RU2783239C2 - Combination including at least one spliceosome modulator and at least one inhibitor selected from bcl2 inhibitors, bcl2/bclxl inhibitors, and bclxl inhibitors, as well as application methods - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: group of inventions relates to the field of medicine, namely to a pharmaceutical composition including: (i) therapeutically effective amount of at least one spliceosome modulator selected from E7107, H3B-8800, and their pharmaceutically acceptable salts, and (ii) therapeutically effective amount of at least one inhibitor selected from venetoclax (ABT199), navitoclax (ABT263), A-1331852, and their pharmaceutically acceptable salts. The group of inventions also relates to a combination for the treatment of a malignant tumor selected from hemoblastoses and solid tumors, including: (i) at least one spliceosome modulator selected from E7107, H3B-8800, and their pharmaceutically acceptable salts, and (ii) at least one inhibitor selected from venetoclax (ABT199), navitoclax (ABT263), A-1331852, and their pharmaceutically acceptable salts. In this case, at least one spliceosome modulator is administered simultaneously, separately, or sequentially with at least one inhibitor. The group of inventions also relates to the use of a combination including: (i) at least one spliceosome modulator selected from E7107, H3B-8800, and their pharmaceutically acceptable salts, and (ii) at least one inhibitor selected from venetoclax (ABT199), navitoclax (ABT263), A-1331852, and their pharmaceutically acceptable salts, for the treatment of a malignant tumor selected from hemoblastoses and solid tumors. In this case, at least one spliceosome modulator is administered simultaneously, separately, or sequentially with at least one inhibitor. The group of inventions also relates to a method for the treatment of a malignant tumor, including the administration to a subject who needs it of: (i) therapeutically effective amount of at least one spliceosome modulator selected from E7107, H3B-8800, and their pharmaceutically acceptable salts, and (ii) therapeutically effective amount of at least one inhibitor selected from venetoclax (ABT199), navitoclax (ABT263), A-1331852, and their pharmaceutically acceptable salts, where the malignant tumor is selected from hemoblastoses and solid tumors. In this case, at least one spliceosome modulator is administered simultaneously, separately, or sequentially with at least one inhibitor.

EFFECT: group of inventions provides a synergetic antitumor effect of combinations of spliceosome modulators and inhibitors.

84 cl, 14 dwg

Description

[0001] This application claims priority over U.S. Provisional Application 62/579,666, filed October 31, 2017, and U.S. Provisional Application 62/580,364, filed November 1, 2017, each of which is hereby incorporated by reference in its entirety .

[0002] BCL2 family genes encode BH-domain-containing anti-apoptotic proteins/survival-promoting proteins that play a particularly important role in the regulation of apoptosis. There are at least five proteins BCL2, BCL2, BCL2L1, BCL2L2, BCL2A1, and MCL1 that are involved in tumor cell survival in various forms of cancer (see, e.g., Delbridge ARD, et al., 2016, Nat. Rev. Cancer 16, 99-109; Czabotar PE, et al., 2014, Nat. Rev. Mol. Cell Bio. 15, 49-63). Several compounds have been developed to inhibit BCL2 family proteins including, for example, ABT199 (venetoclax), ABT263 (navitoclax), A-1331852 and ABT737. Although BCL2 inhibitors have shown promise as cytotoxic agents, these compounds are unable to inhibit the anti-apoptotic effects of MCL1. In particular, MCL1 is locally amplified in many types of cancers (Zack Tl, et al., 2013, Nature Genet. 45, 1 134-1 140). High expression of BCL2L1 (BCLxL) has been reported in some reports to confer resistance to MCL1 repression, with MCL1 amplification/overexpression being the main mechanism conferring resistance to BCL2, BCL2/BCLxL and BCLxL inhibitors (see e.g. Wei G, et al., 2012, Cancer Cell 21 (4): 547-562; Lin X, et al., 2007, Oncogene 26(27): 3972-3979; Teh TC, et al, 2017, Leukemia, doi: 10.1038/leu.2017.243) . Effective therapies are needed to overcome resistance to BCL2, BCL2/BCLxL and BCLxL inhibitors.

[0003] A growing body of evidence indicates that combination therapy can help overcome incomplete response and therapeutic resistance with antitumor monotherapy (Sellers WR., 2011, Cell 147(1):26-31). For example, the combination of MAPK pathway inhibitors, vemurafenib (RAF inhibitor) and cobimetinib (MEK inhibitor), has been approved by the FDA for the treatment of melanoma patients with B-RAF mutations (Flaherty KT, et al., 2012, N Engl. J Med 367:1694 -1703.) However, the development of an effective combination therapy has been difficult in part because of the lack of effective preclinical approaches that predict the clinical activity of the combination, especially in the case of experimental confirmation of the effectiveness of drug combinations. Mechanism-based drug combination strategies have been applied in preclinical and clinical settings based on the results of basic biological research related to targets and pathways. Given the complexity of the mechanisms of action, there are many obstacles in determining effective combinations of cytotoxic agents.

SUMMARY OF THE INVENTION

[0004] The present invention is based on the observation that the combination of certain spliceosome modulators (eg, pladienolide compounds) and inhibitors of BCL2, BCL2/BCLxL or BCLxL, exhibits improved (eg, synergistic) antitumor activity. Pladienolide compounds that target and mutate the spliceosome are particularly useful. Thus, provided herein is a combination therapy for the treatment of cancer comprising administering a therapeutically effective amount of at least one spliceosome modulator pladienolide (e.g., E7107 and/or H3B-8800) and a therapeutically effective amount of at least one inhibitor selected from the inhibitors BCL2, BCL2/BCLxL and BCLxL.

[0005] Also provided are methods, combination therapies, pharmaceutical compositions, and kits for treating cancer using a combination of a therapeutically effective amount of at least one spliceosome modulator pladienolide (e.g., E7107 and/or H3B-8800) and a therapeutically effective amount of at least one an inhibitor selected from BCL2, BCL2/BCLxL and BCLxL inhibitors.

[0006] Other features of the present invention will become apparent from the following detailed description, drawings and claims.

BRIEF DESCRIPTION OF THE DRAWINGS

[0007] FIG. 1 and 2 show the identification of MCL1-overexpressing and MCL1-dependent non-small cell lung carcinoma (NSCLC) cell lines. FIG. 1 shows Western blot of MCL1L (full length MCL1) and GAPDH (application control). Dilutions of lysates were used as semi-quantitative standards. FIG. 2 shows the growth inhibition of cell lines upon knockdown of MCL1 by shRNA. CNTRL: shRNA control; Dox: doxycycline.

[0008] FIG. 3-5 show that E7107 modulates MCL1 splicing in NCIH1568 cells. FIG. 3 is a schematic representation of MCL gene splicing. FIG. 4 shows detection of MCL1 mRNA by quantitative RT-PCR: MCL1L: long form containing exons 1, 2 and 3; MCL1S: short form that contains exons 1 and 3; MCL1 pre-mRNA: intron-1 conserving mRNA. FIG. 5 shows Western blot of MCL1L (full length), truncated MCL1, cleaved PARP and tubulin (application control) after treatment with E7107 for 6 hours.

[0009] FIG. 6-9 show that E7107-induced cytotoxicity is MCL1- and BCLxL-dependent. FIG. 6 shows inducible expression of MCL1L cDNA in NCIH1568 cells. Western blotting shows expression of MCL1L and GAPDH (application control). CNTRL: control vector. FIG. 7 shows growth inhibition of empty vector NCIH1568 cell lines (control) and overexpression of MCL1L cDNA. FIG. 8 shows induced shRNA-mediated knockdown of BCLxL (encoded by the BCL2L1 gene) in A549 cells. Western blot shows expression of BCLxL and GAPDH (application control). FIG. 9 shows the growth inhibition of A549 cell lines by Dox-induced knockdown of BCLxL. Dox: doxycycline.

[0010] FIG. 10 shows the synergistic effect of treatment with E7107 and ABT263 in four NSCLC cell lines. This study was performed in vector control or BCLxL shRNA.

[0011] FIG. 11 shows the synergistic effect of treatment with E7107 and ABT199 in the A549 cell line. This study was performed in vector control or BCLxL shRNA.

[0012] FIG. 12 shows the synergistic effect of treatment with H3B-8800 and ABT263 in two multiple myeloma cell lines: U266B1 and RPMI8226.

[0013] FIG. 13 shows the synergistic effect of treatment with H3B-8800 and ABT199 in two multiple myeloma cell lines: JJN3 and RPMI8226.

[0014] FIG. 14 shows the synergistic effect of treatment with H3B-8800 and A-1331852 in two multiple myeloma cell lines: RPMI8226 and MM1S.

[0015] As used herein, the following definitions shall apply unless otherwise noted.

[0016] "Isomers" refers to compounds containing the same number and type of atoms, and therefore the same molecular weight, but differing in the arrangement or configuration of the atoms. "Stereoisomers" refers to compounds that have the same atomic bonds but differ in the arrangement of their atoms in space. "Diastereoisomers" or "diastereomers" refer to stereoisomers that are not enantiomers. "Enantiomers" refers to stereoisomers that are non-superimposable mirror images of each other. "Geometric isomers" refers to cis-trans isomers having different group arrangements relative to the double bond or ring or central atom.

[0017] Enantiomers described herein may include "enantiomerically pure" isomers that include essentially a single enantiomer, for example, in an amount greater than or equal to 90%, 92%, 95%, 98%, or 99%, or equal to 100 % of one enantiomer at a particular center or centers of asymmetry. "Asymmetric center" or "chiral center" refers to a tetrahedral carbon atom that contains four different substituents.

[0018] "Stereomerically pure" as used herein means a compound or composition thereof that includes one stereoisomer of the compound and substantially no other stereoisomers of the compound. For example, a stereomerically pure composition of a compound having one chiral center will essentially not contain the opposite enantiomer of the compound. A stereomerically pure composition of a compound having two chiral centers will essentially be free of diastereomers, and essentially free of the opposite enantiomer of the compound. A typical stereomerically pure compound contains more than about 80% by weight of one stereoisomer of the compound and less than about 20% by weight of other stereoisomers of the compound, more preferably more than about 90% by weight of one stereoisomer of the compound and less than about 10% by weight of other stereoisomers of the compound , even more preferably more than about 95% by weight of one stereoisomer of the compound and less than about 5% by weight of other stereoisomers of the compound, and most preferably more than about 97% by weight of one stereoisomer of the compound and less than about 3% by weight of other stereoisomers of the compound . See, for example, US Pat. No. 7,189,715.

[0019] "R" and "S" as terms describing isomers are identifiers of the stereochemical configuration on an asymmetrically substituted carbon atom. The designation of an asymmetrically substituted carbon atom as "R" or "S" is accomplished by applying the Kahn-Ingold-Prelog precedence rules, which are well known to those skilled in the art and are described in the Rules for the Nomenclature of Organic Chemistry of the International Union of Pure and Applied Chemistry (IUPAC), Section E , Stereochemistry.

[0020] "Treating", "treating", or "treatment" of cancer refers to alteration (e.g., overcoming a blockage in cell differentiation), alleviation (e.g., alleviation of one or more symptoms such as anaemia fatigue, low blood counts, etc.). .d.) and/or delaying the progression (eg, delaying the progression of a condition such as degeneration into AML) of cancer, as described herein.

[0021] "Subject" as used herein means a test animal, preferably a mammalian subject, and in particular a human.

[0022] A "pharmaceutically acceptable carrier" as used herein refers to a non-toxic carrier, excipient, or solvent that does not interfere with the pharmacological activity of the compound with which it is formulated. Pharmaceutically acceptable carriers, adjuvants or solvents that may be used in the compositions of the present invention include, but are not limited to, ion exchange resins, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffering agents such as phosphates. , glycine, sorbic acid, potassium sorbate, mixtures of partial glycerides of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silicon dioxide, magnesium trisilicate, polyvinylpyrrolidone, substances based on cellulose, polyethylene glycol, cyclodextrins, sodium carboxymethyl cellulose, polyacrylates, waxes, polyethylene-polyoxypropylene block copolymers, polyethylene glycol and grease.

[0023] A "pharmaceutically acceptable salt" is a salt that retains the desired biological activity of the parent compound and does not have an undesirable toxic effect. Examples of such salts are: (a) acid addition salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like; and salts formed with organic acids such as acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; and (b) salts formed from elemental anions such as chlorine, bromine and iodine. See, for example, Haynes et al., "Commentary: Occurrence of Pharmaceutically Acceptable Anions and Cations in the Cambridge Structural Database," J. Pharmaceutical Sciences, vol. 94, no. 10 (2005), and Berge et al., "Pharmaceutical Salts", J. Pharmaceutical Sciences, vol. 66, no. 1 (1977), which are incorporated herein by reference.

[0024] Unless otherwise indicated, compounds provided herein may include mixtures of a compound provided herein and any enantiomeric, diastereomeric, and/or geometric (or conformational) forms of the structure; for example, R and S configurations for each asymmetric center, (Z) and (E) double bond isomers, and (Z) and (E) conformational isomers. Unless otherwise indicated, the compounds provided herein, existing together with tautomeric forms, are included in the scope of the invention. In addition, unless otherwise indicated, the structures presented herein are also intended to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures, except for the replacement of hydrogen with deuterium or tritium, or the replacement of carbon with 13C- or 14C-rich carbon, are within the scope of the present invention. Such compounds can be used, for example, as analytical tools or probes in biological assays.

[0025] Various pladienolide compounds have been developed as splicing modulators for the treatment of cancer, including compounds disclosed in the following patent applications: WO 2002/060890; WO 2004/01 1459; WO 2004/01 1661; WO2004/050890; W02005/052152; WO2006/009276; WO2008/126918; and WO 2015/175594, each of which is incorporated herein by reference. For example, the pladienolide compound (8E,12E,14E)-7-((4-Cycloheptylpiperazin-1-yl)carbonyl)oxy-3,6,16,21-tetrahydroxy-6,10,12,16,20-pentamethyl- 18,19-epoxytricose-8,12,14-triene-11-olide, also known as E7107, is a semi-synthetic derivative of the natural product pladienolide D, and the results of its Phase I study have been reported:

.

.

[0026] As another example, pyridine pladienolide compound (2S,3S,6S,7R,10R,E)-7,10-dihydroxy-3,7-dimethyl-12-oxo-2-((R,2E,4E )-6-(pyridin-2-yl)hepta-2,4-dien-2-yl)oxacyclo-dodec-4-en-6-yl-4-methylpiperazin-1-carboxylate (also called "(2S,3S ,4E,6S,7R,10R)-7,10-dihydroxy-3,7-dimethyl-12-oxo-2-((2E,4E,6R)-6-(pyridin-2-yl)hepta-2, 4-dien-2-yl)oxacyclododec-4-en-6-yl-4-methylpiperazine-1-carboxylate"), also known as H3B-8800, has received the prescription of a rare disease drug for the treatment of certain hemoblastoses and has the following structure :

.

.

[0027] In some embodiments, the at least one pladienolide spliceosome modulator for use in combination therapy is selected from a compound of Formula 1 ('E7107"):

and its pharmaceutically acceptable salts.

[0028] In some embodiments, the at least one pladienolide spliceosome modulator for use in combination therapy is selected from a compound of formula 2 ("H3B-8800"):

and its pharmaceutically acceptable salts.

[0029] As used herein, at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors includes, but is not limited to, HA14-1, BH3I-1, antimycin A, chelerythrin, gossypol (NSC19048), agossypol (NSC736630) TW-37 ABT263), A-1331852 and ABT737.

[0030] In some embodiments, at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors is selected from venetoclax (ABT199), navitoclax (ABT263), A-1331852, ABT737, and pharmaceutically acceptable salts thereof.

[0031] The methods disclosed herein can be used to treat various types of cancers, including hematological malignancies and solid tumors.

[0032] Hemoblastoses may include cancers of the blood (eg, leukemia) or cancers of the lymph nodes (eg, lymphomas) or other similar cancers. Leukemias may include acute lymphoblastic leukemia (ALL), acute myelogenous leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), chronic myelomonocytic leukemia (CMML), acute monocytic leukemia (AML), etc. Lymphomas may include Hodgkin's lymphoma and non-Hodgkin's lymphoma. Other hemoblastoses may include myelodysplastic syndrome (MDS) and multiple myeloma (MM).

[0033] Solid tumors may include carcinomas such as adenocarcinoma, e.g., breast cancer, pancreatic cancer, prostate cancer, colon or colorectal cancer, lung cancer (including non-small cell lung carcinoma (NSCLC) and small cell carcinoma lung (SCLC)), gastric cancer, cervical cancer, endometrial cancer, ovarian cancer, cholangiocarcinoma, glioma, melanoma, and the like.

[0034] The methods disclosed herein may also be used to treat cancers that may respond to therapy with agents that target a spliceosome gene or protein, such as SF3B1. Examples of such cancers include, but are not limited to, myelodysplastic syndrome, multiple myeloma, chronic lymphocytic leukemia, acute lymphoblastic leukemia, chronic myelomonocytic leukemia, acute myeloid leukemia, colon cancer, pancreatic cancer, endometrial cancer, ovarian cancer, breast cancer, uveal melanoma, gastric cancer, cholangiocarcinoma, or lung cancer (including non-small cell lung carcinoma (NSCLC) and small cell lung carcinoma (SCLC)). Examples of spliceosome genes or proteins include, but are not limited to, splicing factor 3B subunit 1 (SF3B1), small nuclear RNA U2 accessory factor 1 (U2AF1), serine/arginine-rich splicing factor 2 (SRSF2), zinc finger (CCCH type) RNA- binding motif and serine/arginine-rich 2 (ZRSR2), pre-mRNA splicing processing factor 8 (PRPF8), small nuclear RNA U2 accessory factor 2 (U2AF2), splicing factor 1 (SF1), splicing factor 3a subunit 1 (SF3A1 ), PRP40 pre-mRNA processing factor 40 homologue B (PRPF40B), containing RNA-binding motif protein 10 (RBM 10), poly(rC)-binding protein 1 (PCBP1), pre-mRNA splicing factor crooked neck 1 (CRNKL1) , DEAH (Asp-Glu-Ala-His) box helicase 9 (DHX9), peptidyl-prolyl cis-trans isomerase-like 2 (PPIL2), containing RNA-binding motif protein 22 (RBM22), small nuclear ribonucleoprotein Sm D3 (SNRPD3 ), probable ATP-dependent RNA helicase DDX5 (DDX5), pre-mRNA splicing factor ATP-dependent RNA helicase DHX 15 (DHX15) and polyadenylate binding protein 1 (PABPC1).

[0035] The methods disclosed herein can also be used to treat MCL1-dependent cancers. Examples of MCL1 dependent cancers may include, but are not limited to, multiple myeloma, leukemias, lymphomas, and solid tumors. MCL1 dependent leukemias may include, but are not limited to, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myelomonocytic leukemia, and acute monocytic leukemia. MCL1-dependent lymphomas may include, but are not limited to, Hodgkin's lymphoma and non-Hodgkin's lymphoma. MCL1-dependent solid tumors may include, but are not limited to, lung cancer (e.g., non-small cell lung carcinoma and small cell lung carcinoma), breast cancer, pancreatic cancer, prostate cancer, colon or colorectal cancer, gastric cancer , cervical cancer, endometrial cancer, ovarian cancer, cholangiocarcinoma, glioma and melanoma.

[0036] Cancers highly expressing MCL1 have been shown to be susceptible to MCL1 inhibition, either by direct target inhibition or by altering the level of the gene, such as transcription or splicing inhibition (Gao Y, Koide K., 2013, ACS Chem Biol. 8 (5):895-900; Wei G, et al., 2012, Cancer Cell 21(4):547-562). High expression of BCL-xL has also been shown to confer resistance to MCL1 repression, and MCL1 amplification/overexpression is the main mechanism conferring resistance to BCL2/xL inhibitors (see, e.g., Wei G, et al., 2012, Cancer Cell 21 (4):547-562; Lin X, et al., 2007, Oncogene 26(27):3972-3979; Teh TC, et al, 2017, Leukemia, doi:10.1038/leu.2017.243). Without wishing to be bound by any particular theory, as described herein, pladienolide derivatives E7107 and H3B-8800 can induce potent modulation of MCL1 gene splicing resulting in decreased expression of functional full-length protein. A decrease in the MCL1 protein can induce cell death in cancer cell lines. The combination of at least one pladienolide derivative (eg E7107 and/or H3B-8800) and at least one inhibitor selected from BCL2, BCL2/BCLxL and BCLxL inhibitors can cause synergistic inhibition of cancer cell growth. Thus, a combination of at least one small molecule splicing modulator and at least one inhibitor selected from BCL2, BCL2/BCLxL and BCLxL inhibitors can be used to treat cancers such as malignancies that depend on anti-apoptotic genes.

[0037] Also disclosed herein are pharmaceutical compositions comprising at least one pladienolide spliceosome modulator and at least one inhibitor selected from BCL2, BCL2/BCLxL and BCLxL inhibitors. In some embodiments, the implementation of the pharmaceutical composition further includes at least one pharmaceutically acceptable carrier. At least one pharmaceutically acceptable carrier may be selected according to the intended route of administration.

[0038] The pharmaceutical compositions disclosed herein may be formulated for parenteral, oral, inhalation aerosol, topical, rectal, nasal, buccal, vaginal or implantable reservoir administration, etc. The term "parenteral" as used herein includes subcutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional, and intracranial injection or infusion techniques. In specific embodiments, the combination therapy compounds are administered by intravenous, oral, subcutaneous, or intramuscular injection. Sterile injectable forms of the compositions of the present invention may be an aqueous or oily suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example as a solution in 1,3-butanediol. Suitable vehicles and solvents that may be used include water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile fixed oils are usually used as a solvent or suspending medium.

[0039] For this purpose, you can use any fixed oil without taste and smell, including synthetic mono - or diglycerides. Fatty acids such as oleic acid and its glyceride derivatives are suitable for the manufacture of injectables, as are natural pharmaceutically acceptable oils such as olive oil or castor oil, especially in their polyoxyethylated versions. These oily solutions or suspensions may also contain a long chain alcohol diluent or dispersant such as carboxymethyl cellulose or similar dispersants that are commonly used in the manufacture of pharmaceutically acceptable dosage forms, including emulsions and suspensions. Other commonly used surfactants such as Tween, Span, and other emulsifiers or bioavailability enhancers that are commonly used in the manufacture of pharmaceutically acceptable solid, liquid, or other dosage forms may also be used for formulation purposes.

[0040] For oral use, at least one pladienolide spliceosome modulator and/or at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors may be provided in an acceptable oral dosage form, including without limitations to those listed, capsules, tablets, aqueous suspensions or solutions. In the case of tablets for oral use, the carriers may be selected from, for example, lactose and corn starch. Lubricants such as magnesium stearate may also be added. For oral administration in capsule form, useful diluents include lactose and dried corn starch. If aqueous suspensions are required for oral administration, the active ingredient is combined with an emulsifying and/or suspending agent. Certain sweetening, flavoring or coloring agents may also be added if desired.

[0041] In some embodiments, at least one pladienolide spliceosome modulator and at least one inhibitor selected from the BCL2, BCL2/BCLxL, and BCLxL inhibitors disclosed herein are administered to a subject in a single dosage form or by separate or sequential administration. each active ingredient.

[0042] In some embodiments, at least one pladienolide spliceosome modulator and at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors are formulated as tablets, pills, capsules, or solutions. In some embodiments, at least one pladienolide spliceosome modulator and/or at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors are included in the parenteral solution. In some embodiments, at least one pladienolide spliceosome modulator and at least one inhibitor selected from BCL2, BCL2/BCLxL and BCLxL inhibitors are included in separate regions or different caplets placed in a capsule. In some embodiments, at least one spliceosome modulator pladienolide and at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors are included in isolated layers in a tablet.

[0043] In some embodiments, the pharmaceutical composition comprises: a therapeutically effective amount of at least one spliceosome modulator pladienolide, a therapeutically effective amount of at least one inhibitor selected from inhibitors of BCL2, BCL2/BCLxL, and BCLxL, and at least one pharmaceutically acceptable carrier.

[0044] In some embodiments, the pharmaceutical composition includes: a therapeutically effective amount of E7107, a therapeutically effective amount of at least one inhibitor selected from inhibitors of BCL2, BCL2/BCLxL and BCLxL, and at least one pharmaceutically acceptable carrier.

[0045] In some embodiments, the pharmaceutical composition includes: a therapeutically effective amount of H3B-8800, a therapeutically effective amount of at least one inhibitor selected from inhibitors of BCL2, BCL2/BCLxL and BCLxL, and at least one pharmaceutically acceptable carrier.

[0046] In some embodiments, at least one pladienolide spliceosome modulator and at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors may be administered in separate compositions and optionally in different forms, e.g., as separate tablets or solutions. In addition, as a non-limiting example, at least one pladienolide spliceosome modulator and at least one inhibitor selected from BCL2 inhibitors, BCL2/BCLxL and BCLxL inhibitors may be administered separately as oral tablets.

[0047] In some embodiments, at least one pladienolide spliceosome modulator and at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors are to be administered in separate compositions:

a pharmaceutical composition comprising a therapeutically effective amount of at least one inhibitor selected from inhibitors of BCL2, BCL2/BCLxL and BCLxL, and at least one pharmaceutically acceptable carrier; and

a pharmaceutical composition comprising a therapeutically effective amount of at least one spliceosome modulator pladienolide and at least one pharmaceutically acceptable carrier.

[0048] In some embodiments, provided herein is a kit comprising a first pharmaceutical composition comprising a therapeutically effective amount of at least one spliceosome modulator pladienolide, a second pharmaceutical composition comprising a therapeutically effective amount of at least one inhibitor selected from BCL2 inhibitors, BCL2/BCLxL and BCLxL, and instructions for using the kit in cancer treatment.

[0049] In some embodiments, at least one pladienolide spliceosome modulator and at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors are administered simultaneously. In some embodiments, at least one pladienolide spliceosome modulator and at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors are administered sequentially. In some embodiments, at least one pladienolide spliceosome modulator and at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors are administered intermittently. The interval between administrations of at least one spliceosome modulator pladienolide and at least one inhibitor selected from BCL2, BCL2/BCLxL and BCLxL inhibitors can be adjusted to provide the desired therapeutic effect. In some embodiments, at least one pladienolide spliceosome modulator and at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors are administered only a few minutes apart. In some embodiments, at least one spliceosome modulator pladienolide and at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors are administered several hours later (e.g., about 2, 4, 6, 10, 12, 24, or 36 hours). In some embodiments, it may be preferable to administer more than one dose of one of at least one pladienolide spliceosome modulator and at least one inhibitor selected from BCL2, BCL2/BCLxL and BCLxL inhibitors between administrations of the remaining therapeutic agent. For example, one therapeutic agent may be administered 1 hour and then again 11 hours after administration of another therapeutic agent. In some embodiments, the therapeutic effects of each pladienolide spliceosome modulator and BCL2 inhibitor, BCL2/BCLxL, or BCLxL must overlap for at least part of the duration of action so that the overall therapeutic effect of the combination therapy can be partly due to the combined or synergistic effect of the combination therapy. .

[0050] At least one spliceosome modulator pladienolide and at least one inhibitor selected from the BCL2, BCL2/BCLxL, and BCLxL inhibitors disclosed herein may be administered to a subject in a therapeutically effective or therapeutically effective amount. The amount of each of at least one spliceosome modulator pladienolide and at least one inhibitor selected from BCL2, BCL2/BCLxL and BCLxL inhibitors, which can be combined in combination with at least one pharmaceutically acceptable carrier, to form a single dosage form, will be vary depending on the subject being treated and the intended route of administration.

[0051] In some embodiments, the pharmaceutical compositions are formulated such that a dose of 0.01 to 100 mg/kg body weight/day of each of at least one spliceosome modulator pladienolide and at least one inhibitor selected from inhibitors of BCL2, BCL2/BCLxL and BCLxL. In some embodiments, the subject is administered a dose ranging from 1 to 100 mg/kg body weight/day of each of at least one spliceosome modulator pladienolide and at least one inhibitor selected from inhibitors of BCL2, BCL2/BCLxL, and BCLxL. In some embodiments, the subject is administered a dose ranging from 0.01 mg to 50 mg of each of at least one spliceosome modulator pladienolide and at least one inhibitor selected from BCL2, BCL2/BCLxL, and BCLxL inhibitors. In some embodiments, a dose in the range of 1 mg to 50 mg, 0.1 mg to 25 mg, or 5 mg to 40 mg of each of at least one spliceosome modulator pladienolide and at least one inhibitor selected from inhibitors is provided. BCL2, BCL2/BCLxL and BCLxL.

[0052] In some embodiments, at least one pladienolide spliceosome modulator is administered in a dose range of 1 mg/kg to 10 mg/kg. In some embodiments, at least one spliceosome pladienolide is administered at a dose of 1 mg/kg, 1.25 mg/kg, 2 mg/kg, 2.5 mg/kg, 3 mg/kg, 4 mg/kg, 5 mg/kg. kg, 6 mg/kg, 7 mg/kg, 8 mg/kg, 9 mg/kg or 10 mg/kg. In some embodiments, at least one spliceosome pladienolide is administered at a dose of 5 mg/kg. In some embodiments, at least one spliceosome pladienolide is administered at a dose of 8 mg/kg.

[0053] In some embodiments, E7107 is administered intravenously at a dose of 5 mg/kg for five consecutive days. In some embodiments, H3B-8800 is administered orally at a dose of 8 mg/kg for five consecutive days followed by a nine-day break.

[0054] It will be apparent to one of ordinary skill in the art that the specific dosage and treatment regimen for any particular patient will depend on a variety of factors including potency of the particular compound used, age, body weight, general health, sex, diet, time of administration. , rate of excretion, combination of drugs, the judgment of the attending physician, and the severity of the particular disease being treated. The amount of each active ingredient in combination therapy will also depend on the particular compound/salt in the composition.

[0055] The following examples are set forth so that the embodiments described herein, and their application, can be more fully understood. It should be understood that these examples are for illustrative purposes only and should not be construed as limiting in any way.

EXAMPLES

A. Materials and methods

1. Cell lines and cell culture protocol

[0056] Non-small cell lung cancer (NSCLC) cell lines A549, NCI-H23, NCI-H 1568, NCI-H1650, NCI-H1975, and NCI-H2110 were obtained from the American Type Culture Collection (ATCC) and cultured according to the manufacturer's instructions. Inducible shRNA and cDNA lines obtained by lentiviral transduction were cultured according to the manufacturer's instructions using FBS approved for use with the Tet system (Clontech) rather than standard serum. LentiX-293T (Clontech) was used to create viruses for overexpressing shRNA and cDNA for infection and cultured according to the manufacturer's instructions. Cell lines were examined for mycoplasma contamination and authenticity to confirm cell identity. Puromycin (0.25-1.25 µg/mL, Thermo Fisher Scientific) was used to select shRNA-expressing cells; G418 (0.5-2 mg/ml, Thermo Fisher Scientific) was used to select inducible cells expressing cDNA. Doxycycline hyclate (Sigma) (Dox) was used to induce shRNA and cDNA.

[0057] NKM 1 and KO52 cells were obtained from the Japan Research Bioresources Cell Bank Collection. HNT34, MONOMAC6 and MUTZ3 cells were obtained from the German Collection of Microorganisms and Cell Cultures. HNT34 and NKM 1 cells were maintained in RPMI (ATCC) with 10% fetal bovine serum. KO52 cells were maintained in Alpha-MEM (ATCC) with 10% fetal bovine serum. MONOMAC6 cells were maintained in RPMI (ATCC) with 20% fetal bovine serum. MUTZ3 cells were maintained in alpha-MEM (ATCC) with 20% fetal bovine serum and 20% conditioned 5637 medium. Cell lines were incubated in a humidified incubator at 37°C with 5% CO2.

2. Western blotting technique MCL1 and BCLxL

[0058] Cell lines were lysed in RIPA buffer (Boston BioProducts) with a mixture of protease inhibitors (Mini-complete, no EDTA, Roche) and PhosSTOP phosphatase inhibitor (Roche). Lysates were diluted with RIPA buffer with 4x LDS sample buffer (Nupage, Thermo Fisher Scientific) and 10x Reducing Reagent (Nupage, Thermo Fisher Scientific) and boiled for 5 minutes. Twenty-five micrograms of protein was loaded into a well in 4-12% bis-Tris SDS PAAG gels (Novex, Thermo Fisher Scientific). The gels were transferred to nitrocellulose membranes using the iBIot system (Thermo Fisher Scientific). The membranes were blocked in blocking buffer (1x Tris buffered sodium chloride + 0.1% Tween-20 (Boston Bioproducts) + 5% non-fat dry milk (Bio-Rad)) for 1 hour and then cut. Each section was individually labeled with antibodies to each of the following proteins in blocking buffer: MCL1 (Cell Signaling Technologies 5453) (D35A5), rabbit monoclonal, 1:500 dilution, BCL-xL (Cell Signaling Technologies 2764) (54H6), rabbit monoclonal, diluted 1:500 digested with Parp (Cell Signaling Technologies 5625) (D64P10), rabbit monoclonal, 1:500 dilution, and GAPDH (Sigma G8795), mouse monoclonal at 100 ng/mL. Blots were incubated with dilutions of primary antibodies at 4°C overnight with shaking. The Western blots were then labeled with secondary Odyssey Licor or HRP antibodies. The blots were then washed four times using wash buffer (1x Tris buffered sodium chloride + 0.1% Tween-20). Blots developed using Licor were labeled with shaking at room temperature for 1 hour with Licor IR-labeled secondary antibodies, IRDye® 800CW goat anti-rabbit IgG (Odyssey 925-3221 1) and IRDye® 680LT goat anti-mouse IgG (Odyssey 925 -68020) at a 1:10000 dilution in blocking buffer. The blots were then washed three times with wash buffer. IR dye detection was performed using a Licor imaging system (Odyssey) according to the manufacturer's instructions. Blots visualized using HRP were labeled with shaking at room temperature for 1 hour with HRP-conjugated anti-mouse IgG (Cell Signaling Technologies 7076) and HRP-conjugated anti-rabbit IgG (Cell Signaling Technologies 7074) at a dilution of 1:5000 in the blocking buffer. The blots were then washed three times with wash buffer. HRP detection was performed using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) and visualized using an ImageQuant™ LAS 4000 biomolecular imaging system (GE Healthcare Life Sciences) according to the manufacturer's instructions.

3. Real-time quantitative MCL1 PCR technique

[0059] RNA lysates were isolated from compound-treated cells in 96-well plates and reverse transcribed using the TaqMan Gene Expression Cells-to-CT kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Quantitative PCR was performed using a TaqMan Gene Expression master mix (Thermo Fisher Scientific) with MCL1 transcript probes (Integrated DNA technologies FAM-ZEN/IBFQ) coupled to VIC-MH 18S rRNA (Thermo Fisher Scientific, test Hs99999901_s1), and the amount determined using the AACt method.

Probe set MCL1L

primer ATATGCCAAACCAGCTCCTAC

primer AAGGACAAAACGGGACTGG

test AGAACTCCACAAACCCATCCCAGC

probe MCL1S

primer AAAGCCAATGGGCAGGT

primer CCACCTTCTAGGTCCTTCTACAT

probe TCCACAAACCCATCTTGGAAGGCC

MCL1 pre-mRNA probe set with intron1-exon2

primer GACAAAGGAGGCCGTGAGGA

primer GTTTGTTACGCCGTCGCTGAAA

probe TCAGGCATGCTTCGGAAACTGGA

4. Inducible shRNA and cDNA technique

[0060] BCL-xL shRNA 1 (GCTCACTCTTCAGTCGGAAAT) (Wei G, et al., 2012, Cancer Cell 21(4):547-562) was cloned by AgeI and EcoRI into the Tet-inducible lentiviral vector pLKO-iKD-H1 puro ( Wiederschain D, et al., 2009, Cell Cycle 8(3):498-504). MCL1 shRNA 48 (GCATCGAACCATTAGCAGAAA) (Wei G, et al., 2012, Cancer Cell 21(4):547-56) was cloned by AgeI and EcoRI into the Tet-induced lentiviral vector pLKO-iKD-U6 puro. MCL1-L pENTR-D-TOPO was cloned using Gateway technology (LR clonase, Thermo Fisher Scientific) into pINDUCER20 (Meerbrey KL, et al., 2011, Proc Natl Acad Sci U S A. 108(9):3665-3670). Lentiviruses were obtained in LentiX-293T cells. 2.5M cells in 10 cm Biocoat Collagen II dishes (Corning) were transfected with 2.4 µg pLKO-shsRNA target or pINDUCER20 plasmid with 2.4 µg ρΔ8.91 (packaging) and 0.6 µg VSVG (coat) using the TransIT reagent ( Mirus). pINDUCER20+MCL1-L, pINDUCER20 vector, pLKO-iKD-U6 puro+MCL1 shRNA 48 and pLKO-iKD-U6 puro vector viruses were used to infect A549, NCI-H23, NCI-H1568, NCI-H1650, NCI-H1975 and NCI -H2110. pLKO-iKD-H1 puro+BCL-xL shRNA 1 and pLKO-iKD-H1 puro viruses were used to infect A549, NCI-H23, NCI-H1568 and NCI-H2110. Cells were infected with or without centrifugation using Polybrene (Millipore). One to three days after infection, cells were cultured in geneticin (pINDUCER20) or puromycin (pLKO shRNA). Selected cells were cultured in the presence or absence of Dox (300 ng/ml). Cells were harvested for protein and RNA isolation three to five days after induction. RNA was isolated as in the MCL1 real-time PCR section. Protein extracts were obtained as in the MCL1 and BCL-xL Western blot methodology section above.

5. Cell viability and MCL1 rescue technique

[0061] For inducible shRNA experiments, cells were cultured in a 96-well format with or without 300 ng/ml Dox for 72 hours and then lysed using the CellTiter-Glo Luminescent Cell Viability Assay (Promega) according to the manufacturer's instructions and examined using Perkin -Elmer Envision. Dox-treated wells were normalized to untreated wells for each cell line.

[0062] For dose-effect experiments, cells were seeded into 96- or 384-well plates at 1000 cells in 50 μl per well. Compounds were added from a series of 11 point serial dilutions in 90% DMSO to cells in media by acoustic transfer. The final concentration of DMSO was 0.1%. The plates were covered with lids and the cells were allowed to grow at 37°C and 5% CO2. At t=0, untreated cells were lysed using CellTiter-Glo and measured on an Envision plate analyzer. At t=72 (72 hours after compound addition), compound-treated cells were lysed using CellTiter-Glo and analyzed by Envision. The luminescence index for each treated sample was normalized to the mean of the corresponding DMSO control.

[0063] For MCL1 rescue experiments, cell lines were cultured for 72 hours with 300 ng/ml dox, then subcultured and seeded in 96- or 384-well plates with 300 ng/ml dox.

6. Combined application studies

[0064] Serial dilutions of compounds were prepared for a splicing modulator (eg, E7107 or H3B-8800) and a BCL2, BCL2/BCLxL or BCLxL inhibitor (eg, ABT263, ABT199, or A-1331852) and cells were treated as described in Cell Viability and MCL1-rescue technique. For BCL-xL knockdown, cells were treated with 300 ng/ml dox according to the Cell Viability and MCL1-rescue methodology prior to seeding into 384-well plates. The final concentration of DMSO was 0.2%. CellTiter-Glo was run according to the Cell Viability and MCL1-rescue methodology. Data were analyzed using Chalice Bioinformatics software (Horizon Discovery, Cambridge, UK). To evaluate the synergy of compounds for a splicing modulator (eg, E7107 or H3B-8800) and a BCL2, BCL2/BCLxL or BCLxL inhibitor (eg, ABT263, ABT199, or A-1331852), the Levé additivity model from Horizon Discovery was used, and Levé's excess was calculated by subtracting the Leve model (pure additivity based on combining the compound with itself) from the dose-response matrix.

7. Animal studies

[0065] To determine tolerated doses for use in the combination therapy group of the efficacy study, mice were administered a spliceosome modulator (e.g., E7107 or H3B-8800) intravenously, once a day, for 5 consecutive days (QD×5) at well tolerated dose levels (e.g., 1, 25, 2.5, and 5 mg/kg for E7107) or BCL2, BCL2/BCLxL, or BCLxL inhibitors orally, once daily (QD), at tolerated doses (100, 50, and 25 mg/kg) , alone or in combination. After dosing, animals were monitored for development of disorders (eg, paralysis or excessive weight loss). The maximum tolerated dose of the combination and corresponding single doses of each compound were used in an efficacy study in tumor animals.

[0066] The antitumor activity of the combination of E7107 and an inhibitor of BCL2, BCL2/BCLxL or BCLxL was evaluated in vivo in the subcutaneous model A549 and NCIH1568. Cells (5x106 H1568 cells and 10x106 A549 cells) were implanted subcutaneously in the flank of nude mice. Animals were treated with a spliceosome modulator and a BCL2, BCL2/BCLxL or BCLxL inhibitor based on doses determined in a previous study.

B. Results

1. Identification of MCL1-overexpressing and MCL1-dependent NSCLC cell lines

[0067] Six non-small cell lung carcinoma (NSCLC) cell lines with or without MCL1 amplification were selected to identify combinatorial activity of pladienolide spliceosome modulators and BCL2, BCL2/BCLxL or BCLxL inhibitors based on a previous report (Wei G, et al. , 2012, Cancer Cell 21(4):547-562). Western blotting was performed to analyze MCL1 protein expression in these cell lines. As shown in FIG. 1, NCIH1568, NCIH23 and NCIH2110 with MCL1 gene amplification express higher levels of MCL1 protein compared to NCIH1650, NCIH1975 and A549 cell lines without amplification. MCL1 dependence was then explored in these cell lines using inducible shRNA that specifically downregulates MCL1, demonstrating selective MCL dependence in MCL-amplified cell lines but not in non-amplified cells (FIG. 2). Lineage models of MCL1-overexpressed and MCL1-dependent NSCLC cells have been identified for use in subsequent functional studies.

2. E7107 causes MCL1 splicing modulation

[0068] Modulation of MCL1 gene splicing by pladienolide derivative, E7107, was studied. The MCL1 gene contains three exons and two introns that can be alternatively spliced to produce two major transcripts: MCL1L, which encodes a functional full-length protein, and MCL1S, which encodes a putative loss-of-function protein (FIG. 3). As part of the study, MCL1 intron retention was measured, as E7107 impairs the function of the splicing apparatus. Six-hour treatment of NCIH1568 E7107 cells effectively caused a decrease in MCL1L mRNA, transient expression of MCL1S mRNA, and continuous intron-sparing pre-mRNA induction of MCL1 (FIG. 4).

[0069] MCL1 protein expression was also examined in NCIH1568 cells. Consistent with mRNA data, E7107 caused a dose-dependent downregulation of the full-length MCL1 protein, while the truncated short form of the protein product was up-regulated in a dose-dependent manner. Altered MCL protein levels were associated with the induction of cleaved PARP, which is an indicator of apoptosis, suggesting that E7107 modulation of MCL1 splicing may lead to NCIH1568 cell death (FIG. 5).

3. E7107-induced cell death is BCLxL- and MCLI-dependent

[0070] To confirm that E7107-induced downregulation of MCL1 is the cause of cell death, MCL1L cDNA was overexpressed in NCIH1568 cells as shown by Western blotting (FIG. 6). Overexpression of the MCL1L cDNA prevented cell death induced by E7107 in the MCL1 dependent cell line (FIG. 7). The role of BCLxL (encoded by BCL2L1) in E7107-treated MCL1-independent A549 cells was also investigated. Although E7107 caused only cytostatic inhibition, as expected, the induced knockdown of BCLxL (FIG. 8) resulted in overt cell death upon treatment with E7107 (FIG. 9). Thus, these data confirm that inhibition of both MCL1 and BCLxL results in synergistic activity leading to cytotoxicity in both MCL1-dependent and MCL1-independent cancer cells.

4. Combination of E7107 with BCL2, BCL2/BCLxL or BCLxL inhibitors shows a synergistic effect

[0071] Since E7107 can modulate MCL1, and other BCL2 proteins can prevent cytotoxicity caused by MCL1 inhibition, the combination of E7107 with inhibitors of BCL2, BCL2/BCLxL or BCLxL can provide enhanced cell death by broadly targeting all anti-apoptotic BCL2 proteins.

[0072] ABT263 (Navitoclax), a BCL2/BCLxL/BCLw pan-inhibitor, was tested in combination with E7107 in an 8x8 dose matrix mode (FIG. 10). In fact, the combination of these two inhibitors showed a strong synergistic effect with a large excess over Levé's additivity model (FIG. 10, left panels) in four different cell line models expressing empty vectors, including MCL1-dependent NCIH23 cells (synergy score=50, 8), NCIH2110 (Synergy Score=50.2), NCIH1568 (Synergy Score=35.2), and MCL1-independent A549 cells (Synergy Score=85.4). Furthermore, BCLxL shRNA depletion basically reduced this synergy between E7107 and ABT263 (FIG. 10, right panels), confirming that the shRNA genetic manipulation and the pharmacological inhibitor (ABT263) acted on the same BCLxL node to achieve a synergistic effect. In particular, the synergy score was significantly reduced in NCIH23 (7.42), NCIH2110 (7.03), NCIH1568 (12.7) and A549 (28.3).

[0073] ABT199 (venetoclax) was also tested in combination with E7107. ABT199 is a more BCL2 selective inhibitor that is active against BCLxL. The combination of E7107 and ABT199 in MCL1-independent A549 cells showed synergistic activity (score=32.6), while BCLxL knockdown significantly reduced synergy (score=16.4) (FIG. 11).

5. Combination of H3B-8800 with BCL2, BCL2/BCLxL or BCLxL inhibitors shows synergistic effect

[0074] H3B-8800, another SF3b-targeted splicing modulator, was also evaluated for potential synergistic activity with BCL2/BCLxL inhibitors, which may confer enhanced cell death by broadly targeting all anti-apoptotic BCL2 proteins.

[0075] ABT263 (Navitoclax), a BCL2/BCLxL/BCLw pan-inhibitor, was tested in combination with H3B-8800 in a 12×12 dose matrix regimen. The combination of these two inhibitors showed a strong synergistic effect with a large excess in the Levé additivity model (FIG. 12) in two different multiple myeloma cell line models including U266B1 (synergy score=41.3) and RPMI8226 (synergy score=40.1).

[0076] ABT199 (venetoclax) was also tested in combination with H3B-8800. ABT199 is a more BCL2 selective inhibitor that is active against BCLxL. The combination of H3B-8800 and ABT199 also showed synergistic activity in the two multiple myeloma cell line models tested JJN3 (synergy score=26.1) and RPMI8226 (synergy score=19) (FIG. 13).

[0077] In addition, A-1331852 was also tested in combination with H3B-8800. A-1331852 is a more BCLxL selective inhibitor. The combination of H3B-880 and A-1331852 showed significant synergistic activity in the two multiple myeloma cell line models tested RPMI8226 (synergy score=68.3) and MM1S (synergy score=56.8) (FIG. 14).

[0078] Taken together, these data indicate that the combination of pladienolide-derived splicing modulators (eg, E7107 or H3B-8800) with inhibitors of BCL2, BCL2/BCLxL, or BCLxL (eg, ABT263, ABT199, or A-1331852) causes synergistic cytotoxicity in various cancer cells. Thus, these data support the use of a combination of pladienolide splicing modulators and BCL2, BCL2/BCLxL or BCLxL inhibitors in the treatment of cancer.

--->

SEQUENCE LIST

<110> EISAI R&D MANAGEMENT CO., LTD.

<120> COMBINATION INCLUDING AT LEAST ONE SPLYSOSOME MODULATOR AND

AT LEAST ONE INHIBITOR SELECTED FROM THE BCL2 INHIBITORS,

BCL2/BCLXL INHIBITORS AND BCLXL INHIBITORS AND METHODS OF APPLICATION

<130> 08061.0033-00304

<140> PCT/US2018/058277

<141> 2018-10-30

<150> 62/580.364

<151> 2017-11-01

<150> 62/579.666

<151> 2017-10-31

<160> 12

<170>PatentIn version 3.5

<210> 1

<211> 4

<212> PROTEIN

<213> Unknown

<220>

<221> source

<223> /note="Description of unknown:

peptide DEAH-box helicase 9 (DHX9)"

<400> 1

Asp Glu Ala His

one

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial Sequence Description: Synthetic

primer"

<400> 2

atatgccaaa ccagctccta c 21

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial Sequence Description: Synthetic

primer"

<400> 3

aaggacaaaa cgggactgg 19

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial Sequence Description: Synthetic

probe"

<400> 4

agaactccac aaacccatcc cagc 24

<210> 5

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial Sequence Description: Synthetic

primer"

<400> 5

aaagccaatgggcaggt 17

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial Sequence Description: Synthetic

primer"

<400> 6

ccaccttcta ggtcctctac at 22

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial Sequence Description: Synthetic

probe"

<400> 7

tccacaaacc catcttggaa ggcc 24

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial Sequence Description: Synthetic

primer"

<400> 8

gacaaaggag gccgtgagga 20

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial Sequence Description: Synthetic

primer"

<400> 9

gtttgttacg ccgtcgctga aa 22

<210> 10

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial Sequence Description: Synthetic

probe"

<400> 10

tcaggcatgc ttcggaaact gga 23

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial Sequence Description: Synthetic

oligonucleotide"

<400> 11

gctcactctt cagtcggaaa t 21

<210> 12

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> source

<223> /note="Artificial Sequence Description: Synthetic

oligonucleotide"

<400> 12

gcatcgaacc attagcagaa a 21

<---

Claims (84)

1. A pharmaceutical composition comprising: (i) a therapeutically effective amount of at least one spliceosome modulator selected from E7107, H3B-8800 and their pharmaceutically acceptable salts, and (ii) a therapeutically effective amount of at least one inhibitor selected from venetoclax ( ABT199), navitoclax (ABT263), A-1331852 and their pharmaceutically acceptable salts. 2. The composition of claim 1 wherein the at least one spliceosome modulator is selected from E7107 and pharmaceutically acceptable salts thereof. 3. The composition of claim 1 wherein the at least one spliceosome modulator is selected from H3B-8800 and pharmaceutically acceptable salts thereof. 4. A composition according to any one of claims 1 to 3, wherein at least one spliceosome modulator is stereoisomerically pure. 5. Composition according to any one of claims 1 to 4, wherein at least one inhibitor is selected from venetoclax (ABT199) and pharmaceutically acceptable salts thereof. 6. Composition according to any one of claims 1 to 4, wherein at least one inhibitor is selected from navitoclax (ABT263) and pharmaceutically acceptable salts thereof. 7. Composition according to any one of claims 1-4, wherein at least one inhibitor is selected from A-1331852 and pharmaceutically acceptable salts thereof. 8. A composition according to any one of claims 1 to 7 wherein at least one spliceosome modulator is included in the formulation for intravenous, oral, subcutaneous or intramuscular administration. 9. A composition according to any one of claims 1 to 8, wherein at least one spliceosome modulator is included in the oral formulation. 10. The composition according to any one of claims 1 to 9, wherein at least one inhibitor is included in the composition for intravenous, oral, subcutaneous or intramuscular administration. 11. A composition according to any one of claims 1 to 10, wherein at least one inhibitor is included in the oral formulation. 12. A combination for the treatment of a malignant tumor selected from hemoblastoses and solid tumors, comprising: (i) at least one spliceosome modulator selected from E7107, H3B-8800 and their pharmaceutically acceptable salts, and (ii) at least one inhibitor, selected from venetoclax (ABT199), navitoclax (ABT263), A-1331852 and their pharmaceutically acceptable salts, wherein at least one spliceosome modulator is administered simultaneously, separately or sequentially with at least one inhibitor. 13. The combination of claim 12 wherein at least one spliceosome modulator is selected from E7107 and pharmaceutically acceptable salts thereof. 14. The combination of claim 12 wherein the at least one spliceosome modulator is selected from H3B-8800 and pharmaceutically acceptable salts thereof. 15. A combination according to any one of claims 12-14, wherein at least one spliceosome modulator is stereoisomerically pure. 16. A combination according to any one of claims 12-15, wherein at least one inhibitor is selected from venetoclax (ABT199) and pharmaceutically acceptable salts thereof. 17. Combination according to any one of claims 12-15, wherein at least one inhibitor is selected from navitoclax (ABT263) and pharmaceutically acceptable salts thereof. 18. A combination according to any one of claims 12-15, wherein at least one inhibitor is selected from A-1331852 and pharmaceutically acceptable salts thereof. 19. A combination according to any one of claims 12-18, wherein at least one spliceosome modulator is included in the formulation for intravenous, oral, subcutaneous or intramuscular administration. 20. A combination according to any one of claims 12-19, wherein at least one spliceosome modulator is included in the oral formulation. 21. A combination according to any one of claims 12-20, wherein at least one inhibitor is included in the formulation for intravenous, oral, subcutaneous or intramuscular administration. 22. A combination according to any one of claims 12-21, wherein at least one inhibitor is included in the oral formulation. 23. A combination according to any one of claims 12-22, wherein at least one spliceosome modulator is administered simultaneously with at least one inhibitor. 24. A combination according to any one of claims 12-22, wherein at least one spliceosome modulator is administered sequentially with at least one inhibitor. 25. A combination according to any one of claims 12-22, wherein at least one spliceosome modulator is administered separately with at least one inhibitor. 26. Combination according to any one of claims 12-25, wherein said malignant tumor is selected from myelodysplastic syndrome, multiple myeloma, chronic lymphocytic leukemia, acute lymphoblastic leukemia, chronic myelomonocytic leukemia, acute myeloid leukemia, colon cancer, pancreatic cancer, endometrial cancer , ovarian cancer, breast cancer, uveal melanoma, gastric cancer, cholangiocarcinoma, or lung cancer. 27. The combination of claim 26 wherein said cancer is lung cancer. 28. The combination of claim 27, wherein said lung cancer is selected from non-small cell lung cancer and small cell lung cancer. 29. The combination of claim 12, wherein said hemoblastosis is selected from acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myelomonocytic leukemia, acute monocytic leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma, myelodysplastic syndrome and multiple myeloma. 30. The combination of claim 12, wherein said solid tumor is selected from breast cancer, pancreatic cancer, prostate cancer, colon or rectal cancer, lung cancer, gastric cancer, cervical cancer, endometrial cancer, cancer ovary, cholangiocarcinoma, glioma and melanoma. 31. A combination according to any one of claims 12-25, wherein said cancer is selected from MCL1-dependent cancer forms. 32. The combination of claim 31, wherein said MCL1-dependent malignant tumor is selected from acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myelomonocytic leukemia, acute monocytic leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma, myelodysplastic syndrome, multiple myeloma, lung cancer, breast cancer, pancreatic cancer, prostate cancer, colon or colorectal cancer, gastric cancer, cervical cancer, endometrial cancer, ovarian cancer, cholangiocarcinoma, glioma and melanoma. 33. A combination according to any one of claims 12-25, wherein said cancer is positive for one or more mutations in a spliceosome gene or protein. 34. The combination of claim 33, wherein said spliceosome gene or protein is selected from splicing factor 3B subunit 1 (SF3B1), small nuclear RNA U2 accessory factor 1 (U2AF1), serine/arginine-rich splicing factor 2 (SRSF2), zinc finger ( CCCH type) RNA-binding motif and serine/arginine-rich 2 (ZRSR2), pre-mRNA splicing processing factor 8 (PRPF8), U2 small nuclear RNA accessory factor 2 (U2AF2), splicing factor 1 (SF1), subunit 1 splicing factor 3a (SF3A1), PRP40 pre-mRNA processing factor 40 homologue B (PRPF40B) containing RNA-binding motif protein 10 (RBM10), poly(rC)-binding protein 1 (PCBP1), crooked neck pre-mRNA splicing factor 1 (CRNKL1), DEAH (Asp-Glu-Ala-His) box helicase 9 (DHX9), peptidyl-prolyl cis-trans isomerase-like 2 (PPIL2) containing RNA-binding motif protein 22 (RBM22), small nuclear ribonucleoprotein Sm D3 (SNRPD3), probable ATP-dependent RNA helicase DDX5 (DDX5), pre-mRNA splicing factor ATP-dependent RNA helicase DHX15 (DHX15) and polyadenylate binding protein 1 (PABPC1). 35. The combination of claim 34, wherein said spliceosome gene or protein is splicing factor 3B subunit 1 (SF3B1). 36. Use of a combination comprising: (i) at least one spliceosome modulator selected from E7107, H3B-8800 and their pharmaceutically acceptable salts, and (ii) at least one inhibitor selected from venetoclax (ABT199), navitoclax (ABT263 ), A-1331852 and their pharmaceutically acceptable salts, for the treatment of a malignant tumor selected from hemoblastoses and solid tumors, where at least one spliceosome modulator is administered simultaneously, separately or sequentially with at least one inhibitor. 37. Use according to claim 36 wherein the at least one spliceosome modulator is selected from E7107 and pharmaceutically acceptable salts thereof. 38. Use according to claim 36 wherein the at least one spliceosome modulator is selected from H3B-8800 and pharmaceutically acceptable salts thereof. 39. Use according to claim 36, wherein at least one spliceosome modulator is stereoisomeric pure. 40. Use according to any one of claims 36-39, wherein at least one inhibitor is selected from venetoclax (ABT199) and pharmaceutically acceptable salts thereof. 41. Use according to any one of claims 36-39, wherein at least one inhibitor is selected from navitoclax (ABT263) and pharmaceutically acceptable salts thereof. 42. Use according to any one of claims 36-39, wherein at least one inhibitor is selected from A-1331852 and pharmaceutically acceptable salts thereof. 43. Use according to any one of claims 36-42, wherein the at least one spliceosome modulator is for intravenous, oral, subcutaneous or intramuscular administration. 44. Use according to any one of claims 36-43, wherein the at least one spliceosome modulator is for oral administration. 45. Use according to any one of claims 36-44, wherein at least one inhibitor is for intravenous, oral, subcutaneous or intramuscular administration. 46. Use according to any one of claims 36-45, wherein at least one inhibitor is for oral administration. 47. Use according to any one of claims 36-46, wherein at least one spliceosome modulator is administered simultaneously with at least one inhibitor. 48. Use according to any one of claims 36-47, wherein at least one spliceosome modulator is administered sequentially with at least one inhibitor. 49. Use according to any one of claims 36-47, wherein at least one spliceosome modulator is administered separately with at least one inhibitor. 50. Use according to any one of claims 36-49, wherein said malignant tumor is selected from myelodysplastic syndrome, multiple myeloma, chronic lymphocytic leukemia, acute lymphoblastic leukemia, chronic myelomonocytic leukemia, acute myeloid leukemia, colon cancer, pancreatic cancer, endometrial cancer , ovarian cancer, breast cancer, uveal melanoma, gastric cancer, cholangiocarcinoma and lung cancer. 51. Use according to claim 50, wherein said cancer is lung cancer. 52. Use according to claim 51, wherein said lung cancer is selected from non-small cell lung cancer and small cell lung cancer. 53. Use according to claim 36, wherein said hemoblastosis is selected from acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myelomonocytic leukemia, acute monocytic leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma, myelodysplastic syndrome and multiple myeloma. 54. Use according to claim 36, wherein said solid tumor is selected from breast cancer, pancreatic cancer, prostate cancer, colon cancer or colon and rectal cancer, lung cancer, gastric cancer, cervical cancer, endometrial cancer, cancer ovary, cholangiocarcinoma, glioma and melanoma. 55. Use according to any one of claims 36-49, wherein said cancer is selected from MCL1-dependent cancer forms. 56. Use according to claim 55, wherein said MCL1-dependent malignant tumor is selected from acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myelomonocytic leukemia, acute monocytic leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma, myelodysplastic syndrome, multiple myeloma, lung cancer, breast cancer, pancreatic cancer, prostate cancer, colon or colorectal cancer, gastric cancer, cervical cancer, endometrial cancer, ovarian cancer, cholangiocarcinoma, glioma and melanoma. 57. Use according to any one of claims 36-49, wherein said cancer is positive for one or more mutations in a spliceosome gene or protein. 58. Use according to claim 57, wherein said spliceosome gene or protein is selected from splicing factor 3B subunit 1 (SF3B1), small nuclear RNA U2 accessory factor 1 (U2AF1), serine/arginine-rich splicing factor 2 (SRSF2), zinc finger ( CCCH type) RNA-binding motif and serine/arginine-rich 2 (ZRSR2), pre-mRNA splicing processing factor 8 (PRPF8), U2 small nuclear RNA accessory factor 2 (U2AF2), splicing factor 1 (SF1), subunit 1 splicing factor 3a (SF3A1), PRP40 pre-mRNA processing factor 40 homologue B (PRPF40B) containing RNA-binding motif protein 10 (RBM10), poly(rC)-binding protein 1 (PCBP1), crooked neck pre-mRNA splicing factor 1 (CRNKL1), DEAH (Asp-Glu-Ala-His) box helicase 9 (DHX9), peptidyl-prolyl cis-trans isomerase-like 2 (PPIL2) containing RNA-binding motif protein 22 (RBM22), small nuclear ribonucleoprotein Sm D3 (SNRPD3), probable ATP-dependent RNA helicase DDX5 (DDX5), pre-mRNA splicing factor ATP-dependent RNA helicase DHX15 (DHX15) and polyadenylate binding protein 1 (PABPC1). 59. Use according to claim 58, wherein said spliceosome gene or protein is splicing factor 3B subunit 1 (SF3B1). 60. A method of treating cancer, comprising administering to a subject in need thereof: (i) a therapeutically effective amount of at least one spliceosome modulator selected from E7107, H3B-8800, and pharmaceutically acceptable salts thereof, and (ii) a therapeutically effective amount of at least one inhibitor selected from venetoclax (ABT199), navitoclax (ABT263), A-1331852 and their pharmaceutically acceptable salts, where the malignant tumor is selected from hemoblastoses and solid tumors, and at least one spliceosome modulator is administered simultaneously, separately or sequentially with at least one inhibitor. 61. The method of claim 60, wherein the at least one spliceosome modulator is selected from E7107 and pharmaceutically acceptable salts thereof. 62. The method of claim 60, wherein the at least one spliceosome modulator is selected from H3B-8800 and pharmaceutically acceptable salts thereof. 63. The method according to any one of claims 60-62, wherein at least one spliceosome modulator is stereoisomerically pure. 64. The method according to any one of claims 60-63, wherein at least one inhibitor is venetoclax (ABT199) or a pharmaceutically acceptable salt thereof. 65. The method according to any one of claims 60-63, wherein at least one inhibitor is selected from navitoclax (ABT263) and pharmaceutically acceptable salts thereof. 66. The method of any one of claims 60-63, wherein at least one inhibitor is selected from A-1331852 and pharmaceutically acceptable salts thereof. 67. The method of any one of claims 60-66, wherein the spliceosome modulator is for intravenous, oral, subcutaneous, or intramuscular administration. 68. The method of any one of claims 60-67, wherein the spliceosome modulator is for oral administration. 69. The method of any one of claims 60-68, wherein the at least one inhibitor is for intravenous, oral, subcutaneous, or intramuscular administration. 70. The method of any one of claims 60-69, wherein at least one inhibitor is for oral administration. 71. The method according to any one of claims 60-70, wherein at least one spliceosome modulator and at least one inhibitor are administered sequentially. 72. The method of any one of claims 60-70, wherein at least one spliceosome modulator and at least one inhibitor are administered separately. 73. The method according to any one of claims 60-70, wherein at least one spliceosome modulator and at least one inhibitor are administered simultaneously. 74. The method according to any one of claims 60-73, wherein said malignant tumor is selected from myelodysplastic syndrome, multiple myeloma, chronic lymphocytic leukemia, acute lymphoblastic leukemia, chronic myelomonocytic leukemia, acute myeloid leukemia, colon cancer, pancreatic cancer, endometrial cancer , ovarian cancer, breast cancer, uveal melanoma, gastric cancer, cholangiocarcinoma and lung cancer. 75. The method of any one of claims 60-74, wherein said cancer is lung cancer. 76. The method of any one of claims 60-75, wherein said cancer is selected from non-small cell lung cancer and small cell lung cancer. 77. The method of claim 76, wherein said hemoblastosis is selected from Hodgkin's lymphoma, non-Hodgkin's lymphoma, myelodysplastic syndrome, multiple myeloma, chronic lymphocytic leukemia, acute lymphoblastic leukemia, acute myelogenous leukemia, chronic myelogenous leukemia, chronic myelomonocytic leukemia, and acute myeloid leukemia. 78. The method of claim 60 wherein said solid tumor is selected from colon or rectal cancer, pancreatic cancer, endometrial cancer, ovarian cancer, breast cancer, melanoma, gastric cancer, cholangiocarcinoma, prostate cancer, cancer cervical, glioma and lung cancer. 79. The method of claim 78, wherein said melanoma is uveal melanoma. 80. The method of any one of claims 60-73, wherein said cancer is an MCL1-dependent cancer. 81. The method of claim 80, wherein said MCL1-dependent malignant tumor is selected from acute lymphoblastic leukemia, acute myelogenous leukemia, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myelomonocytic leukemia, acute monocytic leukemia, Hodgkin's lymphoma, non-Hodgkin's lymphoma, myelodysplastic syndrome, multiple myeloma, lung cancer, breast cancer, pancreatic cancer, prostate cancer, colon or colorectal cancer, gastric cancer, cervical cancer, endometrial cancer, ovarian cancer, cholangiocarcinoma, glioma and melanoma. 82. The method of any one of claims 60-73, wherein said cancer is positive for one or more mutations in a spliceosome gene or protein. 83. The method of claim 82, wherein said spliceosome gene or protein is selected from splicing factor 3B subunit 1 (SF3B1), small nuclear RNA accessory factor 1 U2 (U2AF1), serine/arginine-rich splicing factor 2 (SRSF2), zinc finger ( CCCH type) RNA-binding motif and serine/arginine-rich 2 (ZRSR2), pre-mRNA splicing processing factor 8 (PRPF8), U2 small nuclear RNA accessory factor 2 (U2AF2), splicing factor 1 (SF1), subunit 1 splicing factor 3a (SF3A1), PRP40 pre-mRNA processing factor 40 homologue B (PRPF40B) containing RNA-binding motif protein 10 (RBM10), poly(rC)-binding protein 1 (PCBP1), crooked neck pre-mRNA splicing factor 1 (CRNKL1), DEAH (Asp-Glu-Ala-His) box helicase 9 (DHX9), peptidyl-prolyl cis-trans isomerase-like 2 (PPIL2) containing RNA-binding motif protein 22 (RBM22), small nuclear ribonucleoprotein Sm D3 (SNRPD3), probable ATP-dependent RNA helicase DDX5 (DDX5), pre-mRNA splicing factor ATP-dependent RNA- helicase DHX15 (DHX15) and polyadenylate binding protein 1 (PABPC1). 84. The method of claim 83, wherein said spliceosome gene or protein is splicing factor 3B subunit 1 (SF3B1).

Images