The molar ratio of the total capping agent to the nucleic acid sequence attached to the solid phase support can be from 1:100 to 100:1, and according to some embodiments of the present invention is from 1:10 to 10:1. If an equimolar amount of acetic anhydride and N-methylimidazole is used as a capping agent, the molar ratio of acetic anhydride, N-methylimidazole and the nucleic acid sequence connected to the solid phase support can be 1:1:10-10:10:1 and according to some embodiments of the present invention is 1:1:2-2:2:1.

[232] The oxidation reaction condition includes a reaction temperature of 0-50°C and, in some embodiments of the present invention, 15-35°C, as well as a reaction time of 1-100 seconds and, in some embodiments of the present invention, 5-50 seconds . In some embodiments of the present invention, the oxidizing agent is iodine (in some embodiments of the present invention, it is provided as a solution of iodine in water). The molar ratio of oxidizing agent to nucleic acid sequence coupled to the solid phase support in the binding step can be from 1:1 to 100:1 and, according to some embodiments of the present invention, from 5:1 to 50:1. According to some embodiments of the present invention, the oxidation reaction is carried out in a mixed solvent in which the ratio of tetrahydrofuran:water:pyridine is 3:1:1-1:1:3. The sulfurization reaction condition includes a reaction temperature of 0-50°C and, according to some embodiments of the present invention, 15-35°C, as well as a reaction time of 50-2000 seconds and, according to some embodiments of the present invention, 100-1000 seconds. In some embodiments of the present invention, the sulfurizing agent is xanthan hydride. The molar ratio of the sulfurizing agent to the nucleic acid sequence coupled to the solid phase support in the binding step is from 10:1 to 1000:1 and, according to some embodiments of the present invention, from 10:1 to 500:1. According to some embodiments of the present invention, the sulfurization reaction is carried out in a mixed solvent in which the ratio of acetonitrile:pyridine is 1:3-3:1.

[233] The method further includes isolating the sense strand and the antisense strand of the siRNA after all nucleoside monomers have been combined and before renaturation. Isolation methods are well known to those skilled in the art and typically include cleavage of the synthesized nucleotide sequence from a solid phase support, deprotection of bases, phosphate groups and ligands, purification and desalting.

[234] Conventional cleavage and deprotection techniques for siRNA synthesis can be used to cleave the synthesized nucleotide sequence from a solid phase support and remove protecting groups on bases, phosphate groups, and ligands. For example, bringing the resulting nucleotide sequence, connected to the solid phase substrate, in contact with a concentrated aqueous solution of ammonia; during deprotection, the YCOO- protecting group in the A46-A54 groups is converted into a hydroxyl group, and thus the Si groups are converted into the corresponding M ₁ groups, which provides the conjugate represented by Formula (1); wherein the concentrated aqueous ammonia solution may be an aqueous ammonia solution at a concentration of 25-30% by weight. The amount of concentrated aqueous ammonia solution can be from 0.2 ml/μmol to 0.8 ml/μmol relative to the target siRNA.

[235] If the synthesized nucleotide sequence has at least several 2'-TBDMS protections, the method further comprises contacting the nucleotide sequence removed from the solid phase support with triethylamine trihydrofluoride to deprotect the 2'-TBDMS. herein, the resulting siRNA target sequence contains the corresponding nucleoside having a free 2'-hydroxyl. The amount of pure triethylamine trihydrofluoride is 0.4 ml/μmol - 1.0 ml/μmol relative to the target siRNA sequence. Thus, the siRNA conjugate represented by Formula (1) can be obtained.

[236] Purification and desalination methods are well known to those skilled in the art. For example, nucleic acid purification can be performed using a preparative ion chromatography purification column eluting with a NaBr or NaCl gradient; after collection and pooling of the product, desalting can be performed using a reverse phase purification column.

[237] The nonbridging oxygen or sulfur atom in the phosphodiester bond or phosphodiester bond between nucleotides in the resulting siRNA conjugate is substantially bound to a sodium ion, and the siRNA conjugate is essentially present in the form of a sodium salt. Well-known ion exchange methods can be used in which the sodium ion can be replaced by a hydrogen ion and/or other cations, providing other forms of siRNA conjugates. The cations are those described above.

[238] During synthesis, the purity and molecular weight of the nucleic acid sequence can be determined at any time to better control the quality of the synthesis. Such detection methods are well known to those skilled in the art. For example, the purity of the nucleic acid can be determined using ion exchange chromatography, and the molecular weight can be determined using liquid chromatography-mass spectrometry (LC-MS).

[239] Methods for renaturation are also well known to those skilled in the art. For example, a synthesized sense strand (S-strand) and an antisense strand (AS-strand) can simply be mixed in water for injection in an equimolar ratio, heated to 70-95°C, and then cooled at room temperature to form a double-stranded structure by hydrogen bond. Therefore, a second siRNA conjugate according to the present invention can be obtained.

[240] After obtaining the conjugate, according to some embodiments of the present invention, the second siRNA conjugate synthesized in this way can also be characterized by means such as determination of molecular weight using methods such as LC-MS to confirm that the synthesized siRNA conjugate is is the designed second siRNA conjugate of interest, and the synthesized siRNA sequence is the siRNA sequence to be synthesized, for example, is one of the sequences listed in Table 1 above.

[241] The compound represented by Formula (321) can be produced by the following method, including: contacting the compound represented by Formula (313) with a cyclic anhydride in an organic solvent under an esterification reaction condition in the presence of a base and an esterification catalyst; isolation of the compound represented by Formula (321) by ion exchange:

while the definitions and options n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ , S ₁ , respectively, are described above;

R ₆ is a group to provide R ₄ Formula (321). According to some embodiments of the present invention, for example, R ₆ has the structure represented by Formula (A61):

wherein,

R _i is any group capable of bonding to an N atom on the nitrogenous backbone, bonding to R _k O, and bonding to a free hydroxy group; R _k is a hydroxyl protecting group. In this case, a compound represented by Formula (321) is obtained, where R ₄ contains a first functional group as a hydroxyl protecting group and a second functional group containing a group represented by Formula (C1) or (C2).

[242] The esterification reaction condition includes a reaction temperature of 0-100° C. and a reaction time of 8-48 hours. According to some embodiments of the present invention, the esterification reaction condition includes a reaction temperature of 10-40° C. and a reaction time of 20-30 hours.

[243] According to some embodiments of the present invention, the organic solvent comprises one or more of an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments of the present invention, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments of the present invention, the ether solvent is diethyl ether and/or tert-butyl methyl ether. In some embodiments of the present invention, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments of the present invention, the organic solvent is dichloromethane. The amount of organic solvent is 3-50 l/mol and, according to some embodiments of the present invention, 5-20 l/mol, relative to the compound represented by Formula (313).

[244] In some embodiments of the present invention, the cyclic anhydride is one of succinic anhydride, glutaric anhydride, adipic anhydride, or pimelic anhydride, and in some embodiments of the present invention, the cyclic anhydride is succinic anhydride. The molar ratio of cyclic anhydride to the compound represented by Formula (313) is 1:1 to 10:1 and, according to some embodiments of the present invention, 2:1 to 5:1.

[245] The esterification catalyst can be any catalyst capable of catalyzing the esterification, such as 4-dimethylaminopyridine. The molar ratio of catalyst to compound represented by Formula (313) is 1:1 to 10:1, and according to some embodiments of the present invention, is 2:1 to 5:1.

[246] According to some embodiments of the present invention, the base may be any inorganic base, organic base, or a combination thereof. Given the solubility and stability of the product, the base is an organic base of a tertiary amine. In some embodiments of the present invention, the organic base of the tertiary amine is triethylamine or N,N-diisopropylethylamine. The molar ratio of the organic base of the tertiary amine to the compound represented by Formula (313) is 1:1 to 20:1, and according to some embodiments of the present invention, is 3:1 to 10:1.

[247] Ion exchange has the function of converting the compound represented by Formula (321) into the desired form of a carboxylic acid or a salt of a carboxylic acid, and ion exchange methods are well known to those skilled in the art. The above conjugating molecule, in which the cation is M ⁺ , can be obtained using a suitable ion exchange solution and ion exchange conditions, which are not described in detail herein. In some embodiments of the present invention, a solution of triethylamine phosphate is used in the ion exchange reaction. In some embodiments of the present invention, the concentration of the triethylamine phosphate solution is 0.2-0.8 M. In some embodiments of the present invention, the concentration of the triethylamine phosphate solution is 0.4-0.6 M. In some embodiments, the amount of triethylamine phosphate solution is is 3-6 l/mol, and in an additional embodiment, the implementation of 4-5 l/mol in relation to the compound represented by Formula (313).

[248] The compound represented by Formula (321) can be isolated from the reaction mixture using any suitable isolation methods. According to some embodiments of the present invention, the compound represented by Formula (321) may be isolated by solvent removal by evaporation followed by chromatography, for example, using the following chromatographic conditions for isolation: (1) conventional phase purification: silica gel filler with 200 -300 mesh, gradient elution 1 wt. % triethylamine in dichloromethane: methanol = 100:18-100:20; or (2) reversed phase purification: C18 and C8 reversed phase vehicles, gradient elution methanol:acetonitrile=0.1:1-1:0.1. In some embodiments of the present invention, the solvent may be directly removed to provide a crude product of the compound represented by Formula (321) which may be directly used in subsequent reactions.

[249] According to some embodiments of the present invention, a method for producing a compound represented by Formula (321) further comprises: bringing the product obtained from the above ion exchange reaction into contact with a solid phase support with amino or hydroxy groups in an organic solvent under a condensation reaction condition in the presence of a condensing agent and an organic base of a tertiary amine. In this case, a compound represented by Formula (321) is obtained, where R ₄ contains a first functional group containing a hydroxyl protecting group and a second functional group having the structure represented by Formula (C1').

[250] The solid phase support is one of the supports used in solid phase siRNA synthesis, some of which are well known to those skilled in the art. For example, the solid phase support may be selected from solid phase supports containing an active hydroxy or amino functionality. In some embodiments of the present invention, the solid phase support is an amino or hydroxy resin. To facilitate subsequent solid phase nucleic acid synthesis, the amino or hydroxy resin, according to some embodiments of the present invention, has the following parameters: a particle size of 100-400 mesh and a surface content of amino groups or hydroxy groups of 0.2-0.5 mmol/g. The ratio of the compound represented by Formula (321) to the solid support is 10 µmol of compound per gram of solid support (µmol/g) to 400 µmol/g. According to some embodiments of the present invention, the ratio of the compound of Formula (321) to solid phase support is from 50 µmol/g to 200 µmol/g.

[251] The organic solvent can be any suitable solvent or mixed solvents known to those skilled in the art. According to some embodiments of the present invention, the organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments of the present invention, the epoxy solvent is dioxane and/or tetrahydrofuran; the ether solvent is diethyl ether and/or tert-butyl methyl ether; the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1,2-dichloroethane. In some embodiments of the present invention, the organic solvent is acetonitrile. The amount of organic solvent is 20-200 l/mol, according to some variants of implementation of the present invention 50-100 l/mol in relation to the compound represented by Formula (321).

[252] The condensing agent may be benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate, 3-diethoxyphosphoryl-1,2,3-benzotrizin-4(3H)-one, and/or O-benzotriazoletetramethyluronium hexafluorophosphate. In some embodiments of the present invention, the condensing agent is O-benzotriazoletetramethyluronium hexafluorophosphate. The molar ratio of the condensing agent to the compound represented by Formula (321) is from 1:1 to 20:1 and, according to some embodiments of the present invention, from 1:1 to 5:1.

[253] According to some embodiments of the present invention, the organic base of the tertiary amine is triethylamine and/or N,N-diisopropylethylamine and, according to some embodiments of the present invention, N,N-diisopropylethylamine. The molar ratio of the organic base of the tertiary amine to the compound represented by Formula (321) is from 1:1 to 20:1 and, according to some embodiments of the present invention, from 1:1 to 5:1.

[254] According to some embodiments of the present invention, a method for producing a compound represented by Formula (321) further comprises: contacting the resultant condensation product with a capping agent and an acylation catalyst in an organic solvent under a capping reaction condition, and isolating the compound represented by Formula (321) . The capping reaction is used to remove any active functional group that does not fully react to avoid the formation of unnecessary by-products in subsequent reactions. The capping reaction condition includes a reaction temperature of 0-50°C and, in some embodiments of the present invention, 15-35°C, as well as a reaction time of 1-10 hours and, in some embodiments of the present invention, 3-6 hours, a capping agent may be a capping agent used in solid phase siRNA synthesis, which is well known to those skilled in the art.

[255] According to some embodiments of the present invention, the capping agent consists of a capping agent A (capA) and a capping agent B (carB). CapA is N-methylimidazole and according to some embodiments of the present invention is provided as a mixed solution of N-methylimidazole in pyridine/acetonitrile, wherein the volume ratio of pyridine to acetonitrile is from 1:10 to 1:1 and, according to some embodiments of the present invention, from 1:3 to 1:1. According to some embodiments of the present invention, the ratio of the total volume of pyridine and acetonitrile to the volume of N-methylimidazole is from 1:1 to 10:1 and, according to some embodiments of the present invention, from 3:1 to 7:1. Capping reagent B is acetic anhydride. In some embodiments of the present invention, the sarB is provided as a solution of acetic anhydride in acetonitrile, wherein the volume ratio of acetic anhydride to acetonitrile is from 1:1 to 1:10 and, in some embodiments of the present invention, from 1:2 to 1:6.

[256] According to some embodiments of the present invention, the ratio of the volume of the mixed solution of N-methylimidazole in pyridine/acetonitrile to the mass of the compound of Formula (321) is 5 ml/g-50 ml/g, and, according to some embodiments of the present invention, 15 ml/g -30 ml/g. The ratio of the volume of the solution of acetic anhydride in acetonitrile to the mass of the compound of Formula (321) is 0.5 ml/g-10 ml/g and, according to some embodiments of the present invention, 1 ml/g-5 ml/g.

[257] According to some embodiments of the present invention, the capping agent contains an equimolar amount of acetic anhydride and N-methylimidazole. The organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments of the present invention, the organic solvent is acetonitrile. The amount of organic solvent is 10-50 l/mol and, according to some embodiments of the present invention, 5-30 l/mol, relative to the compound represented by Formula (321).

[258] The acylation catalyst can be selected from any catalyst that can be used for condensation by esterification or amide condensation, such as alkaline heterocyclic compounds. In some embodiments of the present invention, the acylation catalyst is 4-dimethylaminopyridine. The weight ratio of catalyst to compound represented by Formula (321) may be from 0.001:1 to 1:1 and, according to some embodiments of the present invention, from 0.01:1 to 0.1:1.

[259] The compound represented by Formula (321) can be isolated from the reaction mixture by any suitable means. According to some embodiments of the present invention, the compound of Formula (321) can be obtained by thorough washing with an organic solvent and filtration to remove unreacted reagents, excess capping agent and other impurities, while the organic solvent is selected from acetonitrile, dichloromethane or methanol. In some embodiments of the present invention, the organic solvent is acetonitrile.

[260] According to some embodiments of the present invention, obtaining a conjugating molecule represented by Formula (321) comprises contacting a compound represented by Formula (313) with a phosphodiamidite in an organic solvent under a coupling reaction condition in the presence of a coupling agent, and isolating the compound represented by Formula (313) Formula (321). In this case, a compound represented by Formula (321) is obtained in which R ₄ contains a first functional group containing a hydroxyl protecting group and a second functional group containing a structure represented by Formula (C3).

[261] According to some embodiments of the present invention, the binding reaction condition includes a reaction temperature of 0-50°C, for example, 15-35°C. The molar ratio of the compound of Formula (313) to phosphodiamidite may be from 1:1 to 1:50, for example, from 1:5 to 1:15. The molar ratio of the compound of Formula (313) to the binding agent may be from 1:1 to 1:100, for example, from 1:50 to 1:80. The reaction time may be 200-3000 seconds, for example 500-1500 seconds. The phosphodiamidite may be, for example, bis(diisopropylamino)(2-cyanoethoxy)phosphine, which may be commercially available or synthesized according to methods well known in the art. The binding agent is selected from one or more of 1H-tetrazole, 5-ethylthio-1H-tetrazole and 5-benzylthio-1H-tetrazole, for example 5-ethylthio-1H-tetrazole. The coupling reaction can be carried out in an organic solvent. According to some embodiments of the present invention, the organic solvent is selected from one or more of anhydrous acetonitrile, anhydrous DMF and anhydrous dichloromethane, for example, is anhydrous acetonitrile. The amount of the organic solvent may be 3-50 L/mol, for example, 5-20 L/mol, based on the compound represented by Formula (313). When the coupling reaction is performed, the hydroxy group in compound (313) reacts with phosphodiamidite to form a phosphoamidite group. In some embodiments of the present invention, the solvent may be directly removed to provide a crude product of the compound represented by Formula (321) which may be directly used in subsequent reactions.

[262] According to some embodiments of the present invention, a method for producing a compound represented by Formula (321) further comprises: bringing the isolated product into contact with a solid phase support with hydroxyl groups in an organic solvent under a coupling reaction condition in the presence of a coupling agent, followed by capping, oxidation, and isolation to obtain a compound represented by Formula (321), where R ₄ represents a first functional group containing a protecting hydroxyl group and a second functional group having a structure represented by Formula (C3').

[263] According to some embodiments of the present invention, the solid phase support is a support well known in the art of solid phase nucleic acid synthesis, such as a commercially available general purpose deprotected solid phase support, e.g., ^NittoPhase® HL UnyLinker™ 300 oligonucleotide synthesis support, Kinovate Life Sciences represented by Formula B80:

[264] The deprotection reaction is well known in the art. According to some embodiments of the present invention, the deprotection condition includes a temperature of 0-50°C, such as 15-35°C, and a reaction time of 30-300 seconds, such as 50-150 seconds. The deprotecting agent may be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid. In some embodiments of the present invention, the deprotecting agent is dichloroacetic acid. The molar ratio of deprotectant to protecting group-DMTr (4,4'-dimethoxytrityl) on the solid phase support may be from 2:1 to 100:1, for example from 3:1 to 50:1. By this deprotection, reactive free hydroxyl groups are generated on the surface of the solid phase support to facilitate the subsequent coupling reaction.

[265] The coupling reaction condition and coupling agent may be selected as above. In this coupling reaction, the free hydroxy groups formed in the deprotection reaction react with phosphoamidite groups to form an ester phosphite bond.

[266] According to some embodiments of the present invention, the capping reaction condition includes a temperature of 0-50°C, such as 15-35°C, and a reaction time of 5-500 seconds, such as 10-100 seconds. The capping reaction is carried out in the presence of a capping agent. The choice and amount of capping agent is described above.

[267] The oxidation reaction condition may include a temperature of 0-50°C, such as 15-35°C, and a reaction time of 1-100 seconds, such as 5-50 seconds. The oxidizing agent may be, for example, iodine (provided in some embodiments of the present invention as a solution of iodine in water). According to some embodiments of the present invention, the molar ratio of oxidizing agent to ester phosphite group is from 1:1 to 100:1, preferably from 5:1 to 50:1. According to some embodiments of the present invention, the oxidation reaction is carried out in a mixed solvent in which the ratio of tetrahydrofuran:water:pyridine is 3:1:1-1:1:3.

[268] According to some embodiments of the present invention, R ₆ is a group represented by Formula B7 or B8:

in which q ₂ is defined above.

[269] In this case, the compound represented by Formula (313) can be obtained by the following production method, including: bringing the compound represented by Formula (314) into contact with the compound represented by Formula (A-1) or (A- 2), in an organic solvent under the condition of an amidation reaction in the presence of an amide condensation agent and an organic base of a tertiary amine, and isolation of:

while the definitions and variants of n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ , S ₁ , q ₂ and R _k , respectively, are described above.

[270] The amidation reaction condition may include a reaction temperature of 0-100° C. and a reaction time of 1-48 hours. In some embodiments of the present invention, the amidation reaction condition comprises a reaction temperature of 10-40° C. and a reaction time of 2-16 hours.

[271] According to some embodiments of the present invention, the organic solvent is one or more of an alcohol solvent, an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. According to some embodiments of the present invention, the alcoholic solvent is one or more of methanol, ethanol, and propanol, and, in additional embodiments, is ethanol. In some embodiments of the present invention, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments of the present invention, the ether solvent is diethyl ether and/or tert-butyl methyl ether. In some embodiments of the present invention, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments of the present invention, the organic solvent is dichloromethane. The amount of organic solvent is 3-50 l/mol and, according to some embodiments of the present invention, 3-20 l/mol relative to the compound represented by Formula (314).

[272] According to some embodiments of the present invention, the amide condensation agent is benzotriazol-1-yl-hydroxytripyrrolidinophosphonium hexafluorophosphate, 3-diethoxyphosphoryloxy-1,2,3-benzotrizin-4(3H)-one, 4-(4,6 -dimethoxytriazin-2)-yl)-4-methylmorpholine, 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (EEDQ) or O-benzotriazoletetramethyluronium hexafluorophosphate and in other embodiments is 3-diethoxyphosphoryloxy-1,2,3- benzotrizin-4(3H)-one. The molar ratio of the amide condensing agent to the compound represented by Formula (314) may be from 1:1 to 10:1 and, according to some embodiments of the present invention, from 2.5:1 to 5:1.

[273] In some embodiments of the present invention, the organic base of the tertiary amine is triethylamine or N,N-diisopropylethylamine, and in some embodiments of the present invention is N,N-diisopropylethylamine. The molar ratio of the tertiary amine to the compound represented by Formula (314) may be from 3:1 to 20:1 and, according to some embodiments of the present invention, from 5:1 to 10:1.

[274] the Compounds of Formula (A-1) and (A-2) can be obtained using any suitable methods. For example, if R _k is a DMTr group, the compound of Formula (A-1) can be obtained by reacting calcium glycerate with DMTrCl. Similarly, a compound of Formula (A-2) can be prepared by contacting 3-amino-1,2-propanediol with a cyclic anhydride and then reacting with DMTrCl, where the cyclic anhydride can contain 4-13 carbon atoms and, in some embodiments, implementation, 4-8 carbon atoms. Those skilled in the art will readily appreciate that sets of different cyclic anhydrides correspond to different q ₂ values in the compound of Formula (A-2). For example, if the cyclic anhydride is succinic anhydride, q ₂ =1; if the cyclic anhydride is glutaric anhydride, q ₂ =2 and so on.

[275] According to some embodiments of the present invention, the compound of Formula (313) can also be obtained by sequentially reacting the compound represented by Formula (314) with cyclic anhydride, 3-amino-1,2-propanediol and DMTrCl. Those skilled in the art will readily appreciate that these variations will not affect the structure and function of the compound of Formula (313), and these variations can be easily carried out by those skilled in the art based on the above methods.

[276] Similarly, the compound represented by Formula (313) can be isolated from the reaction mixture using any suitable isolation methods. According to some embodiments of the present invention, the compound represented by Formula (313) can be isolated by solvent removal by evaporation followed by chromatography, for example, using the following two sets of chromatographic conditions for isolation: (1) conventional phase purification: silica gel filler with 200-300 mesh, gradient elution petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide=1:1:1:0.5-1:1:1:0.6; and (2) reversed phase purification: C18 and C8 reversed phase vehicles, gradient elution methanol:acetonitrile=0.1:1-1:0.1. In some embodiments of the present invention, the solvent may be directly removed to provide a crude product of the compound represented by Formula (313) which may be directly used in subsequent reactions.

[277] According to some embodiments of the present invention, the compound represented by Formula (314) can be obtained using the following preparation method, including bringing the compound represented by Formula (315) into contact with haloacetic acid in an organic solvent under a deprotection reaction condition, and then selection:

in which R ₇ is selected from the groups represented by Formula (330), (331), (332) and (333), and according to some embodiments of the present invention, R ₇ has the structure represented by Formula (330):

the definitions and variants of n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ and S ₁ , respectively, are described above.

[278] The haloacetic acid can be selected from one or more of dichloroacetic acid, trichloroacetic acid, monochloroacetic acid, and trifluoroacetic acid, and, according to some embodiments of the present invention, is dichloroacetic acid.

[279] The deprotection reaction condition may include a reaction temperature of 0-100°C and a reaction time of 0.1-24 hours and, according to some embodiments of the present invention, a reaction temperature of 10-40°C and a reaction time of 0.5-16 hours .

[280] According to some embodiments of the present invention, the organic solvent is one or more of an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments of the present invention, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments of the present invention, the ether solvent is diethyl ether and/or tert-butyl methyl ether. In some embodiments of the present invention, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments of the present invention, the organic solvent is dichloromethane. The amount of organic solvent is 3-50 l/mol and, according to some embodiments of the present invention, 5-20 l/mol, relative to the compound represented by Formula (315).

[281] The molar ratio of haloacetic acid to the compound represented by Formula (315) is from 5:1 to 100:1 and, according to some embodiments of the present invention, from 10:1 to 50:1.

[282] Similarly, the compound represented by Formula (314) can be isolated from the reaction mixture using any suitable isolation methods. According to some embodiments of the present invention, the compound represented by Formula (314) can be isolated by solvent removal by evaporation followed by chromatography, for example, using the following two sets of chromatographic conditions for isolation, (1) conventional phase purification: silica gel filler with 200-300 mesh, gradient elution dichloromethane:methanol=100:30-100:40; and (2) reversed phase purification: C18 and C8 reversed phase vehicles, gradient elution methanol:acetonitrile=0.1:1-1:0.1. In some embodiments of the present invention, the solvent may be directly removed to provide a crude product of the compound represented by Formula (314) which may be directly used in subsequent reactions.

[283] The compound represented by Formula (315) can be produced by the following method, including bringing the compound represented by Formula (317) into contact with the compound represented by Formula (316) in an organic solvent under a condensation reaction condition in the presence of an agent for amide condensation and organic base of tertiary amine, as well as isolation:

while the definitions and variants of n1, n3, m1, m2, m3, R ₇ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ , R ₁₅ , L ₁ and S ₁ , respectively, are described above.

[284] The compound of Formula (316) may be that described in J. Am. Chem. soc. 2014, 136, 16958-16961. In another embodiment, compounds of Formula (316) can be prepared by those skilled in the art using a variety of methods. For example, some compounds of Formula (316) can be obtained in accordance with the methods described in example 1 of US patent 8106022 B2, which is fully incorporated into this application by reference.

[285] According to some embodiments of the present invention, the condensation reaction condition includes a reaction temperature of 0-100° C. and a reaction time of 0.1-24 hours. According to some embodiments of the present invention, the condensation reaction condition includes a reaction temperature of 10-40° C. and a reaction time of 0.5-16 hours.

[286] The molar ratio of the compound represented by Formula (316) to the compound represented by Formula (317) may be from 2:1 to 10:1 and, according to some embodiments of the present invention, from 2.5:1 to 5: one.

[287] According to some embodiments of the present invention, the organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments of the present invention, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments of the present invention, the ether solvent is diethyl ether and/or tert-butyl methyl ether. In some embodiments of the present invention, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments of the present invention, the organic solvent is acetonitrile. The amount of organic solvent may be 3-50 l/mol and, according to some embodiments of the present invention, 5-20 l/mol, relative to the compound represented by Formula (317).

[288] The amide condensation agent is benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate, 3-diethoxyphosphoryloxy-1,2,3-benzotrizin-4(3H)-one (DEPBT), O-benzotriazoletetramethyluronium hexafluorophosphate, or 4-(4 ,6-dimethoxytriazin-2-yl)-4-methylmorpholine and according to some embodiments of the present invention is 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride. The molar ratio of the amide condensing agent to the compound represented by Formula (317) is 2:1 to 10:1, and according to some embodiments of the present invention, is 2.5:1 to 5:1.

[289] The organic base of the tertiary amine is N-methylmorpholine, triethylamine, or N,N-diisopropylethylamine and, according to some embodiments of the present invention, N-methylmorpholine. The molar ratio of the tertiary amine to the compound represented by Formula (317) may be from 3:1 to 20:1 and, according to some embodiments of the present invention, from 5:1 to 10:1.

[290] Similarly, the compound represented by Formula (315) can be isolated from the reaction mixture using any suitable isolation methods. According to some embodiments of the present invention, the compound represented by Formula (315) is isolated by removing the solvent by evaporation followed by chromatography, for example, using the following two sets of chromatographic conditions for isolation, 300 mesh, gradient elution dichloromethane:methanol=100:5-100:7; (2) reversed phase purification: C18 and C8 reversed phase vehicles, gradient elution methanol:acetonitrile=0.1:1-1:0.1. In some embodiments of the present invention, the solvent is directly removed to provide a crude product of the compound represented by Formula (315) which can be used directly in subsequent reactions.

[291] According to some embodiments of the present invention, the compound of Formula (317) is reacted with a sufficient amount of one compound of Formula (316) in one batch to obtain the target compound of Formula (315), with all S ₁ -L ₁ groups being identical. In some embodiments of the present invention, a compound of Formula (317) is reacted with various compounds of Formula (316) in random batches, i. with compounds of Formula (316) having different L ₁ and/or S ₁ to obtain a compound of Formula (315) with two or more types of S ₁ and/or L ₁ in it. For example, 1 eq. compounds of Formula (317) may first be brought into contact with 2 equiv. the first compound of Formula (316) to attach the first groups S ₁ -L ₁ to the two terminal primary amino groups in the compound of Formula (317), and then brought into contact with (n3+n1-1) eq. the second compound of Formula (316) to attach the second groups S ₁ -L ₁ to (n3+n1-1) secondary amino groups in the compound of Formula (317), the definitions and ranges of n3 and n1 being described above.

[292] According to some embodiments of the present invention, the compound represented by Formula (317) can be obtained using the following method, including bringing the compound represented by Formula (318) into contact with an aqueous solution of methylamine under the condition of a deprotection reaction in the presence of an organic solvent , as well as selection:

the definitions and variants of n1, n3, m1, m2, m3, R ₇ , R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ , respectively, are described above.

[293] The deprotection reaction condition includes a reaction temperature of 0-150°C and a reaction time of 5-72 hours and, according to some embodiments of the present invention, a reaction temperature of 20-80°C and a reaction time of 10-30 hours.

[294] The organic solvent is selected from alcohols, in some embodiments of the present invention, it is one of methanol, ethanol and isopropanol, and in some embodiments of the present invention is methanol. The amount of organic solvent may be 1-20 L/mol, and according to some variants of implementation of the present invention is 1.5-10 L/mol relative to the compound represented by Formula (318).

[295] The concentration of an aqueous solution of methylamine can be 30%-40% by weight, and the molar ratio of methylamine to the compound represented by Formula (318) can be from 10:1 to 500:1 and, according to some embodiments of the present invention, from 50:1 to 200:1.

[296] Similarly, the compound represented by Formula (317) can be isolated from the reaction mixture using any suitable isolation techniques. According to some embodiments of the present invention, the compound represented by Formula (317) can be isolated by removing the solvent by evaporation followed by chromatography, for example, using the following two sets of chromatographic conditions for isolation, (1) conventional phase purification: silica gel filler with 200-300 mesh, gradient elution dichloromethane:methanol:ammonia aqueous solution (25wt%)=1:1:0.05-1:1:0.25; and (2) reversed phase purification: C18 and C8 reversed phase vehicles, gradient elution methanol:acetonitrile=0.1:1-1:0.1. In some embodiments of the present invention, the solvent may be directly removed to provide a crude product of the compound represented by Formula (317) which may be directly used in subsequent reactions.

[297] The compound represented by Formula (318) can be prepared by the following method, comprising contacting the compound represented by Formula (319) with triphenylchloromethane (TrCl), diphenylethylphenylchloromethane, phenyldiethylphenylchloromethane, or triethylphenylchloromethane (according to some embodiments of the present invention with triphenylchloromethane (TrCl)) under the condition of a substitution reaction in the presence of an organic solvent, as well as the isolation of:

the definitions and variants of n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ , respectively, are described above.

[298] The displacement reaction condition may include a reaction temperature of 0-100°C and a reaction time of 5-72 hours and, according to some embodiments of the present invention, a reaction temperature of 10-40°C and a reaction time of 10-30 hours.

[299] Triphenylchloromethane (TrCl), diphenylethylphenylchloromethane, phenyldiethylphenylchloromethane or triethylphenylchloromethane are commercially available. The molar ratio of triphenylchloromethane (TrCl), diphenylethylphenylchloromethane, phenyldiethylphenylchloromethane or triethylphenylchloromethane to the compound represented by Formula (319) may be from 1:1 to 10:1 and, according to some embodiments of the present invention, from 1:1 to 3:1.

[300] The organic solvent may be one or more of an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments of the present invention, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments of the present invention, the ether solvent is diethyl ether and/or tert-butyl methyl ether. In some embodiments of the present invention, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments of the present invention, the organic solvent is dichloromethane. The amount of organic solvent may be 3-50 l/mol and, according to some variants of implementation of the present invention, 5-20 l/mol relative to the compound represented by Formula (319).

[301] Similarly, the compound represented by Formula (318) can be isolated from the reaction mixture using any suitable isolation methods. According to some embodiments of the present invention, the compound represented by Formula (318) can be isolated by solvent removal by evaporation followed by chromatography, for example, using the following two sets of chromatographic conditions for isolation, (1) conventional phase purification: silica gel filler with 200-300 mesh, gradient elution methanol:dichloromethane=0.01:1-0.5:1 or gradient elution methanol:dichloromethane:ethyl acetate:petroleum ether=0.1:1:1:1-1:1:1 :one; and (2) reversed phase purification: C18 and C8 reversed phase vehicles, gradient elution methanol:acetonitrile=0.1:1-1:0.1. In some embodiments of the present invention, the solvent may be directly removed to provide a crude product of the compound represented by Formula (318) which may be directly used in subsequent reactions.

[302] According to some embodiments of the present invention, the compound represented by Formula (319) can be obtained using the following method, including bringing the compound represented by Formula (320) into contact with ethyl trifluoroacetate in an organic solvent under a substitution reaction condition, as well as isolating :

the definitions and variants of n1, n3, m1, m2, m3, R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ , respectively, are described above.

[303] According to some embodiments of the present invention, the organic solvent is one or more of acetonitrile, an epoxy solvent, an ether solvent, a haloalkane solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments of the present invention, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments of the present invention, the ether solvent is diethyl ether and/or tert-butyl methyl ether. In some embodiments of the present invention, the haloalkane solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments of the present invention, the organic solvent is acetonitrile. The amount of organic solvent is 1-50 l/mol and, according to some embodiments of the present invention, 1-20 l/mol relative to the compound represented by Formula (320).

[304] The displacement reaction condition may include a reaction temperature of 0-100°C and a reaction time of 5-72 hours and, according to some embodiments of the present invention, a reaction temperature of 10-40°C and a reaction time of 10-30 hours.

[305] The compound represented by Formula (320) may be commercially available or obtained by those skilled in the art using known methods. For example, in the case where m1=m2=m3=3, n1=1, n3=2 and R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ are all H, the compound represented by Formula (320) , available commercially from Alfa Aesar Inc.

[306] The molar ratio of ethyl trifluoroacetate to the compound represented by Formula (320) may be from 2:1 to 10:1 and, according to some embodiments of the present invention, from 3:1 to 5:1.

[307] Similarly, the compound represented by Formula (319) can be isolated from the reaction mixture using any suitable isolation methods. According to some embodiments of the present invention, the compound represented by Formula (319) can be isolated by solvent removal by evaporation followed by chromatography, for example, using the following two sets of chromatographic conditions for isolation: (1) conventional phase purification: silica gel filler with 200-300 mesh, gradient elution methanol:dichloromethane=0.01:1-0.5:1 or gradient elution methanol:dichloromethane:ethyl acetate:petroleum ether=0.1:1:1:1-1:1:1 :one; and (2) reversed phase purification: C18 and C8 reversed phase vehicles, gradient elution methanol:acetonitrile=0.1:1-1:0.1. In some embodiments of the present invention, the solvent may be directly removed to provide a crude product of the compound represented by Formula (319) which may be directly used in subsequent reactions.

[308] The first or second siRNA conjugates of the present invention may also be used in combination with other pharmaceutically acceptable excipients, which may be one or more of various formulations or compounds conventional in the art. Detailed information is provided in the above description of the pharmaceutical compositions according to the present invention.

Use of modified siRNA, pharmaceutical composition, first siRNA conjugate and second siRNA conjugate according to the present invention

[309] According to some embodiments of the present invention, the use of an siRNA, a pharmaceutical composition, a first siRNA conjugate and/or a second siRNA conjugate according to the present invention is provided in the manufacture of a medicament for the treatment and/or prevention of pathological conditions or diseases caused by hepatitis B virus (HBV) infection. ).

[310] In accordance with some embodiments of the present invention, there is provided a method for treating pathological conditions or diseases caused by hepatitis B virus (HBV) infection, comprising administering to a patient an effective amount of siRNA, a pharmaceutical composition, a first siRNA conjugate and / or a second siRNA conjugate according to the present invention .

[311] In accordance with other embodiments of the present invention, there is provided a method for inhibiting HBV gene expression in hepatitis-affected cells chronically infected with HBV, comprising bringing an siRNA, a pharmaceutical composition, a first siRNA conjugate, and/or a second siRNA conjugate of the present invention into contact with hepatitis-affected cells. cells chronically infected with HBV.

[312] The pathological condition or disease caused by hepatitis B virus (HBV) infection is selected from chronic liver diseases, inflammation, fibrotic diseases, and proliferative diseases.

[313] The goal of treating hepatitis B can be achieved based on the RNA interference (RNAi) mechanism by administering to a patient in need thereof an siRNA and/or a pharmaceutical composition, a first siRNA conjugate and/or a second siRNA conjugate according to the present invention. Thus, the siRNA and/or pharmaceutical composition and siRNA conjugates of the present invention can be used to prevent and/or treat hepatitis B or to produce a medicament for the prevention and/or treatment of hepatitis B.

[314] As used herein, the term “administer/administer” refers to the delivery of a modified siRNA, a pharmaceutical composition, a first siRNA conjugate, and/or a second siRNA conjugate of the present invention to a subject via a method or route that at least partially localizes the modified siRNA , a pharmaceutical composition, the first siRNA conjugate and/or the second siRNA conjugate according to the present invention at the target site to obtain the target effect. Suitable routes of administration for the methods of the present invention include topical administration and systemic administration. Typically, topical administration results in the delivery of more of the modified siRNA, pharmaceutical composition, first siRNA conjugate, and/or second siRNA conjugate to a specific site compared to the entire body of the subject; while systemic administration results in the delivery of the modified siRNA, the pharmaceutical composition, the first siRNA conjugate and/or the second siRNA conjugate substantially throughout the subject's body. Whereas the present invention is intended to provide agents for the prevention and/or treatment of dyslipidemia, according to some embodiments of the present invention, a route of administration capable of delivering drugs to the liver is used.

[315] Administration to a subject may be by any suitable route known in the art, including, but not limited to, oral or parenteral routes such as intravenous, intramuscular, subcutaneous, transdermal, intratracheal (aerosol) , pulmonary administration, nasal administration, rectal administration, and topical administration (including buccal administration and sublingual administration). The frequency of administration may be one or more times a day, weekly, once every two weeks, once every three weeks, monthly or annually.

[316] The dose of siRNA, pharmaceutical composition, first siRNA conjugate and/or second siRNA conjugate according to the present invention may be a conventional dose in the art, which may be determined in accordance with various parameters, in particular, the age, weight and sex of the subject . Toxicity and efficacy can be measured in cell cultures or in experimental animals using standard pharmaceutical procedures, for example, by determining the LD ₅₀ (lethal dose that causes death of 50% of the population) and ED ₅₀ (the dose that can cause 50% of the maximum intensity of the response with a quantitative response and which results in 50% of experimental subjects having a positive response with a qualitative response). Dose ranges for humans can be derived from data obtained from cell culture assays and animal studies.

[317] When a pharmaceutical composition or siRNA conjugate of the present invention is administered, for example, to male or female C57BL/6J or C3H/HeNCrIVr mice aged 6-12 weeks and weighing 18-25 g, and when calculated based on the amount of siRNA in pharmaceutical composition or siRNA conjugate: (i) for the first siRNA conjugate and/or the second siRNA conjugate, the dosage of its siRNA may be 0.001-100 mg/kg body weight and, according to other embodiments of the present invention, 0.01-50 mg/kg body weight body, and in other additional embodiments is 0.05-20 mg/kg of body weight, and in other additional embodiments is 0.1-10 mg/kg of body weight; (ii) for a pharmaceutical composition formed by siRNA and a pharmaceutically acceptable carrier, the dosage of its siRNA may be 0.001-50 mg/kg body weight and according to other embodiments of the present invention is 0.01-10 mg/kg body weight, and in other additional embodiments is 0.05-5 mg/kg of body weight, and in other additional embodiments is 0.1-3 mg/kg of body weight.

[318] In addition, when siRNA and/or the pharmaceutical composition and/or siRNA conjugates of the present invention are administered to hepatitis cells chronically infected with HBV, the goal of inhibiting HBV gene expression in hepatitis cells chronically infected with HBV is also can be achieved using the mechanism of RNA interference. In some preferred embodiments of the present invention, the cells are HepG2.2.15 cells.

[319] In the event that the expression of HBV genes in cells is inhibited using the method of the present invention, the amount of siRNA in the provided siRNA, the pharmaceutical composition, the first siRNA conjugate and/or the second siRNA conjugate is generally an amount sufficient to reduce the expression target gene and obtain an extracellular concentration of 1 pM to 1 μM, or 0.01 nM to 100 nM, or 0.05 nM to 50 nM, or 0.05 nM to about 5 nM, on the surface of the target cells. The amount required to achieve this local concentration will vary depending on various factors, including the method of delivery, the site of delivery, the number of cell layers between the site of delivery and target cells or tissues, the route of delivery (local or systemic), etc. The concentration at the site of delivery may be significantly higher than the concentration on the surface of the target cells or tissues.

Kit

[320] The present invention provides a kit comprising an effective amount of at least one of a modified siRNA, a pharmaceutical composition, a first siRNA conjugate, and/or a second siRNA conjugate.

[321] In some embodiments, the kits disclosed herein provide the modified siRNA in a single container. According to some variants of implementation of the present invention, the kit according to the present invention contains a container containing pharmaceutically acceptable excipients. According to some variants of implementation of the present invention, the kits according to the present invention additionally contain additional ingredients, such as stabilizers or preservatives. In some embodiments of the present invention, the kit contains at least one additional therapeutic agent in a container other than the container containing the modified siRNA of the present invention. In some embodiments of the present invention, the kit contains instructions for mixing the modified siRNA with pharmaceutically acceptable carriers and/or adjuvants or other ingredients (if any).

[322] In the kits of the present invention, the modified siRNA and pharmaceutically acceptable carriers and/or adjuvants, as well as the modified siRNA, the pharmaceutical composition, the first siRNA conjugate and/or the second siRNA conjugate and/or the conjugate and/or the pharmaceutically acceptable adjuvants can be provided in any form, such as liquid form, dry form or lyophilized form. In some embodiments of the present invention, the modified siRNA and pharmaceutically acceptable carriers and/or adjuvants, as well as the pharmaceutical composition and/or conjugate and optional pharmaceutically acceptable adjuvants, are substantially pure and/or sterile. In some embodiments of the present invention, sterile water may be provided in the kits of the present invention. Preferred Effects

[323] In some embodiments of the present siRNA invention, an siRNA composition or siRNA conjugate of the present invention may have higher stability, lower toxicity, and/or higher in vivo activity. According to some embodiments of the present invention, the siRNA, siRNA composition, or siRNA conjugate of the present invention exhibits a percentage inhibition of HBV gene expression of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%. % under in vivo conditions. According to some embodiments of the present invention, the siRNA, siRNA composition or siRNA conjugate of the present invention exhibits a percentage inhibition of HBV gene expression in the liver of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% under in vivo conditions. According to some embodiments of the present invention, the siRNA, siRNA composition or siRNA conjugate of the present invention exhibits a percentage inhibition of HBV gene expression in the liver of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% in in vivo animal models. In some embodiments of the present invention, the siRNA, siRNA composition, or siRNA conjugate of the present invention exhibits a percentage inhibition of HBV surface antigen expression of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% in vivo. In some embodiments of the present invention, the double stranded oligonucleotide, composition or oligonucleotide conjugate of the present invention does not exhibit a significant off-target effect. An off-target effect may be, for example, inhibition of the normal expression of a gene that is not the target gene. It is considered that if the binding/inhibition of expression of the off-target gene is 50%, 40%, 30%, 20% or 10% lower than the activity of the target, then the off-target effect is not significant.

[324] According to some embodiments of the present invention, the siRNA conjugates of the present invention have lower toxicity at the animal level.

[325] According to some embodiments of the present invention, the siRNA conjugates of the present invention can remain intact for up to 72 hours in human plasma, exhibiting excellent stability in human plasma.

[326] According to some embodiments of the present invention, siRNA conjugates of the present invention can remain intact for up to 72 hours in cynomolgus monkey plasma, exhibiting excellent stability in monkey plasma.

[327] According to some embodiments of the present invention, the siRNA conjugates of the present invention can remain intact for at least 24 hours in a lysosome lysate obtained from human and rat, showing satisfactory stability.

[328] According to some embodiments of the present invention, the siRNA conjugates of the present invention can be specifically and significantly enriched in the liver and remain stable, exhibiting a high degree of targeting.

[329] According to some embodiments of the present invention, in several experiments with different time points tested, the siRNA conjugates of the present invention exhibit potent inhibitory activity on HBV mRNA expression in mice in vivo.

[330] According to some embodiments of the present invention, the siRNA conjugates of the present invention exhibit long-lasting and potent inhibitory efficacy against serum HBsAg in various animal models, exhibiting a common dose-dependence.

[331] According to some embodiments of the present invention, the siRNA conjugates of the present invention not only have higher in intro activity, but also exhibit low off-target effects.

[332] The present invention will be further described below using production examples and experimental examples, but is not limited to them in any respect.

Examples

[333] Hereinafter, the present invention will be described in detail with reference to examples. Unless otherwise noted, the agents and culture media used in the following examples are commercially available, and all procedures used, such as nucleic acid electrophoresis and real-time PCR, are performed according to the methods described in Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)).

[334] Unless otherwise indicated, all reactant ratios below are calculated as ratios by volume (v/v).

[335] HBV transgenic C57BL/6J-Tg (Alb1HBV) 44Bri/J mice were purchased from the Department of Animal Research, Peking University Medical Science Center. Mice with S/COV>10 are selected before experiments; hereinafter sometimes also referred to as the 44Bri mouse model;

[336] HBV transgenic mice, named M-Tg HBV, were purchased from the Animal Department of the Shanghai Public Health Center. Methods for producing transgenic mice have been described as Ren J. et al., in J. Medical Virology. 2006, 78:551-560; hereinafter also sometimes referred to as the M-Tg model;

[337] AAV-HBV transgenic mice: Produced according to the literature method (Xiaoyan Dong et al., Chin J Biotech 2010, May 25; 26(5): 679-686) using rAAV8-1.3HBV type D virus ( ayw) (purchased from FivePlus Molecular Medicine Institute Co. Ltd., Beijing, 1×10 ¹² viral genomes (vg)/ml, lot #2016123011). rAAV8-1.3HBV was diluted to 5×10 ¹¹ vg/ml with sterile PBS. 200 µl of diluted rAAV8-1.3HBV was injected into each mouse, i. 1×10 ¹¹ c.g. per mouse. Orbital blood (approximately 100 μl) was taken from all mice on day 28 post-virus injection to collect serum for HBsAg and HBV DNA determination; hereinafter also referred to as the AAV-HBV mouse model;

[338] AAV-HBV low concentration transgenic mice: essentially the same model building method as described above was used, the difference being that the virus was diluted to 1 x 10 ¹¹ vg/ml with sterile PBS prior to experiment. Each mouse was injected with 100 μl of virus, i.e. 1×10 ¹⁰ vg per mouse; hereinafter also sometimes referred to as a low-concentration AAV-HBV mouse model;

[339] HBV transgenic mice: C57BL/6-HBV, strain name: B6-Tg HBV/Vst (1.28 copies, genotype A) purchased from Beijing Vitalstar Biotechnology Co., Ltd. Mice with COI>10 ⁴ selected before experiments; hereinafter also sometimes referred to as a model with 1.28 copies.

Receiving example 1

Obtaining conjugates 1-11

[340] In this preparation example, conjugate 1 (hereinafter also referred to as L10-siHBa1M1SVP conjugate), conjugate 2 (hereinafter also referred to as L10-siHBa1M1SP conjugate), conjugate 3 (hereinafter also referred to as L10-conjugate) were synthesized. siHBa1M1SPsT), conjugate 4 (hereinafter also referred to as L10-siHBa1M1SPs conjugate), conjugate 5 (hereinafter also referred to as L10-siHBa1M2S conjugate), conjugate 6 (hereinafter also referred to as L10-siHBa1M2S conjugate), conjugate 7 (hereinafter also referred to as L10-siHBa2M1S conjugate) conjugate 8 (hereinafter also referred to as L10-siHBa1M1S conjugate), conjugate 9 (hereinafter also referred to as L10-siHBa1M2S conjugate), conjugate 10 (hereinafter also referred to as as L10-siHBa2M2S conjugate) and conjugate 11 (hereinafter also referred to as L10-siHBa2M1S conjugate). The conjugates were those formed by conjugation of the conjugating molecule L-9, respectively, with siRNAs numbered L10-siHBa1M1SVP, L10-siHBa1M1SP, L10-siHBa1M1SPsT, L10-siHBa1M1SPs, L10-siHBa1M2S, L10-siHBa1M2S, L10-siHBa1 , L10-siHBa1MIS, L10-siHBa1M2S, L10-siHBa2M2S or L10-siHBa2M1S. The conjugated siRNA sequences in the conjugates are shown in Table 3.

(1-1) Synthesis of compound L-10:

[341] Compound L-10 was synthesized according to the following method:

(1-1-1) Synthesis of GAL-5 (terminal segment of the conjugating molecule)

(1-1-1a) Synthesis of GAL-2

[342] 100.0 g of GAL-1 (N-acetyl-D-galactosamine hydrochloride, CAS No. 1772-03-8, purchased from Ningbo Hongxiang Bio-Chem Co., Ltd., 463.8 mmol) was dissolved in 1000 ml anhydrous pyridine, to which was added 540 ml of acetic anhydride (purchased from Enox Inc., 5565.6 mmol) in an ice water bath to react with stirring at room temperature for 1.5 hours. The resulting reaction solution was poured into 10 L of ice water and subjected to vacuum filtration under reduced pressure. The residue was washed with 2 L of ice water, and then a mixed solvent of acetonitrile/toluene (v/v=1:1) was added until complete dissolution. The solvent was removed by evaporation to give 130.0 g of GAL-2 product as a white solid.

(1-1-1b) Synthesis of GAL-3

[343] GAL-2 (35.1 g, 90.0 mmol) obtained in step (1-1-1a) was dissolved in 213 ml of anhydrous 1,2-dichloroethane, to which was added 24.0 g of TMSOTf (No. CAS 27607-77-8, purchased from Macklin Inc., 108.0 mmol) in an ice water bath and under nitrogen to react at room temperature overnight.

[344] 400 ml of dichloromethane was added to the reaction solution for dilution, filtered through diatomaceous earth, and then 1 l of saturated sodium bicarbonate aqueous solution was added and stirred until uniform. The organic phase was isolated. The remaining aqueous phase was extracted twice, each time with 300 ml of dichloroethane, and all organic phases were combined and washed with 300 ml of saturated aqueous sodium bicarbonate and 300 ml of saturated brine, respectively. The organic phase resulting from the washing was isolated and dried using anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure to give 26.9 g of GAL-3 product as a light yellow viscous syrup.

(1-1-1c) Synthesis of GAL-4

, а затем 9,0 г 5-гексен-1-ола (№ CAS 821-41-0, приобретен у Adamas-beta Inc., 89,9 ммоль) и перемешивали при комнатной температуре в течение 30 минут. 9,08 мл TMSOTf (40,9 ммоль) добавляли на ледяной бане и в атмосфере азота для взаимодействия при перемешивании при комнатной температуре в течение ночи. Порошок молекулярного сита

удаляли с помощью фильтрации. К фильтрату добавляли 300 мл дихлорэтана для разбавления, фильтровали через диатомит, а затем добавляли 500 мл насыщенного водного раствора бикарбоната натрия и перемешивали в течение 10 минут для промывки. Выделяли органическую фазу. Водную фазу экстрагировали один раз с применением 300 мл дихлорэтана. Все органические фазы объединяли и промывали с применением 300 мл насыщенного водного раствора бикарбоната натрия и 300 мл насыщенного рассола, соответственно. Органическую фазу, полученную в результате промывки, выделяли и высушивали с применением безводного сульфата натрия. Растворитель удаляли с помощью выпаривания при пониженном давлении с получением 41,3 г продукта GAL-4 в виде желтого сиропа, который непосредственно использовали в следующей реакции окисления без очистки. (1-1-1d) Синтез GAL-5[345] GAL-3 (26.9 g, 81.7 mmol) obtained in step (1-1-1b) was dissolved in 136 ml of anhydrous 1,2-dichloroethane, 30 g of dry molecular sieve powder was added

and then 9.0 g of 5-hexen-1-ol (CAS No. 821-41-0, purchased from Adamas-beta Inc., 89.9 mmol) and stirred at room temperature for 30 minutes. 9.08 ml TMSOTf (40.9 mmol) was added in an ice bath and under nitrogen to react with stirring at room temperature overnight. Molecular Sieve Powder

removed by filtration. 300 ml of dichloroethane was added to the filtrate to dilute, filtered through diatomaceous earth, and then 500 ml of saturated sodium bicarbonate aqueous solution was added and stirred for 10 minutes to wash. The organic phase was isolated. The aqueous phase was extracted once with 300 ml of dichloroethane. All organic phases were combined and washed with 300 ml of saturated aqueous sodium bicarbonate and 300 ml of saturated brine, respectively. The organic phase resulting from the washing was isolated and dried using anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure to give 41.3 g of GAL-4 product as a yellow syrup, which was directly used in the next oxidation reaction without purification. (1-1-1d) Synthesis of GAL-5

[346] GAL-4 (14.9 g, 34.7 mmol) obtained in accordance with the method described in step (1-1-1c) was dissolved in a mixed solvent of 77 ml of dichloromethane and 77 ml of acetonitrile, 103 ml of deionized water and 29.7 g of sodium periodate (CAS No. 7790-28-5, purchased from Aladdin Inc., 138.8 mmol), respectively, and stirred in an ice bath for 10 minutes. Ruthenium trichloride (CAS No. 14898-67-0, available from Energy Chemical, 238 mg, 1.145 mmol) was added to react at room temperature overnight. The resulting reaction solution was diluted by adding 300 ml of water with stirring, and adjusted to a pH of approximately 7.5 by adding saturated sodium bicarbonate. The organic phase was isolated and removed. The aqueous phase was extracted three times, each time using 200 ml of dichloromethane, and the organic phase resulting from the extraction was removed. The aqueous phase resulting from the extraction was adjusted to a pH of about 3 using dry citric acid, extracted three times with 200 ml of dichloromethane each time, and the resulting organic phases were combined and dried using anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure to give 6.5 g of GAL-5 product as a white foamy solid. H ¹ -NMR (400 MHz, DMSO) δ 12.01 (br, 1H), 7.83 (d, J=9.2 Hz, 1H), 5.21 (d, J=3.2 Hz, 1H ), 4.96 (dd, J=11.2, 3.2 Hz, 1H), 4.49 (d, J=8.4 Hz, 1H), 4.07-3.95 (m, 3H) , 3.92-3.85 (m, 1H), 3.74-3.67 (m, 1H), 3.48-3.39 (m, 1H), 2.20 (t, J=6, 8Hz, 2H), 2.11(s, 3H), 2.00(s, 3H), 1.90(s, 3H), 1.77(s, 3H), 1.55-1.45( m, 4H).

(1-1-2) Synthesis of M-11-T3:

[347] J-0 (1.883 r, 10 mmol, purchased from Alfa Aesar) was dissolved in 25 ml of acetonitrile, triethylamine (4.048 g, 40 mmol) was added and cooled to 0°C in an ice water bath. Ethyl trifluoroacetate (5.683 g, 40 mmol) was added to react at room temperature for 22 hours. The solvent was removed by evaporation under reduced pressure, and the residue was dried in a foamy state in a vacuum oil pump for 18 hours to obtain 5.342 g of a crude solid product M-11-T3, which was directly used in the subsequent reaction without further purification. MS m/z: C15H22F9N4O3, [M+H]+, calculated: 477.35, measured: 477.65.

(1-1-3) Synthesis of M-11-T3-Tr:

[348] The crude product M-11-T3 (5.342 g, 10 mmol) was dissolved in 50 ml of dichloromethane. To the resulting reaction solution were added TrCl (3.345 g, 12 mmol) and triethylamine (1.518 g, 15 mmol) to react with stirring at room temperature for 20 hours. The reaction solution was washed twice, each time with 20 ml of saturated sodium bicarbonate solution and once with 20 ml of saturated brine. The resulting organic phase was dried using anhydrous sodium sulfate and filtered. The organic solvent was removed by evaporation under reduced pressure, and the residue was dried in a foam state in a vacuum oil pump overnight to obtain 7.763 g of the crude solid product M-11-T3-Tr. MS m/z: C34H36F9N4O3, [M+Na]+, calculated: 741.25, measured: 741.53. The crude M-11-T3-Tr solid was then used in the next step to synthesize M-18-Tr without purification.

(1-1-4) Synthesis of M-18-Tr:

[349] The crude product M-11-T3-Tr (7.763 g, 10 mmol) obtained in step (1-1-3) was dissolved in 100 ml of methanol and 100 ml of an aqueous solution of methylamine (40 wt.%) was added to interaction with stirring at 50°C for 23 hours. Insoluble particles were removed by filtration. The solvent was evaporated under reduced pressure, and 200 ml of a mixed solvent of DCM:methanol in a 1:1 v/v ratio was added to the residue, washed with 50 ml of a saturated sodium bicarbonate solution. The aqueous phase was extracted three times, each time using 50 ml of dichloromethane. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure, and the residue was dried in a foamy state in a vacuum oil pump overnight and purified using a regular phase silica gel column (200-300 mesh). The column was filled with simple petroleum ether, 1 wt. % triethylamine to neutralize the acidity of the silica gel and eluted using a gradient elution dichloromethane:methanol:ammonia aqueous solution (25 wt.%)=1:1:0.05-1:1:0.25. The eluate was collected, the solvent was removed by evaporation under reduced pressure, and the residue was dried in a foam state in a vacuum oil pump to obtain 2.887 g of pure product M-18-Tr. H ¹ -NMR (400 MHz, DMSO) δ 7.47-7.39 (m, 6H), 7.32-7.24 (m, 6H), 7.19-7.12 (m, 3H), 2.60-2.47 (m, 4H), 2.46-2.19 (m, 13H), 1.70-1.55 (m, 4H), 1.40 (p, J=6.8 Hz, 2H), MS m/z: C28H39N4, [M+H]+, calculated: 431.65, measured: 432.61.

(1-1-5) Synthesis of L-5-Tr:

[350] M-18-Tr (2.02 g, 4.69 mmol) obtained in step (1-1-4) and GAL-5 (6.93 g, 15.48 mmol) obtained in step (1-1-1), mixed and dissolved in 47 ml of acetonitrile and added N-methylmorpholine (3.13 g, 30.96 mmol) and 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM, 4.28 g, 15.48 mmol) to react with stirring at room temperature for 2 hours. The resulting reaction solution was diluted with 200 ml of dichloromethane. The organic phase was washed with 100 ml of saturated sodium bicarbonate solution and 100 ml of saturated brine, dried with anhydrous sodium sulfate and filtered. The solvent was then removed by evaporation under reduced pressure to give a crude product. The crude product was purified using a regular phase silica gel column (200-300 mesh). The column was filled with simple petroleum ether, 1 wt. % triethylamine to neutralize the acidity of the silica gel and eluted with dichloromethane:methanol=100:5-100:7 gradient elution. The eluate was collected and evaporated to dryness under reduced pressure to give 7.49 g of pure L-5-Tr. H ¹ -NMR (400 MHz, DMSO) δ 7.83-7.10 (m, 4H), 7.67-7.60 (m, 1H), 7.44-7.34 (m, 6H), 7.33-7.24 (m, 6H), 7.20-7.15 (m, 3H), 5.22 (s, 3H), 4.97 (d, J=11.3 Hz, 3H) , 4.49 (d, J=8.4 Hz, 3H), 4.06-3.07 (m, 9H), 3.95-3.83 (m, 3H), 3.77-3.64 (m, 3H), 3.45-3.35 (m, 3H), 3.12-2.87 (m, 8H), 2.30-2.15 (m, 3H), 2.11-1 .98 (m, 22H), 1.95-1.84 (m, 11H), 1.81-1.61 (m, 14H), 1.54-1.36 (m, 14H). MS m/z: C85H119N7O30, [M+H]+, calculated: 1718.81, measured: 1718.03.

(1-1-6) Synthesis L-8:

[351] L-5-Tr (5.94 g, 3.456 mmol) obtained in step (1-1-5) was dissolved in 69 mL of dichloromethane and dichloroacetic acid (13.367 g, 103.67 mmol) was added to react at room temperature for 2 hours. The resulting reaction solution was diluted by adding 100 ml of dichloromethane, washed and adjusted to pH=7-8 using saturated sodium bicarbonate solution. The separated aqueous phase was extracted six times, each time using 30 ml of dichloromethane. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was then removed by evaporation under reduced pressure to give a crude product. The crude product was purified using a regular phase silica gel column (200-300 mesh). 10 wt. % triethylamine to neutralize the acidity of silica gel, balanced 1 wt. %o with triethylamine and eluted with dichloromethane:methanol=100:30-100:40 gradient elution. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 4.26 g of pure product L-8. L-8. H ¹ -NMR (400 MHz, DMSO) δ 7.84 (d, J=9.0 Hz, 3H), 7.27-7.23 (m, 1H), 7.13-7.18 (m, 1H), 5.22 (d, J=3.1 Hz, 3H), 4.97 (dd, J=11.3, 3.1 Hz, 3H), 4.48 (d, J=8.4 Hz, 3H), 4.09-3.98 (m, 9H), 3.88 (dd, J=19.3, 9.3 Hz, 3H), 3.75-3.66 (m, 3H) , 3.44-3.38 (m, 3H), 3.17-3.30 (m, 4H), 3.10-2.97 (m, 4H), 2.35-2.20 (m, 6H), 2.15-2.08 (m, 9H), 2.07-1.98 (m, 13H), 1.94-1.87 (m, 9H), 1.81-1.74 ( m, 9H), 1.65-1.42 (m, 18H). MS m/z: C85H119N7O30, [M+H]+, calculated: 1477.59, measured: 1477.23.

(1-1-7a) Synthesis A-1

[352] DMTrCl (4,4'-dimethoxytrityl chloride, 38.12 g, 112.5 mmol) was dissolved in 450 mL of anhydrous pyridine and DL-calcium glycerate hydrate (12.88 g, 45.0 mmol) was added to react at 45°C for 22 hours. The reaction solution was filtered. The residue was washed with 200 ml of DCM and the filtrate was concentrated to dryness under reduced pressure. The residue was redissolved in 500 ml of dichloromethane and washed twice, each time using 200 ml of 0.5 M triethylamine phosphate (pH=7-8). The separated aqueous phase was extracted twice, each time using 200 ml of dichloromethane. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure, and the residue was purified using a normal phase (200-300 mesh) silica gel column, which was eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:methanol=1:1:1:0 .35-1:1:1:0.55. The eluate was collected and the solvent was removed by evaporation under reduced pressure. The residue was redissolved in 500 ml of dichloromethane and washed once with 200 ml of 0.5 M triethylamine phosphate. The separated aqueous phase was extracted twice, each time using 200 ml of dichloromethane. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure (reduced pressure in a vacuum oil pump) to dryness overnight to give 20.7 g of product A-1 as a white solid. H ¹ -NMR (400 MHz, DMSO-d6) δ 7.46 (ddd, J=6.5, 2.3, 1.1 Hz, 1H), 7.40-7.28 (m, 7H), 6.89-6.81 (m, 4H), 4.84 (d, J=5.0 Hz, 1H), 4.36-4.24 (m, 1H), 4.29 (s, 6H) , 3.92 (dd, J=12.4, 7.0 Hz, 1H), 3.67 (dd, J=12.3, 7.0 Hz, 1H), 2.52 (q, J=6 .3 Hz, 6H), 1.03 (t, J=6.3 Hz, 9H). MS m/z: C24H23O6, [M-H]-, calculated: 407.15, measured: 406.92.

(1-1-7b) Synthesis of L-7:

[353] L-8 (2.262 g, 1.532 mmol) obtained in step (1-1-6) and A-1 (2.342 g, 4.596 mmol) obtained in step (1-1-7a) were mixed and dissolved in 16 ml dichloromethane, 3-diethoxyphosphoryloxy-1,2,3-benzotrizin-4(3H)-one (DEPBT, 1.375 g, 4.596 mmol) was added and then diisopropylethylamine (1.188 g, 9.191 mmol) was added to react with stirring at 25°C for 2 hours. The organic phase was washed with 10 ml of saturated sodium bicarbonate solution. The separated aqueous phase was extracted three times, each time using 10 ml of dichloromethane. All organic phases were combined and washed with 10 ml of saturated brine, the separated aqueous phase was extracted twice, each time with 10 ml of dichloromethane, the resulting organic phases were combined, dried with anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure and the residue was foam dried in a vacuum oil pump overnight to give 4.900 g of crude product. The crude product was subjected to column purification. The column was filled with 120 g of silica gel with normal phase (200-300 mesh), 20 ml of triethylamine was added to neutralize the acidity of the silica gel, and balanced with petroleum ether containing 1 wt. % triethylamine and eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide=1:1:1:0.5-1:1:1:0.6. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 2.336 g of pure product L-7. H ¹ -NMR (400 MHz, DMSO) δ 7.90-7.78 (m, 4H), 7.75-7.64 (m, 1H), 7.38-7.18 (m, 9H), 6.91-6.83 (m, 4H), 5.25-5.10 (m, 4H), 4.97 (dd, J=11.2, 3.2 Hz, 3H), 4.48- 4.30 (m, 4H), 4.02 (s, 9H), 3.93-3.84 (m, 3H), 3.76-3.66 (m, 9H), 3.45-3, 35 (m, 3H), 3.24-2.98 (m, 10H), 2.30-2.20 (m, 2H), 2.11-1.88 (m, 3H), 1.80- 1.40 (m, 28H). MS m/z: C90H128N7O35, [M-DMTr]+, calculated: 1564.65, measured: 1564.88.

(1-1-8) Synthesis of conjugating molecule L-9:

[354] L-7 (2.300 g, 1.26 mmol) obtained in step (1-1-7b), succinic anhydride (0.378 g, 3.78 mmol) and 4-dimethylaminopyridine (DMAP, 0.462 g, 3, 78 mmol) was mixed and dissolved in 13 ml of dichloromethane, then DIPEA (0.814 g, 6.30 mmol) was added and stirred at 25°C for 24 hours. The reaction solution was washed with 5 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted three times, each time using 5 ml of dichloromethane. All organic phases were combined and the solvent was evaporated off under reduced pressure to give 2.774 g of crude product. The crude product was subjected to column purification. The column was filled with 60 g of silica gel with the usual phase (200-300 mesh), added 1 wt. % triethylamine to neutralize the acidity of the silica gel, equilibrate with dichloromethane, and elute with a gradient elution dichloromethane (containing 1 wt.% triethylamine):methanol=100:18-100:20. The eluate was collected and the solvent was evaporated under reduced pressure to give 1.874 g of the pure product of the conjugating molecule L-9. H ¹ -NMR (400 MHz, DMSO) δ 8.58 (d, J=4.2 Hz, 1H), 7.94-7.82 (m, 3H), 7.41-7.29 (m, 5H), 7.22 (d, J=8.1 Hz, 5H), 6.89 (d, J=8.3 Hz, 4H), 5.49-5.37 (m, 1H), 5, 21 (d, J=3.0 Hz, 3H), 4.97 (d, J=11.1 Hz, 3H), 4.49 (d, J=8.2 Hz, 3H), 4.02 ( s, 9H), 3.88 (dd, J=19.4, 9.4 Hz, 3H), 3.77-3.65 (m, 9H), 3.50-3.39 (m, 6H) , 3.11-2.90 (m, 5H), 2.61-2.54 (m, 4H), 2.47-2.41 (m, 2H), 2.26-2.17 (m, 2H), 2.15-1.95 (m, 22H), 1.92-1.84 (m, 9H), 1.80-1.70 (m, 10H), 1.65-1.35 ( m, 17H), 1.31-1.19 (m, 4H), 0.96 (t, J=7.1 Hz, 9H), MS m/z: C94H132N7O38, [M-DMTr]+, calculated: 1664.72, measured: 1665.03.

(1-1-9) Synthesis of compound L-10:

[355] At this stage, the compound L-10 was obtained by connecting the conjugating molecule L-9 with a solid phase support.

[356] Conjugating molecule L-9 (0.233 g, 0.1126 mmol) obtained in step (1-1-8), O-benzotriazoletetramethyluronium hexafluorophosphate (HBTU, 0.064 g, 0.1689 mmol) and diisopropylethylamine (DIEA, 0.029 g, 0.2252 mmol) were mixed and dissolved in 19 ml of acetonitrile and stirred at room temperature for 5 minutes. Aminomethyl resin (0.901 g, 100-200 mesh, amino load: 400 µmol/g, purchased from Tianjin Nankai HECHENG S&T Co., Ltd.) was added to the reaction liquid. The reaction was performed on a shaker at 25°C and 220 rpm for 15 hours, followed by filtration. The residue was washed twice, each time with 30 ml of DCM, then three times, each time with 30 ml of acetonitrile and once with 30 ml of ethyl ether, and dried for 2 hours with a vacuum oil pump. The capping reaction was then performed by adding starting materials (CapA, CapB, 4-dimethylaminopyridine (DMAP) and acetonitrile) according to the charge ratio shown in Table 2. The reaction was performed on a shaker at 25° C. and 200 rpm for 5 hours. The reaction liquid was filtered. The residue was washed three times, each time using 30 ml of acetonitrile, the solvent was evaporated to dryness, and the mixture was dried overnight under reduced pressure using a vacuum oil pump to obtain 1.100 g of compound L-10 (i.e. conjugating molecule L-9 bonded to a solid phase support), with a load of 90.8 µmol/g.

In the table above, CapA and CapB are solutions of capping agents. CapA is a 20% by volume solution of N-methylimidazole in a mixture of pyridine/acetonitrile, with a volume ratio of pyridine to acetonitrile of 3:5. CapB is a 20% solution by volume of acetic anhydride in acetonitrile.

(1-2) Synthesis of sense chains of conjugates 1-11

[357] Nucleoside monomers were joined one by one in the 3' to 5' direction according to the sequence of nucleotides in the sense strand using the solid phase phosphoamidite synthesis method, the cycles were started from compound L-10 obtained in the above step. The connection of each nucleoside monomer included a four-step reaction of deprotection, coupling, capping and oxidation or sulfurization. Here, if two nucleotides are linked by a phosphoester bond, a four-step deprotection, coupling, capping, and oxidation reaction is included at the time of addition of the subsequent nucleoside monomer; and if two nucleotides are connected by a phosphothioate bond, a four-step deprotection, coupling, capping, and sulfurization reaction is included at the time of addition of the subsequent nucleoside monomer. The synthesis condition was set as follows.

[358] Nucleoside monomers are provided in 0.1M acetonitrile solution. The deprotection reaction condition is the same in each step, i.e. temperature 25°C, reaction time 70 seconds, a solution of dichloroacetic acid in dichloromethane (3% v/v) and a molar ratio of dichloroacetic acid to the protective group 4,4'-dimethoxytrityl on solid phase support 5 are used as a deprotection agent: one.

[359] The coupling reaction condition is identical in each step, including temperature 25°C, molar ratio of nucleic acid sequence coupled to solid phase support to nucleoside monomers 1:10, molar ratio of nucleic acid sequence coupled to solid phase support to binding agent 1:65, reaction time 600 seconds and 0.5 M solution of 5-ethylthio-1H-tetrazole in acetonitrile as coupling agent.

[360] The condition for the capping reaction is identical in each step, including a temperature of 25°C and a reaction time of 15 seconds, a mixed solution of Cap A and Cap B in a 1:1 molar ratio is used as the capping agent, and the molar ratio of the capping agent to the nucleic acid sequence acid coupled to the solid phase support is 1:1:1 (anhydride: N-methylimidazole: nucleic acid sequence coupled to the solid phase support).

[361] the condition of the oxidation reaction is identical in each stage, including the temperature of 25°C, the reaction time of 15 seconds and 0.05 M solution of iodine in water as an oxidizing agent; and the molar ratio of iodine to nucleic acid sequence coupled to the solid phase support in the binding step is 30:1. The reaction is carried out in a mixed solvent in which the ratio of tetrahydrofuran:water:pyridine is 3:1:1.

[362] The condition for the sulfurization reaction is the same in each step, including a temperature of 25°C, a reaction time of 300 seconds, and xanthan hydride as the sulfurization agent; the molar ratio of the sulfurizing agent to the nucleic acid sequence connected to the solid phase support in the binding step is 120:1. The reaction is carried out in a mixed solvent in which the ratio of acetonitrile: pyridine is 1:1.

[363] The conditions for cleavage and removal of the protective group are as follows: adding the synthesized nucleotide sequence connected to the substrate, 25 wt. % aqueous ammonia solution for interaction for 16 hours at 55°C, while the amount of aqueous ammonia solution is 0.5 ml/μmol. The liquid is removed and the residue is concentrated in vacuo to dryness.

[364] Purification and desalting: Purification of the nucleic acid is carried out using a preparative ion chromatography column (Source 15Q) with NaCl gradient elution. In particular, eluent A: 20 mM sodium phosphate (pH=8.1), solvent: water/acetonitrile=9:1 (v/v); eluent B: 1.5 M sodium chloride, 20 mM sodium phosphate (pH=8.1), solvent: water/acetonitrile=9:1 (v/v); elution gradient: eluent A:eluent B=100:0-50:50. The eluate is collected, combined and desalted using a reverse phase chromatography column. Specific conditions include the use of a Sephadex column (carrier: Sephadex-G25) for desalting and deionized water for elution.

[365] Definition: Purity was determined by ion exchange chromatography (IC-HPLC); and the molecular weight was analyzed by liquid chromatography-mass spectrometry (LC-MS).

(1-3) Synthesis of antisense chains of conjugates 1-11

(1-3A) Preparation of antisense strand of conjugates 1, 6 and 11

[366] Antisense strands (AS) of conjugates 1 and 2 were synthesized by running cycles using a universal solid phase support (UnyLinker™ loaded ^NittoPhase® HL solid supports, Kinovate Life Sciences Inc.) according to solid phase phosphoamidite synthesis. The reactions of deprotection, binding, capping, oxidation or sulfurization, cleavage, deprotection, purification and desalting in the solid phase synthesis method were carried out under the same conditions as in the synthesis of the sense strand.

[367] In this case, vinyl phosphate-modified and 2'-methoxy uridine monomer (VP-Um) is synthesized according to the following method:

(1-3-1) Synthesis of VP-U-2

[368] The VP-U-2 molecule was synthesized according to the following method:

[369] 2'-methoxy-modified uracil nucleoside (2'-OMe-U, 51.30 g, 91.6 mmol), tert-butyldiphenylchlorosilane (TBDPSCl, 50.35 g, 183.2 mmol) and imidazole (12 47 g, 183.2 mmol) were mixed and dissolved in 450 ml of N,N-dimethylformamide (DMF) to react with stirring at room temperature for 20 hours. The DMF was removed by evaporation and the residue was dissolved in 600 ml of dichloromethane and washed with 300 ml of saturated sodium bicarbonate solution. The separated aqueous phase was extracted three times, each time using 300 ml of dichloromethane. All organic phases were combined, washed with 5% oxalic acid until the pH of the aqueous phase was <5. The solvent was evaporated to dryness to give the crude product VP-U-1, which was directly used in the subsequent synthesis of VP-U-2.

[370] The crude product VP-U-1 was dissolved in 100 ml of dichloromethane and then stirred for 10 minutes in an ice bath. 450 ml of a 2% solution of p-toluenesulfonic acid (with a mixed solvent of methanol and dichloromethane in a volume ratio of 3:7), pre-cooled in a refrigerator at 4°C, was added to react for 10 minutes. The reaction was stopped by adding 200 ml of saturated sodium bicarbonate solution. The resulting organic phase was washed by adding saturated sodium bicarbonate solution until pH=8. The aqueous phases were combined and extracted twice, each time using 200 ml of dichloromethane. All organic phases were combined and washed once with 200 ml of saturated brine. The solvent was removed by evaporation and the residue was purified using a regular phase silica gel column (200-300 mesh). The column was filled with simple petroleum ether and eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:methanol=1:1:1:0.05-1:1:1:0.25. The eluate was collected, the solvent was removed by evaporation under reduced pressure, and the residue was foam dried in a vacuum oil pump to give a total of 40.00 g of pure VP-U-2 product. H ¹ -NMR (400 MHz, DMSO-d6) δ 7.96 (d, J=7.8 Hz, 1H), 7.64 (dtd, J=5.l, 4.0, 2.2 Hz, 4H), 7.41-7.30 (m, 6H), 6.79 (d, J=4.7 Hz, 1H), 5.73 (d, J=7.6 Hz, 1H), 4, 94 (t, J=7.0Hz, 1H), 4.12 (td, J=4.6, 3.9Hz, 1H), 4.05 (dd, J=4.8, 4.0Hz , 1H), 3.96 (t, J=4.7 Hz, 1H), 3.68 (ddd, J=11.8, 7.0, 4.6 Hz, 1H), 3.57-3, 46 (m, 1H), 3.39 (s, 3H), 1.05 (s, 8H). MS m/z: C26H33N2O6Si, [M+H]+, calculated: 497.21, measured: 497.45. (1-3-2) Synthesis of VP-U-4:

[371] VP-U-2 (19.84 g, 40.0 mmol), dicyclohexylcarbodiimide (DCC, 16.48 g, 80.0 mmol), pyridine (4.20 g, 53.2 mmol), and trifluoroacetic acid (6.61 g, 53.2 mmol) was mixed and dissolved in 200 ml of dimethyl sulfoxide (DMSO) to interact with stirring at room temperature for 20 hours. Tetraethylmethylene diphosphate (21.44 g, 74.4 mmol) was dissolved separately in 120 ml of THF, cooled in an ice bath, t-BuOK (11.36 g, 101.2 mmol) was added at ice bath temperature to react for 10 minutes, warmed to room temperature to react for 0.5 hour, and added to the above reaction solution for about 1 hour. The reaction was carried out at the temperature of the ice bath for 1 hour, and then warmed to room temperature to react for 18 hours. The reaction was stopped by adding water. The separated aqueous phase was extracted three times, each time using 200 ml of dichloromethane. All organic phases were combined and washed once with 200 ml of saturated brine. The solvent was evaporated to dryness and the residue was purified using a regular phase silica gel column (200-300 mesh). The column was filled with simple petroleum ether and eluted using a gradient elution of simple petroleum ether:ethyl acetate=1:1-1:4. The eluate was collected, the solvent was removed by evaporation under reduced pressure, and the residue was dried in a foam state in a vacuum oil pump to obtain a total of 14.00 g of pure product VP-U-4. H ¹ -NMR (400 MHz, DMSO-d6) δ 7.96 (d, J=7.8 Hz, 1H), 7.64 (dtd, J=5.1, 4.0, 2.2 Hz, 4H), 7.41-7.30 (m, 6H), 6.82-6.71 (m, 2H), 5.90 (ddd, J=25.9, 15.0, 1.0 Hz, 1H), 5.73 (d, J=7.6 Hz, 1H), 4.36-4.21 (m, 3H), 4.18 (t, J=4.9 Hz, 1H), 4, 05 (ddq, J=9.7, 8.5, 6.9 Hz, 2H), 3.87 (t, J=4.8 Hz, 1H), 3.39 (s, 3H), 1.32 (td, J=6.9, 0.7 Hz, 6H), 1.05 (s, 8H). MS m/z: C31H42N2O8PSi, [M+H]+, calculated: 629.24, measured: 629.51.

(1-3-3) Synthesis of VP-U-5:

VP-U-4 (14.00 g, 22.29 mmol) was dissolved in 100 ml of tetrahydrofuran, triethylamine trihydrofluoride (17.96 g, 111.45 mmol) was added and stirred at room temperature for 20 hours for complete reaction. The solvent was directly evaporated to dryness and the residue was dissolved in dichloromethane; the above evaporation and dissolution steps were further repeated twice, each time using 50 ml of dichloromethane, to obtain a crude product. The crude product was purified using a regular phase silica gel column (200-300 mesh). The column was filled with simple petroleum ether and eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:methanol=1:1:1:0.05-1:1:1:0.25. The eluate was collected, the solvent was removed by evaporation under reduced pressure, and the residue was dried in a foam state in a vacuum oil pump to obtain a total of 6.70 g of pure product VP-U-5. H ¹ -NMR (400 MHz, DMSO-d6) δ 7.96 (d, J=7.8 Hz, 1H), 6.77 (dd, J=15.0, 6.2 Hz, 1H), 5 .99-5.82 (m, 2H), 5.73 (d, J=7.6 Hz, 1H), 5.27 (d, J=5.1 Hz, 1H), 5.10 (dd, J=5.3, 4.7 Hz, 1H), 4.29 (ddq, J=9.8, 8.6, 7.0 Hz, 2H), 4.17 (ddd, J=6.2, 5.2, 1.0 Hz, 1H), 4.12-3.98 (m, 3H), 3.39 (s, 2H), 1.32 (td, J=6.9, 0.6 Hz , 6H). MS m/z: C15H24N2O8P, [M+H]+, calculated: 391.13, measured: 391.38.

(1-3-4) Synthesis of VP-U-6:

[372] VP-U-5 (391 mg, 1.0 mmol), pyridine trifluoroacetate (0.232 g, 1.2 mmol), N-methylimidazole (0.099 g, 1.2 mmol), and bis-(diisopropylamino)(2 -cyanoethoxy)phosphine (0.452 g, 1.5 mmol) was added to 10 ml of anhydrous dichloromethane under argon to react with stirring at room temperature for 5 hours. The solvent was evaporated to dryness, and then the residue was purified by column chromatography (normal phase silica gel 200-300 mesh, gradient elution dichloromethane:acetonitrile (with 0.5 wt% triethylamine)=3:1-1:3). The eluate was collected and concentrated to remove the solvent to give a total of 508 mg of the desired product VP-U-6. P ³¹ -NMR (161 MHz, DMSO-d6) δ 150.34, 150.29, 17.07, 15.50. MS m/z: C24H41N4O9P2, [M+H]+, calculated: 591.23, measured: 591.55. It was indicated that VP-U-6 is the target product of VP-Um, which is involved in the synthesis of RNA chains as a nucleoside monomer.

(1-3B) Obtaining the antisense strand of conjugates 2 and 10

[373] The antisense strands of conjugates 2 and 10 differ from those of conjugates 1 and 11 only by modification of the first 5'-terminal nucleotide. During the preparation of the antisense strand according to the solid phase phosphoamidite synthesis method, after the addition of the 2'-methoxy-modified uridine monomer as the last nucleoside monomer to be attached, the monomer of Formula (CPR-I) (purchased from Suzhou GenePharma Inc. catalog number 13-2601-XX) was coupled to the 5' end of the antisense strand by a four step deprotection, coupling, capping and oxidation reaction to form the 5' phosphoester modification.

(CPR-I)

[374] During synthesis, the universal solid phase support to be applied, the conditions for deprotection, coupling, capping, oxidation or sulfurization reaction, cleavage and deprotection, purification and desalting are similar to those

used in the synthesis of the sense strand.

(1-3C) Preparation of antisense strand of conjugates 3, 4 and 9

[375] For the synthesis of the antisense strand, a synthetic procedure similar to that for conjugates 2 and 19 was used, except that when the CPR-I monomer was coupled, the above oxidation reaction condition was replaced by a sulfurization reaction condition, which allowed the antisense strand of conjugates 3, 4 and 9 to be obtained. with 5'-phosphothioate modification.

(1-3D) Preparation of antisense strand of conjugates 5, 7 and 8

[376] Antisense strands (AS) of conjugates 5, 7 and 8 were synthesized by running cycles using a universal solid phase support (UnyLinker™ loaded ^NittoPhase® HL solid supports, Kinovate Life Sciences Inc.) according to solid phase phosphoamidite synthesis. The reactions of deprotection, binding, capping, oxidation or sulfurization, cleavage, deprotection, purification and desalting in the solid phase synthesis method were carried out under the same conditions as in the synthesis of the sense strand.

(1-4) Synthesis of conjugates 1-11

[377] For conjugate 1, the S chain and the AS chain, respectively, were dissolved in water for injection to make a 40 mg/m solution. They are mixed in an equimolar ratio, heated at 50°C for 15 minutes and then cooled to room temperature so that they can form a double-stranded structure through hydrogen bonds. The conjugate was diluted to a concentration of 0.2 mg/mL with ultrapure water (prepared using a Milli-Q pure water meter with a resistivity of 18.2 MΩ*cm (25° C.)). The molecular weight was measured with an LC-MS instrument (purchased from Waters Corp., model: LCT Premier). Since the measured values corresponded to the calculated values, it was confirmed that the synthesized conjugate 1 was the designed double-stranded nucleic acid sequence of interest with the conjugating molecule L-9.

[378] The sense strands and the corresponding antisense strands of conjugates 2-11, synthesized as described above, were annealed according to the same method to form double stranded structures; and the molecular weights of the conjugates were measured as follows:

Conjugate 2: calculated values S: 7516.37, AS: 7065.58;

measured values: S: 7516.6, AS: 7064.5;

Conjugate 3: calculated values S: 7504.34, AS: 7139.68;

measured values: S: 7515.6, AS: 7138.9;

Conjugate 4: calculated values S: 7516.37, AS: 7081.64;

measured values: S: 7515.6, AS: 7080.9;

Conjugate 5: calculated values S: 7504.34, AS: 6961.52;

measured values: S: 7503.4, AS: 6960.9;

Conjugate 6: calculated values S: 7504.34, AS: 7037.51;

measured values: S: 7503.6, AS: 7036.9;

Conjugate 7: calculated values S: 8218.83, AS: 7703.05;

measured values: S: 8218, AS: 7702.5;

Conjugate 8: calculated values S: 7516.37, AS: 6985.58;

measured values: S: 7516.5, AS: 6984.9;

Conjugate 9: calculated values S: 7504.34, AS: 7041.52;

measured values: S: 7503.6, AS: 7040.8;

Conjugate 10: calculated values S: 7504.34, AS: 7057.58,

measured values: S: 7503.6, AS: 7057;

the measured values were consistent with the calculated values, indicating that the synthesized conjugates were siRNA conjugates with the target sequences.

Conjugates 1-11 have the structure represented by Formula (3).

Receiving example 2

Preparation of Conjugates 12-26 and Comparative Conjugate 1

[379] It was expected that the subject conjugates could be obtained using the same method as in Preparation Example 1, except that: conjugate 1; and 2) if the target sequence contains an unmodified nucleotide, under cleavage and deprotection conditions, after treatment with an aqueous solution of ammonia, the product is dissolved in N-methylpyrrolidone in an amount of 0.4 ml/μmol followed by the addition of 0.3 ml/μmol triethylamine and 0.6 ml/μmol triethylamine trihydrofluoride, relative to the amount of single strand nucleic acid, which results in the removal of the 2'-TBDMS protecting group on the ribose.

[380] The sequences of conjugated siRNAs in the conjugates of the present invention are shown in Table 3. Wherein, the siRNA contained in Comparative Conjugate 1 is a negative control siRNA (hereinafter also referred to as NC) that does not exhibit an inhibitory effect on the gene HBV.

(3-1) Synthesis of P-10 compounds

[381] P-10 compounds were synthesized according to the following method:

(3-1-1) Synthesis of GAL5-C4-1

[382] GAL-5 (13.43 g, 30.0 mmol) obtained according to the method described in step (1-1-1) above, t-butyl 4-aminobutyrate hydrochloride (5.87 g, 30.0 mmol), O-benzotriazoletetramethyluronium hexafluorophosphate (13.65 g, 36.0 mmol) and diisopropylethylamine (11.63 g, 90.0 mmol) were added in 40 ml of N,N-dimethylformamide, dissolved until uniform and then stirred at room temperature for (3-1) Synthesis of P-10 compounds

[381] P-10 compounds were synthesized according to the following method:

(3-1-1) Synthesis of GAL5-C4-1

[382] GAL-5 (13.43 g, 30.0 mmol) obtained according to the method described in step (1-1-1) above, t-butyl 4-aminobutyrate hydrochloride (5.87 g, 30.0 mmol), O-benzotriazoletetramethyluronium hexafluorophosphate (13.65 g, 36.0 mmol) and diisopropylethylamine (11.63 g, 90.0 mmol) were added in 40 ml of N,N-dimethylformamide, dissolved until uniform, and then stirred at room temperature for interaction within 5 hours. To the resulting reaction solution was added 300 ml of a saturated sodium bicarbonate aqueous solution, extracted three times using 200 ml of ethyl acetate each time. All organic phases were combined and washed once with 200 ml of saturated brine. The organic phase was isolated and dried using anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure to dryness to give 30.3 g of crude GAL5-C4-1 product as an oil, which was directly used in the next reaction.

(3-1-2) Synthesis of GAL5-C4-2

[383] The crude product GAL5-C4-1 (30.3 g, 30 mmol) obtained in step (3-1-1) was dissolved in 180 ml of formic acid and stirred at room temperature to react for 16 hours. The solvent was evaporated to dryness. The residue was purified by column chromatography (normal phase silica gel with 200-300 mesh, dichloromethane:methanol gradient elution = 100:18-100:20). The eluate was collected and concentrated to remove solvents to give a total of 14.84 g of the desired GAL5-C4-2 product.

(3-1-3) Synthesis R-6:

[384] M-18-Tr (2.02 g, 4.69 mmol) obtained according to the method described in step (1-1-4) and GAL5-C4-2 (8.24 g, 15 .48 mmol) obtained in step (3-1-2) was mixed and dissolved in 47 ml of acetonitrile, N-methylmorpholine (3.13 g, 30.96 mmol) was added, followed by 4-(4,6-dimethoxytriazine) hydrochloride -2-yl)-4-methylmorpholine (DMTMM, 4.28 g, 15.48 mmol) to react with stirring at room temperature for 2 hours. The resulting reaction solution was diluted with 20 ml of dichloromethane. The resulting organic phase was washed with 10 ml of saturated sodium bicarbonate solution and 10 ml of saturated brine, respectively. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure to give a crude product which was purified using a regular phase silica gel column (200-300 mesh). The column was filled with simple petroleum ether, 1 wt. % triethylamine to neutralize the acidity of the silica gel and elute with a gradient elution dichloromethane:methanol = 100:5-100:7. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give a total of 8.27 g of pure product P-6.

(3-1-4) P-7 Synthesis:

[385] P-6 (6.82 g, 3.456 mmol) obtained in step (3-1-3) above was dissolved in 69 mL of dichloromethane and dichloroacetic acid (13.367 g, 103.67 mmol) was added to react at room temperature. temperature for 2 hours. The resulting reaction solution was diluted by adding 100 ml of dichloromethane, washed and adjusted to pH=7-8 with saturated sodium bicarbonate solution. The separated aqueous phase was extracted six times, each time using 30 ml of dichloromethane. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was then removed by evaporation under reduced pressure to give a crude product. The crude product was purified using a regular phase silica gel column (200-300 mesh). 10 wt. % triethylamine to neutralize the acidity of silica gel, balanced 1 wt. % with triethylamine and eluted with dichloromethane:methanol gradient elution 100:30-100:40. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give a total of 4.82 g of P-7. MS m/z: C78H127N10033, [M+H]+, calculated: 1732.91, measured: 1735.73.

(3-1-5) P-8 Synthesis:

(A-1)

[386] P-7 (2.653 g, 1.532 mmol) and A-1 (2.342 g, 4.596 mmol) were mixed and dissolved in 16 ml of dichloromethane, 3-diethoxyphosphoryl-1,2,3-benzotrizine-4(3H)- it (DEPBT) (1.375 g, 4.596 mmol) followed by the addition of diisopropylethylamine (1.188 g, 9.191 mmol) to react with stirring at 25°C for 2 hours. The organic phase was washed with 10 ml of saturated sodium bicarbonate solution. The separated aqueous phase was extracted three times, each time using 10 ml of dichloromethane. All organic phases were combined and washed with 10 ml of saturated brine. The separated aqueous phase was extracted twice, each time using 10 ml of dichloromethane, and the resulting organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure and foam dried in a vacuum oil pump overnight to give a crude product. The crude product was subjected to column purification. The column was filled with 120 g of silica gel with normal phase (200-300 mesh), 20 ml of triethylamine was added to neutralize the acidity of the silica gel, and balanced with petroleum ether containing 1 wt. % triethylamine and eluted with a gradient elution of petroleum ether: ethyl acetate: dichloromethane: N,N-dimethylformamide = 1:1:1:0.5-1:1:1:0.6. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give a total of 2.793 g of pure product P-8.

(3-1-6) Synthesis R-9:

[387] P-8 (490 mg, 0.231 mmol), succinic anhydride (69 mg, 0.693 mmol) and 4-dimethylaminopyridine (DMAP, 68 mg, 0.554 mmol) were mixed and dissolved in 2.3 ml dichloromethane and diisopropylethylamine (DIEA) was added , 149 mg, 1.155 mmol) to interact with stirring at 25°C for 21 hours. To the resulting reaction solution was added 50 ml of dichloromethane to dilute, and then washed with 100 ml of 0.5 M triethylamine phosphate. The separated aqueous phase was extracted three times, each time using 10 ml of dichloromethane. All organic phases were combined and the solvent was removed by evaporation under reduced pressure to give the crude product. The crude product was subjected to column purification. The column was filled with 80 g of silica gel with the usual phase (200-300 mesh), was added 1 wt. % triethylamine to neutralize the acidity of the silica gel, equilibrated with dichloromethane and eluted with dichloromethane (containing 1 wt% triethylamine) : methanol = 100:18-100:20 gradient elution. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give a total of 200 mg of pure P-9 conjugating molecule product. MS m/z: C106H153N10041, [M-DMTr]+, calculated: 1921.05, measured: 1920.97.

(3-1-7) P-10 Synthesis:

[388] P-10 was obtained using the same method as in step (1-1-9) of Preparation Example 1, except that: the P-9 conjugation molecule was used to replace the L-9 conjugation molecule to obtain thus conjugating the P-9 molecule coupled to the solid phase support.

(3-2) Synthesis of P10-siHBa1M1SVP conjugate

[389] Conjugate 27 was obtained using the same method as in steps (1-2), (1-3A) and (1-4) of Preparation Example 1, except that compound P-10 was used to replace compound L-10 to start the synthesis of the sense chain. It was expected that a P10-siHBa1M1SVP conjugate with the structure represented by Formula (4) could be obtained.

Receiving Example 4

Preparation of R5-siHBa1M1SVP conjugate (conjugate 28)

(4-1) Synthesis of compound R-5

[390] Compound R-5 was synthesized as follows:

(4-1-1) Synthesis of GAL-C7-1

[391] GAL-3 (26.4 g, 80.2 mmol) obtained in accordance with the method described in step (1-1-1b) was dissolved in 134 ml of anhydrous 1,2-dichloroethane and 60 g of powder was added 4A molecular sieve followed by 7-octen-1-ol (11.3 g, 88.2 mmol) to react with stirring at room temperature for 10 minutes. Trimethylsilyl trifluoromethanesulfonate (8.9 g, 40.1 mmol) was added in an ice bath and under nitrogen to react with stirring at room temperature for 24 hours. The 4A molecular sieve powder was removed by filtration. 500 ml of saturated aqueous sodium bicarbonate solution was added to the filtrate for washing. The organic phase was isolated. The aqueous phase was extracted once with 100 ml of dichloromethane. All organic phases were combined and washed once with 250 ml of saturated brine. The organic phase was isolated and dried using anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure to dryness to give 33.3 g of GAL-C7-1 product as a yellow syrup, which was directly used in the next oxidation reaction without purification.

(4-1-2) Synthesis of GAL-C7-2

[392] GAL-C7-1 (33.3 g, 72.8 mmol) obtained in step (4-1-1) was dissolved in a mixed solvent of 160 ml of dichloromethane and 160 ml of acetonitrile, 216 ml of water and solid sodium periodate (62.3 g, 291.2 mmol), respectively, was stirred in an ice water bath for 10 minutes and the catalyst ruthenium trichloride (498 mg, 2.4 mmol) was added. The reaction mixture was naturally warmed to room temperature and stirred for 23 hours. The resulting reaction solution was diluted by adding 200 ml of water with stirring, and the pH was adjusted to 7.5 by adding a saturated sodium bicarbonate solution. The organic phase was separated and removed. The aqueous phase was extracted three times, each time using dichloromethane. The organic phases resulting from the extraction were removed. The aqueous phase resulting from the extraction was adjusted to pH approx. 3 with dry matter of citric acid and extracted three times with 200 ml of dichloromethane each time, the resulting organic phases were combined and dried using anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure, and then the residue was purified by column chromatography (ordinary phase silica gel with 200-300 mesh, gradient elution with dichloromethane:methanol=100:18-100:20) to obtain 22.4 g of product GAL-C7-2 as a white foam. MS m/z: C21H32N011, [M+H]+, calculated: 476.50, measured: 475.94.

(4-1-3) Synthesis of R-1:

[393] M-18-Tr (2.02 g, 4.69 mmol) obtained according to the method described in step (1-1-4) and GAL-C7-2 (7.36 g, 15 .48 mmol) was mixed and dissolved in 47 ml of acetonitrile, N-methylmorpholine (3.13 g, 30.96 mmol) was added, followed by 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM , 4.28 g, 15.48 mmol) to react with stirring at room temperature for 2 hours. The resulting reaction solution was diluted with 200 ml of dichloromethane. The organic phase was washed with 100 ml of saturated sodium bicarbonate solution and 100 ml of saturated brine, respectively. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure to give a crude product which was purified using a regular phase silica gel column (200-300 mesh). The column was filled with simple petroleum ether, 1 wt. % triethylamine to neutralize the acidity of the silica gel and elute with a gradient elution dichloromethane:methanol = 100:5-100:7. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 7.82 g of pure product R-1.

(4-1-4) Synthesis of R-2:

[394] R-1 (6.23 g, 3.456 mmol) was dissolved in 69 mL of dichloromethane and dichloroacetic acid (13.367 g, 103.67 mmol) was added to react at room temperature for 2 hours. The resulting reaction solution was diluted by adding 100 ml of dichloromethane, washed and adjusted to pH=7-8 with saturated sodium bicarbonate solution. The separated aqueous phase was extracted six times, each time using 30 ml of dichloromethane. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was then removed by evaporation under reduced pressure to give a crude product. The crude product was purified using a regular phase silica gel column (200-300 mesh). 10 wt. % triethylamine to neutralize the acidity of silica gel, balanced 1 wt. % with triethylamine and eluted with dichloromethane:methanol gradient elution 100:30-100:40. The solvent was removed by evaporation under reduced pressure to give 4.49 g of pure product R-2.

(4-1-5) Synthesis of R-3:

[395] R-2 (2.391 g, 1.532 mmol) and A-1 (2.342 g, 4.596 mmol) were mixed and dissolved in 16 ml of dichloromethane, 3-diethoxyphosphoryloxy-1,2,3-benzotrizine-4(3H)- it (DEPBT, 1.375 g, 4.596 mmol) followed by diisopropylethylamine (1.188 g, 9.191 mmol) to react with stirring at 25° C. for 2 hours. The organic phase was washed with 10 ml of saturated sodium bicarbonate solution. The separated aqueous phase was extracted three times, each time using 10 ml of dichloromethane. The organic phase was washed with 10 ml of saturated brine. The separated aqueous phase was extracted twice, each time using 10 ml of dichloromethane, and the resulting organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure, and the residue was dried in a foam state in a vacuum oil pump overnight to obtain a crude product. The crude product was subjected to column purification. The column was filled with 120 g of normal phase silica gel (200-300 mesh), 20 ml of triethylamine was added to neutralize the acidity of the silica gel, and equilibrated with petroleum ether containing 1 wt. % triethylamine and eluted with a gradient elution of petroleum ether:ethyl acetate:dichloromethane:N,N-dimethylformamide = 1:1:1:0.5-1:1:1:0.6. The solvent was removed by evaporation under reduced pressure to give 2.642 g of pure product R-3.

(4-1-6) Synthesis of R-4:

[396] R-3 (795 mg, 0.4074 mmol), succinic anhydride (82 mg, 0.8148 mmol) and 4-dimethylamino pyridine (DMAP, 100 mg, 0.8148 mmol) were mixed and dissolved in 4 ml dichloromethane and diisopropylethylamine (DIEA, 100 mg, 0.8148 mmol) was added to react with stirring at 25° C. for 18 hours. The resulting reaction solution was washed with 5 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted three times, each time using 5 ml of dichloromethane. All organic phases were combined and the solvent was removed by evaporation under reduced pressure to give the crude product. The crude product was subjected to column purification. The column was filled with 30 g of silica gel with the usual phase (200-300 mesh), added 1 wt. % triethylamine to neutralize the acidity of the silica gel, equilibrated with dichloromethane and eluted with dichloromethane (containing 1 wt% triethylamine) : methanol = 100:18-100:20 gradient elution. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 505 mg of pure R-4 conjugating molecule product.

(4-1-7) Synthesis of R-5

[397] R-5 was obtained using the same method as in step (1-1-9) of Preparation Example 1, except that: R-4 conjugate molecule was used to replace L-9 conjugate molecule to obtain thus conjugating the R-4 molecule coupled to the solid phase support.

(4-2) Synthesis of R5-siHBa1M1SVP conjugate

[398] Conjugate 28 was obtained using the same method as in steps (1-2), (1-3A) and (1-4) of Preparation Example 1, except that compound R-5 was used to replace compound L-10 to start the synthesis of the sense chain. It was expected that an R5-siHBa1M1SVP conjugate with the structure represented by Formula (7) could be obtained.

Receiving Example 5

Preparation of LA5-siHBa1M1SVP (conjugate 29)

[399] It was expected that the compound LA-5 can be synthesized in accordance with the following technological route:

[400] Conjugate 29 was obtained using the same method as in steps (1-2), (1-3A) and (1-4) of Preparation Example 1, except that compound LA-5 was used to replace compound L-10 to start the synthesis of the sense chain. It was expected that an LA5-siHBa1M1SVP conjugate with the structure represented by Formula (12) could be obtained.

Receiving example 6

Preparation of LB5-siHBa1M1SVP conjugate (conjugate 30)

(6-1) Synthesis of compound LB-5

[401] Compound LB-5 was synthesized according to the following method:

(6-1-1) Synthesis of LB-1:

[402] L-8 (5.0 g, 3.386 mmol) obtained according to the method described in step (1-1-6), adipic anhydride (870 mg, 6.772 mmol) and 4-dimethylaminopyridine (DMAP, 827 mg, 6.772 mmol) was mixed and dissolved in 130 ml dichloromethane, then diisopropylethylamine (DIEA, 2.2 g, 16.931 mmol) was added to react with stirring at 25° C. for 4 hours. To the resulting reaction solution was added 70 ml of dichloromethane to dilute, and then washed with 0.5 M triethylamine phosphate. The separated aqueous phase was extracted four times, each time using 10 ml of dichloromethane. All organic phases were combined and the solvent was removed by evaporation under reduced pressure to give the crude product. The crude product was subjected to column purification. The column was filled with 120 g of silica gel with the usual phase (200-300 mesh), added 1 wt. % triethylamine to neutralize the acidity of the silica gel, equilibrate with dichloromethane and elute with a gradient elution of petroleum ether: ethyl acetate: dichloromethane: methanol = 1:1:1:0.2-1:1:1:1. The solvent was removed by evaporation under reduced pressure to give 4.267 g of pure LB-1 product.

(6-1-2) Synthesis of LB-2:

[403] LB-1 (4.697 g, 2.753 mmol, combination of 2 batches) obtained according to the method described in step (6-1-1), 3-amino-1,2-propanediol (313 mg, 3.442 mmol ), 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM, 953 mg, 3.442 mmol) and N-methylmorpholine (700 mg, 6.884 mmol) were added successively to a mixture of 30 ml of acetonitrile and 3 ml of methanol for interaction with stirring at room temperature overnight. The solvent was evaporated to dryness and the residue was purified by column chromatography (normal phase silica gel 200-300 mesh, gradient elution dichloromethane:methanol = 1:0.07-1:0.5). The eluate was collected and concentrated to remove solvents to give 3.27 g of desired LB-2 product.

(6-1-3) Synthesis of LB-3:

[404] LB-2 (2.27 g, 1.353 mmol) was dissolved in 14 mL of anhydrous pyridine and 4,4'-dimethoxytrityl chloride (688 mg, 2.03 mmol) was added to react with stirring at room temperature overnight. The reaction was stopped by adding 150 ml of methanol. The solvent was evaporated to dryness and the residue was purified by column chromatography (normal phase silica gel 200-300 mesh, gradient elution dichloromethane:methanol = 1:0.05-1:0.2). The eluate was collected and concentrated to remove the solvent to give 1.647 g of the desired LB-3 product.

(6-1-4) Synthesis of LB-4:

[405] LB-3 (822 mg, 0.415 mmol), succinic anhydride (83 g, 0.83 mmol) and 4-dimethylamino pyridine (DMAP, 102 mg, 0.83 mmol) were mixed and dissolved in 4 ml dichloromethane, added DIEA (270 mg, 2.075 mmol) and stirred at 25° C. to react overnight. The resulting reaction solution was washed three times with 0.5 M triethylamine phosphate. The separated aqueous phase was extracted three times, each time using 2 ml of dichloromethane. All organic phases were combined and the solvent was removed by evaporation under reduced pressure to give the crude product. The crude product was subjected to column purification. The column was filled with silica gel with normal phase (200-300 mesh), added 5 wt. % triethylamine to neutralize the acidity of the silica gel, equilibrate with petroleum ether, and elute with a gradient elution dichloromethane (containing 1 wt. % triethylamine):methanol=100:5-100:20. The solvent was removed by evaporation under reduced pressure to give 787 mg of pure LB-4 conjugating molecule product.

(6-1-5) Synthesis of LB-5

[406] LB-5 was obtained using the same method as in step (1-1-9) of Production Example 1, except that: the LB-4 conjugator molecule was used to replace the L-9 conjugator molecule to obtain thus conjugating the LB-4 molecule coupled to the solid phase support.

(6-2) Synthesis of LB5-siHBa1M1SVP conjugate

[407] Conjugate 30 was obtained using the same method as in steps (1-2), (1-3A) and (1-4) of Preparation Example 1, except that the compound LB-5 was used to replace the compound L-10 to start the synthesis of the sense chain. It was expected that an LB5-siHBa1M1SVP conjugate with the structure represented by Formula (13) could be obtained.

Receiving Example 7

Preparation of VS-siHBa1M1SVP conjugate (conjugate 31)

[408] It was expected that the connection V-8 can be synthesized in accordance with the following technological route:

[409] Conjugate 31 was obtained using the same method as in steps (1-2), (1-3A) and (1-4) of Preparation Example 1, except that compound V-8 was used to replace compound L-10 to start the synthesis of the sense chain. It was expected that a VS-siHBa1M1SVP conjugate with the structure represented by Formula (14) could be obtained.

Receiving example 8

Preparation of WS-siHBa1M1SVP conjugate (conjugate 32)

(8-1) Synthesis of compound W-8

[410] Compound W-8 was synthesized according to the following method:

(8-1-1) Synthesis W-1:

[411] W-0 (2.024 g, 10 mmol) was dissolved in 25 ml of acetonitrile, triethylamine (4.048 g, 40 mmol) was added and cooled to approximately 0° C. in an ice water bath. Ethyl trifluoroacetate (5.683 g, 40 mmol) was added to react at room temperature for 22 hours. The solvent was removed by evaporation under reduced pressure, and the residue was dried in a foam state in a vacuum oil pump for 18 hours to obtain 5.835 g of crude solid product W-1.

(8-1-2) Synthesis W-2:

[412] The crude product W-1 (5.835 g, 10 mmol) was dissolved in 50 ml of dichloromethane. To the resulting reaction solution were added TrCl (3.345 g, 12 mmol) and triethylamine (1.518 g, 15 mmol) to react with stirring at room temperature for 20 hours. The resulting reaction solution was washed twice, each time with 20 ml of saturated sodium bicarbonate solution and once with 20 ml of saturated brine. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The organic solvent was removed by evaporation under reduced pressure, and the residue was dried in a foam state in a vacuum oil pump overnight to obtain 8.012 g of crude solid product W-2. The crude W-2 solid was used in the subsequent deprotection reaction without treatment.

(8-1-3) Synthesis W-3:

[413] The crude product W-2 (8.012 g, 10 mmol) was dissolved in 100 ml of methanol and 100 ml of an aqueous solution of methylamine (40 wt.%) was added to react with stirring at 50°C for 23 hours. Insoluble particles were removed by filtration. The solvent was removed by evaporation under reduced pressure. 200 ml of a mixed solvent of DCM:methanol in a 1:1 v/v ratio was added to the residue, and the resulting organic phase was washed with 50 ml of saturated sodium bicarbonate solution. The separated aqueous phase was extracted three times, each time using 50 ml of dichloromethane. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure, the residue was dried in a foam in a vacuum oil pump overnight and purified using a regular phase silica gel column (200-300 mesh). The column was filled with simple petroleum ether, 1 wt. % triethylamine to neutralize the acidity of the silica gel and eluted using a gradient elution dichloromethane: methanol: aqueous ammonia solution (25 wt.%) = 1:1:0.05-1:1:0.25. The eluate was collected. The solvent was removed by evaporation under reduced pressure, and the residue was dried in a foam state in a vacuum oil pump to obtain 3.062 g of pure product W-3.

(8-1-4) Synthesis W-4:

[414] W-3 (0.675 g, 1.517 mmol) and GAL-C7-2 (2.60 g, 5.46 mmol) were mixed and dissolved in 47 ml of acetonitrile, diisopropylethylamine (1.57 g, 12.14 mmol) was added ) and then 3-diethoxyphosphoryloxy-1,2,3-benzotrizin-4(3H)-one (DEPBT, 1.816 g, 6.04 mmol) to react with stirring at room temperature for 2.5 hours. The resulting reaction solution was diluted with 100 ml of dichloromethane. The resulting organic phase was washed with 80 ml of saturated sodium bicarbonate solution and 80 ml of saturated brine, respectively. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure to give a crude product which was purified using a regular phase silica gel column (200-300 mesh). The column was filled with simple petroleum ether, 1 wt. % triethylamine to neutralize the acidity of the silica gel and elute with a gradient elution dichloromethane:methanol = 100:5-100:7. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 1.610 g of pure product W-4.

(8-1-5) Synthesis W-5:

[415] W-4 (1.61 g, 0.886 mmol) was dissolved in 125 mL of dichloromethane and dichloroacetic acid (3.5 mL, 42.43 mmol) was added to react at room temperature for 1 hour. The resulting reaction solution was neutralized by adding 150 ml of pyridine. The solvent was removed by evaporation under reduced pressure to give a crude product. The crude product was purified using a regular phase silica gel column (200-300 mesh). 10 wt. % triethylamine to neutralize the acidity of silica gel, balanced 1 wt. % with triethylamine and eluted with dichloromethane:methanol gradient elution 100:30-100:40. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 1.26 g of pure product W-5.

(8-1-6) Synthesis W-6:

[416] W-5 (1.25 g, 0.793 mmol) and A-1 (1.21 g, 2.38 mmol) obtained according to the method described in step (1-1-7a) were mixed and was dissolved in 12 ml dichloromethane and 3-diethoxyphosphoryloxy-1,2,3-benzotrizin-4(3H)-one (DEPBT, 0.712 g, 2.38 mmol) was added followed by diisopropylethylamine (0.615 g, 4.76 mmol) for interaction with stirring at 25°C for 3 hours. The organic phase was washed with 80 ml of saturated sodium bicarbonate solution. The separated aqueous phase was extracted three times, each time using 10 ml of dichloromethane. All organic phases were combined and washed with 10 ml of saturated brine. The resulting organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure, and the residue was dried in a foam state in a vacuum oil pump overnight to obtain a crude product. The crude product was subjected to column purification. The column was filled with 185 g of normal phase silica gel (200-300 mesh), 20 ml of triethylamine was added to neutralize the acidity of the silica gel, and balanced with petroleum ether containing 1 wt. % triethylamine and eluted with a gradient elution of petroleum ether: ethyl acetate: dichloromethane: N,N-dimethylformamide = 1:1:1:0.1-1:1:1:0.7. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 1.57 g of pure product W-6.

(8-1-7) Synthesis W-7:

[417] W-6 (1.238 g, 0.63 mmol), succinic anhydride (0.189 g, 1.89 mmol) and 4-dimethylaminopyridine (DMAP, 0.231 g, 1.89 mmol) were mixed and dissolved in 7 ml of dichloromethane, and then DIEA (0.407 g, 3.15 mmol) was added to interact with stirring at 25° C. for 24 hours. The resulting reaction solution was washed with 5 ml of 0.5 M triethylamine phosphate. The separated aqueous phase was extracted three times, each time using 5 ml of dichloromethane. All organic phases were combined and the solvent was removed by evaporation under reduced pressure to give the crude product. The crude product was subjected to column purification. The column was filled with 30 g of silica gel with the usual phase (200-300 mesh), added 1 wt. % triethylamine to neutralize the acidity of the silica gel, equilibrated with dichloromethane and eluted with dichloromethane (containing 1 wt% triethylamine) : methanol = 100:18-100:20 gradient elution. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 1.033 g of the pure product of the W-7 conjugator molecule. MS m/z: C101H146N7038, [M-DMTr]+, calculated: 1763.92, measured: 1763.21.

(8-1-8) Synthesis W-8

[418] W-8 was obtained using the same method as in step (1-1-9) of Production Example 1, except that: the W-7 conjugator molecule was used to replace the L-9 conjugator to obtain thus conjugating the W-7 molecule coupled to the solid phase support.

(8-2) Synthesis of W8-siHBa1M1SVP conjugate

[419] Conjugate 32 was obtained using the same method as in steps (1-2), (1-3A) and (1-4) of Preparation Example 1, except that Compound W-8 was used to replace compound L-10 to start the synthesis of the sense strand. It was expected that a WS-siHBa1M1SVP conjugate with the structure represented by Formula (15) could be obtained.

Receiving example 9

Preparation of XS-siHBa1M1SVP conjugate (conjugate 33)

[420] Compound X-8 was expected to be synthesized according to the following process route:

[421] Conjugate 33 was obtained using the same method as in steps (1-2), (1-3A) and (1-4) of Preparation Example 1, except that compound X-8 was used to replace compound L-10 to start the synthesis of the sense strand. It was expected that an XS-siHBa1M1SVP conjugate with the structure represented by Formula (21) could be obtained.

Receiving example 10

Preparation of Z5-siHBa1M1SVP conjugate (conjugate 34)

(10-1) Synthesis of compound Z-5

[422] Compound Z-5 was synthesized according to the following method:

(10-1-1) Synthesis Z-1:

[423] W-3 (1.50 g, 3.37 mmol) obtained according to the method described in step (8-1-3) and GAL5-C4-2 (7.18 g, 13.48 mmol) obtained according to the method described in step (3-1-2) was mixed and dissolved in 34 ml of dichloromethane and diisopropylethylamine (3.48 g, 26.96 mmol) was added, followed by 3-diethoxyphosphoryloxy-1,2 ,3-benzotrizin-4(3H)-one (DEPBT, 4.04 g, 13.48 mmol) to react with stirring at room temperature for 4.5 hours. The resulting liquid solution was diluted with 100 ml of dichloromethane. The organic phase was washed with 80 ml of saturated sodium bicarbonate solution and 80 ml of saturated brine, respectively. All organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure to give a crude product which was purified using a regular phase silica gel column (200-300 mesh). The column was filled with simple petroleum ether, 1 wt. % triethylamine to neutralize the acidity of the silica gel and eluted with a gradient elution dichloromethane : methanol = 30:1-15:1. The eluate was collected and extraction was carried out by evaporation under reduced pressure to give 3.97 g of pure product Z-1. MS m/z: C98H143N10033, [M+H]+, calculated: 1987.98, measured: 1987.90.

(10-1-2) Synthesis Z-2:

[424] Z-1 (3.97 g, 2.00 mmol) was dissolved in 250 mL of dichloromethane and dichloroacetic acid (10.941 g, 84.85 mmol) was added to react at room temperature for 1 hour. Pyridine was added to neutralize the resulting reaction solution to neutral. The solvent was removed by evaporation under reduced pressure to give a crude product. The column was loaded with 220 g of silica gel with a normal phase with 200-300 mesh and added 10 wt. % pyridine to neutralize the acidity of silica gel, balanced 1 wt. %o with pyridine and eluted with a gradient elution dichloromethane : methanol = 10:1-2:1. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 3.49 g of pure product Z-2. MS m/z: C79H129N10033, [M+H]+, calculated: 1746.94, measured: 1746.90.

(10-1-3) Synthesis Z-3:

[425] Z-2 (3.49 g, 2.0 mmol) and A-1 (3.06 g, 6.0 mmol), obtained in accordance with the method described in step (1-1-7a), mixed and dissolved in 30 ml dichloromethane and 3-diethoxyphosphoryloxy-1,2,3-benzotrizin-4(3H)-one (DEPBT, 1.80 g, 6.0 mmol) was added followed by diisopropylethylamine (1.55 g, 12.0 mmol) for interaction for 3 hours with stirring at 25°C. To the resulting reaction solution was added 100 ml of dichloromethane to dilute. The organic phase was washed twice with 30 ml of saturated sodium bicarbonate solution. The aqueous phase was extracted with 10 ml dichloromethane. All organic phases were combined and washed with 50 ml of saturated brine. The resulting organic phases were combined, dried using anhydrous sodium sulfate and filtered. The solvent was removed by evaporation under reduced pressure, and the residue was dried in a foam state in a vacuum oil pump overnight to obtain a crude product. The crude product was subjected to column purification. The column was filled with 200 g of normal phase silica gel (200-300 mesh), 20 ml of triethylamine was added to neutralize the acidity of the silica gel. The column was balanced with a simple petroleum ether containing 1 wt. % triethylamine and eluted with dichloromethane:methanol gradient elution 25:1-15:1. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 2.2 g of pure product Z-3. MS m/z: C103H151N10038, [M+H]+, calculated: 2136.02, measured: 2136.20.

(10-1-4) Synthesis Z-4:

[426] Z-3 (2.10 g, 0.983 mmol) was dissolved in 14.8 ml of dichloromethane containing DIEA (0.635 g, 4.915 mmol), 4-dimethylaminopyridine (DMAP, 240 mg, 1.966 mmol) was added to the resulting solution and stirred until a clear solution was obtained. Added succinic anhydride (197 mg, 1,966 mmol) to interact with stirring at 25°C for 18 hours. To the resulting reaction solution was added 50 ml of dichloromethane to dilute, and washed with 80 ml of 0.5 M triethylamine phosphate. The aqueous phase was extracted twice, each time using 50 ml of dichloromethane. All organic phases were combined and the solvent was removed by evaporation under reduced pressure to give the crude product. The crude product was subjected to column purification. The column was filled with 188 g of silica gel with the usual phase (200-300 mesh), added 1 wt. % triethylamine to neutralize the acidity of the silica gel, equilibrated with dichloromethane and eluted with dichloromethane (containing 1 wt ‰ triethylamine) : methanol = 10:1-3:1 gradient elution. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 1.95 g of pure Z-4 conjugate molecule product. MS m/z: C107H155N10041, [M+H]+, calculated: 1935.07, measured: 1935.29.

(10-1-5) Synthesis Z-5

[427] Z-5 was obtained using the same method as in step (1-1-9) of Preparation Example 1, except that: the Z-4 conjugation molecule was used to replace the L-9 conjugation molecule to obtain thus conjugating the Z-4 molecule coupled to the solid phase support.

(10-2) Synthesis of conjugate Z5-siHB1M1SVP

[428] Conjugate 34 was obtained using the same method as in steps (1-2), (1-3A) and (1-4) of Preparation Example 1, except that compound Z-5 was used to replace compound L-10 to start the synthesis of the sense chain. It was expected that a Z5-siHB1M1SVP conjugate with the structure represented by Formula (22) could be obtained.

Preparation Example 11: This preparation example was used to illustrate the preparation of conjugates 35-49

[429] In this production example, conjugates 35-49 were synthesized. The sequences of the conjugated miRNAs in the conjugates are shown in Table 3.

(11-1) Synthesis of FIN-2 conjugating molecule

[430] The FIN-2 conjugating molecule was synthesized according to the preparation method described in Rajeev et al., ChemBioChem 2015, 16, 903-908, according to the following workflow:

(11-1-1) Synthesis of PRO-10

(11-1-1a) Synthesis of PRO-7

[431] 2.93 g PRO-6 (L-hydroxyproline, CAS no. 51-35-4, purchased from Energy Chemical, 22.4 mmol) was dissolved in 22.5 ml of 1,4-dioxane (CAS no. 123-91 -1) and added 34 ml of 10% (wt./mass.) aqueous solution of Na ₂ CO ₃ in the form of a suspension. 6.95 g Fmoc-Cl (9-fluorenylmethyl chloroformate, CAS No. 28920-43-6, purchased from Energy Chemical, 26.8 mmol) was dissolved in 34 ml of 1,4-dioxane, added to the above suspension in an ice bath and naturally warmed to room temperature to react overnight. The reaction solution was poured into 150 ml of ice water and extracted three times, each time using 100 ml of methyl tert-butyl ether, and the resulting organic phases were removed. The remaining aqueous phase was adjusted to pH≤5 with concentrated hydrochloric acid, extracted twice, each time using 100 ml of ethyl acetate. The resulting organic phases were combined and dried using anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure to give 7.83 g of PRO-7 product as a white foamy solid. H ¹ -NMR (400 MHz, DMSO-d ₆ ) δ 7.91 (t, J=7.2 Hz, 2H), 7.67 (d, J=7.5 Hz, 2H), 7.48- 7.39 (m, 2H), 7.38-7.27 (m, 2H), 5.17 (s, 1H), 4.27 (s, 2H), 4.23-4.11 (m, 2H), 3.55-3.41(m, 3H), 2.31-2.10(m, 1H), 2.08-1.88(m, 1H). HRMS (ESI) m/z, calculated for C ₂₀ H ₁₉ NO ₅ [MH]-: 352.1190, measured: 352.1033.

(11-1-1b) Synthesis of PRO-8

[432] 7.83 g PRO-7 (22.2 mmol) was dissolved in 80 ml THF (CAS no. 109-99-9), heated to 65°C in an oil bath, 36.6 ml of a 2 mol/l solution was added BH ₃ -Me ₂ S in THF (CAS No. 13292-87-0, purchased from J&K Scientific Ltd., 73.2 mmol) under reflux, and continuously heated under reflux to react for 3 hours. The reaction solution was poured out, and the remaining solid was dissolved in methanol. Methanol was added to the resulting reaction solution with stirring until gas evolution ceased, and stirred continuously for 30 minutes. The solvent was removed by evaporation under reduced pressure, and then the residue was purified three times using simple petroleum ether to obtain 7.1 g of the product PRO-8 as a white solid. H ¹ -NMR (400 MHz, DMSO-d ₆ ) δ 7.91 (t, J=6.7 Hz, 2H), 7.67 (d, J=7.2 Hz, 2H), 7.49- 7.39 (m, 2H), 7.38-7.26 (m, 2H), 5.18 (dd, J=6.1, 3.8 Hz, 1H), 4.28 (s, 2H) , 4.23-4.13(m, 2H), 3.55-3.38(m, 2H), 2.32-2.11(m, 1H), 2.08-1.89(m, 1H). HRMS (ESI) m/z, calculated for C ₂₀ H ₂₁ NO ₄ [M+Na] ⁺ 362.1368, measured: 362.1012.

(11-1-1s) Synthesis of PRO-9

[433] 7.1 g PRO-8 (21 mmol) was dissolved in 100 ml pyridine and 14.2 g DMTr-Cl (4,4'-dimethoxytrityl chloride, 42 mmol) was added to react with stirring at room temperature for 5 hours. The solvent was removed by evaporation under reduced pressure. The resulting crude product was dissolved in ethyl acetate and filtered to remove salt impurities. The solvent was removed by evaporation under reduced pressure, and then the residue was purified using a silica gel column. For purification, the crude product, dissolved in DCM, was loaded onto a silica gel column pre-treated with pyridine to alkalize the column. DMTr-Cl was eluted with DCM containing 1% (v/v) pyridine and then the product was eluted with ethyl acetate. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 8.2 g of PRO-9 product as a white solid. HRMS (ESI) m/z, calculated for C ₄₁ H ₃₉ NO ₆ [M+Na]+664.2675, measured: 664.2348; C18 RP-HPLC (Batch No. JJS160324-1); purity: 94.20%.

(11-1-1d) Synthesis of PRO-10

[434] 8.2 g PRO-9 (12.8 mmol) was dissolved in 64 ml DMF and 40 ml piperidine (384 mmol) was added to react with stirring at room temperature for 30 minutes. The reaction solution was poured into 300 ml of ice water and extracted three times, each time using 150 ml of ethyl acetate. The resulting organic phases were combined and washed with 200 ml of saturated brine, and the organic phase resulting from the washing was dried using anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure, and then the residue was purified using a silica gel column. For purification, the crude product, dissolved in DCM, was loaded onto a silica gel column pre-treated with pyridine to alkalize the column. Fmoc was eluted with DCM containing 1% (v/v) pyridine and then the product was eluted with ethyl acetate. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 4.65 g of PRO-10 product as a white solid. H ¹ -NMR (400 MHz, DMSO-d ₆ ) δ 7.40 (d, J=7.2 Hz, 2H), 7.35-7.18 (m, 7H), 6.93-6.84 (m, 4H), 4.56 (d, J=3.9 Hz, 1H), 4.12 (s, 1H), 3.74 (s, 6H), 3.46-3.37 (m, 1H), 2.88 (ddd, J=18.5, 10.0, 5.5 Hz, 2H), 2.75 (dd, J=8.7, 5.8 Hz, 1H), 2.62 (dd, J=11.0, 2.7 Hz, 1H), 1.74-1.65 (m, 1H), 1.40 (ddd, J=12.9, 8.5, 5.9 Hz , 1H); HRMS (ESI) m/z, calculated for C ₂₆ H ₂₉ NO ₄ [M+Na] ⁺ 442.1994, measured: 442.1999; C18 RP-HPLC (batch no. JJS160329-1), purity: 97.07%.

(11-1-2) Synthesis of FIN-1

[435] GAL-5 (4.5 g, 10 mmol), obtained in accordance with the method described in step (1-1-1), was dissolved in 40 ml of DMF, sequentially adding 3.9 g of DIEA (N,N -diisopropylethylamine, CAS No. 7087-68-5, purchased from Aladdin Inc., 30 mmol) and 3.8 g HBTU (benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate, CAS No. 94790-37-2, purchased from Aladdin Inc., 11 mmol) and stirred at room temperature for 10 minutes. PRO-10 (4.2 g, 10 mmol) obtained in step (11-1-1d) was dissolved in 40 ml DMF and was added to the above reaction solution. The resulting reaction solution was dried by adding anhydrous sodium sulfate and stirred at room temperature for 2 hours. The reaction solution was poured into 120 ml of ice water and extracted three times, each time using 60 ml of ethyl acetate. The resulting organic phases were combined, washed with 20 ml of water and 20 ml of saturated brine, respectively. The organic phase resulting from the washing was isolated and dried using anhydrous sodium sulfate. The solvent was removed by evaporation under reduced pressure, and then the residue was purified using a silica gel column. For purification, the sample was loaded onto a silica gel column pretreated with pyridine to make the column alkaline and eluted with a dichloromethane (DCM) solution containing 1% (v/v) triethylamine and 1% (v/v) methanol. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 6.5 g of FIN-1 product as a light yellow foamy solid. H ¹ -NMR (400 MHz, DMSO-d ₆ ) δ 7.83 (d, J=9.2 Hz, 1H), 7.32 (t, J=6.6 Hz, 4H), 7.20 ( td, J=8.9, 3.5 Hz, 5H), 6.93 - 6.84 (m, 4H), 5.21 (d, J=3.2 Hz, 1H), 5.04 - 4 .90 (m, 2H), 4.49 (s, 1H), 4.40 (d, J=4.4 Hz, 0.8H), 4.31 (d, J=5.0 Hz, 0, 2H), 4.15(s, 1H), 4.03(s, 3H), 3.93(s, 1H), 3.74(s, 7H), 3.59(dt, J=12.0 , 6.0 Hz, 1H), 3.50-3.40 (m, 1H), 3.39-3.25 (m, 3H), 3.13 (dd, J=8.9, 5.2 Hz, 1H), 3.00 (dq, J=9.3, 5.3, 4.3 Hz, 1H), 2.22 (s, 2H), 2.07 (s, 3H), 1.99 (s, 3H), 1.90 (s, 4H), 1.74 (s, 3H), 1.50 (s, 3H), 1.36 (s, 1H). C18 RP-HPLC (batch no: LJ160422), purity: 95.45%. (11-1-3) Synthesis of FIN-2

[436] FIN-1 (3.0 g, 3.53 mmol) obtained in step (11-1-2) and acetonitrile were heated for azeotropic dehydration, vacuum dried under reduced pressure, dissolved in 10 ml of DMF (dried immersion in a molecular sieve), 2.13 g of PA (bis(diisopropylamino)(2-cyanoethoxy)phosphine, Adamas Inc., product catalog number 11356 B, 7.06 mmol) and 346 mg of tetrazole (CAS No. 288-94- 8, purchased from Aladdin Inc., 4.94 mmol) under nitrogen and stirred to react at room temperature. The reaction mixture was supplemented with 10 ml of DMF and continuously stirred to react for 1 hour. The solvent was removed by evaporation under reduced pressure, and then the residue was purified by silica gel column chromatography. For purification, the crude product, dissolved in DCM, was loaded onto a silica gel column pretreated with pyridine to make the column alkaline and eluted with ethyl acetate. The eluate was collected and the solvent was removed by evaporation under reduced pressure to give 4.5 g of crude product as a colorless syrup. The crude product was completely dissolved in 50% (v/v) aqueous acetonitrile and purified using a medium pressure column (C-18, 330 g, 300 Å) pretreated with 1% (v/v) pyridine in acetonitrile to alkalinize the column. The product peak was collected by gradient elution and the solvent was removed by evaporation under reduced pressure to give 2.2 g of the FIN-2 conjugating molecule product as a white powder. P ³¹ -NMR (162 MHz, CDCl ₃ ) δ 148.04, 147.94, 147.62, 147.19, P ³¹ -NMR purity: 92%; C18 purity RP-HPLC: 90.54%.

(11-2) Linking the FIN-2 conjugating molecule to a solid phase support

[437] A conjugation group (FIN_FIN_FIN) was linked to the 3' end of the sense strand of RNA by linking the FIN-2 conjugation molecule obtained in step (11-1-3) to a universal solid phase support (UnyLinker™ loaded ^NittoPhase® HL solid supports) using the method of solid-phase synthesis of nucleic acids within three reaction cycles.

[438] Connection of the FIN_FIN_FIN conjugation group was performed according to the method described in Rajeev et al., Chem Bio Chem 2015, 16, 903-908. In particular, the hydroxyl-protecting group was first removed from the above-mentioned universal solid phase support, and then the solid phase support, which was subsequently brought into contact and coupled with the FIN-2 conjugation molecule in a coupling reaction condition in the presence of a coupling agent, and the FIN conjugation molecule connected to the solid phase support , was obtained after the capping and oxidation reaction.

In addition, the DMTr hydroxyl protecting group was removed from the FIN conjugation molecule coupled to the solid phase support, and the solid phase support was then contacted and coupled to another FIN-2 conjugation molecule, followed by a capping and oxidation reaction. By repeating the above steps of deprotection-coupling-capping-oxidation, a third FIN-2 conjugation molecule was attached, and thus a conjugation group (FIN_FIN_FIN) coupled to the solid phase support was obtained.

[439] In the reactions described above, the reaction conditions for deprotection, coupling, capping, and oxidation, as well as the amounts of solvents and reagents, are similar to those used in the solid-phase nucleic acid synthesis method described in step (1-2) above.

(11-3) Synthesis of conjugates 35-49

[440] The subject conjugates were obtained using the same methods as in steps (1-2) to (1-4) of Preparation Example 1, except that: 1) the compound obtained in step (11-2) was used in order to start the synthesis of the semantic chain; and 2) the conjugated siRNAs had sequences corresponding to conjugates 35-49 shown in Table 3.

[441] The molecular weight was measured using an LC-MS instrument (liquid chromatography-mass spectrometry purchased from Waters Corp., model: LCT Premier). The results showed that the measured values were consistent with the calculated values, and thus it was confirmed that the synthesized conjugates were designed compounds of interest that have the structure represented by Formula (307).

Receiving Example 12

Preparation of Comparative Conjugate 2

[442] In this preparation example, comparative conjugate 2 was synthesized. The sequence of the conjugated siRNA in this conjugate is shown in Table 3. This conjugate has the same structure as compound AD-66810 described in US Patent Application 15/597225.

(12-1) Synthesis of (GalNAc)3 conjugating molecule

[443] Compound 30, i. e. a conjugating molecule containing the aforementioned linker -(LA) ₃ ^{-trihydroxymethylaminomethane-L B -} and a targeting group, an N-acetylgalactosamine molecule (where each L ^A can be connected to one N-acetylgalactosamine molecule so that one linker can be connected to three N-acetylgalactosamine molecules) were synthesized according to the preparation method described in WO 2014025805 A1. This conjugating molecule may also be referred to as the (GalNAc) ₃ conjugating molecule, and the structure of compound 30 is shown as follows:

(12-2) Compound (GalNAc) ₃ conjugating molecules with solid phase support

[444] The (GalNAc) ₃ conjugating group was coupled to the solid phase support by the same method as in step (1-1-9) of Preparation Example 1 to obtain the (GalNAc) ₃ conjugation group coupled to the solid support.

(12-3) Synthesis of comparative conjugate 2

[445] Comparative conjugate 2 was obtained using the same method as in steps (1-2), (1-3D) and (1-4) of Preparation Example 1, except that: 1) the compound obtained by steps (12-2) were used to start the synthesis of the sense strand; and 2) the conjugated siRNA had the sequence shown under No. AD-66810 in Table 1.

[446] The molecular weight was measured by liquid chromatography-mass spectrometry (LC-MS, purchased from Waters Corp., model: LCT Premier). The results showed that the measured values were consistent with the calculated values, and thus it was confirmed that the synthesized conjugate was the designed target compound which has the structure represented by Formula (305).

Experimental example 1

Toxicity of siRNA conjugates according to the present invention

[447] In C57BL/6J mice, conjugate 1 (0.9 wt.% aqueous NaCl solution, injection volume 10 ml/kg, concentrations 10 mg/ml and 20 mg/ml, each concentration was used for 6 mice: three males and three females) were administered subcutaneously to each mouse at a single dose of 100 mg/kg or 200 mg/kg (based on siRNA). During the treatment period, continuous clinical observation was performed, which did not reveal the death of animals and any clinical symptoms associated with adverse drug responses. 24 hours after administration, blood samples were taken for clinical pathology and the mice were sacrificed. The results show that no abnormalities were found in the study of clinical pathology and macroscopic anatomy. Thus, the above results indicate that the conjugates of the present invention have a relatively low toxicity at the animal level.

Experimental example 2

This experiment illustrated the stability of the siRNA conjugates of the present invention (Experimental Example 2-1) Stability of the siRNA conjugates of the present invention in a lysosome lysate under in vitro conditions. [448] Preparation of test samples treated with lysosome lysate: comparative conjugate 2 and conjugates 49, 36, 37, 38, 39, 43, 45 (each provided in the form of 0.9 wt.% aqueous NaCl solution, in which the concentration of siRNA is 20 µM, 6 µl for each group) were thoroughly mixed separately with 27.2 µl of an aqueous solution of sodium citrate (pH=5.0), 4.08 µl of deionized water and 2.72 µl of tritosomes (purchased from Xenotech Inc., catalog number R0610LT, batch #1610069) and incubated at a constant temperature of 37°C. Samples of 5 µl were taken at each time point of 0 h, 1 h, 2 h, 4 h, 6 h, 8 h, 24 h and 48 h, respectively, were added to 15 µl of 9 M urea for denaturation and 4 µl was added 6× buffer for loading (purchased from Solarbio Inc., catalog number 20160830), then immediately cryopreserved in a freezer at -80°C to stop the reaction. 0 hours is the point in time when the sample was taken immediately after the samples to be tested were thoroughly mixed with the lysosome lysate.

[449] Preparation of control samples not treated with lysosome lysate: 1.5 µl of each of the above conjugates in an equimolar amount (20 µM) were thoroughly mixed with 7.5 µl of an aqueous solution of sodium citrate (pH=5.0) and 1 µl of deionized water was added to 30 μl of 9 M urea solution for denaturation, and 8 μl of 6× loading buffer was added, then immediately cryopreserved in a freezer at -80°C to stop the reaction. The control sample for each conjugate is marked on the electropherogram as Con.

[450] Prepared 16 wt. % non-denaturing polyacrylamide gel. 20 μl of each of the test samples and controls described above were applied to the electrophoresis gel at a constant current of 20 mA for 10 minutes, and then at a constant current of 40 mA for 30 minutes. After completion of electrophoresis, the gel was placed on a shaker and stained with Gelred dye (BioTium, catalog number 13G1203) for 10 minutes. The gel was subjected to visualization, observation and photocopying. The results are shown in FIG. one.

[451] In FIG. 1 shows a semi-quantitative result of determining the stability of the tested siRNA conjugates in tritosome under in vitro conditions. The results indicate that the conjugates of the present invention can remain intact for a long time in the tritosome, showing good stability.

[452] As can be seen from the results in FIG. 1, siRNAs with specific modifications according to the present invention exhibit satisfactory stability in lysosome lysate.

(Experimental example 2-2)

Stability of miRNA conjugates in lysosome lysate under in vitro conditions

[453] Stability was measured using the same method as in Experimental Example 2-1, except that the samples to be tested are conjugates 1 and 6, sequences 1 and 2, and NS negative control, and the incubation period s tritosomes is 0 h, 5 min, 15 min, 30 min, 1 h, 2 h, 4 h and 8 h, respectively. While the sequences of Sequences 1 and 2 are shown below and can be obtained using solid phase synthesis methods commonly used in the art:

Sequence 1:

Sense strand: CCUUGAGGCAUACUUCAAA (SEQ ID NO: 143)

Antisense strand: UUUGAAGUAUGCCUCAAGGUC (SEQ ID NO: 144)

Sequence 2:

Sense chain: CmsCmsUmUmGiAmGiGfCfAmUmAmCmUmUmCmAmAmAm (SEQ ID NO:145)

Antisense strand: VP-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsCm (SEQ ID NO: 146)

[454] The results of non-denaturing polyacrylamide gel electrophoresis are shown in FIG. 2.

[455] In FIG. 2 shows a semi-quantitative result of determining the stability of the tested siRNA conjugates in tritosome under in vitro conditions. The results indicate that the conjugates of the present invention can remain intact for a long time in the tritosome, showing good stability.

(Experimental example 2-3)

Stability in human plasma

[456] Conjugates 1 and 6, sequences 2 and 3, and the negative NS control (each provided as 0.9 wt.% aqueous NaCl solution, in which the concentration of siRNA is 20 μM, 12 μl for each group) were separately thoroughly mixed with 108 μl of 90% human plasma (diluted in PBS) and incubated at a constant temperature of 37°C. Samples of 10 µl were taken at each time point of 0 h, 2 h, 4 h, 6 h, 8 h, 24 h, 48 h and 72 h, respectively, and immediately frozen in liquid nitrogen and cryopreserved in a freezer at -80°C . After sampling at each time point, each cryo-preserved sample was diluted 5 times with 1×PBS (pH=7.4) and then taken in a volume of 10 μl for use. At the same time, each of the samples to be tested was taken in equimolar amounts (2 μM, 2 μl) and thoroughly mixed with 8 μl of 1×PBS (pH=7.4) to obtain 10 μl of samples not treated with human plasma ( designated as Con). Prepared 20 wt. % non-denaturing polyacrylamide gel. Each of the above cryopreserved sample was mixed with 4 µl of loading buffer (aqueous solution of 20 mM EDTA, 36 wt.% glycerol and 0.06 wt.% bromophenol blue) and then applied to the above gel for electrophoresis at a constant current of 80 mA for 60 minutes. After completion of electrophoresis, the gel was stained with 1x Sybr Gold (Invitrogen, cat. no. 11494) for 15 minutes followed by imaging. The results are shown in FIG. 3. While the sequence of Sequence 3 is shown below and can be obtained using solid phase synthesis methods commonly used in the art:

Sequence 3:

Sense chain: CmsCmsUmUmGiAmGiGfCfAmUmAmCmUmUmCmAmAmAm (SEQ ID NO: 147)

Antisense strand:

VPUmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm (SEQ ID NO: 148)

[457] In FIG. 3 shows a semi-quantitative result of determining the stability of the test conjugates in human plasma under in vitro conditions.

[458] As can be seen from the results in FIG. 3, in human plasma, the conjugates of the present invention remain intact for up to 72 hours, showing excellent stability in human plasma.

(Experimental example 2-4)

Stability of conjugates in monkey plasma

[459] Conjugates 1 and 6, as well as sequences 2 and 3 (each provided in the form of 0.9 wt.% aqueous NaCl solution, in which the concentration of siRNA is 20 μm, 12 μl for each group) were thoroughly mixed separately with 108 μl 90% cynomolgus monkey plasma (monkey plasma purchased from HONGQUAN Bio, catalog number HQ70082, diluted in PBS) and incubated at a constant temperature of 37°C. Samples of 10 µl were taken at each time point of 0 h, 2 h, 4 h, 6 h, 8 h, 24 h, 48 h and 72 h, respectively, and immediately frozen in liquid nitrogen and cryopreserved in a freezer at -80°C . After sampling at each time point, each sample was diluted 5 times with 1×PBS (pH=7.4) and then taken in a volume of 10 μl for use. At the same time, each of the samples to be tested was taken in equimolar amounts (2 μM, 2 μl) and thoroughly mixed with 8 μl of 1×PBS (pH=7.4) to obtain 10 μl of samples not treated with monkey plasma (indicated like Con). Prepared 20 wt. % non-denaturing polyacrylamide gel. Each cryopreserved sample was mixed whole with 4 µl of loading buffer (aqueous solution of 20 mM EDTA, 36 wt.% glycerol and 0.06 wt.% bromophenol blue) and then applied to the above gel to perform electrophoresis at a constant current of 80 mA for 60 minutes. After completion of electrophoresis, the gel was stained with 1x Sybr Gold (Invitrogen, cat. no. 11494) for 15 minutes followed by imaging. The results are shown in FIG. four.

[460] In FIG. 4 shows a semi-quantitative result of determining the stability of the tested siRNA in monkey plasma under in vitro conditions.

[461] As follows from the results presented in FIG. 4, in cynomolgus monkey plasma, the siRNA conjugates of the present invention remain intact up to 72 hours, showing excellent stability in monkey plasma.

(Experimental example 2-5)

This experiment illustrated the stability of the siRNA conjugates of the present invention in lysosome lysate under in vitro conditions.

[462] The X2M2 negative control sequence used in this experimental example is shown below:

Sense strand: 5'-CmCmUmUmGAGGCmAUmACmUmUmCmAAAdT-S-dT-3' (SEQ ID NO: 149)

Antisense strand: 5'-UfUmUfGAAGUfAUGCCUfCAAGGdT-S-dT-3' (SEQ ID NO: 150).

[463] This siRNA was synthesized using the solid phase phosphoamidite synthesis method. Negative control and conjugate 2 were made with 0.9 wt. % NaCl aqueous solution, respectively, to give 20 µM aqueous solutions (based on siRNA concentration), which were labeled X2M2 and conjugate 2.

1) Determination of stability in a lysate of lysosomes obtained from a rat

[464] Preparation of test specimens treated with lysosome lysate: 6 μl of each of conjugate 2 and X2M2 (20 μM) were thoroughly mixed separately with 27.2 μl of aqueous sodium citrate solution (pH=5.0), 4.08 μl of deionized water and 2.72 µl of mouse lysosome lysate (rat liver tritosomes, purchased from Xenotech Inc., catalog number R0610.LT, lot #1610069, with a final concentration of acid phosphatase of 0.2 mU/µl) and incubated at a constant temperature of 37°C. 5 µl of the mixed solution was taken at each time point of 0 h, 1 h, 2 h, 4 h, 6 h and 24 h, respectively, was added to 15 µl of 9 M urea solution for denaturation, and 4 µl of 6× loading buffer was added (purchased from Solarbio Inc., catalog number 20160830), then immediately cryopreserved in a freezer at -80°C to stop the reaction. 0 h is the time point when the sample was taken immediately after the samples to be tested were thoroughly mixed with the lysosome lysate.

[465] Preparation of control samples not treated with lysosome lysate: 1.5 µl of each of conjugate 2 and X2M2 (20 µM) in equimolar amounts were thoroughly mixed with 7.5 µl of aqueous sodium citrate solution (pH=5.0) and 1 µl deionized water was added to 30 μl of 9 M urea solution for denaturation, and 8 μl of 6× loading buffer was added, then immediately cryopreserved in a freezer at -80°C to stop the reaction. For each electrophoresis image, the corresponding control sample was labeled M. 16 wt. % non-denaturing polyacrylamide gel. 20 μl of each of the test sample and the control sample described above were applied to the electrophoresis gel at a constant current of 20 mA for 10 minutes, and then at a constant current of 40 mA for 30 minutes. After completion of electrophoresis, the gel was placed on a shaker and stained with Gelred dye (BioTium, catalog number 13G1203) for 10 minutes. The gel was subjected to visualization, observation and photocopying. The results are shown in FIG. 5.

2) Determination of stability in human lysosome lysate

[466] The stability of X2M2 and conjugate 2 in human lysosome lysate was measured using the same method as in 1), except that mouse lysosome lysate was replaced with human lysosome lysate (human liver lysosomes purchased from Xenotech Inc., catalog number R0610.L, serial no. 1610316). The results are shown in FIG. 6.

[467] The results in FIG. 5 and 6 indicate that the siRNA conjugates of the present invention can remain intact for at least 24 hours in both human-derived lysosome lysate and mouse lysosome lysate, exhibiting satisfactory stability.

Experimental Example 3

Results of a pharmacokinetic study of conjugates 1 and 6 in rats in vivo

[468] In this experimental example, conjugates 1 and 6 were administered to rats in each experimental group (10 rats per group, five males and five females) by subcutaneous injection, respectively, at a single dose of 10 mg/kg and 50 mg/kg. Then, at each time point, the concentration of the drug in plasma, liver and kidney tissues of rats was measured.

[469] The SD rats used in this experimental example were provided by Beijing Vital River Laboratory Animal Technology Co., Ltd.

[470] First, SD rats were randomly divided into groups according to body weight and sex using the PRISTIMAdata system, version 7.2.0, and then, respectively, conjugates were administered to each group in accordance with the planned dosage. Drug dosages for all animals were calculated according to body weight (single administration (subcutaneous), administration dosage of 10 mg/kg and 50 mg/kg as 0.9% NaCl aqueous solution containing 1 mg/mL and 5 mg/mL conjugates, and the volume of administration is 10 ml/kg). Whole blood of rats was collected from the jugular vein before and after 5 minutes (±30 seconds), 30 minutes (±1 minute), 1 hour (±2 minutes), 2 hours (±2 minutes), 6 hours (±5 minutes) , 24 hours (±10 minutes), 48 hours (±20 minutes), 72 hours (±20 minutes), 120 hours (±30 minutes) and 168 hours (±30 minutes) after administration. Then the whole blood samples were centrifuged at 1800×g at 2-8°C for 10 minutes to separate the plasma. Approximately 70 μl of the plasma sample was placed in one tube and the remainder of the sample was placed in another, both tubes were cryopreserved at -70 to -86°C for determination. Liver and kidney tissues were collected at 24, 48, 72, 120 and 168 hours after administration using a method involving anesthesia of rats with sodium pentobarbital according to their weight (60 mg/kg, intraperitoneal injection), euthanasia of rats by taking blood from the abdominal aorta and performing a macroscopic anatomy study. Liver and kidney samples from each rat were taken and stored in a 1 ml cryotube at a temperature below -68°C until determination and analysis.

[471] The concentrations of conjugates 24 and 25 in plasma, liver and kidney tissues of rats were quantified using high performance liquid chromatography with fluorescence detection (HPLC-FO) in accordance with the following specific steps:

(1) tissue grinding to obtain a tissue mass of not more than 80 mg, then adding tissue and cell lysis solution (supplier: Epicentre, catalog number MTC096H) to obtain 66.7 mg/ml tissue homogenate;

(2) treatment of the tissue homogenate with ultrasound (150 W, 30 s) to destroy the cells;

(3) for tissue samples, add 75 µl of tissue samples to a 96-well PCR plate, add 5 µl of proteinase K (supplier: Invitrogen, cat. no. 25530-015) and 10 µl of a 10 wt. % acetonitrile and 0.01 wt. % tween-20; for plasma samples, add 20 µl of plasma to a 96-well PCR plate, add 45 µl of tissue and cell lysis solution, 5 µl of proteinase K, and 20 µl of a mixed aqueous solution of 10 wt. % acetonitrile and 0.01 wt. % tween-20;

(4) blocking the plates, placing them in a PCR instrument (supplier: Applied Biosystems, model: ^GeneAmp® PCR 9700 system) and incubating at 65° C. for 45 minutes;

(5) after the end of the incubation, add 10 µl of 3 M aqueous KCl solution (supplier: Sigma-Aldrich, catalog number 60135-250ML), shake thoroughly and centrifuge at 3200 rcf at 4°C for 15 minutes;

(6) for tissue samples, add 80 µl of supernatant to 120 µl of hybridization mix solution (composition: 0.5 ml of 6 µM PNA probe (supplier: TAHE-PNA), 1 ml of 200 mM Trizma/pH=8.5 ml 8 M aqueous urea solution, 3.5 ml H ₂ O, 2 ml acetonitrile);

for plasma samples, add 40 µl supernatant to 160 µl hybridization mix solution (composition: 0.5 ml 6 µM PNA probe, 1 ml 200 mM Trizma/pH=8, 5 ml 8 M urea aqueous solution, 7.5 ml H ₂ O, 2 ml acetonitrile);

(7) blocking the plates, placing them in the PCR instrument, incubating at 95° C. for 15 minutes, then immediately placing them on ice for 5 minutes;

(8) transferring samples to new 96-well conical bottom plates, shaking and centrifuging at 3200 rcf for 1 minute;

(9) injection of samples for detection and quantification using HPLC-PO (liquid phase system supplier: Thermo Fisher, chromatograph model: ultimate 3000).

[472] The results of the analysis can be found in FIG. 7-14, while in FIG. 7-10 show metabolic time-dependence curves of rat plasma PK/TK and rat liver and kidney PK/TK concentrations for conjugate 1 at 10 mg/kg or 50 mg/kg, respectively; and Fig. 11-14 show metabolic time-dependence curves of rat plasma PK/TK and rat liver and kidney PK/TK concentrations for conjugate 6 at 10 mg/kg or 50 mg/kg, respectively. In particular, Fig. 7 is a metabolic curve versus time showing plasma concentration PK/TK for conjugate 1 at 10 mg/kg in rat plasma.

Fig. 8 is a metabolic curve versus time showing PK/TK tissue concentrations for Conjugate 1 at 10 mg/kg in rat liver and kidney.

Fig. 9 is a metabolic curve versus time showing plasma concentration PK/TK for conjugate 1 at 50 mg/kg in rat plasma.

Fig. 10 is a metabolic curve versus time showing PK/TK tissue concentrations for Conjugate 1 at 50 mg/kg in rat liver and kidney.

Fig. 11 is a metabolic curve versus time showing plasma concentration PK/TK for conjugate 6 at 10 mg/kg in rat plasma.

Fig. 12 is a metabolic curve versus time showing PK/TK tissue concentrations for conjugate 6 at 10 mg/kg in rat liver and kidney.

Fig. 13 is a metabolic curve versus time showing plasma concentration PK/TK for conjugate 6 at 50 mg/kg in rat plasma.

Fig. 14 is a metabolic curve versus time showing PK/TK tissue concentrations for conjugate 6 at 50 mg/kg in rat liver and kidney.

[473] As can be seen from the results in FIG. 7-14, the concentrations for conjugates 1 and 6 in rat plasma rapidly decreased below the limit of detection within several hours, while the concentrations in rat liver tissue were maintained at a relatively high and stable level for at least 168 hours, as at low dosage (10 mg/kg) and relatively high dosage (50 mg/kg). This indicates that the siRNA conjugate of the present invention can be specifically and significantly enriched in the liver and can remain stable while exhibiting a high degree of targeting.

Experimental Example 4 This experiment illustrates the inhibitory efficacy of the siRNA conjugates of the present invention on HBV mRNA expression in vivo.

[474] In this experimental example, the inhibitory efficacy of conjugates 5 and 7 on HBV mRNA expression was studied in C57BL/6J-Tg(Alb1HBV)44Bri/J mice transgenic for HBV.

[475] Serum HBsAg in mice was measured using a hepatitis B surface antigen (ELISA) kit (Shanghai Kehua Bio-engineering Co., Ltd.). Mice with S/COV>10 were selected and randomly divided into groups (all females, 4 mice in each group) and respectively numbered as conjugate 5 and conjugate 7, and the group receiving saline (NS ). Drug dosages for all animals were calculated according to body weight (single administration (subcutaneously), administration dosage of 1 mg/kg and 0.1 mg/kg in the form of 0.9% aqueous NaCl solution containing 0.2 mg/ml and 0.02 mg/ml conjugates, and injection volume 5 ml/kg). Animals were sacrificed 14 days after administration. The liver was then collected and stored with RNA (Sigma Aldrich) and the liver tissue was homogenized with a tissue homogenizer. Total RNA was then extracted and prepared using Trizol according to standard total RNA extraction procedures.

[476] The expression level of HBV mRNA in liver tissue was determined using real-time fluorescent qPCR. In particular, the extracted total RNA was subjected to reverse transcription to obtain cDNA using the ImProm-II™ reverse transcription kit (Promega) according to the instructions, and then the inhibitory efficacy of siRNA on HBV mRNA expression in liver tissue was determined using the fluorescent qPCR kit. (Beijing Cowin Biosicences Co., Ltd). In the fluorescent qPCR method, the β-actin gene was used as an internal control gene, HBV and β-actin were determined using primers for HBV and β-actin, respectively.

[477] The primer sequences for determination are shown in Table 4.

[478] In this fluorescent qPCR method, HBV mRNA expression was expressed as residual HBV X gene expression and calculated using the following equation:

Residual expression of HBV gene X = (number of copies of HBV gene X in the test group / number of copies of the β-actin gene in the test group) / (number of copies of the HBV gene in the control group / number of copies of the β-actin gene in the control group) × 100%, which is marked in the figures as HBV/β-actin mRNA X expression.

[479] Then the percentage of inhibition of the conjugate against mRNA was calculated in accordance with the equation:

Percentage of conjugate inhibition against mRNA = (1-residual HBV gene X expression) × 100%,

where the control group was a group of control mice that were injected with NS in this experiment, and each test group was a group of mice that were injected with different siRNA conjugates, respectively. The results are shown in FIG. fifteen.

[480] In other experiments, additional tests were performed according to the following conditions:

Tests were performed using the same method as described above, except that the introduced siRNA conjugate was replaced with conjugates 1 and 6 and data was collected on day 14. The results are shown in FIG. 16; and

Tests were performed using the same method as described above, except that the siRNA conjugates for administration were replaced with conjugates 5 and 6 and data was collected on day 7. The results are shown in FIG. 17; and

Tests were performed using the same method as described above, except that the siRNA conjugates for administration were replaced with conjugates 9, 10, 5 and 6 and data was collected on day 7. The results are shown in FIG. eighteen; and

Tests were performed using the same method as described above, except that the administration siRNA conjugates were replaced with conjugates 1, 2, 3 and 4 (5 mice per group) and data was collected on day 28. Each conjugate was administered at two dosages of 1 mg/kg and 0.3 mg/kg (whereby the volume of administration remained the same, while the concentrations of the conjugate solutions were adjusted accordingly). The results are shown accordingly in FIG. 19.

Tests were performed using the same method as described above, except that the introduced siRNA conjugate was replaced with conjugate 1 and data was collected on day 14. Each conjugate was administered at two doses of 1 mg/kg and 0.1 mg/kg (whereby the volume of administration remained unchanged while the concentrations of the conjugate solutions were adjusted accordingly). The results are shown accordingly in FIG. twenty.

[481] As follows from the above results, in several experiments with different test time points, all of the conjugates of the present invention described above show a strong inhibitory activity against the expression of HBV mRNA in mice in vivo.

Experimental Example 5 This experiment illustrates the time dependence testing of the inhibitory efficacy of the siRNA conjugates of the present invention against HBsAg and HBV DNA in the sera of HBV transgenic mice.

[482] An AAV-HBV mouse model was used. After successful establishment of animal models, these mice were randomly divided into groups based on the content of HBsAg in serum (5 mice in each group). Conjugates 1 and 6, comparative conjugate 2 and NS blank controls were administered to each group, respectively. Drug dosages for all animals were calculated according to body weight (single administration (subcutaneous), administration dosage of 3 mg/kg and 1 mg/kg in the form of 0.9% aqueous NaCl solution containing 0.3 mg/ml and 0. 1 mg/ml conjugates, and injection volume 5 ml/kg). Blood was taken from the mouse orbital venous plexus before administration (designated as DO) and at 7, 14, 21, 28, 56, 84, 112, 140, 154, 168, and 182 days after administration, and serum HBsAg levels were measured at each time point. point. During the experiment, the determination of the subject is terminated if the serum HBsAg content in the test is comparable to the initial value or exceeds it.

[483] Approximately 100 μl of orbital blood was taken at each time point, with serum volume after centrifugation being at least 20 μl. Serum HBsAg was measured using the HBsAg CLIA kit (Autobio, CL0310). The expression level of HBV DNA was measured by extracting DNA from serum according to the instructions of the QIAamp 96 DNA Blood Kit, and then qPCR was performed.

[484] Normalized level of HBsAg expression = (HBsAg content after administration/HBsAg content before administration) × 100%.

Percent inhibition against HBsAg = (1-HBsAg content after administration/HBsAg content before administration) × 100%, and the HBsAg content is expressed in equivalents (UI) of HBsAg per milliliter (ml) of serum.

[485] Normalized expression level of HBV DNA = (content of HBV DNA after administration/content of HBV DNA before administration) × 100%.

Percent inhibition against HBV DNA = (1-HBV DNA content after administration/HBV DNA content before administration) × 100%,

and the content of HBV DNA was expressed in copies of HBV DNA per milliliter (ml) of serum.

[486] The results are shown in FIG. 21 and 22.

[487] As can be seen from the results in FIG. 21, the NS negative control group showed no inhibitory effect at various time points after administration; on the contrary, each siRNA conjugate exhibits an excellent inhibitory effect on HBsAg at various time points after administration. In particular, conjugate 1 consistently exhibited a high percentage of serum HBsAg inhibition for up to 140 days, indicating stable and effective inhibition of HBV gene expression over a longer period of time.

[488] As follows from the results of FIG. 22, the siRNA conjugate in each example also showed effective inhibition of HBV DNA expression and maintained a higher percentage of inhibition for up to 84 days.

[489] In contrast, although Comparative Conjugate 2 achieved inhibitory effects on mRNA comparable to those of the individual conjugates in in vivo experiments, the duration of the inhibitory effects as shown in FIG. 21 and 22 was significantly shorter than conjugates 1 and 6 at the same dose level.

[490] In accordance with the same methods as described above, four additional tests were performed in which serum HBsAg was measured, except that:

in a low-concentration AAV-HBV mouse model, 3 mg/kg and 1 mg/kg of conjugate 6 were administered, respectively; the test lasted until day 140; and the results are shown in FIG. 23;

in the M-Tg models, 3 mg/kg (3 mg per 1 kg) and 1 mg/kg (1 mg per 1 kg) of conjugates 5 and 6 (PBS for the control group), respectively, were administered; the trial lasted until day 70; and the results are shown in FIG. 24; The mice were purchased from the Animal Department of the Shanghai Public Health Center. Methods for producing transgenic mice have been described by Ren J. et al., in J. Medical Virology. 2006, 78:551-560;

in the M-Tg models, 5 mg/kg, 1 mg/kg, and 0.2 mg/kg of conjugates 11 and 6 (PBS for the control group) and 5 mg/kg of comparative conjugate 2, respectively, were administered; the trial continued until day 78; and the results are shown in FIG. 25;

in models with 1.28 copies, 3 mg/kg and 1 mg/kg of conjugate 1 were administered, respectively; the test lasted until day 210; and the results are shown in FIG. 26 and 27.

[491] For the various doses of administration described above, each conjugate was administered in the same volume of administration, while the concentration of the solution was adjusted accordingly so as to carry out the administration at the appropriate dose.

[492] Based on the results in FIG. 22-27 that the siRNA conjugates of the present invention exhibited consistent and potent inhibitory efficacy against serum HBsAg in various animal models and a general dose-dependence. Experimental Example 6 This experiment illustrates that the siRNA conjugates of the present invention not only have higher in vitro activity, but also show low off-target effect.

[493] (6-1) The HEK293A cells used in this experimental example were provided by the Nucleic Acid Laboratory of the Institute of Molecular Medicine, Peking University, and cultured in complete DMEM (Hyclone) containing 20% fetal bovine serum (FBS, Hyclone). ), 0.2% (v/v) penicillin-streptomycin (Gibco, Invitrogen), at 37° C. in a 5% CO ₂ /95% air incubator.

[494] In this experimental example, the target activity and off-target effect of conjugate 1 was studied in the psiCHECK system under in vitro conditions. In particular, the activity of Conjugate 1 was tested in relation to targeting a completely matched target sequence (in which the nucleotide sequence is fully complementary to the nucleotide sequence along the entire length of the sense/antisense strand of Conjugate 1) or targeting the region of the primer sequence corresponding to the target sequence (in which the nucleotide sequence is the sequence is complementary to the nucleotide sequence of positions 1-8 of the sense/antisense strand of conjugate 1).

[495] According to the method described by Kumico Ui-Tei et al., Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008.36(7), 2136-2151, detection plasmids were constructed and co-transfected with siRNA conjugates to be detected into HEK293A cells; and expression levels of the luciferase double reporter gene reflect the target activity and off-target effect of the siRNA conjugates. The specific steps are described below:

[496] [1] Construction of a plasmid to determine

[497] Four recombinant plasmids were constructed using the plasmid psiCHECK™-2 (Promega™) in which GSCM is the target plasmid; and PSCM, GSSM and PSSM are non-target plasmids:

[498] (1) A GSCM containing a target sequence, wherein the target sequence is fully complementary to the entire 21 nucleotide sequence of the antisense strand in conjugate 1.

[499] (2) PSCM containing a target sequence, wherein the target sequence is identical to the entire 21 nucleotide sequence of the antisense strand in conjugate 1.

[500] (3) A GSSM containing a target sequence, wherein the target sequence is fully complementary to the nucleotide sequence at positions 1-8 from the 5' end of the antisense strand in conjugate 1, while the remainder of the target sequence corresponds to the nucleotide sequence at positions 9 -21 from the 5' end of the antisense strand in conjugate 1, but does not match completely for mating; those. if the nucleotide at any position at positions 9-21 from the 5' end of the antisense strand in Conjugate 1 is G, C, A, or U, the nucleotide at the corresponding position in the target sequence is T, A, C, or G.

[501] (4) PSSM containing a target sequence, wherein the target sequence is fully complementary to the nucleotide sequence at positions 1-8 from the 5' end of the sense strand in conjugate 1, while the remainder of the target sequence corresponds to the nucleotide sequence at positions 9 -19 from the 5' end of the sense strand in conjugate 1, but does not match completely for mating; those. if the nucleotide at any position at positions 9-19 from the 5' end of the sense strand in conjugate 1 is G, C, A, or U, the nucleotide at the corresponding position in the target sequence is T, A, C, or G. In order so that the length was the same as the target sequence in the GSSM, two CCs were added at the 3' end of the target sequence in the PSSM.

[502] The target sequence was inserted into the Xho I/Not I site of the psiCHECK™-2 plasmid.

[503] [2] Transfection

[504] In a 96-well plate, siRNA and each of the above plasmids were co-transfected according to the instructions for Lipofectamine™ 2000 (Invitrogen), with each plasmid corresponding to several specific concentrations of A1 conjugate. Specifically, 10 ng of plasmid was transfected per well using 0.2 μl of Lipofectamine™ 2000 per well; the final concentration (based on siRNA concentration) of conjugate 1 ranged from 100 nM to 0.0001 nM (4-fold serial dilution of 11 concentrations), with 3 replicate wells per group.

[505] [3] Definition

[506] 24 hours after co-transfection, HEK293A cells were lysed using the luciferase double reporter gene assay kit (Promega, cat. no. E2940) according to the luciferase double reporter gene expression level test. For the test group of each specific concentration, cells not treated with the conjugate were used as control (Con). The level of Renilla luciferase protein (Ren) was normalized to the level of firefly luciferase protein (Fir).

[507] Dose-response curves were constructed from activity measurements at different siRNA concentrations, and the curves were fitted using the log (inhibitor) function versus response - variable slope of Graphpad 5.0 software. The IC _{50 of} siRNA targeting GSCM was calculated from the dose-response curve using the following Formula:

wherein:

Y is the expression level of the residual mRNA,

X is the logarithm of the transfected siRNA concentration,

Bot is the Y value at the bottom of the stationary stage,

The torus represents the Y value at the top of the stationary stage,

LogIC ₅₀ is the value of X, where Y is the median value between the bottom and top of the asymptote, and HillSlope (Hill's slope) is the slope of the curve.

[508] IC ₅₀ of conjugate 1 targeting GSCM was calculated based on the dose-effect curve. The results are shown in Figures 28A-28D showing that the IC ₅₀ value for Conjugate 1 corresponding to GSCM was 0.0513 nM. Conjugate 1 corresponding to PSCM, GSSM or PSSM does not show a significant inhibitory effect at each concentration of siRNA, indicating that the siRNA conjugate of the present invention not only has a higher activity under in vitro conditions, but also exhibits a low off-target effect.

[509] According to the above results, conjugate 1 exhibits an excellent inhibitory effect on the expression of the target mRNA in the low IC ₅₀ target plasmid; however, it does not show an inhibitory effect on the expression of the three non-target plasmids. Thus, Conjugate 1 not only has excellent inhibitory efficacy against the target mRNA, but also exhibits low off-target effect.

[510] Embodiments of the present invention are described in detail above, but the present invention is not limited to the specific details of the above described embodiments. Various simple changes to the technical solution of the present invention can be made within the scope of the technical concept of the present invention, and these simple changes are within the scope of the present invention.

[511] It should be noted that each of the specific technical features described in the above embodiments may be combined in any suitable manner, provided that no conflict occurs. To avoid unnecessary repetition, various possible combination methods will not be further described in the present invention.

[512] In addition, the various embodiments of the present invention can also be made in any combination, provided that there is no conflict with the idea of the present invention, this should also be considered as a disclosure of the present invention.

--->

SEQUENCE LIST

<110> Suzhou Ribo Life Science Co.,Ltd

<120> NUCLEIC ACID, COMPOSITION AND CONJUGATE CONTAINING IT AND METHOD

THEIR PRODUCTION AND APPLICATIONS

<130> 11460pRIBO

<150> CN201711249333.8

<151> 2017-12-01

<150> CN201711482970.X

<151> 2018-12-29

<160> 156

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<221> miscellaneous signs

<222> (19)..(19)

<223> n is A, U, G, or C

<400> 1

ccuugaggca uacuucaan 19

<210> 2

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<221> miscellaneous signs

<222> (1)..(1)

<223> n is A, U, G, or C

<400> 2

nuugaaguau gccucaagg 19

<210> 3

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<221> miscellaneous signs

<222> (1)..(1)

<223> n is A, U, G, or C

<400> 3

nuugaaguau gccucaaggu u 21

<210> 4

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<221> miscellaneous signs

<222> (1)..(1)

<223> n is A, U, G, or C

<400> 4

nuugaaguau gccucaaggu c 21

<210> 5

<211> 19

<212> RNA

<213> Artificial sequence

<400> 5

ccuugaggca uacuucaaa 19

<210> 6

<211> 21

<212> RNA

<213> Artificial sequence

<400> 6

uuugaaguau gccucaaggu u 21

<210> 7

<211> 21

<212> RNA

<213> Artificial sequence

<400> 7

gaccuugagg cauacuucaa a 21

<210> 8

<211> 23

<212> RNA

<213> Artificial sequence

<400> 8

uuugaaguau gccucaaggu cgg 23

<210> 9

<211> 19

<212> RNA

<213> Artificial sequence

<400> 9

ccuugaggca uacuucaaa 19

<210> 10

<211> 21

<212> RNA

<213> Artificial sequence

<400> 10

uuugaaguau gccucaaggu u 21

<210> 11

<211> 19

<212> RNA

<213> Artificial sequence

<400> 11

ccuugaggca uacuucaaa 19

<210> 12

<211> 21

<212> RNA

<213> Artificial sequence

<400> 12

uuugaaguau gccucaaggu u 21

<210> 13

<211> 21

<212> RNA

<213> Artificial sequence

<400> 13

gaccuugagg cauacuucaa a 21

<210> 14

<211> 23

<212> RNA

<213> Artificial sequence

<400> 14

uuugaaguau gccucaaggu cgg 23

<210> 15

<211> 21

<212> RNA

<213> Artificial sequence

<400> 15

gaccuugagg cauacuucaa a 21

<210> 16

<211> 23

<212> RNA

<213> Artificial sequence

<400> 16

uuugaaguau gccucaaggu cgg 23

<210> 17

<211> 19

<212> RNA

<213> Artificial sequence

<400> 17

ccuugaggca uacuucaaa 19

<210> 18

<211> 21

<212> RNA

<213> Artificial sequence

<400> 18

uuugaaguau gccucaaggu u 21

<210> 19

<211> 19

<212> RNA

<213> Artificial sequence

<400> 19

ccuugaggca uacuucaaa 19

<210> 20

<211> 21

<212> RNA

<213> Artificial sequence

<400> 20

uuugaaguau gccucaaggu u 21

<210> 21

<211> 21

<212> RNA

<213> Artificial sequence

<400> 21

gaccuugagg cauacuucaa a 21

<210> 22

<211> 23

<212> RNA

<213> Artificial sequence

<400> 22

uuugaaguau gccucaaggu cgg 23

<210> 23

<211> 21

<212> RNA

<213> Artificial sequence

<400> 23

gaccuugagg cauacuucaa a 21

<210> 24

<211> 23

<212> RNA

<213> Artificial sequence

<400> 24

uuugaaguau gccucaaggu cgg 23

<210> 25

<211> 19

<212> RNA

<213> Artificial sequence

<400> 25

ccuugaggca uacuucaaa 19

<210> 26

<211> 21

<212> RNA

<213> Artificial sequence

<400> 26

uuugaaguau gccucaaggu u 21

<210> 27

<211> 19

<212> RNA

<213> Artificial sequence

<400> 27

ccuugaggca uacuucaaa 19

<210> 28

<211> 21

<212> RNA

<213> Artificial sequence

<400> 28

uuugaaguau gccucaaggu u 21

<210> 29

<211> 21

<212> RNA

<213> Artificial sequence

<400> 29

gaccuugagg cauacuucaa a 21

<210> 30

<211> 23

<212> RNA

<213> Artificial sequence

<400> 30

uuugaaguau gccucaaggu cgg 23

<210> 31

<211> 21

<212> RNA

<213> Artificial sequence

<400> 31

gaccuugagg cauacuucaa a 21

<210> 32

<211> 23

<212> RNA

<213> Artificial sequence

<400> 32

uuugaaguau gccucaaggu cgg 23

<210> 33

<211> 19

<212> RNA

<213> Artificial sequence

<400> 33

ccuugaggca uacuucaaa 19

<210> 34

<211> 21

<212> RNA

<213> Artificial sequence

<400> 34

uuugaaguau gccucaaggu u 21

<210> 35

<211> 19

<212> RNA

<213> Artificial sequence

<400> 35

ccuugaggca uacuucaaa 19

<210> 36

<211> 21

<212> RNA

<213> Artificial sequence

<400> 36

uuugaaguau gccucaaggu u 21

<210> 37

<211> 21

<212> RNA

<213> Artificial sequence

<400> 37

gaccuugagg cauacuucaa a 21

<210> 38

<211> 23

<212> RNA

<213> Artificial sequence

<400> 38

uuugaaguau gccucaaggu cgg 23

<210> 39

<211> 21

<212> RNA

<213> Artificial sequence

<400> 39

gaccuugagg cauacuucaa a 21

<210> 40

<211> 23

<212> RNA

<213> Artificial sequence

<400> 40

uuugaaguau gccucaaggu cgg 23

<210> 41

<211> 19

<212> RNA

<213> Artificial sequence

<400> 41

ccuugaggca uacuucaaa 19

<210> 42

<211> 21

<212> RNA

<213> Artificial sequence

<400> 42

uuugaaguau gccucaaggu u 21

<210> 43

<211> 19

<212> RNA

<213> Artificial sequence

<400> 43

ccuugaggca uacuucaaa 19

<210> 44

<211> 21

<212> RNA

<213> Artificial sequence

<400> 44

uuugaaguau gccucaaggu u 21

<210> 45

<211> 19

<212> RNA

<213> Artificial sequence

<400> 45

ccuugaggca uacuucaaa 19

<210> 46

<211> 21

<212> DNA/RNA

<213> Artificial sequence

<400> 46

tuugaaguau gccucaaggu u 21

<210> 47

<211> 19

<212> RNA

<213> Artificial sequence

<400> 47

ccuugaggca uacuucaaa 19

<210> 48

<211> 21

<212> RNA

<213> Artificial sequence

<400> 48

uuugaaguau gccucaaggu u 21

<210> 49

<211> 19

<212> RNA

<213> Artificial sequence

<400> 49

ccuugaggca uacuucaaa 19

<210> 50

<211> 21

<212> RNA

<213> Artificial sequence

<400> 50

uuugaaguau gccucaaggu u 21

<210> 51

<211> 19

<212> RNA

<213> Artificial sequence

<400> 51

ccuugaggca uacuucaaa 19

<210> 52

<211> 21

<212> RNA

<213> Artificial sequence

<400> 52

uuugaaguau gccucaaggu u 21

<210> 53

<211> 21

<212> RNA

<213> Artificial sequence

<400> 53

gaccuugagg cauacuucaa a 21

<210> 54

<211> 23

<212> RNA

<213> Artificial sequence

<400> 54

uuugaaguau gccucaaggu cgg 23

<210> 55

<211> 19

<212> RNA

<213> Artificial sequence

<400> 55

ccuugaggca uacuucaaa 19

<210> 56

<211> 21

<212> RNA

<213> Artificial sequence

<400> 56

uuugaaguau gccucaaggu u 21

<210> 57

<211> 19

<212> RNA

<213> Artificial sequence

<400> 57

ccuugaggca uacuucaaa 19

<210> 58

<211> 21

<212> RNA

<213> Artificial sequence

<400> 58

uuugaaguau gccucaaggu u 21

<210> 59

<211> 21

<212> RNA

<213> Artificial sequence

<400> 59

gaccuugagg cauacuucaa a 21

<210> 60

<211> 23

<212> RNA

<213> Artificial sequence

<400> 60

uuugaaguau gccucaaggu cgg 23

<210> 61

<211> 21

<212> RNA

<213> Artificial sequence

<400> 61

gaccuugagg cauacuucaa a 21

<210> 62

<211> 23

<212> RNA

<213> Artificial sequence

<400> 62

uuugaaguau gccucaaggu cgg 23

<210> 63

<211> 19

<212> RNA

<213> Artificial sequence

<400> 63

ccuugaggca uacuucaaa 19

<210> 64

<211> 21

<212> RNA

<213> Artificial sequence

<400> 64

uuugaaguau gccucaaggu u 21

<210> 65

<211> 21

<212> RNA

<213> Artificial sequence

<400> 65

gaccuugagg cauacuucaa a 21

<210> 66

<211> 23

<212> RNA

<213> Artificial sequence

<400> 66

uuugaaguau gccucaaggu cgg 23

<210> 67

<211> 19

<212> RNA

<213> Artificial sequence

<400> 67

ccuugaggca uacuucaaa 19

<210> 68

<211> 21

<212> RNA

<213> Artificial sequence

<400> 68

uuugaaguau gccucaaggu u 21

<210> 69

<211> 19

<212> RNA

<213> Artificial sequence

<400> 69

ccuugaggca uacuucaaa 19

<210> 70

<211> 21

<212> RNA

<213> Artificial sequence

<400> 70

uuugaaguau gccucaaggu u 21

<210> 71

<211> 21

<212> RNA

<213> Artificial sequence

<400> 71

gaccuugagg cauacuucaa a 21

<210> 72

<211> 23

<212> RNA

<213> Artificial sequence

<400> 72

uuugaaguau gccucaaggu cgg 23

<210> 73

<211> 21

<212> RNA

<213> Artificial sequence

<400> 73

gaccuugagg cauacuucaa a 21

<210> 74

<211> 23

<212> RNA

<213> Artificial sequence

<400> 74

uuugaaguau gccucaaggu cgg 23

<210> 75

<211> 21

<212> RNA

<213> Artificial sequence

<400> 75

gaccuugagg cauacuucaa a 21

<210> 76

<211> 23

<212> RNA

<213> Artificial sequence

<400> 76

uuugaaguau gccucaaggu cgg 23

<210> 77

<211> 19

<212> RNA

<213> Artificial sequence

<400> 77

ccuugaggca uacuucaaa 19

<210> 78

<211> 21

<212> RNA

<213> Artificial sequence

<400> 78

uuugaaguau gccucaaggu u 21

<210> 79

<211> 19

<212> RNA

<213> Artificial sequence

<400> 79

ccuugaggca uacuucaaa 19

<210> 80

<211> 21

<212> RNA

<213> Artificial sequence

<400> 80

uuugaaguau gccucaaggu u 21

<210> 81

<211> 21

<212> RNA

<213> Artificial sequence

<400> 81

gaccuugagg cauacuucaa a 21

<210> 82

<211> 23

<212> RNA

<213> Artificial sequence

<400> 82

uuugaaguau gccucaaggu cgg 23

<210> 83

<211> 21

<212> RNA

<213> Artificial sequence

<400> 83

gaccuugagg cauacuucaa a 21

<210> 84

<211> 23

<212> RNA

<213> Artificial sequence

<400> 84

uuugaaguau gccucaaggu cgg 23

<210> 85

<211> 21

<212> RNA

<213> Artificial sequence

<400> 85

gaccuugagg cauacuucaa a 21

<210> 86

<211> 23

<212> RNA

<213> Artificial sequence

<400> 86

uuugaaguau gccucaaggu cgg 23

<210> 87

<211> 19

<212> RNA

<213> Artificial sequence

<400> 87

ccuugaggca uacuucaaa 19

<210> 88

<211> 21

<212> RNA

<213> Artificial sequence

<400> 88

uuugaaguau gccucaaggu u 21

<210> 89

<211> 19

<212> RNA

<213> Artificial sequence

<400> 89

ccuugaggca uacuucaaa 19

<210> 90

<211> 21

<212> RNA

<213> Artificial sequence

<400> 90

uuugaaguau gccucaaggu u 21

<210> 91

<211> 19

<212> RNA

<213> Artificial sequence

<400> 91

ccuugaggca uacuucaaa 19

<210> 92

<211> 21

<212> RNA

<213> Artificial sequence

<400> 92

uuugaaguau gccucaaggu u 21

<210> 93

<211> 19

<212> RNA

<213> Artificial sequence

<400> 93

ccuugaggca uacuucaaa 19

<210> 94

<211> 21

<212> RNA

<213> Artificial sequence

<400> 94

uuugaaguau gccucaaggu u 21

<210> 95

<211> 19

<212> RNA

<213> Artificial sequence

<400> 95

ccuugaggca uacuucaaa 19

<210> 96

<211> 21

<212> RNA

<213> Artificial sequence

<400> 96

uuugaaguau gccucaaggu u 21

<210> 97

<211> 19

<212> RNA

<213> Artificial sequence

<400> 97

ccuugaggca uacuucaaa 19

<210> 98

<211> 21

<212> RNA

<213> Artificial sequence

<400> 98

uuugaaguau gccucaaggu u 21

<210> 99

<211> 19

<212> RNA

<213> Artificial sequence

<400> 99

ccuugaggca uacuucaaa 19

<210> 100

<211> 21

<212> RNA

<213> Artificial sequence

<400> 100

uuugaaguau gccucaaggu u 21

<210> 101

<211> 19

<212> RNA

<213> Artificial sequence

<400> 101

ccuugaggca uacuucaaa 19

<210> 102

<211> 21

<212> RNA

<213> Artificial sequence

<400> 102

uuugaaguau gccucaaggu u 21

<210> 103

<211> 19

<212> RNA

<213> Artificial sequence

<400> 103

ccuugaggca uacuucaaa 19

<210> 104

<211> 21

<212> RNA

<213> Artificial sequence

<400> 104

uuugaaguau gccucaaggu u 21

<210> 105

<211> 19

<212> RNA

<213> Artificial sequence

<400> 105

ccuugaggca uacuucaaa 19

<210> 106

<211> 21

<212> RNA

<213> Artificial sequence

<400> 106

uuugaaguau gccucaaggu u 21

<210> 107

<211> 19

<212> RNA

<213> Artificial sequence

<400> 107

ccuugaggca uacuucaaa 19

<210> 108

<211> 21

<212> RNA

<213> Artificial sequence

<400> 108

uuugaaguau gccucaaggu u 21

<210> 109

<211> 21

<212> RNA

<213> Artificial sequence

<400> 109

gaccuugagg cauacuucaa a 21

<210> 110

<211> 23

<212> RNA

<213> Artificial sequence

<400> 110

uuugaaguau gccucaaggu cgg 23

<210> 111

<211> 21

<212> RNA

<213> Artificial sequence

<400> 111

gaccuugagg cauacuucaa a 21

<210> 112

<211> 23

<212> RNA

<213> Artificial sequence

<400> 112

uuugaaguau gccucaaggu cgg 23

<210> 113

<211> 21

<212> RNA

<213> Artificial sequence

<400> 113

gaccuugagg cauacuucaa a 21

<210> 114

<211> 23

<212> RNA

<213> Artificial sequence

<400> 114

uuugaaguau gccucaaggu cgg 23

<210> 115

<211> 21

<212> RNA

<213> Artificial sequence

<400> 115

gaccuugagg cauacuucaa a 21

<210> 116

<211> 23

<212> RNA

<213> Artificial sequence

<400> 116

uuugaaguau gccucaaggu cgg 23

<210> 117

<211> 21

<212> RNA

<213> Artificial sequence

<400> 117

gaccuugagg cauacuucaa a 21

<210> 118

<211> 23

<212> RNA

<213> Artificial sequence

<400> 118

uuugaaguau gccucaaggu cgg 23

<210> 119

<211> 21

<212> RNA

<213> Artificial sequence

<400> 119

gaccuugagg cauacuucaa a 21

<210> 120

<211> 23

<212> RNA

<213> Artificial sequence

<400> 120

uuugaaguau gccucaaggu cgg 23

<210> 121

<211> 19

<212> RNA

<213> Artificial sequence

<400> 121

ccuugaggca uacuucaaa 19

<210> 122

<211> 21

<212> RNA

<213> Artificial sequence

<400> 122

uuugaaguau gccucaaggu c 21

<210> 123

<211> 19

<212> RNA

<213> Artificial sequence

<400> 123

ccuugaggca uacuucaaa 19

<210> 124

<211> 21

<212> RNA

<213> Artificial sequence

<400> 124

uuugaaguau gccucaaggu c 21

<210> 125

<211> 19

<212> RNA

<213> Artificial sequence

<400> 125

ccuugaggca uacuucaaa 19

<210> 126

<211> 21

<212> RNA

<213> Artificial sequence

<400> 126

uuugaaguau gccucaaggu u 21

<210> 127

<211> 19

<212> RNA

<213> Artificial sequence

<400> 127

ccuugaggca uacuucaaa 19

<210> 128

<211> 21

<212> RNA

<213> Artificial sequence

<400> 128

uuugaaguau gccucaaggu u 21

<210> 129

<211> 19

<212> RNA

<213> Artificial sequence

<400> 129

ccuugaggca uacuucaaa 19

<210> 130

<211> 21

<212> RNA

<213> Artificial sequence

<400> 130

uuugaaguau gccucaaggu u 21

<210> 131

<211> 19

<212> RNA

<213> Artificial sequence

<400> 131

ccuugaggca uacuucaaa 19

<210> 132

<211> 21

<212> RNA

<213> Artificial sequence

<400> 132

uuugaaguau gccucaaggu u 21

<210> 133

<211> 21

<212> RNA

<213> Artificial sequence

<400> 133

gaccuugagg cauacuucaa a 21

<210> 134

<211> 23

<212> RNA

<213> Artificial sequence

<400> 134

uuugaaguau gccucaaggu cgg 23

<210> 135

<211> 19

<212> RNA

<213> Artificial sequence

<400> 135

ccuugaggca uacuucaaa 19

<210> 136

<211> 21

<212> RNA

<213> Artificial sequence

<400> 136

uuugaaguau gccucaaggu u 21

<210> 137

<211> 21

<212> DNA/RNA

<213> Artificial sequence

<400> 137

ccuugaggca uacucaaat t 21

<210> 138

<211> 21

<212> DNA/RNA

<213> Artificial sequence

<400> 138

uuugaaguau gccucaaggt t 21

<210> 139

<211> 19

<212> RNA

<213> Artificial sequence

<400> 139

uucuccgaac gugucacgu 19

<210> 140

<211> 21

<212> RNA

<213> Artificial sequence

<400> 140

acgugacacg uucggagaau u 21

<210> 141

<211> 19

<212> RNA

<213> Artificial sequence

<400> 141

gugugcacuu cgcuucaca 19

<210> 142

<211> 21

<212> RNA

<213> Artificial sequence

<400> 142

ugugaagcga agugcacacu u 21

<210> 143

<211> 19

<212> RNA

<213> Artificial sequence

<400> 143

ccuugaggca uacuucaaa 19

<210> 144

<211> 21

<212> RNA

<213> Artificial sequence

<400> 144

uuugaaguau gccucaaggu c 21

<210> 145

<211> 19

<212> RNA

<213> Artificial sequence

<400> 145

ccuugaggca uacuucaaa 19

<210> 146

<211> 21

<212> RNA

<213> Artificial sequence

<400> 146

uuugaaguau gccucaaggu c 21

<210> 147

<211> 19

<212> RNA

<213> Artificial sequence

<400> 147

ccuugaggca uacuucaaa 19

<210> 148

<211> 21

<212> RNA

<213> Artificial sequence

<400> 148

uuugaaguau gccucaaggu u 21

<210> 149

<211> 21

<212> DNA/RNA

<213> Artificial sequence

<400> 149

ccuugaggca uacucaaat t 21

<210> 150

<211> 21

<212> DNA/RNA

<213> Artificial sequence

<400> 150

uuugaaguau gccucaaggt t 21

<210> 151

<211> 20

<212> DNA

<213> Artificial sequence

<400> 151

ccgtctgtgc cttctcatct 20

<210> 152

<211> 20

<212> DNA

<213> Artificial sequence

<400> 152

taatctcctc ccccaactcc 20

<210> 153

<211> 24

<212> DNA

<213> Artificial sequence

<400> 153

agcttctttg cagctccttc gttg 24

<210> 154

<211> 24

<212> DNA

<213> Artificial sequence

<400> 154

ttctgaccca ttcccaccat caca 24

<210> 155

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<221> miscellaneous signs

<222> (19)..(19)

<223> n为A

<400> 155

ccuugaggca uacuucaan 19

<210> 156

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<221> miscellaneous signs

<222> (1)..(1)

<223> n为U

<400> 156

nuugaaguau gccucaagg 19

<---

Claims (167)

1. miRNA conjugate for inhibition of hepatitis B virus (HBV) gene expression, having the structure represented by Formula 1

Formula 1, wherein n1 is an integer from 1 to 3, and n3 is an integer from 0 to 4; each of m1, m2 and m3 is independently an integer from 2 to 10; each of R ₁₀ , R ₁₁ , R ₁₂ , R ₁₃ , R ₁₄ and R ₁₅ independently represents H or is selected from the group consisting of C ₁ -C ₁₀ alkyl, C ₁ -C ₁₀ haloalkyl and C ₁ -C ₁₀ alkoxy ; R ₃ is a group having the structure represented by Formula A59

(A59), wherein E ₁ is OH, SH or BH ₂ ; and Nu is miRNA; each nucleotide in said siRNA is independently a modified or unmodified nucleotide; said siRNA contains a sense strand and an antisense strand, wherein said sense strand contains nucleotide sequence 1 and said antisense strand contains nucleotide sequence 2; said nucleotide sequence 1 and said nucleotide sequence 2 are at least partially reverse complementary to form a double-stranded region; the specified nucleotide sequence 1 has the same length as the nucleotide sequence shown in SEQ ID NO: 155, and differs from it by no more than 3 nucleotides; and the specified nucleotide sequence 2 has the same length as the nucleotide sequence shown in SEQ ID NO: 156, and differs from it by no more than 3 nucleotides: 5'-CCUUGAGGCAUACUUCAAZ-3' (SEQ ID NO: 155); 5'-Z'UUUGAAGUAUGCCUCAAGG-3' (SEQ ID NO: 156); wherein Z is A; Z' is U; the specified nucleotide sequence 1 contains the nucleotide Z _A in the position corresponding to Z; the specified nucleotide sequence 2 contains the nucleotide Z' _B in the position corresponding to Z'; nucleotide Z' _B is the first nucleotide from the 5' end of the antisense strand; R ₂ is a linear alkylene of 1 to 20 carbon atoms in length, with one or more carbon atoms optionally substituted by any one or more of the group consisting of the following: C(O), NH, O, S, CH=N, S (O) ₂ , C ₂ -C ₁₀ alkylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, wherein R ₂ is optionally substituted with any one or more from the group consisting of the following: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen, OH, -SH , NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), cyano, nitro, CO ₂ H, C ( O) O (C ₁ -C ₁₀ alkyl), CON (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), CONH (C ₁ -C ₁₀ alkyl), CONH ₂ , NHC (O) (C ₁ -C ₁₀ alkyl), NHC (O) (phenyl), N (C ₁ -C ₁₀ alkyl) C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl )C(O)(phenyl), C(O)C ₁ -C ₁₀ alkyl, C(O)C ₁ -C ₁₀ alkylphenyl, C(O)C ₁ -C ₁₀ haloalkyl, OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH (C ₁ -C ₁₀ alkyl ), SO ₂ NH(phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl); each L ₁ is independently linear alkylene from 1 to 70 carbon atoms in length, with one or more carbon atoms optionally substituted by any one or more of the group consisting of the following: C(O), NH, O, S, CH=N , S(O) ₂ , C ₂ -C ₁₀ alkylene, C ₂ -C ₁₀ alkynylene, C ₆ -C ₁₀ arylene, C ₃ -C ₁₈ heterocyclylene and C ₅ -C ₁₀ heteroarylene, and L ₁ is optionally substituted with any one or more of the group consisting of the following: C ₁ -C ₁₀ alkyl, C ₆ -C ₁₀ aryl, C ₅ -C ₁₀ heteroaryl, C ₁ -C ₁₀ haloalkyl, OC ₁ -C ₁₀ alkyl, OC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylOH, OC ₁ -C ₁₀ haloalkyl, SC ₁ -C ₁₀ alkyl, SC ₁ -C ₁₀ alkylphenyl, -C ₁ -C ₁₀ alkylSH, SC ₁ -C ₁₀ haloalkyl, halogen, OH, -SH, NH ₂ , C ₁ -C ₁₀ alkylNH ₂ , N (C ₁ -C ₁₀ alkyl) (C ₁ -C ₁₀ alkyl), NH (C ₁ -C ₁₀ alkyl), cyano, nitro, CO ₂ H, C(O)O(C ₁ -C ₁₀ alkyl), CON(C ₁ -C ₁₀ alkyl)(C ₁ -C ₁₀ alkyl), CONH(C ₁ -C ₁₀ alkyl), CONH ₂ , NHC(O)( C ₁ -C ₁₀ alkyl), NHC (O) (phenyl), N (C ₁ -C ₁₀ alkyl) C (O) (C ₁ -C ₁₀ alkyl), N (C ₁ -C ₁₀ alkyl) C (O) (phenyl), C (O) C ₁ -C ₁₀ alkyl, C (O) C ₁ -C ₁₀ alkylphenyl, C (O) C ₁ -C ₁₀ haloalkyl, OC(O)C ₁ -C ₁₀ alkyl, -SO ₂ (C ₁ -C ₁₀ alkyl), -SO ₂ (phenyl), -SO ₂ (C ₁ -C ₁₀ haloalkyl), -SO ₂ NH ₂ , SO ₂ NH(C ₁ -C ₁₀ alkyl), SO ₂ NH(phenyl), -NHSO ₂ (C ₁ -C ₁₀ alkyl), -NHSO ₂ (phenyl) and NHSO ₂ (C ₁ -C ₁₀ haloalkyl);

represents the position at which the group is attached to the rest of the molecule; M ₁ is a targeting group and each M ₁ is independently a ligand that binds to asialoglycoprotein (ASGP-R) receptors on the surface of mammalian hepatocytes. 2. The siRNA conjugate according to claim 1, characterized in that each L ₁ is independently selected from the group consisting of groups A1-A26 and any of their connected combinations:

where each j1 is independently an integer from 1 to 20; each j2 is independently an integer from 1 to 20; each R' is independently C ₁ -C ₁₀ alkyl; each Ra is independently selected from the group consisting of A27-A45 and any combinations thereof:

each Rb is independently C ₁ -C ₁₀ alkyl. 3. The siRNA conjugate according to claim 2, characterized in that L ₁ is selected from connected combinations of one or more of A1, A4, A5, A6, A8, A10, A11, A13, as well as their connected combinations, or L ₁ is selected from connected combinations of at least two of A1, A4, A8, A10 and A11. 4. The siRNA conjugate according to any one of paragraphs. 1-3, characterized in that the length L ₁ is from 3 to 25 atoms or the length L ₁ is additionally from 4 to 15 atoms. 5. The siRNA conjugate according to any one of paragraphs. 1-4, characterized in that each of m1, m2 and m3 is independently an integer from 2 to 5 or m1=m2=m3. 6. The siRNA conjugate according to any one of paragraphs. 1-5, characterized in that each M ₁ is independently selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D- glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N -trifluoroacetylgalactosamine, N-propionylgalactosamine, Nn-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino -L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl-2,3,4-tris-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β- D-galactopyranose, ethyl-3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D- ribose, D-4-thioribose, L-ribose and L-4-thioribose. 7. The siRNA conjugate according to any one of paragraphs. 1-6, characterized in that the R ₂ group contains both a position connecting to the N atom on the nitrogenous backbone and a position connecting to the P atom in R ₃ , R ₂ forms an amide bond with the N atom on the nitrogenous backbone, and the position connecting with the P atom in R ₃ , forms a phosphoester bond with the P atom; or R ₂ is selected from B5, B6, B5' or B6':

where

is the position at which the groups are covalently attached; and q ₂ is an integer from 1 to 10. 8. The siRNA conjugate according to any one of paragraphs. 1-7, characterized in that said conjugate has a structure represented by Formula 3, Formula 4, Formula 5, Formula 6, Formula 7, Formula 8, Formula 9, Formula 10, Formula 11, Formula 12, Formula 13, Formula 14, Formula 15, Formula 16, Formula 17, Formula 18, Formula 19, Formula 20, Formula 21 or Formula 22:

9. The siRNA conjugate according to any one of paragraphs. 1-8, characterized in that said P atom in Formula A59 is connected to the 3' end of the sense strand of said siRNA. 10. The siRNA conjugate according to any one of paragraphs. 1-9, characterized in that the difference in nucleotides between the specified nucleotide sequence 2 and the specified nucleotide sequence presented in SEQ ID NO: 156, includes a difference in the position of Z' _B , and Z' _B is selected from A, C or G. 11. The siRNA conjugate according to any one of paragraphs. 1-10, characterized in that said sense strand further comprises a nucleotide sequence of 3, and said antisense strand further comprises a nucleotide sequence of 4; each of the specified nucleotide sequences 3 and 4 has a length of 1-4 nucleotides; the specified nucleotide sequence 3 is connected to the 5'end of the nucleotide sequence 1, and the specified nucleotide sequence 4 is connected to the 3'end of the nucleotide sequence 2; the specified nucleotide sequence 3 has the same length as the nucleotide sequence 4, and is essentially reverse complementary or fully reverse complementary to it; moreover, the specified nucleotide sequence 3 and the specified nucleotide sequence 4 both have a length of 1 nucleotide; the base of said nucleotide sequence 3 is A; said nucleotide sequence 3 and said nucleotide sequence 4 are both 2 nucleotides long; in the 5' to 3' direction, the bases of the nucleotide sequence 3 are G and A in sequence; said nucleotide sequence 3 and said nucleotide sequence 4 are both 3 nucleotides long; in the 5' to 3' direction, the bases of the nucleotide sequence 3 are C, G and A in sequence; or said nucleotide sequence 3 and said nucleotide sequence 4 are both 4 nucleotides long; in the 5' to 3' direction, the bases of nucleotide sequence 3 are C, C, G, and A in sequence. 12. The siRNA conjugate according to any one of paragraphs. 1-11, characterized in that said siRNA additionally contains a nucleotide sequence 5, which is 1-3 nucleotides long and connected to the 3' end of the antisense strand to form a 3' overhang of said antisense strand. 13. The siRNA conjugate according to any one of paragraphs. 1-12, characterized in that said sense strand contains the nucleotide sequence shown in SEQ ID NO: 1 and said antisense strand contains the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4: 5'-CCUUGAGGCAUACUUCAAZ _A -3' (SEQ ID NO: 1); 5'-Z' _B UUGAAGUAUGCCUCAAGGUU-3' (SEQ ID NO: 3); 5'-Z' _B UUGAAGUAUGCCUCAAGGUC-3' (SEQ ID NO: 4); in which the nucleotide Z' _B is the first nucleotide from the 5' end of the specified antisense strand; Z _A is selected from A, U, G or C; and Z' _B is a nucleotide complementary to Z _A . 14. The siRNA conjugate according to any one of paragraphs. 1-13, characterized in that said siRNA is siHBa1 or siHBa2: siHBa1 Sense strand: 5'-CCUUGAGGCAUACUUCAAA-3' (SEQ ID NO: 5), Antisense strand: 5'-UUUGAAGUAUGCCUCAAGGUU-3' (SEQ ID NO: 6) siHBa2 Sense strand: 5'-GACCUUGAGGCAUACUUCAAA-3' (SEQ ID NO: 7), Antisense strand: 5'-UUUGAAGUAUGCCUCAAGGUCGG-3' (SEQ ID NO: 8). 15. The siRNA conjugate according to any one of paragraphs. 1-14, characterized in that each nucleotide in said sense strand and said antisense strand is independently a fluorine-modified or non-fluorine-modified nucleotide; "fluorine-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl of the ribose group of a nucleotide with fluorine; "Non-fluorine-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl of the ribose group of a nucleotide with a group other than fluorine, or a nucleotide analog; wherein said fluorine-modified nucleotides are located within nucleotide sequences 1 and 2; and in the 5' to 3' direction, the nucleotides at positions 7, 8 and 9 of said nucleotide sequence 1 are fluorine-modified nucleotides; and in the 5' to 3' direction, the nucleotides at positions 2, 6, 14, and 16 of said nucleotide sequence 2 are fluorine-modified nucleotides. 16. An miRNA conjugate according to claim 15, characterized in that each non-fluorine-modified nucleotide is a methoxy-modified nucleotide, which refers to a nucleotide formed by replacing the 2'-hydroxyl of a ribose group with a methoxy group. 17. The siRNA conjugate according to any one of paragraphs. 1-16, characterized in that in the direction from the 5'-end to the 3'-end, the nucleotides at positions 7, 8 and 9 of the specified nucleotide sequence 1 in the sense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are are methoxy-modified nucleotides; and the nucleotides at positions 2, 6, 14 and 16 of said nucleotide sequence 2 in the antisense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides; in the 5' to 3' direction, the nucleotides at positions 5, 7, 8, and 9 of said nucleotide sequence 1 in the sense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are methoxy-modified nucleotides; and the nucleotides at positions 2, 6, 8, 9, 14 and 16 of said nucleotide sequence 2 in the antisense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides; or in the 5' to 3' direction, the nucleotides at positions 5, 7, 8, and 9 of the indicated nucleotide sequence 1 in the miRNA sense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are methoxy-modified nucleotides ; and the nucleotides at positions 2, 6, 14 and 16 of said nucleotide sequence 2 in the antisense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides. 18. The siRNA conjugate according to any one of paragraphs. 1-17, characterized in that said siRNA is siHBa1M1, siHBa1M2, siHBa2M1 or siHBa2M2: siHBa1M1 Sense chain: 5'-CmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 9), Antisense strand: 5'-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmUm-3' (SEQ ID NO: 10), siHBa1M2 Sense chain: 5'-CmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 11), Antisense strand: 5'-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmUm-3' (SEQ ID NO: 12), siHBa2M1 Sense chain: 5'-GmAmCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 13), Antisense strand: 5'-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmGmGm-3' (SEQ ID NO: 14), siHBa2M2 Sense chain: 5'-GmAmCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm -3' (SEQ ID NO: 15), Antisense strand: 5'-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmGmGm-3' (SEQ ID NO: 16), in which C, G, U and A denote the composition of the bases of the nucleotides; m means that the nucleotide to the left of the letter m is a methoxy-modified nucleotide; f means that the nucleotide to the left of the letter f is a fluorine-modified nucleotide. 19. The siRNA conjugate according to claim 1, characterized in that in said siRNA at least one group is a phosphothioate group, the phosphothioate bond is present in at least one of the following positions: the position between the first and second nucleotides at the 5' end of the sense strand; the position between the second and third nucleotides at the 5' end of the sense strand; the position between the first and second nucleotides at the 3' end of the sense strand; the position between the second and third nucleotides at the 3' end of the sense strand; the position between the first and second nucleotides at the 5' end of the antisense strand; the position between the second and third nucleotides at the 5' end of the antisense strand; the position between the first and second nucleotides at the 3' end of the antisense strand; and position between the second and third nucleotides at the 3' end of the antisense strand. 20. The siRNA conjugate according to any one of paragraphs. 1-19, characterized in that said siRNA is siHBa1M1S, siHBa1M2S, siHBa2M1S or siHBa2M2S: siHBa1M1S Sense strand: 5'-CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 17), Antisense strand: 5'-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm-3' (SEQ ID NO: 18) siHBa1M2S Sense strand: 5'-CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 19), Antisense strand: 5'-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm-3' (SEQ ID NO: 20) siHBa2M1S Sense strand: 5'-GmsAmsCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 21), Antisense strand: 5'-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm-3' (SEQ ID NO: 22) siHBa2M2S Sense strand: 5'-GmsAmsCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 23), Antisense strand: 5'-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm-3' (SEQ ID NO: 24) in which C, G, U and A denote the composition of the bases of the nucleotides; m means that the nucleotide to the left of the letter m is a methoxy-modified nucleotide; f denotes that the nucleotide to the left of the letter f is a fluorine-modified nucleotide; s means that the two nucleotides on either side of the letter s are connected by a phosphothioate bond. 21. The siRNA conjugate according to any one of paragraphs. 1-20, characterized in that said 5'-terminal nucleotide in the antisense strand is a 5'-phosphate nucleotide or a nucleotide modified with a 5'-phosphate analog. 22. The siRNA conjugate according to any one of paragraphs. 1-21, characterized in that said siRNA is any one selected from the group consisting of siHBa1M1P1, siHBa1M2P1, siHBa2M1P1, siHBa2M2P1, siHBa1M1SP1, siHBa1M2SP1, siHBa2M1SP1 and siHBa2M2SP1: siHBa1M1P1 Sense chain: 5'-CmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 25), Antisense strand: 5'-P1-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmUm-3' (SEQ ID NO: 26), siHBa1M2P1 Sense chain: 5'-CmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 27), Antisense strand: 5'-P1-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmUm-3' (SEQ ID NO: 28), siHBa2M1P1 Sense chain: 5'-GmAmCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 29), Antisense strand: 5'-P1-UmUfUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmGmGm-3' (SEQ ID NO: 30), siHBa2M2P1 Sense chain: 5'-GmAmCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 31), Antisense strand: 5'-P1-UmUfUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmGmGm-3' (SEQ ID NO: 32), siHBa1M1SP1 Sense chain: 5'-CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 33), Antisense strand: 5'-P1-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm-3' (SEQ ID NO: 34), siHBa1M2SP1 Sense chain: 5'-CmsCmsUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 35), Antisense strand: 5'-P1-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmsUmsUm -3' (SEQ ID NO: 36), siHBa2M1SP1 Meaning chain: 5'-GmsAmsCmCmUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3' (SEQ ID NO: 37), Antisense strand: 5'-P1-UmsUfsUmGmAmAfGmUmAmUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm-3' (SEQ ID NO: 38), siHBa2M2SP1 Meaning chain: 5'-GmsAmsCmCmUmUmGfAmGfGfCfAmUmAmCmUmUmCmAmAmAm -3' (SEQ ID NO: 39), Antisense strand: 5'-P1-UmsUfsUmGmAmAfGmUfAfUmGmCmCmUfCmAfAmGmGmUmCmsGmsGm -3' (SEQ ID NO: 40), in which C, G, U and A denote the composition of the bases of the nucleotides; m means that the nucleotide to the left of the letter m is a methoxy-modified nucleotide; f denotes that the nucleotide to the left of the letter f is a fluorine-modified nucleotide; s means that the two nucleotides on either side of the letter s are connected by a phosphothioate bond; P1 means that the nucleotide adjacent to the right side of P1 is a 5'-phosphate nucleotide or a nucleotide modified with a 5'-phosphate analog. 23. The use of an siRNA conjugate according to any one of paragraphs. 1-22 in the manufacture of a medicament for the treatment and/or prevention of pathological conditions or diseases caused by hepatitis B virus (HBV) infection. 24. Use according to claim 23, characterized in that said pathological condition or disease caused by hepatitis B virus (HBV) infection is selected from chronic liver diseases, hepatitis, liver fibrosis and proliferative liver diseases. 25. A method of inhibiting the expression of HBV genes, including bringing an effective amount of an siRNA conjugate according to any one of paragraphs. 1-22 in contact with hepatitis-infected cells infected with HBV.

Images