EA040521B1 - COMBINED THERAPY USING IMETELSTAT AND ABT-199 FOR THE TREATMENT OF ACUTE MYELOID LEUKEMIA, A KIT AND PHARMACEUTICAL COMPOSITION FOR ITS IMPLEMENTATION, A METHOD FOR IN VITRO INDUCTION OF APOPTOSIS IN ACUTE MYELOID LEUKEMIA CELL - Google Patents

Description

This application claims priority over U.S. Provisional Application No. 62/370018 (filed August 2, 2016), European Patent Application No. 16197293.0 (filed November 4, 2016) and U.S. Provisional Application No. 62/422738 (November 16, 2016) , the full contents of each of which are incorporated herein by reference.

Sequence listing

This application contains a Sequence Listing that has been filed electronically in ASCII format and is incorporated herein by reference in its entirety. The specified ASCII copy, created on July 17, 2017, is named PRD3424WOPCT_SL.txt and is 2335 bytes in size.

Technical field

The disclosure provided herein relates to the treatment of hematological cancers using a combination of a telomerase inhibitor and a Bcl-2 inhibitor.

State of the art

Patients with acute myeloid leukemia (AML) have limited treatment options at the time of diagnosis; treatment usually comes in the form of chemotherapy to quickly reduce the workload of leukemic cells. Invasive leukapheresis procedures to remove large numbers of white blood cells (normal and disease-prone) can be used in parallel with chemotherapy to temporarily reduce the burden of tumor cells. The induction phase of chemotherapy may be successful, but most of the healthy cells in the patient's bone marrow also die, causing damage and requiring additional relief therapy to prevent infection and increase the white blood cell count. Additional rounds of chemotherapy may be given in an attempt to keep patients in remission; but relapse is common.

Telomerase is present in more than 90% of tumors of all types of cancer; and is absent in normal, healthy tissues. Imelstat sodium is a first-in-class telomerase inhibitor that is a covalently lipidated 13-mer oligonucleotide (shown below) complementary to the human telomerase RNA template (hTR) region. Imelstat sodium does not function through an anti-sense mechanism and therefore does not have the side effects commonly seen with these treatments. Imetelstat sodium is the sodium salt of imetelstat (shown below):

O

Imelstat sodium

Unless otherwise noted or clear from the context, references below to imetelstat also include its salts. As mentioned above, in particular, imetelstat sodium is the sodium salt of imetelstat.

AVT-199/Venitoclax (trade name Venclexta) is a US Food and Drug Administration (FDA) approved Bcl-2 inhibitor for use in patients with chronic lymphocytic leukemia (CLL) with del17p who are relapsed/difficult to treat. AVT-199 is also known as AVT 199, GDC0199, GDC-0199 or RG7601. Chemical name AVT-199: 4-[4-[[2-(4-chlorophenyl)-4,4-dimethylcyclohexen-1-yl]methyl]piperazin1-yl]-N-[3-nitro-4-(oxan- 4-ylmethylamino)phenyl]sulfonyl-2-( 1 H-pyrrolo[2,3-b]pyridin-5-yloxy-1040521 c)benzamide (CAS No. 1257044-40-8). Unless otherwise noted or clear from the context, references below to

ABT-199 also includes its pharmaceutically acceptable salts. In particular, specifically in the examples, ABT-199 was used in deprotonated form.

ABT-199, shown below in its deprotonated form, is highly specific for Bcl-2, unlike other first generation inhibitors that show affinity for related members of the Bcl family and cause more severe side effects. Bcl-2 inhibition blocks proapoptotic signals caused by damage or abnormalities in cellular DNA and ultimately leads to programmed cell death in treated cells via the caspase cascade and apoptosis via the mitochondrial signaling pathway.

AVT-199 (shown in deprotonated form)

State of the art

The combined dosing of imetelstat sodium and ABT-199 cells in AML provides a fundamentally new treatment for hematological cancers and, in particular, AML. Imelstat sodium is currently being clinically investigated for myeloid fibrosis (MF) and myelodysplastic syndrome (MDS). ABT-199 is FDA approved for CLL (chronic lymphocytic leukemia) and is also being investigated in AML.

One embodiment of the invention is a method of treating acute myeloid leukemia comprising administering imetelstat and ABT-199 to a subject with acute myeloid leukemia. The imetelstat may be sodium imetelstat. Imelstat or imetelstat sodium may be administered for 1, 2, 3, 4, 5, 6, 7, 8, or more than 8 dosing cycles, with each cycle comprising: (a) intravenous administration of about 7-10 mg/kg imetelstata every four weeks; (b) intravenous administration of about 7-10 mg/kg imetelstat once a week for four weeks; or (c) intravenous administration of about 2.5-7 mg/kg imetelstat once every three weeks; or (d) intravenous administration of about 0.5-9.4 mg/kg imetelstat once every four weeks. In one of the embodiments of the method, ABT-199 is administered at a dose of (a) 50-400 mg of ABT-199 daily; (b) 2 mg ABT-199 on Day 1, increased daily to a final dose of 800 mg on Day 6 and daily thereafter; or (c) 25 mg AVT-199 on Day 1, increased daily to a final dose of 400 mg on Day 5 and daily thereafter. In yet another embodiment of the method, the administration of AVT-199 is carried out one day before, one day after, or on the same day when imetelstat is administered.

Other embodiments of the invention are the use of imetelstat or sodium imetelstat for the treatment of acute myeloid leukemia in a patient treated with ABT199 or a pharmaceutically acceptable salt thereof, and the use of ABT-199 or a pharmaceutically acceptable salt thereof for the treatment of acute myeloid leukemia in a patient treated with imetelstat or sodium imetelstat. The imetelstat may be sodium imetelstat. Imelstat can be administered, for example, for 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 dosing cycles, with each cycle comprising: (a) intravenous administration of about 7-10 mg/kg imetelstata once every four weeks; (b) intravenous administration of about 7-10 mg/kg imetelstat once a week for four weeks; or c) intravenous administration of about 2.5-7 mg/kg imetelstat once every three weeks; or (d) intravenous administration of about 0.5-9.4 mg/kg imetelstat once every four weeks. In one embodiment, ABT-199 is administered at a dose of: (a) 50-400 mg of ABT-199 daily; (b) 2 mg ABT-199 on Day 1, increased daily to a final dose of 800 mg on Day 6 and daily thereafter; or (c) 25 mg AVT-199 on Day 1, increased daily to a final dose of 400 mg on Day 5 and daily thereafter. In another embodiment of the mentioned applications, administration of ABT-199 is possible one day before, one day after, or on the same day when imetelstat is administered.

Another embodiment of the invention is the use of a combination containing imetelstat and ABT-199 for the treatment of acute myeloid leukemia in a patient. The imetelstat may be sodium imetelstat. In one embodiment, imetelstat is administered for 1, 2, 3, 4, 5, 6, 7, 8, or more than 8 dosing cycles, with each cycle comprising: (a) intravenous administration of about 7-10 mg / kg imetelstat once every four weeks; (b) intravenous administration of about 7-10 mg/kg imetelstat once a week for four weeks; or c) intravenous administration of about 2.5-7 mg/kg imetelstat once every three weeks; or (d) intravenous administration of about 0.5-9.4 mg/kg imetelstat once every four weeks. In another embodiment, ABT-199 is for administration at a dose of: (a) 50-400 mg of ABT-199 daily; (b) 2 mg ABT-199 on day 1, increased daily to a final dose of 800 mg on day 6 and daily thereafter; or (c) 25 mg ABT-2 040521

199 on day 1, increasing daily to a final dose of 400 mg on day 5 and daily thereafter. In another embodiment, administration of ABT-199 is possible one day before, one day after, or on the same day that imetelstat is administered. The combination may be a pharmaceutical composition.

Another embodiment of the invention is the use of imetelstat and ABT199 in the preparation of a medicament for the treatment of acute myeloid leukemia. The imetelstat may be sodium imetelstat. The combination of imetelstat and AVT-199 can induce apoptosis in acute myeloid leukemia cells.

Another embodiment of the invention is the use of imetelstat sodium for the treatment of acute myeloid leukemia (AML) comprising administering imetelstat sodium and ABT-199 in combination to a subject in need thereof. Another embodiment of the invention is the use of ABT-199 for the treatment of acute myeloid leukemia (AML), comprising administering a combination of ABT-199 and imetelstat sodium to a subject in need thereof.

Imelstat sodium may be given for 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 dosing cycles, each cycle including: (a) intravenous administration of about 7-10 mg/kg imetelstat sodium once every four weeks; (b) intravenous administration of about 7-10 mg/kg imetelstat sodium once a week for four weeks; (c) intravenous administration of about 2.5-7 mg/kg imetelstat sodium once every three weeks; or (d) intravenous administration of about 0.5-9.4 mg/kg imetelstat sodium once every four weeks. ABT-199 can be administered at a dose of: (a) about 50-400 mg of ABT-199 daily; (b) about 2 mg of ABT-199 on Day 1 with daily increases to a final dose of about 800 mg on Day 6 and daily thereafter, or (c) about 25 mg of ABT-199 on Day 1 with daily increases to a final dose of about 400 mg on day 5 and daily thereafter. The introduction of AVT-199 can be carried out one day before, one day after, or on the same day when imetelstat sodium is administered.

Another embodiment of the invention is an in vitro method for inducing apoptosis in an acute myeloid leukemia (AML) cell, comprising contacting the cell with a therapeutically effective amount of imetelstat; and bringing the cell into contact with a therapeutically effective amount of ABT-199. In some embodiments of this method, the imetelstat is sodium imetelstat.

Another embodiment of the invention is a kit for implementing the methods or uses described above, comprising: (a) a dose of imetelstat in an amount effective when administered to induce apoptosis of acute myeloid leukemia cells; (b) a dose of ABT-199 or a pharmaceutically acceptable salt thereof in an amount effective when administered to induce apoptosis of acute myeloid leukemia cells. In some embodiments of this kit, the imetelstat is sodium imetelstat.

In another embodiment, the present invention relates to a pharmaceutical composition for implementing the above methods and uses, containing imetelstat and ABT-199.

In one embodiment of said pharmaceutical composition, imetelstat is sodium imetelstat.

In another embodiment, said pharmaceutical composition is for the treatment of acute myeloid leukemia.

Brief description of the drawings

Fig. 1A and 1B show the results of treating KG-1 cells with sodium metelstat and/or ABT199 for 48 hours. Fig. 1A shows dot plots of KG-1 cells after 48 hours of treatment with various concentrations of ABT-199 and/or sodium imetelstat, and staining with annexin V and propidium iodide. Fig. 1B shows a plot of % apoptotic cells versus compound concentration for a 48 hour treatment of KG-1 cells with various concentrations of ABT-199 and/or sodium imetelstat. Apoptotic cells are double labeled with annexin V and propidium iodide.

Fig. 2A and 2B show the results of treating KG-1 cells with sodium imetelstat and/or ABT199 for 96 hours. FIG. 2A shows dot plots of KG-1 cells after 96 hours of treatment with various concentrations of ABT-199 and/or sodium imetelstat, and staining with annexin V and propidium iodide. Fig. 2B shows a plot of % apoptotic cells versus compound concentration for a 96 hour treatment of KG-1 cells with various concentrations of ABT-199 and/or imetelstat sodium. Apoptotic cells are double labeled with annexin V and propidium iodide.

Fig. 3A and 3B show the effects of treating KG-1 cells with incompletely complementary or non-complementary oligonucleotides and ABT-199 for 48 hours. FIG. 3A shows dot plots of KG-1 cells after 48 hours of treatment with various concentrations of ABT-199 and/or control oligonucleotides, and staining with annexin V and propidium iodide. Fig. 3B shows a plot of % apoptotic cells versus compound concentration for a 48 hour treatment of KG-1 cells with various concentrations of ABT-199 and/or control oligonucleotides. Noncomp. refers to a non-complementary control oligonucleotide. Apoptotic cells are double labeled with annexin V and propidium iodide.

- 3 040521

Fig. 4A and 4B show the effects of treating KG-1 cells with incompletely complementary or non-complementary oligonucleotides and ABT-199 for 96 hours. FIG. 4A shows dot plots of KG-1 cells after 96 hours of treatment with various concentrations of ABT-199 and/or control oligonucleotides, and staining with annexin V and propidium iodide. Fig. 4B shows a plot of % apoptotic cells versus compound concentration for a 48 hour treatment of KG-1 cells with various concentrations of ABT-199 and/or control oligonucleotides. Noncomp. refers to a non-complementary control oligonucleotide. Apoptotic cells are double labeled with annexin V and propidium iodide.

Fig. 5A and 5B show the effects of treating MOLM-13 cells with sodium imetelstat and/or ABT-199 for 48 hours. FIG. 5A shows dot plots of MOLM-13 cells after 48 hours of treatment with various concentrations of ABT-199 and/or sodium imetelstat, and staining with annexin V and propidium iodide. Fig. 5B shows a plot of % apoptotic cells versus compound concentration for a 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or imetelstat sodium. Apoptotic cells are double labeled with annexin V and propidium iodide.

Fig. 6A and 6B show the effects of treating MOLM-13 cells with sodium metelstat and/or ABT-199 for 48 hours. FIG. 6A shows dot plots of MOLM-13 cells after 96 hours of treatment with various concentrations of ABT-199 and/or sodium imetelstat, and staining with annexin V and propidium iodide. Fig. 6B shows a graph of % apoptotic cells versus compound concentration for a 96 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or imetelstat sodium. Apoptotic cells are double labeled with annexin V and propidium iodide.

Fig. 7A and 7B show the effects of treating MOLM-13 cells with various concentrations of ABT-199 and/or control oligonucleotide for 48 hours. FIG. 7A shows dot plots of MOLM-13 cells after 48 hours of treatment with various concentrations of ABT-199 and/or control oligonucleotides and staining with annexin V and propidium iodide. Fig. 7B shows a plot of % apoptotic cells versus compound concentration for 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or control oligonucleotides. Noncomp. refers to a non-complementary control oligonucleotide. Apoptotic cells are double labeled with annexin V and propidium iodide.

Fig. 8A and 8B show the effects of treating MOLM-13 cells with various concentrations of ABT-199 and/or control oligonucleotides for 96 hours. FIG. 8A shows dot plots of MOLM-13 cells after 96 hours of treatment with various concentrations of ABT-199 and/or control oligonucleotides, and staining with annexin V and propidium iodide. Fig. 8B shows a graph of % apoptotic cells versus compound concentration for 96 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or control oligonucleotides. Noncomp. refers to a non-complementary control oligonucleotide. Apoptotic cells are double labeled with annexin V and propidium iodide.

Fig. 9 shows hTERT transcription levels measured by quantitative real-time PCR (qPCR-RT) after treatment with imetelstat sodium, ABT-199, or a combination of the two at 48 and 96 hours in KG-1 or MOLM-13 cells.

Fig. 10 shows levels of telomerase enzyme activity measured by RT-PCR TRAP (Telomeric Repeat Amplification Protocol) after treatment with imetelstat sodium, ABT-199, or the combination at 48 and 96 hours in KG-1 or MOLM-13 cells.

Fig. 11 shows a plot of % apoptotic cells versus compound concentration for a 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or imetelstat sodium. Apoptotic cells are double labeled with annexin V and propidium iodide.

Fig. 12A and 12B show % apoptotic cells versus compound concentration for a 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199, control incompletely complementary oligonucleotide and non-complementary oligonucleotide. Fig. 12A shows a graph of % apoptotic cells versus compound concentration for a 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or control incompletely complementary oligonucleotide Incomplete. FIG. 12B shows a plot of % Apoptotic Cells vs. Compound Concentration for a 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or control non-complementary oligonucleotide Necomp. Apoptotic cells are double labeled with annexin V and propidium iodide.

Fig. 13 shows a plot of % apoptotic cells versus compound concentration for a 96 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or imetelstat sodium. Apoptotic cells are double labeled with annexin V and propidium iodide.

Fig. 14A and 14B show % apoptotic cells versus compound concentration for 48 hour treatment of MOLM-13 cells with various concentrations of ABT-199, a control incompletely complementary oligonucleotide, and a noncomplementary oligonucleotide. Fig. 14A

- 4 040521 shows a plot of % apoptotic cells versus compound concentration for a 96 hour treatment of MOLM-13 cells with various concentrations of ABT-199 and/or control incompletely complementary oligonucleotide Incomplete. FIG. 14B shows a graph of % apoptotic cells versus compound concentration for 96 hours of treatment of MOLM-13 cells with various concentrations of ABT-199 and/or control non-complementary oligonucleotide Necomp. Apoptotic cells are double labeled with annexin V and propidium iodide.

Fig. 15A-15D show mean responses of four PBMC (peripheral blood mononuclear cell) samples obtained from whole blood of AML patients and treated ex vivo with various concentrations of ABT-199 and/or imetelstat sodium for 16 and 40 hours and analyzed for viability. cells by flow cytometry with staining with annexin V and propidium iodide. Fig. 15A and 15B show plots of % viable cells versus compound concentration for treatment with various concentrations of ABT-199 and/or imetelstat sodium for 16 hours of Ficoll-purified PBMCs from whole blood of AML patients. Fig. 15A shows results for CD45+ leukocytes. Fig. 15B shows results for CD45+/CD34+ leukemic stem cells. Fig. 15C and 15D show plots of % viable cells versus compound concentration for treatment with various concentrations of ABT-199 and/or imetelstat sodium for 40 hours of Ficoll-purified PBMCs from whole blood of AML patients. Fig. 15C shows results for CD45+ leukocytes. Fig. 15D shows results for CD45+/CD34+ leukemic stem cells. In FIG. 15A-15D, error bars represent standard deviations. Viable cells remaining after treatment are not labeled with annexin V or propidium iodide.

Fig. 16 demonstrates the antitumor efficacy and in vivo survival benefit of imetelstat sodium or AVT-1 alone, or agents in combination, in a mouse model. Mice were inoculated with MOLM-13 cells (dissemination model) and treated with vehicle, sodium imetelstat and/or ABT-199, or incompletely complementary oligonucleotide control plus ABT-199. Mice survival was observed (n = 10 mice/group at start) after treatment. In particular, FIG. 16 shows the survival rate of mice as a function of day after tumor cell implantation. Mice were treated for 31 days with: (i) vehicles (MM+PEG400/Phosal50/ETOH); (ii) imetelstat sodium (30mg/kg), (iii) ABT-199 (100mg/kg), (iv) MM (incompletely complementary oligo) (30mg/kg) and ABT-199 (100mg/kg) and (v) sodium imetelstat (30 mg/kg) and ABT-199 (100 mg/kg).

Fig. 17A and 17B show apoptotic populations 96 hours after single dose imetelstat sodium treatment for MOLM-13 and HL-60 cells. Fig. 17A shows the apoptotic population (double-labeling) 96 hours after treatment with a single dose of imetelstat sodium for MOLM-13. Fig. 17A shows the apoptotic population (double labeling) 96 hours after single dose sodium imetelstat treatment for the HL-60 AML cell line.

Detailed Description of the Invention

The following detailed description of the invention will be better understood when read in conjunction with the accompanying figures. The figures are provided to illustrate some embodiments of the invention. However, the invention is not limited to the precise arrangements, examples and tools indicated. For clarity of disclosure, and not as a limitation, the detailed description of the invention is divided into subsections that describe or illustrate certain features, embodiments or applications of the present invention.

The invention provides methods for treating hematological cancers with a combination of a telomerase inhibitor and a Bcl-2 inhibitor. Drug-resistant cell populations may be the cause of incomplete response to treatment or disease recurrence. The present invention provides a combination of a telomerase inhibitor and a Bcl-2 inhibitor that work synergistically to induce higher levels of apoptosis in AML cells than either drug alone can induce. The present invention provides a method for inducing apoptosis in a hematological cancer (oncological) cell, comprising contacting the cell with a therapeutically effective amount of a telomerase inhibitor and a therapeutically effective amount of a Bcl-2 inhibitor. In some embodiments, the telomerase inhibitor is imetelstat. In some embodiments, the Bcl-2 inhibitor is ABT-199. In some embodiments, the hematologic cancer is AML.

In some cases, the combination provides enhanced inhibitory effect in relation to each component separately; in some cases, the combination provides a super-additive or synergistic effect relative to the combined or additive effects of the components.

In some embodiments, the method is a method of inducing apoptosis in a hematological cancer (cancer) cell. The method of this invention may include contacting a cell with a therapeutically effective amount of a telomerase inhibitor and contacting the cell with a therapeutically effective amount of a Bcl-2 inhibitor. In some

In other embodiments, the telomerase inhibitor is imetelstat. In some embodiments, the telomerase inhibitor is sodium imetelstat. In some embodiments, the Bcl-2 inhibitor is ABT-199. Contacting the cell with the telomerase inhibitor may be performed before, during and/or after contacting the cell with the Bcl-2 inhibitor. The contacting of the cell with the telomerase inhibitor and the Bcl-2 inhibitor can be performed simultaneously or sequentially.

In one embodiment, the telomerase inhibitor is an oligonucleotide with telomerase inhibitory activity, in particular an oligonucleotide as defined in WO 2005/023994 and/or WO 2014/088785, both of which are incorporated herein by reference.

In general, various combinations of a telomerase inhibitor and a Bcl-2 inhibitor can generally be used, either sequentially or simultaneously. For multiple dosing, the two agents may be directly alternated, or two or more doses of one agent may be alternated, for example, with one dose of another agent. The simultaneous administration of both agents may also alternate or otherwise alternate with the doses of the individual agents. In some cases, the time between dosages can be from about 1-6 to about 6-12 hours, to about 12-24 hours, up to about 1-2 days, up to about 1-2 weeks or longer after the start of treatment. During the course of treatment, the need to fully comply with the planned dosing may be reviewed.

The term apoptosis refers to the process of programmed cell death with accompanying morphological changes and loss of cell viability. In one embodiment, a method for inducing apoptosis provides a method for treating a neoplastic disorder in a vertebrate.

In the context of this method, the term induction means a direct or indirect causal relationship. Thus, the presence and/or maintenance of a certain mode causes or leads to an induced result.

As used herein, the term about, when applied to a measurable value such as quantity, time span, and the like, is meant to cover deviations from ±20% to ±0.1%, preferably ±20% or ±10%, more preferably ± 5%, even more preferably ± 1%, and even more preferably ± 0.1% of the indicated value, since such deviations are suitable for performing the disclosed methods.

As applied everywhere AML refers to acute myeloid leukemia.

A. Treatment

As used herein and well known in the art, treatment is an approach to obtain beneficial or desired results, including clinical results. For the purposes of this invention, useful or desirable clinical results include, but are not limited to: amelioration or improvement of one or more symptoms, reduction in the extent of the disease, a stabilized (i.e., not worsening) state of the disease, prevention of the proliferation of the disease, delay or slowing down progression of the disease, improvement or mitigation of the disease state, and remission (partial or complete), detectable or not detectable. Treatment can also mean an increase in survival compared to expected survival if no treatment is given.

The present invention provides a treatment (of hematologic cancers such as acute myeloid leukemia) comprising combining administration of the telomerase inhibitor imetelstat sodium with administration of the Bcl-2 inhibitor ABT-199. The method of treatment according to the invention may be more effective and cause a greater response to treatment in patients with AML than when using each drug alone. In one embodiment, the method of treatment comprises administering a telomerase inhibitor and a Bcl-2 inhibitor in combination to a subject in need of treatment for a hematologic cancer. In another embodiment, the hematologic cancer is AML. In another embodiment, the telomerase inhibitor is imetelstat. In some embodiments, the telomerase inhibitor is sodium imetelstat. In another embodiment, the Bcl-2 inhibitor is ABT-199.

In some embodiments, the dose of the telomerase inhibitor administered to the subject is an amount sufficient to treat the disease when that amount of the telomerase inhibitor is administered alone. In some embodiments, the dose of the telomerase inhibitor administered to a subject is less than an amount sufficient to treat the disease when the telomerase inhibitor is used alone. In one embodiment, the dose of the telomerase inhibitor is reduced when used in combination with ABT-199 in the treatment of a subject who has been diagnosed with AML. In some embodiments, the telomerase inhibitor is imetelstat. In some embodiments, the telomerase inhibitor is sodium imetelstat. In some embodiments, the dose of the Bcl-2 inhibitor administered to the subject is an amount sufficient to treat the disease when the Bcl-2 inhibitor is used alone. IN

- 6 040521 In some embodiments, the dose of the Bcl-2 inhibitor administered to a subject is less than the amount sufficient to treat the disease when the Bcl-2 inhibitor is used alone. In some embodiments, the Bcl-2 inhibitor is ABT-199. In another embodiment, the dose of the Bcl-2 inhibitor is reduced when used in combination with imetelstat in the treatment of a subject who has been diagnosed with AML. In yet another embodiment, the doses of imetelstat and ABT-199 are reduced when used in combination in the treatment of a subject diagnosed with AML.

In another embodiment, the duration of treatment with a telomerase inhibitor is reduced when used in combination with a Bcl-2 inhibitor in the treatment of a subject who has a hematologic cancer. In another embodiment, the duration of treatment with imetelstat is reduced when used in combination with ABT-199 in the treatment of a subject with hematologic cancer. In another embodiment, the duration of treatment with ABT-199 is reduced when used in combination with imetelstat in the treatment of a subject diagnosed with a hematologic cancer. In another embodiment, the duration of treatment with both imetelstat and ABT-199 is reduced when used in combination in the treatment of a subject diagnosed with a hematologic cancer. In some embodiments, the hematologic cancer is AML.

The drug combinations described herein may be administered to a subject as a composition containing both drugs, or separately. The combinations of drugs described herein may be administered as a combination drug composition, for example by intravenous administration, or separately.

B. Hematologic cancers

The methods of this invention may be used to treat any suitable hematologic malignancy. Hematologic malignancies are forms of cancer that start in cells in the blood-forming tissue, such as bone marrow, or cells in the immune system. Examples of hematological cancers are acute and chronic leukemias, lymphomas, multiple myeloma, and myelodysplastic syndromes. In some cases, a hematological malignancy is referred to as a hematological cancer. Myeloproliferative neoplasms, or MPNs, are hematologic neoplasms that arise from neoplastic hematopoietic myeloid progenitor cells in the bone marrow, such as progenitors of erythrocytes, platelets, and granulocytes. The proliferation of neoplastic progenitor cells results in an overproduction of any combination of white blood cells, red blood cells, and/or platelets, depending on the disease. These overproduced cells may also be abnormal, leading to additional clinical complications. There are different types of chronic myeloproliferative diseases. Myeloproliferative neoplasms include idiopathic thrombocythemia, polycythemia vera, chronic myelogenous leukemia, myelofibrosis, chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myelogenous leukemia. Myelodysplastic syndrome (MDS) is a group of symptoms that includes cancer of the blood and bone marrow. MDS includes, but is not limited to, refractory anemia, refractory anemia with blast cell excess, refractory cytopenia with multi-cell dysplasia, and chronic myelomonocytic leukemia (CML).

Hematologic cancers of interest include, but are not limited to: AML, idiopathic thrombocythemia, polycythemia vera, primary myelofibrosis, systemic mastocytosis, chronic myeloid leukemia; chronic neutrophilic leukemia, chronic eosinophilic leukemia, refractory anemia with ringed sideroblasts, refractory cytopenia with multi-cell dysplasia, refractory type 1 anemia with blast cell excess, type 2 refractory anemia with blast cell excess, myelodysplastic syndrome (MDS) with detected deletion (5q), unclassified MDS, chronic myelomonocytic leukemia (CML), atypical chronic myelogenous leukemia, juvenile myelomonocytic leukemia, myeloproliferative/myelodysplastic syndromes not classifiable, B-lymphoblastic leukemia/lymphoma, T-lymphoblastic leukemia/lymphoma, diffuse large-cell lymphoma central, primary B-lymphocytic lymphoma nervous system, primary mediastinal B-cell lymphoma, Burkitt's lymphoma/leukemia, follicular lymphoma, chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma, B-lymphocytic prolymphocytic leukemia, lymphoplasmacytic lymphoma/Waldenström macroglobulinemia, mantle lethal lymphoma, marginal zone lymphomas, post-transplant lymphoproliferative disorders, HIV-associated lymphomas, primary effusion lymphoma, intravascular large B-lymphocytic lymphoma, primary cutaneous B-lymphocytic lymphoma, hairy cell leukemia, monoclonal gammopathy of unknown significance, indolent multiple myeloma, and solitary plasmacytomas (solitary bone and extramedullary ).

- 7 040521

Some of the treatment regimens according to this invention are particularly suitable for the treatment of AML. In some embodiments of the invention, the subject to whom the drug is administered has AML. Among AML, using the methods disclosed herein, for example by administering imetelstat in combination with ABT-199, chemotherapy-resistant AML, such as AML refractory to treatment with cytarabine in combination with daunorubicin or idarubicin, can be treated. The response of AML to treatment is known in the art. An example of evaluating the response of AML is shown in Table. 1.

Table 1. AML response scores

AML response scores Category Definition Full answer (PO) ¹ Blast cells in the bone marrow <5%; absence of blast cells with Auer bodies; absence of extramedullary disease; absolute neutrophil count >1.0 x 10 ⁹ /l (1000/µl); platelet count >100 x 10 ⁹ /l (100,000/µl); independence from RBC infusion PO with incomplete recovery (POC) ² All LR criteria except residual neutropenia (<1.0 x 10 ⁹ /l [1000/µl]) or thrombocytopenia (<100 x 10 ⁹ /l [100000/µl]) Morphological state without leukemia ³ Blast cells in the bone marrow <5%; absence of blast cells with Auer bodies; absence of extramedullary disease; hematological recovery is not required Partial response (PR) Applies to Phase 1 and 2 clinical trials only; all hematological criteria for software; decrease in the percentage of blast cells in the bone marrow to 5-25%; and a decrease in the percentage of bone marrow blast cells before treatment by at least 50% Cytogenetic PO (POc) ⁴ Return to a normal karyotype at the time of morphological LO (or PONV) in cases with an abnormal karyotype at the time of diagnosis; based on evaluation of 20 metaphase cells from bone marrow Molecular PO (POm) ⁵ There is no standard definition; depends on the molecular target Relapse ⁶ Blast cells in the bone marrow >5%; or the reappearance of blast cells in the blood; or development of extramedullary disease Treatment failure ⁷ >25% absolute increase in the number of blast cells in the bone marrow from baseline prior to this assessment (eg, 20% to 46%) for bone marrow aspirate (or biopsy in the case of dry aspiration)

- 8 040521

Stable disease ⁸ Does not correspond to a complete or partial response and has no evidence of treatment failure. The definitions of the response criteria are based primarily on those given by Cheson in 1990. ¹ All criteria must be met; bone marrow evaluation should be based on a count of 200 nucleated cells in a spiculated puncture; if in doubt, consider retesting after 5-7 days; flow cytometric evaluation may help distinguish between chronic leukemia and regenerating normal bone marrow; bone marrow biopsy should be performed in cases of dry puncture, or if no spicules were obtained; There is no minimum response time required. ² The PIM criterion is relevant in protocols using boosted induction or dual induction strategies in which hematologic recovery is not expected but intensive care will continue. In such protocols, CR may not even be achieved in the cycle of the entire treatment plan. In these cases, the overall response rate should include patients with PO and PONV. Some patients may not achieve complete hematological recovery after a longer follow-up time. ³ This category may be useful in the clinical development of new drugs in phase 1 clinical trials in which a transient state without morphologic leukemia can be achieved during early response evaluation. ⁴ Four studies have shown that failure to transition to a normal karyotype during PT predicts poor outcome. ⁵ As an example, in CBF (κορ-binding factor) AML, low levels of PCR positivity can be detected in patients even with a long-term response. When normalized to 104 copies of ABL1 according to standardized criteria, transcript levels below 12-10 copies appear to be predictive of long-term response. ⁶ In cases with a low blast percentage (5-10%), repeat bone marrow sampling should be performed to confirm recurrence. The appearance of new dysplastic changes should be carefully monitored for recurrence. In a recently treated patient, dysplasia or a transient increase in blasts may reflect the effect of chemotherapy and restoration of hematopoiesis. Cytogenetics should be analyzed to distinguish true relapse from treatment-related MDS/AML

The drug combinations described herein are suitable for use in the treatment of any of the diseases or disorders mentioned herein, including hematologic cancer (or subtypes thereof). The drugs may be administered simultaneously or sequentially.

The drug combinations described herein are suitable for use in the induction of apoptosis in a hematological cancer (cancer) cell. The drugs may be administered simultaneously or sequentially.

It will also be understood that the compositions described herein are suitable for use in the treatment of any of the diseases or disorders mentioned herein, including hematological cancer (or subtypes thereof).

C. Subject

The subject is a mammal in need of cancer treatment. Typically, the subject is a human patient. In some embodiments, the subject may be a non-human mammal, such as a non-human primate, an animal model (e.g., animals such as mice and rats used in drug screening, characterization, and evaluation), and other mammals. As used in this document, the terms patient,

- 9 040521 subject and individual are used interchangeably.

D. Anticancer agents

The following section describes drugs used in various embodiments of the invention. Because these drugs are well known, we only provide brief discussions. The publications cited in this section are intended to illustrate medicinal aspects for the benefit of the medical practitioner; however, reference to a specific publication in this section or elsewhere in this disclosure is not intended to limit the invention in any way, including doses, combinations, and indications.

1. Telomerase inhibitors

Examples of telomerase inhibitors include, without limitation, imetelstat, in particular sodium imetelstat. In some instances, one or more than one telomerase inhibitor (eg, two or three telomerase inhibitors) may be administered to a mammal for the treatment of hematologic malignancy.

Imelstat sodium is the sodium salt of imetelstat, which is a synthetic lipid-conjugated 13-mer oligonucleotide N3'lp5'-thio-phosphoramidate. Chemical name of sodium imetelstat: DNA, d(3'-amino-3'-deoxy-P-thio) (T-A-G-G-G-T-T-A-G-A-C-A-A), 5'-[O-[2hydroxy-3-(hexadecanoylamino)propyl]phosphorothioate], sodium salt (1 :13) (SEQ ID NO: 1). Imelstat and imetelstat sodium can be synthesized, prepared, or prepared as described elsewhere (Asai et al, Cancer Res., 63(14):3931-3939 (2003), Herbert et al., Oncogene, 24:5262- 5268 (2005) and Gryaznov, Chem Biodivers 7:477-493 (2010)).

Imelstat and imetelstat sodium target the telomerase RNA template and have been shown to inhibit telomerase activity and cell proliferation in various cancer cell lines and tumor xenografts in mice. Phase 1 studies in patients with breast cancer, non-small cell lung cancer and other solid tumors, multiple myeloma or chronic lymphocytic leukemia provided information on the pharmacokinetics and pharmacodynamics of the drug, and helped to justify 9.4 mg per kilogram of body weight (provided as 2- hourly intravenous infusion). A subsequent phase 2 study in patients with idiopathic thrombocythemia showed a decrease in platelet activity accompanied by a significant decrease in the load (proportion) of JAK2 V617F and CALR mutant alleles. Imelstat sodium is usually administered intravenously; it is contemplated that other routes of administration, such as intrathecal administration, intratumoral injection, oral administration, and others, may also be used in the practice of the present invention. Imetelstat sodium can be administered at doses comparable to those commonly used in the clinic. In preferred embodiments, sodium imetelstat is administered as described elsewhere in this document.

The particular embodiment corresponds to any of the other embodiments in which imetelstat is limited to sodium imetelstat.

2. ABT-199 - Bcl-2 Inhibitor ABT-199 (Venitoclax) is a platelet-sparing selective oral BCL-2 inhibitor in its class (FIG. 1B). It showed subnanomolar affinity for BCL-2 (Ki < 0.010 nM) with antitumor activity against non-Hodgkin's lymphoma (NHL) and CLL in vitro. In vivo xenograft studies in mice have shown activity against aggressive (Myc+) lymphomas as well as acute leukemia. In the phase Ia trial of ABT-199 in R/R NHL, a continuous daily dose of 200-900 mg was used. A single dose was administered on the 7th day followed by a run-in period with a gradual increase in titer over 2-3 weeks. ABT199 monotherapy has also been studied in an open-label, multicentre, phase 2 study in patients at high risk of R/R AML and in untreated patients who were ineligible for intensive chemotherapy. The study allowed dose escalation in the same patient when the patient received 20 mg ABT-199 weekly (Wek) Day 1. Daily escalation was introduced to reach a final dose of 800 mg on Day 6 and then daily. Such patients with no complete response (CR) or CR with incomplete haematological recovery (HECR) were able to increase the dose to 1200 mg prior to the first scheduled evaluation (end of Week 4). The recommended dose of AVT-199 phase 2 in combination with rituximab is 400 mg daily.

E. Pharmaceutical compositions

This invention also contemplates pharmaceutical compositions containing a telomerase inhibitor (eg imetelstat, in particular sodium imetelstat) and a Bcl-2 inhibitor (eg ABT-199). In one embodiment, the pharmaceutical composition contains imetelstat, in particular sodium imetelstat, and ABT-199. In one embodiment, the pharmaceutical composition contains imetelstat, in particular sodium imetelstat and ABT-199. The drug combinations described herein may be administered to a subject as a composition containing both drugs.

The carrier or diluent must be acceptable in the sense that it is compatible with the other ingredients of the composition and not harmful to their recipients.

For ease of administration, the drug combinations described herein may

- 10 040521 be prepared in various pharmaceutical forms for administration purposes. The drug combinations described herein may be formulated into various pharmaceutical forms for administration purposes. As suitable compositions there may be mentioned all compositions commonly used for the systemic administration of drugs.

To prepare the pharmaceutical compositions of this invention, an effective amount of the drug combination described herein is combined in a homogeneous mixture with a pharmaceutically acceptable carrier, which carrier may take a wide variety of forms depending on the form of preparation desired for administration. These pharmaceutical compositions are desirably in dosage unit form, particularly suitable for oral, rectal, transdermal, parenteral injection or inhalation. In some cases, administration may be by intravenous injection. For example, when preparing compositions in oral dosage form, any conventional pharmaceutical media can be used, such as, for example, water, glycols, oils, alcohols, and the like in the case of oral liquid preparations, such as suspensions, syrups, elixirs, emulsions, and solutions; or solid carriers such as starches, sugars, kaolin, diluents, lubricants, binders, disintegrants and the like, in the case of powders, pills, capsules and tablets. Because of their ease of administration, tablets and capsules are the most advantageous forms of oral dosage units, in which case solid pharmaceutical carriers are obviously used. For parenteral compositions, the carrier will usually contain sterile water, at least in large part, although other ingredients may be included, for example, to aid solubility. For example, injectable solutions may be prepared in which the carrier comprises saline solution, glucose solution, or a mixture of saline and glucose solution. For example, injectable solutions may be prepared in which the carrier includes saline, glucose solution, or a mixture of saline and glucose solution. Injectable solutions containing the combination of the drugs described herein may be formulated as an oil for sustained release. Suitable oils for this purpose are, for example, peanut oil, sesame oil, cottonseed oil, corn oil, soybean oil, synthetic glycerol esters of long chain fatty acids, and mixtures of these and other oils. Injectable suspensions may also be prepared, in which case suitable liquid carriers, suspending agents and the like may be used. Also included are solid form preparations which are intended to be converted, shortly before use, to liquid form preparations. In compositions suitable for transdermal administration, the carrier optionally contains a penetration agent and/or a suitable wetting agent, optionally in combination with suitable additives of any nature in minor proportions, which additives do not cause significant adverse effects on the skin. Said additives may facilitate application to the skin and/or may be useful in preparing the desired compositions. These compositions can be administered in various ways, for example via a transdermal patch, directly into the target, by application of an ointment.

It is particularly advantageous to formulate the aforementioned pharmaceutical compositions in dosage unit form for ease of administration and dosage uniformity. A dosage unit dosage form as used herein refers to physically discrete units suitable as unit doses, each unit containing a predetermined amount of active ingredients calculated to produce the desired therapeutic effect in combination with the required pharmaceutical carrier. Examples of such dosage unit forms are tablets (including crushable or coated tablets), capsules, pills, powder packets, instant tablets, suppositories, injectable solutions or suspensions, and the like, and divided multiple dosages thereof.

In order to increase the solubility and/or stability of drugs in the combinations described herein in pharmaceutical compositions, it may be advantageous to use α-, β- or γ-cyclodextrins or their derivatives, in particular hydroxyalkyl-substituted cyclodextrins, for example, 2-hydroxypropyl-β-cyclodextrin or sulfobutyl-v-cyclodextrin. Also co-solvents such as alcohols can improve the solubility and/or stability of the compounds of this invention in pharmaceutical compositions.

Depending on the route of administration, the pharmaceutical composition will preferably contain from 0.05 to 99% by weight, more preferably from 0.1 to 70% by weight, even more preferably from 0.1 to 50% by weight of drugs in the combinations described herein, and from 1 to 99.95% by weight, more preferably from 30 to 99.9% by weight, even more preferably from 50 to 99.9% by weight of the pharmaceutically acceptable carrier, with all percentages calculated on the total weight of the composition . The frequency of administration can be any frequency that reduces the severity of a symptom of a hematologic malignancy (eg, reduces or reverses bone marrow fibrosis) without causing significant toxicity in the mammal. For example, the frequency of administration may be from about once every two months to about once a week, or from about once a month to about twice a month, or from about once every six weeks to about two times. per month.

The frequency of administration may remain constant or may vary throughout the treatment period. The course of treatment with a composition containing one or more telomerase inhibitors may include periods of rest. For example, a composition containing a telomerase inhibitor and a Bcl-2 inhibitor may be administered weekly for a three week period followed by a two week rest period, and this regimen may be repeated several times. As with an effective amount, various factors may affect the actual frequency of administration used for a particular application. For example, the effective amount, duration of treatment, use of multiple drug agents, route of administration, and degree of hematological malignancy may require an increase or decrease in the frequency of administration.

The effective duration of administration of a composition comprising a telomerase inhibitor (eg, imetelstat or imetelstat sodium) and a Bcl-2 inhibitor (eg, ABT-199) can be any duration that reduces the severity of a symptom of hematologic malignancy (eg, reduces or reverses bone fibrosis). brain) without significant toxicity to the mammal. Thus, the effective duration may vary from one month to several months or years (for example, one month to two years, one month to one year, three months to two years, three months to ten months, or three months to 18 months). In general, as a rule, the effective duration of treatment for hematological malignancy can vary from two to twenty months. In some cases, the effective duration may be as long as the mammal is alive. Many factors can influence the actual effective duration used for a particular treatment. For example, the effective duration may vary depending on the frequency of administration, the effective amount, the use of multiple therapeutic agents, the route of administration, and the degree of hematological malignancy.

In some cases, the progress of treatment and the severity of one or more symptoms associated with a hematologic malignancy can be monitored. Any method can be used to determine whether or not the severity of a symptom of a hematologic malignancy is reduced. For example, the severity of a symptom of a hematologic malignancy (eg, bone marrow fibrosis) can be assessed using biopsy techniques.

The term "pharmaceutically acceptable salt" means a salt that is acceptable for administration to a patient, such as a mammal (counter ion salts having acceptable mammalian safety for a given dosage regimen). Such salts may be derived from pharmaceutically acceptable inorganic or organic bases and from pharmaceutically acceptable inorganic or organic acids. A pharmaceutically acceptable salt refers to pharmaceutically acceptable salts of a compound whose salts are derived from a variety of organic and inorganic counterions well known in the art and include, by way of example only, sodium and the like; and when the molecule contains the basic functionality, salts of organic or inorganic acids such as hydrochloride and the like. Pharmaceutically acceptable salts of interest include, but are not limited to: aluminum, ammonium, arginine, barium, enzatine, calcium, cholinate, ethylenediamine, lysine, lithium, magnesium, meglumine, procaine, potassium, sodium, tromethamine, N- methylglucamine, N,N'dibenzylethylenediamine, chlorprocaine, diethanolamine, ethanolamine, piperazine, zinc, diisopropylamine, diisopropylethylamine, triethylamine and triethanolamine.

The term salt(s) thereof denotes a compound formed when a proton of an acid is replaced by a cation such as a metal cation or an organic cation and the like. Preferably the salt is a pharmaceutically acceptable salt. By way of example, salts of these compounds include those salts in which the compound is protonated with an inorganic or organic acid to form a cation, with the conjugate base of the inorganic or organic acid as the anionic component of the salt. Salts of interest include, but are not limited to, aluminum, ammonium, arginine, barium, benzathine, calcium, cesium, cholinate, ethylenediamine, lithium, magnesium, meglumine, procaine, N-methylglucamine, piperazine, potassium, sodium, tromethamine, zinc, N,N'-dibenzylethylenediamine, chlorprocaine, diethanolamine, ethanolamine, piperazine, diisopropylamine, diisopropylethylamine, triethylamine and triethanolamine. It will be understood that for any of the oligonucleotide structures provided herein that include an internucleoside linkage framework, such oligonucleotides may also include any convenient salt form. In some embodiments, acidic forms of internucleoside bonds are shown for simplicity. In some instances, the salt of a compound of the invention is a salt of a monovalent cation. In some instances, the salt of a compound of the invention is a salt of a divalent cation. In some instances, the salt of a compound of the invention is a salt of a trivalent cation. A solvate refers to a complex formed by the combination of solvent molecules with solute molecules or ions. The solvent may be an organic compound, an inorganic compound, or a mixture of both. Some examples of solvents include, but are not limited to, methanol, A ^f , Adimethylformamide, tetrahydrofuran, dimethyl sulfoxide, and water. When the solvent is water, the solvate formed is a hydrate.

Stereoisomer and stereoisomers refer to compounds that have the same atomic bond but differ in the arrangement of atoms in space. Stereoisomers include, for example, cis-trans isomers, E and Z isomers, enantiomers and diastereomers. With respect to any of the groups disclosed herein that contain one or more substituents, it is understood that such groups do not contain any substitutions or substitution patterns that are sterically impractical and/or synthetically impracticable. All stereoisomers are intended to be included within the scope of this disclosure.

One skilled in the art will appreciate that other tautomeric arrangements of the groups described herein are possible. It is understood that all tautomeric forms of a compound of this invention are encompassed by the framework, which describes one possible tautomeric arrangement of compound groups, even if not specifically stated.

It is intended to include a solvate of a pharmaceutically acceptable salt of the tautomer of a stereoisomer of a compound of this invention. They are intended to be included within the scope of this disclosure.

F. Introduction and administration schedules

For the treatment of hematologic cancers, telomerase inhibitors (eg imetelstat or imetelstat sodium) and Bcl-2 inhibitors (eg ABT-199, ABT-263 and ABT-737) may be administered in combination to a subject in need of treatment. An example of a cancer that can be treated with this method is acute myeloid leukemia (AML), also called acute myelocytic leukemia, acute myelogenous leukemia, acute granulocytic leukemia, or acute non-lymphocytic leukemia. In acute leukemia, leukemia cells are immature blood cells (called blast cells) that grow rapidly and divide rapidly. Without treatment, most patients with acute leukemia would live only a few months.

The telomerase inhibitors and Bcl-2 inhibitors used in the present invention may be administered at any therapeutically effective dose, for example at doses comparable to those commonly used in clinical practice. Specific dosing regimens for known and approved anti-cancer agents (eg, recommended effective dose) are known to physicians and are given, for example, in the product descriptions indicated in PHYSICIANS' DESK REFERENCE, 2003, 57th Ed., Medical Economics Company, Inc., Oradell, N.J. ; Goodman & Gilman's THE PHARMACOLOGICAL BASIS OF THERAPEUTICS 2001, 10th Edition, McGraw-Hill, New York; and/or available from the FDA and/or discussed in the medical literature.

In some aspects, the dose of the telomerase inhibitor, sodium imetelstat, administered to a subject is from about 1.0 to about 13.0 mg/kg. In other aspects, the dose of the telomerase inhibitor is from about 6.5 to about 11.7 mg/kg. In some embodiments, the dosage of the telomerase inhibitor includes at least about 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7, 4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8, 7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.1, 10.2, 10.3, 10.4, 10.5, 10.6, 10.7, 10.8, 10.9, 11, 11.1, 11.2, 11.3, 11.4, 11.5, 11.6, 11.7, 11.8, 11.9, 12, 12.1, 12.2, 12.3, 12.4, 12.5, 12.6, 12.7, 12.8, 12.9 or 13 mg/kg. In some embodiments, an effective amount of a telomerase inhibitor administered to an individual includes at least about 1, 2.5, 3.5, 5, 6.5, 7.5, 9.4, 10, 15, or 20 mg/ kg. In various embodiments, an effective amount of a telomerase inhibitor administered to an individual includes less than about 350, 300, 250, 200, 150, 100, 50, 30, 25, 20, 10, 7.5, 6.5, 5, 3.5, 2.5 1 or 0.5 mg/kg telomerase inhibitor. Exemplary dosing frequencies for pharmaceutical compositions (eg, a pharmaceutical composition containing a telomerase inhibitor and/or a pharmaceutical composition containing a Bcl-2 inhibitor) include, but are not limited to, daily; in a day; twice a week; three times a week; weekly without a break; weekly, three out of four weeks; once every three weeks; once in two weeks; weekly, two out of three weeks. In some embodiments, the pharmaceutical composition is administered about once a week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 6 weeks, or once every 8 weeks. In some embodiments, the composition is administered at least about 1 time, 2 times, 3 times, 4 times, 5 times, 6 times, or 7 times (i.e., daily) per week, or three times per day, twice per day. In some embodiments, the intervals between each administration are less than about 6 months, 3 months, 1 month, 20 days, 15 days, 12 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days , 3 days, 2 days or 1 day. In some embodiments, the intervals between each administration are greater than about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, or 12 months. In some embodiments, there are no breaks in the dosing schedule. In some embodiments, the interval between each administration is no more than about a week.

- 13 040521

Telomerase inhibitors such as imetelstat or imetelstat sodium may be administered by any suitable route. For example, telomerase inhibitors such as imetelstat or imetelstat sodium may be administered intravenously once every 4 weeks for a specified period of time (eg, one, two, three, four, or five hours). In one embodiment, imetelstat is administered intravenously once a week over a period of about 2 hours at a dose of 7-10 mg/kg. In another embodiment, imetelstat is administered intravenously once every 3 weeks over a period of about 2 hours at a dose of 2.5-7 mg/kg. In yet another embodiment, imetelstat is administered intravenously over a period of about 2 hours once every 4 weeks at a dose of 0.5-5 mg/kg. In another embodiment, imetelstat is administered intravenously once every 3 weeks over a period of about 2 hours at a dose of about 2.5-10 mg/kg. In yet another embodiment, imetelstat is administered intravenously over a period of about 2 hours once every 4 weeks at a dose of about 0.5-9.4 mg/kg.

In such cases, when treated with the Bcl-2 inhibitor, ABT-199, the dose of ABT-199 may be about or less than 400 mg orally once a day. For example, a person identified as having a hematologic malignancy may be treated with ABT-199 at a dose that is a) 20 mg orally once a day, b) 50 mg orally once a day, c) 100 mg orally once a day d) 200 mg orally once a day or e) 400 mg orally once a day. In another embodiment, ABT-199 is administered on a weekly dose escalation schedule for 5 weeks to the recommended daily dose of 400 mg starting at 20 mg po once a day for week 1, 50 mg po once a day for week 2, 100 mg orally once a day at week 3, 200 mg orally once a day at week 4, and 400 mg orally once a day at week 5 and beyond. In another embodiment, ABT-199 is administered at a dose of 400 mg orally once a day. In another embodiment, dosing is continued until disease progression or unacceptable toxicity.

It is understood that cancer treatment sometimes includes multiple rounds or cycles of drug administration, with each cycle including drug administration one or more times according to a specified schedule (e.g., every three weeks for three consecutive days, once per week, etc.). For example, anti-cancer drugs may be administered for 1 to 8 cycles, or for a longer period. When more than one drug is administered to a subject (eg, two drugs), each may be administered according to its own schedule (eg, weekly; once every three weeks, etc.). It will be understood that the administration of drugs, even those administered at different intervals, can be coordinated such that both drugs are administered on the same day for at least some of the time, or alternatively that the drugs are administered on consecutive days, at least for a while. In regimens in which a telomerase inhibitor (eg, imetelstat or imetelstat sodium) and a Bcl-2 inhibitor (eg, ABT-199 or Veneteclax) are administered in combination, they may be administered in any order. In some embodiments, the telomerase inhibitor is administered one day before, one day after, or on the same day that the Bcl-2 inhibitor is administered. It is understood that other schedules may be used as determined by the physician.

As is understood in the art, treatment with anticancer therapeutic drugs may be temporarily suspended if toxicity is observed, or for the convenience of the patient, without departing from the scope of the invention, and then resumed.

G. Introduction to combinations

Two or three drugs are administered to a subject in combination when the drugs are administered as part of the same course of therapy. The course of therapy refers to the administration of combinations of drugs that, in the opinion of the physician, should work additively, complement each other, synergistically or otherwise, to obtain a more favorable result than intended for the administration of a single drug. The course of therapy can be one or several days, but more often lasts several weeks.

Thus, an example of administration in combination is the administration of imetelstat once every 28 days for 1 to 4 cycles, starting from day 1, and the administration of AVT-199 once every 7 days, starting from day 1 for 4 cycles. In one embodiment, administration of ABT-199 begins on Day 1, Day -1, or Day 2, or other days within the cycle. In one embodiment, administration in combination is administration of imetelstat once every 28 days for 1 to 4 cycles starting on day 1 and administration of ABT-199 once daily for 28 days starting on day 1. days for 1 to 4 cycles.

When two drugs are administered in combination, different regimens may be used. In one instance, for example and without limitation, drug 1 is first administered prior to drug 2, and treatment with drug 1 is continued throughout the course of drug 2; alternatively, drug 1 is administered after the start or completion of therapy with drug 2; alternatively, drug 1 is first administered simultaneously with the start of another cancer therapy. As used herein, simultaneously means that the two drugs are administered on the same day, or on consecutive days. Although in

- 14 040521 In principle, certain drugs can be prepared together, in general, as a rule, they are administered in separate compositions. Similarly, although some drugs may be administered simultaneously, it is more common (especially for drugs administered by infusion) that drugs are administered at different times on the same day, on consecutive days, or on a different schedule.

The invention also relates to a combination containing a telomerase inhibitor and a Bcl-2 inhibitor. Specifically, the telomerase inhibitor is imetelstat and the Bcl-2 inhibitor is ABT-199. Specifically, the telomerase inhibitor is sodium imetelstat and the Bcl-2 inhibitor is ABT-199. The invention also relates to a combination containing a telomerase inhibitor and a Bcl-2 inhibitor for use as a drug. Specifically, the telomerase inhibitor is imetelstat and the Bcl-2 inhibitor is ABT-199. Specifically, the telomerase inhibitor is sodium imetelstat and the Bcl-2 inhibitor is ABT-199.

H. Diagnosis

For the diagnosis of AML, blood and bone marrow smears are examined morphologically using a May-Greenwald-Giemsa or Wright-Giemsa stain. It is recommended to count at least 200 leukocytes in blood smears and 500 nucleated cells in bone marrow smears, the latter containing spicules. The diagnosis of AML requires the presence of blast cells in the bone marrow or blood in an amount of 20% or more, with the exception of AML with t (15; 17), t (8; 21), inv (16) or t (16; 16) and some cases of erythroleukemia. Myeloblasts, monoblasts and megakaryoblasts are included in the number of blast cells. In AML with monocytic or myelomonocytic differentiation, monoblasts and promonocytes, but not abnormal monocytes, are considered blast equivalents. Erythroblasts are not considered blast cells except in the rare case of pure erythroid leukemia.

I. Kits

This invention also relates to a kit containing a telomerase inhibitor and a Bcl-2 inhibitor. Also provided is a kit containing a telomerase inhibitor and a Bcl-2 inhibitor for use in the treatment of hematologic cancer. Such therapy in some instances includes administering a Bcl-2 inhibitor to a subject, either before, after, or simultaneously with administration of the telomerase inhibitor. In some cases, the telomerase inhibitor is imetelstat.

In a related aspect, the present invention provides a kit containing a dose of a telomerase inhibitor in an amount effective to inhibit cancer cell proliferation in a subject. In some cases, the kit contains an insert with instructions for using the telomerase inhibitor. The insert may provide the user with one set of instructions for using the inhibitor in combination with a Bcl-2 inhibitor. In some cases, the Bcl-2 inhibitor is ABT-199. In some cases, the combination therapy package may recommend (i) a lower dose of a telomerase inhibitor when used in combination with a Bcl-2 inhibitor, (ii) a lower dose of a Bcl-2 inhibitor when used in combination with a telomerase inhibitor, and/or (iii) ) a different dosing regimen for one or both inhibitors from that normally recommended. It will be understood that in the above paragraphs, in some cases, the telomerase inhibitor is imetelstat; in some cases, the telomerase inhibitor is sodium imetelstat; in some cases, the Bcl-2 inhibitor is ABT-199.

J. Exemplary Embodiments

One exemplary embodiment of the invention is a method of treatment comprising administering a combination of a telomerase inhibitor and a Bcl-2 inhibitor to a subject in need of treatment for a hematologic cancer. In some embodiments, the telomerase inhibitor is imetelstat. In alternative embodiments, the Bcl-2 inhibitor is ABT-199, ABT-263, or ABT-737. In yet another embodiment, the Bcl-2 inhibitor is ABT-199. In one embodiment, the telomerase inhibitor is imetelstat and the Bcl-2 inhibitor is ABT-199.

The hematologic cancer may be AML, idiopathic thrombocythemia, polycythemia vera, primary myelofibrosis, systemic mastocytosis, chronic myeloid leukemia; chronic neutrophilic leukemia, chronic eosinophilic leukemia, refractory anemia with ringed sideroblasts, refractory cytopenia with multi-cell dysplasia, refractory type 1 anemia with blast cell excess, type 2 refractory anemia with blast cell excess, myelodysplastic syndrome (MDS) with detected deletion (5q), unclassified MDS, chronic myelomonocytic leukemia (CML), atypical chronic myelogenous leukemia, juvenile myelomonocytic leukemia, myeloproliferative/myelodysplastic syndromes, unclassifiable, B-lymphoblastic leukemia/lymphoma, T-lymphoblastic leukemia/lymphoma, diffuse large B-lymphocytic large cell B-lymphoma lymphoma of the central nervous system, primary mediastinal B-lymphocytic lymphoma, Burkitt's lymphomas/leukemias, follicular lymphoma, chronic lymphocytic leukemia (CLL)/small-cell lymphocytic lymphoma, B-lymphocytic prolymphocytic leukemia, lymphoplasmacytic lymphoma/Walden's macroglobulinemia strema, mantle cell lymphoma, marginal zone lymphomas, post-transplant lymphoproliferative disorders, HIV-associated lymphomas, primary effusion lymphoma, intravascular large B-lymphocytic lymphoma, primary cutaneous B-lymphocytic lymphoma, hairy cell leukemia, monoclonal gammopathy of unknown significance, sluggish multiple myeloma, and solitary bone and extramedullary). In one embodiment, the hematologic cancer is AML.

In some embodiments, the telomerase inhibitor imetelstat is administered for 1, 2, 3, 4, 5, 6, 7, 8, or more than 8 dosing cycles, each cycle comprising: (a) intravenous administration of about 7-10 mg/kg imetelstat once every four weeks; (b) intravenous administration of about 7-10 mg/kg imetelstat once a week for four weeks; (c) intravenous administration of about 2.5-7 mg/kg of imetelstat once every three weeks; or (d) intravenous administration of about 0.5-9.4 mg/kg of imetelstat once every four weeks. The imetelstat may be sodium imetelstat.

In some embodiments, ABT-199 is administered at a dose of: (a) about 50-400 mg of ABT-199 per day; (b) about 2 mg of ABT-199 on day 1, increased daily to a final dose of about 800 mg on day 6 and daily thereafter, or (c) about 25 mg of AVT-199 on day 1, increased daily to a final doses of about 400 mg on day 5 and daily thereafter. The introduction of AVT-199 is possible one day before, one day after or on the same day when the telomerase inhibitor is administered.

Another embodiment of the invention is a method of inducing apoptosis in a hematological cancer (cancer) cell, comprising contacting the cell with a therapeutically effective amount of a telomerase inhibitor and contacting the cell with a therapeutically effective amount of a Bcl-2 inhibitor. The method can be carried out in vitro or in vivo. In one embodiment, the telomerase inhibitor is imetelstat. In another embodiment, the imetelstat is sodium imetelstat. In this method, the Bcl-2 inhibitor is ABT-199. In some embodiments, the hematologic cancer cell may be a cell of the following type of cancer: acute myeloid leukemia (AML), idiopathic thrombocythemia, polycythemia vera, primary myelofibrosis, systemic mastocytosis, chronic myeloid leukemia; chronic neutrophilic leukemia, chronic eosinophilic leukemia, refractory anemia with ringed sideroblasts, refractory cytopenia with multi-cell dysplasia, refractory type 1 anemia with blast cell excess, refractory type 2 anemia with blast cell excess, myelodysplastic syndrome (MDS) with detected deletion (5q), unclassified MDS, chronic myelomonocytic leukemia (CML), atypical chronic myelogenous leukemia, juvenile myelomonocytic leukemia, myeloproliferative/myelodysplastic syndromes - unclassified, Blymphoblastic leukemia/lymphoma, T-lymphoblastic leukemia/lymphoma, diffuse large B-lymphocytic lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt's lymphoma/leukemia, follicular lymphoma, chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma, B-lymphocytic prolymphocytic leukemia, lymphoplasmacytic lymphoma/macroglobules Waldenström's inemia, mantle cell lymphoma, marginal zone lymphoma, post-transplant lymphoproliferative disorders, HIV-associated lymphomas, primary effusion lymphoma, intravascular large B-lymphocytic lymphoma, primary cutaneous B-lymphocytic lymphoma, hairy cell leukemia, monoclonal gammopathy of unknown significance, indolent multiple myeloma, and isolated plasma cells (isolated bone and extramedullary). In one embodiment, the hematologic cancer cell is an acute myeloid leukemia (AML) cell.

The invention also provides combination therapy kits. Another embodiment of the invention is a kit containing: (a) a dose of a telomerase inhibitor in an amount effective when administered to induce apoptosis in a hematological cancer (oncological) cell; and (b) a dose of a Bcl-2 inhibitor in an amount effective when administered to induce apoptosis in a hematologic cancer (cancer) cell. In one embodiment of this kit, the telomerase inhibitor is imetelstat and the Bcl-2 inhibitor is ABT-199.

One embodiment of the invention is a pharmaceutical composition containing a telomerase inhibitor (eg, imetelstat/imetelstat sodium) and a BCL-2 inhibitor (eg, ABT-199) for use in the treatment of hematologic cancer. In one embodiment, the pharmaceutical composition contains imetelstat/imetelstat sodium and ABT-199.

Another embodiment of the invention is a telomerase inhibitor for use in a method of treating a hematologic cancer comprising administering a combination of a telomerase inhibitor and a Bcl-2 inhibitor to a subject in need thereof. Another embodiment of the invention is a Bcl-2 inhibitor for use in a method of treating

- 16 040521 hematological oncological disease, which includes the introduction of a Bcl-2 inhibitor and a telomerase inhibitor in combination to a subject in need thereof. An alternative embodiment of the invention is a combination containing a telomerase inhibitor and a Bcl-2 inhibitor for use in a method of treating a hematologic cancer comprising administering the combination to a subject in need thereof. In these embodiments, the combination of a telomerase inhibitor and a Bcl-2 inhibitor induces apoptosis of hematologic cancer cells. In these embodiments, the telomerase inhibitor may be imetelstat. In one embodiment, the imetelstat is sodium imetelstat. Also in these embodiments, the Bcl-2 inhibitor may be ABT-199. Imetelstat may be administered for 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 dosing cycles, each cycle including: ; (b) intravenous administration of about 7-10 mg/kg imetelstat once a week for four weeks or (c) intravenous administration of about 2.5-7 mg/kg imetelstat once every three weeks; or (d) intravenous administration of about 0.5-9.4 mg/kg imetelstat once every four weeks. ABT-199 may be administered at a dose of: (a) about 50-400 mg of ABT-199 daily; (b) about 2 mg of ABT-199 on day 1, increased daily to a final dose of about 800 mg on day 6 and daily thereafter, or (c) about 25 mg of ABT-199 on day 1, increased daily to a final dose of about 400 mg on day 5 and daily thereafter. In some embodiments, administration of ABT-199 is one day before, one day after, or the same day as the telomerase inhibitor is administered.

In embodiments of the telomerase inhibitor, Bcl-2 inhibitor, or combination, the hematologic cancer may be AML, idiopathic thrombocythemia, polycythemia vera, primary myelofibrosis, systemic mastocytosis, chronic myeloid leukemia; chronic neutrophilic leukemia, chronic eosinophilic leukemia, refractory anemia with ringed sideroblasts, refractory cytopenia with multi-cell dysplasia, refractory type 1 anemia with blast cell excess, type 2 refractory anemia with blast cell excess, myelodysplastic syndrome (MDS) with detected deletion (5q), unclassified MDS, chronic myelomonocytic leukemia (CML), atypical chronic myeloid leukemia, juvenile myelomonocytic leukemia, myeloproliferative/myelodysplastic syndromes - unclassified, B-lymphoblastic leukemia/lymphoma, T-lymphoblastic leukemia/lymphoma, diffuse large B-lymphocytic lymphoma, primary lymphoma of the central nervous system, primary mediastinal B-cell lymphoma, Burkitt's lymphomas/leukemias, follicular lymphoma, chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma, B-lymphocytic prolymphocytic leukemia, lymphoplasmacytic lymphoma/Waldenström macroglobulinemia, mantle lymphoma, marginal zone lymphoma, post-transplant lymphoproliferative disorders, HIV-associated lymphoma, primary effusion lymphoma, intravascular large B-lymphocytic lymphoma, primary cutaneous B-lymphocytic lymphoma, hairy cell leukemia, monoclonal gammopathy of unknown significance, sluggish multiple myeloma, and solitary plasmacytomas (solitary bone and extramedullary). In one embodiment, the hematologic cancer is acute myeloid leukemia (AML).

An alternative embodiment of the invention is an in vitro method for inducing apoptosis in a hematological cancer (cancer) cell, comprising contacting the cell with a therapeutically effective amount of a telomerase inhibitor and contacting the cell with a therapeutically effective amount of a Bcl-2 inhibitor. In one embodiment, the telomerase inhibitor is imetelstat. The imetelstat may be sodium imetelstat. The Bcl-2 inhibitor may be ABT-199.

In some embodiments of the in vitro method, the hematologic cancer cell may be a cell of the following type of cancer: acute myeloid leukemia (AML), idiopathic thrombocythemia, polycythemia vera, primary myelofibrosis, systemic mastocytosis, chronic myeloid leukemia; chronic neutrophilic leukemia, chronic eosinophilic leukemia, refractory anemia with ringed sideroblasts, refractory cytopenia with multi-cell dysplasia, refractory type 1 anemia with blast cell excess, refractory type 2 anemia with blast cell excess, myelodysplastic syndrome (MDS) with detected deletion (5q), unclassified MDS, chronic myelomonocytic leukemia (CML), atypical chronic myeloid leukemia, juvenile myelomonocytic leukemia, myeloproliferative/myelodysplastic syndromes - unclassified, B-lymphoblastic leukemia/lymphoma, T-lymphoblastic leukemia/lymphoma, diffuse large B-lymphocytic lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt's lymphoma/leukemia, follicular lymphoma, chronic lymphocytic leukemia (CLL)/small lymphocytic lymphoma, B-lymphocytic prolymphocytic leukemia, lymphoplasmacytic lymphoma/macroglobu Waldenström's lineemia, mantle cell lymphoma, marginal zone lymphoma, post-transplant lymphoproliferative disorders, HIV

- 17 040521 associated lymphomas, primary effusion lymphoma, intravascular large B-lymphocytic lymphoma, primary cutaneous B-lymphocytic lymphoma, hairy cell leukemia, monoclonal gammopathy of unknown significance, indolent multiple myeloma, and isolated by plasmacyte (isolated bone and extramedullary). In one embodiment of the in vitro method, the hematological cancer cell is an acute myeloid leukemia (AML) cell.

Another embodiment of the invention is a combination containing a telomerase inhibitor and a Bcl-2 inhibitor. In one embodiment, the telomerase inhibitor is imetelstat and the Bcl-2 inhibitor is ABT-199. In another embodiment, the telomerase inhibitor is sodium imetelstat and the Bcl-2 inhibitor is ABT-199. The combination can be used as a drug.

Another embodiment of the invention is the use of imetelstat or imetelstat sodium for the treatment of hematological cancer in a patient undergoing therapy with BCL inhibition. An alternative embodiment is the use of ABT-199 for the treatment of hematologic cancer in a patient undergoing telomerase inhibition therapy. Another embodiment of the invention is imetelstat sodium for use in a method for the treatment of acute myeloid leukemia (AML), the method comprising administering imetelstat sodium and ABT-199 in combination to a subject in need thereof. A further embodiment is ABT-199 for use in a method of treating acute myeloid leukemia (AML), the method comprising administering ABT-199 and imetelstat sodium in combination to a subject in need thereof. A further embodiment is a combination containing imetelstat sodium and ABT-199 for use in a method for the treatment of acute myeloid leukemia (AML), the method comprising administering the combination to a subject in need thereof. As used in these embodiments, imetelstat sodium may be administered for 1, 2, 3, 4, 5, 6, 7, 8, or more than 8 dosing cycles, each cycle comprising: (a) intravenous administration of about 7- 10 mg/kg imetelstat sodium every four weeks; (b) intravenous administration of about 7-10 mg/kg imetelstat sodium once a week for four weeks; (c) intravenous administration of about 2.5-7 mg/kg imetelstat sodium once every three weeks; or (d) intravenous administration of about 0.5-9.4 mg/kg imetelstat sodium once every four weeks. Additionally, in these embodiments, ABT-199 may be administered at a dose of: (a) about 50-400 mg of ABT-199 daily; (b) about 2 mg of ABT-199 on day 1, increased daily to a final dose of about 800 mg on day 6 and daily thereafter, or (c) about 25 mg of ABT-199 on day 1, increased daily to a final dose of about 400 mg on day 5 and daily thereafter. In some of these embodiments, administration of ABT-199 occurs one day before, one day after, or on the same day that imetelstat sodium is administered.

Another embodiment of the invention is an in vitro method for inducing apoptosis in an acute myeloid leukemia (AML) cell, comprising contacting the cell with a therapeutically effective amount of imetelstat sodium and contacting the cell with a therapeutically effective amount of ABT-199.

In all of the above embodiments, the telomerase inhibitor may be imetelstat and the Bcl-2 inhibitor may be ABT-199. More specifically, in all of the above embodiments, the telomerase inhibitor may be sodium imetelstat and the Bcl-2 inhibitor may be ABT-199.

The present invention is further illustrated, but not limited, by the following examples.

Examples

Example 1 The telomerase inhibitor imetelstat sodium in combination with the BCL-2 inhibitor venitoclax enhances apoptosis in AML cell lines in vitro

Tumor cells KG-1 (ACTP (American Type Culture Collection) no. CCL-246) and MOLM13 AML (DSMZ no. ACC554) were plated at a density of about 20,000 cells/well in 96-well polystyrene U-bottom tissue culture plates (catalogue no. 353777). Corning) in RPMI-1640 (ThermoFisher #11875-085) supplemented with 10% fetal bovine serum (ThermoFisher #16140-089) and 1% penicillin/streptomycin antibiotic mix (ThermoFisher #15140-122) and grown in an incubator with 37 °C in a humidified atmosphere with 5% CO ₂ . Cells were immediately treated with sodium imetelstat (Janssen Biotech, Inc.) prepared in RPMI-1640 supplemented with 10% fetal bovine serum, and/or ABT-199 (Selleckchem catalog # S8048) prepared as a 1000x stock solution in DMSO diluted 1:100 in phosphate buffered saline (PBS, vehicle; ThermoFisher Catalog No. 20012-027). In 96 hour experiments, a second dose of compound(s) was administered 48 hours later without the addition of fresh medium because ABT-199 and imetelstat sodium have an in vitro half-life of less than 48 hours (Shammas et al., Leukemia, 22(7): 1410 -1418 (2008)). Imelstat sodium has been tested from 0-50 µM, and ABT-199 has been tested from 0-500 nM. Control non-complementary and incompletely complementary oligonucleotides (US 7998938) shown

- 18 040521 in the table. 2 were used at the same concentrations as imetelstat sodium to show that the effects are specific to the combination of imetelstat sodium and ABT-199.

Table 2. Sequence targeting hTR

Imelstat sodium ³ 5'-R-TAGGGTTAGACAA-NH2-3' SEQID NO:1 Oligonucleotide with incomplete complementarity ^b Non-complementary oligonucleotide ⁰ R is: ³ Palmitoyl [(CH^nCH3] thiophosphate group N3'-> Pi ^b Palmitoyl |(CH ₂ )i4CTE thiophosphate group N3'^ Pi ^c Palmitoyl [(CH ₂ )i ₄ CI oligonucleotide NPS. 5 '-R-TAGGTGTAAGCAA-NH ₂ -3 ' 5 ' -AACAGATTGGGAT-R-3 ' amide is conjugated through the aminoglycerium Gthiophosphoramidate (XP8)-coordinate oli amide is conjugated through the aminoglycerium Gthiophosphoramidate (NPS)-connected oli 33] amide is conjugated through the terminal: SEQID NO :2 SEQID NO :3 The third linker is from the 5'gonucleotide. The ninth linker from the 5'gonucleotide. u 3'-amino group

At 48 and 96 hours, cells were checked for healthy, early apoptotic and apoptotic populations using the flow cytometric assay kit with annexin V (stains the inside of the cell membrane) and propidium iodide (PI, DNA-binding dye) (BioLegend #640914). Annexia V detects externalization of phosphatidylserine in apoptotic cells using recombinant annexin V conjugated with green fluorescent dye FITC and dead cells using propidium iodide (PI). Propidium iodide stains necrotic cells with red fluorescence. After treatment with both probes, early apoptotic cells show green fluorescence, apoptotic (dead) cells show red and green fluorescence, and live cells show little or no fluorescence. Briefly, cells were pelleted and washed 2 times with PBS before being suspended in annexin V binding buffer containing anti-annexin V-FITC and propidium iodide in a 1:2 ratio, according to the manufacturer's suggested protocol. Cells were stained for 30 min at 4°C in the dark, followed by a 3-fold wash with PBS and a suspension in FAC staining buffer (BD catalog #554657), prior to data acquisition on a BD FACS Canto flow cytometer for forward scatter, side scatter, FITC , and PE channels. Cell populations were analyzed using Cytobank software and compared to regimens (no imetelstat sodium or ABT-199) without viable cell penetration limiting treatment (unstained in any channel; i.e. double negative populations). For all experiments, scatter plots of the flow cytometry data show four quadrants with the percentage of live cells in the lower left quadrant, the percentage of early apoptotic cells (anneskin V+/PI-) in the upper left quadrant, and the percentage of apoptotic (dead) cells (double labeled with annexin V+/ PI+) in the upper right quadrant. The percentage of apoptotic cells (double-labeled) was used to calculate combined effects using the Highest Single Agent (HSA) and Bliss additivity models (J Tang et al. Frontiers in Pharmacology. 2015; 6 (181)).

Using the HSA model, the cytotoxic effect of the combination regimen (C) was compared to that produced by each of the control single agents (A or B) for the respective dose in combination:

Excess compared to HSA = C - A (if A > B) or C - B (if A < B)

The Bliss model performs a similar comparison, but instead of the highest effect of a single agent, the Bliss model subtracts from the combination a value equal to the sum of each individual agent minus their product:

Overscaling with BLISS = C - [(A+B) - (A*B)]

These models are able to show additivity or weak synergy in combination.

AML Cell Line Processing Results

Dot plots of flow cytometry data for KG-1 cells after 48 hours of treatment with imetelstat sodium and/or ABT-199 are shown in FIG. 1A, with a plot of % apoptotic cells (double labeling) versus concentration of ABT-199 at different concentrations of sodium imetelstat shown in FIG. 1B. KG-1 shows negligible sensitivity to ABT-199 after 48 hours (-9% and -14% at 100 and 500 nM, respectively) and minimal sensitivity to sodium imetelstat. However, when 50 μM sodium imetelstat treatment is combined with 100 or 500 nM ABT-199, there is a greater effect on cell death (-27% at 100 nM and -50% at 500 nM). In table. 3 and 4

- 19 040521 shows combined effect calculations using HSA or BLISS models when KG-1 cells are treated after 48 hours. Negative values do not indicate antagonism in these models, only lack of interaction.

Table 3. Outlier versus highest single agent effect for KG-1 cells at 48 h with ABT-199 and imetelstat sodium

Exceeding HSA AVT-199, nM 0 1 5 20 100 500 Imelstat sodium, µM 50 0 0 2 9 18 36 25 0 2 3 5 7 9 10 0 1 2 2 4 2 0 0 0 0 0 0 0

Table 4. BLISS overscaling for KG-1 cells at 48 h with ABT-199 and imetelstat sodium

Overstaying with BLISS AVT-199, nM 0 1 5 20 100 500 Imelstat sodium, µM 50 0 -5 -2 3 eleven 28 25 0 -4 -2 -1 0 2 10 0 -5 -3 -4 -2 -3 0 0 0 0 0 0 0

Dot plots of flow cytometry data for KG-1 cells after 96 hours of treatment with imetelstat sodium and/or ABT-199 are shown in FIG. 2A, with a plot of % apoptotic cells (double labeling) versus concentration of ABT-199 at various concentrations of sodium imetelstat shown in FIG. 2B. KG-1 shows negligible sensitivity to ABT-199 at 96 h (~6% and ~10% at 100 and 500 nM, respectively), and some sensitivity to sodium imetelstat was also observed (5, 9, and 16% at 10, 20, and 50 µM, respectively). However, when 25 or 50 µM sodium imetelstat treatment is combined with 20-500 nM ABT-199, there is a greater effect on cell death at all concentrations. In table. Figures 5 and 6 show combined effect calculations using HSA or BLISS models when treated with KG-1 cells after 96 hours.

Table 5. Outlier versus highest single agent effect for KG-1 cells at 96 h with ABT-199 and imetelstat sodium

Exceeding AVT-199, nM compared to HSA 0 1 5 20 100 500 Imelstat sodium, µM 50 0 4 6 13 20 65 25 0 3 4 7 12 26 10 0 1 2 5 7 10 0 0 0 0 0 0 0

Table 6. BLISS overscaling for KG-1 cells at 48 hours with ABT-199 and imetelstat sodium

Overstaying with BLISS AVT-199, nM 0 5 1 20 100 500 Imelstat sodium, µM 50 0 1 3 10 16 57 25 0 0 0 3 7 18 10 0 -2 -1 1 2 5 0 0 0 0 0 0 0

Dot plots of flow cytometry data for KG-1 cells after treatment at 48 hours (FIG. 3A) or 96 hours (FIG. 4A) with non-complementary or incompletely complementary oligonucleotides and ABT-199 are shown. Plots of % apoptotic cells (double labeling) versus ABT-199 concentration at different oligonucleotide concentrations are shown for 48 hours (FIG. 3B) or 96 hours (FIG. 4B). Models of HSA excess (Tables 7 and 8) and Bliss excess (Tables 9 and 10) confirm no effect with oligonucleotide controls. Negative values do not indicate antagonism in these patterns, only lack of interaction.

- 20 040521

Table 7. Overshoot compared to HSA for KG-1 cells at 48 h with non-complementary or incompletely complementary controls

Exceeding HSA AVT-199, nM 0 1 5 20 100 500 Incompletely complementary, µM 50 0 -3 -2 -3 -5 -8 25 0 -3 -2 -2 -3 -5 Non-complementary, µM 50 0 -2 1 -1 -3 -5 25 0 -2 -1 -2 -3 -3

Table 8. Overshoot compared to HSA for KG-1 cells at 96 h with non-complementary or incompletely complementary controls

Excess compared to HSA AVT-199, nM 0 1 5 20 100 500 Incompletely complementary, µM 50 0 2 3 2 2 3 25 0 0 0 0 0 -3 Non-complementary, µM 50 0 1 1 1 1 -2 25 0 0 0 0 -1 -2

Table 9. BLISS overshoot for KG-1 cells at 48 h with non-complementary or incompletely complementary controls

Overstaying with BLISS AVT-199, nM 0 1 5 20 100 500 Incompletely complementary, µM 50 0 -5 -5 -6 -8 -AND 25 0 -5 -4 -4 -5 -7 Non-complementary, µM 50 0 -5 -2 -4 -6 -8 25 0 -5 -4 -5 -5 -5

Table 10. BLISS overscaling for KG-1 cells at 96 h with non-complementary or incompletely complementary controls

Exceeding the setting with BLISS AVT-199, nM 0 1 5 20 100 500 Incompletely complementary, µM 50 0 -2 -1 -2 -2 -1 25 0 -4 -3 -4 -4 -7 Non-complementary, µM 50 0 -2 -2 -2 -2 -5 25 0 -2 -3 -3 -3 -5

Dot plots of flow cytometry data for MOLM-13 cells after 48 hours of treatment with imetelstat sodium and/or ABT-199 are shown in FIG. 5A, with a plot of % apoptotic cells (double labeling) versus concentration of ABT-199 at various concentrations of sodium imetelstat shown in FIG. 5V.

MOLM-13 shows some sensitivity to ABT-199 after 48 hours (-19% and -30% at 100 and 500 nM, respectively) and some sensitivity to sodium imetelstat (21.5% at 50 μM). However, when 25 μM sodium imetelstat was combined with ABT-199, a greater effect on cell death was observed (-32% and -72% at 100 and 500 nM, respectively). The greatest effect on cell death was observed with 50 μM sodium imetelstat in combination with ABT-199 at 100 nM (62%) and 500 nM (88%). Surprisingly, in combination with sodium imetelstat at a concentration of 50 μM, ABT-199 showed an effect on cell death at lower concentrations of 5 and 20 nM. In table. Figures 11 and 12 show combined effect calculations using HSA or BLISS models to treat MOLM-13 cells after 48 hours.

- 21 040521

Table 11. Overshoot vs. Highest Effect of a Single Agent on Cells

MOLM-13 after 48 hours with ABT-199 and sodium imetelstat

Exceeding HSA AVT-199, nM 0 1 5 20 100 500 Imelstat sodium, µM 50 0 6 9 19 40 58 25 0 2 4 8 13 42 10 0 3 3 6 3 14 0 0 0 0 0 0 0

Table 12. BLISS overscaling for MOLM-13 cells at 48 h with ABT-199 and imetelstat sodium

Overstaying with BLISS AVT-199, nM 0 1 5 20 100 500 Imelstat sodium, µM 50 0 -2 -1 9 25 43 25 0 -8 -7 -3 2 33 10 0 -6 -7 -4 -7 6 0 0 0 0 0 0 0

Dot plots of flow cytometric data for MOLM-13 cells after 96 hours of treatment with imetelstat sodium and/or ABT-199 are shown in FIG. 6A, with a plot of % apoptotic cells (double labeling) versus concentration of ABT-199 at different concentrations of sodium imetelstat shown in FIG. 6B. MOLM-13 is sensitive to ABT-199 at 96 h (>30% cell death at 5, 20, 100 and 500 nM) and sensitive to sodium imetelstat (>30% at 10, 25 and 50 µM). At all concentrations of the combined treatment with ABT-199 plus imetelstat sodium, an increase in cell killing was observed. Greater than 90% cell death was observed at the lowest concentration of sodium imetelstat (10 μM) when combined with the highest concentration of ABT199 (500 nM). Greater than 90% cell death was also observed at 100 and 50 nM ABT-199 concentrations in combination. At the highest concentration of sodium imetelstat (50 μM), almost complete cell death was observed at ABT-199 concentrations of 5, 10, 20, 100, and 500 nM. In table. 13 and 14 show combined effect calculations using HSA or BLISS models to treat MOLM-13 cells at 96 h.

Table 13. Overshoot vs. Highest Effect of a Single Agent on Cells

MOLM-13 after 96 hours with AVT-199 and sodium imetelstat

Exceeding HSA AVT-199, nM 0 1 5 20 100 500 Imelstat sodium, µM 50 0 26 41 49 49 50 25 0 14 26 33 46 58 10 0 10 AND 23 25 56 0 0 0 0 0 0 0

Table 14. Overshoot versus highest single agent effect for MOLM-13 cells at 96 h with ABT-199 and imetelstat sodium

Overstaying with BLISS AVT-199, nM 0 1 5 20 100 500 Imelstat sodium, µM 50 0 13 23 26 27 32 25 0 -1 4 AND 23 37 10 0 -8 -7 7 9 37 0 0 0 0 0 0 0

Dot plots of flow cytometry data for MOLM-13 cells are shown after treatment at 48 h (Fig. 7A) or 96 h (Fig. 8A) with incompletely complementary or non-complementary oligonucleotides and ABT-199. Graphs of % apoptotic cells (double labeling) versus ABT-199 concentration at different concentrations of oligonucleotides are shown for 48 h (FIG. 7B) or 96 h (FIG. 8B). Models of HSA excess (Tables 15 and 17) and Bliss excess (Tables 16 and 18) confirm no effect with oligonucleotide controls. Negative values do not indicate antagonism in these patterns, only lack of interaction.

- 22 040521

Table 15 Surplus over HSA for MOLM-13 cells at 48 h with non-complementary or incompletely complementary controls

Exceeding HSA AVT-199, nM 0 1 5 20 100 500 Incompletely complementary, µM 50 0 -4 -1 4 -1 3 25 0 0 -1 1 0 5 Non-complementary, µM 50 0 1 0 5 6 3 25 0 -1 -2 0 -1 -2

Table 16. BLISS overscaling for MOLM-13 cells at 48 h with non-complementary or incompletely complementary controls

Overstaying with BLISS AVT-199, nM 0 1 5 20 100 500 Incompletely complementary, µM 50 0 -10 -7 -2 -6 -1 25 0 -6 -7 -5 -6 0 Non-complementary, µM 50 0 -8 -9 -3 -2 -4 25 0 -8 -9 -7 -8 -8

Table 17 Surplus over HSA for MOLM-13 cells at 96 h with non-complementary or incompletely complementary controls

Exceeding HSA AVT-199, nM 0 1 5 20 100 500 Incompletely complementary, µM 50 0 -22 -32 -39 -37 -32 25 0 -15 -26 -33 -29 -17 Non-complementary, µM 50 0 -18 -24 -31 -40 -33 25 0 -10 -22 -28 -21 -16

Table 18. BLISS overscaling for MOLM-13 cells at 96 h with non-complementary or incompletely complementary controls

Exceeding the setting with BLISS AVT-199, nM 0 1 5 20 100 500 Incompletely complementary, µM 50 0 -25 -34 -41 -40 -35 25 0 -24 -33 -39 -36 -25 Non-complementary, µM 50 0 -24 -29 -35 -44 -38 25 0 -19 -29 -34 -28 -24

Example 2 Mechanism of Interaction Studies Between Imetelstat Sodium and ABT-199 in Treated Cells

Mechanistically, sodium imetelstat functions mainly by inhibiting the active site of the telomerase enzymatic complex. In this case, the ends of the telomeres, on which the enzyme functions, do not lengthen. Due to the rapid and repetitive cell division of tumor cells, they become vulnerable over time to a progressive reduction in telomeres. When the telomere repair process is blocked, cells gradually approach a crisis and eventually initiate apoptosis (Bruedigam et al., Cell Stem Cell., 15: 775-790 (2014)). Bcl-2 and related family members play a role in the delivery of anti-apoptotic signals to tumor cells. Bcl-2 functions by inhibiting Bax, which is a key mediator in signaling the release of apoptotic factors that cause almost normal programmed cell death. When exposed to these signals, Bax translocates to mitochondria, releasing cytochrome c and other apoptotic factors that lead to activation of the caspase cascade, and which culminates in cell death via the mitochondrial signaling pathway (i.e., non-receptor-mediated -TRAIL, TNFa, etc. .). The presence of Bcl-2 causes blockage of these signals, since Bcl-2 can directly inhibit Bax. Without Bax, apoptotic factors are not released, and cells become independent of apoptotic signals.

- 23 040521

The two pathways converge because the primary protein component of telomerase, hTERT, also has supporting roles in the mitochondrial apoptotic pathway that overlap with Bc12. In addition, Bcl-2 is also known to increase hTERT expression and subsequent telomerase activity, further reducing apoptosis in tumor cells. It has been shown that hTERT is able to intercept Bax before it reaches the mitochondria and trigger a cascade of apoptotic signals. In addition, in mitochondria, hTERT can enhance the inhibitory effect of Bcl-2 on Bax. To further elucidate the mechanism of interaction between imetelstat sodium and ABT-199 in treated cells, hTERT expression was measured by assessing transcription levels using qPCR-RT, and telomerase activity was assessed using protein from lysed cells in a PCR-based TRAP assay.

Transcriptional levels of hTERT

Samples from cellular experiments (and single control agents) were selected for molecular analysis to assess the effects of combinations that contribute to the proposed mechanisms of action. AML cells were grown in Falcon T25 flasks (Corning #353135) in batches of 8 million cells in 8 ml of medium, with a dose of either 50 μM sodium imetelstat, 20 nM ABT-199, 50 μM sodium imetelstat plus 20 nM ABT-199, or without drug, for 48 and 96 hours, similar to previous experiments, and then collected as a cell pellet for lysis and either nucleic acid or protein isolation. Nucleic acids were purified by first lysing the cells with 350 μl RLT buffer (Qiagen #1030963) supplemented with 2-mercaptoethanol (Sigma #63689-100MLF). RNA was purified with an AllPrep RNA/DNA mini kit (Qiagen catalog # 80204) and back transcribed to DNA using the High Capacity cDNA kit ( ThermoFisher catalog # 4368814) and pre-amplified before analysis with TaqMan PreAmp Master Mix ( ThermoFisher catalog # 4384557B). ). Products were analyzed using a proprietary Taq-Man qPCR-RT assay to measure hTERT transcription levels (TaqMan Universal PCR Master Mix - ThermoFisher catalog # 4304437; primer and probe sequences below) using ThermoFisher's ViiA7 real-time PCR system:

hTERT full length forward: 5'-TGTACTTTGTCAAGGTGGATGTGA-3' (SEQ

W NO: 4) hTERT full size reverse: 5'-GCTGGAGGTCTGTCAAGGTAGAG-3' (SEQ GO

NO: 5) hTERT FAM probe: FAM 5'-CGCGTACGACACCAT-3' MGBNFQ (SEQ ID NO:6) where FAM is a fluorescent reporter and MGBNFQ is a quencher.

Bar graphs indicating hTERT expression after 48 and 96 hours of treatment with imetelstat sodium and/or ABT-199 are shown in FIG. 9. RNA expression levels measured by qPCR-RT are shown as percentage of untreated controls at the same exposure time. The results show that KG-1 cells have a minimal decrease (90-95% compared to control at any time point) in hTERT RNA levels when treated with ABT-199, and MOLM-13 cells show only a slight decrease in hTERT transcription levels after 96 h dosing (about 69% compared to control). Imetelstat sodium treatment showed greater reduction in RNA levels for both cell lines, with lower expression at longer treatment times (KG-172% control cells at 48 h and 47% control at 96 h; MOLM13-39% cells at 48 h to an undetectable level after 96 hours). For the combination of sodium imetelstat and ABT-199, hTERT expression did not change compared to the single agent, sodium imetelstat, for KG-1. For MOLM-13, hTERT was undetectable at both times.

hTERT enzyme levels

Samples from the previous section for protein analysis were collected as cell pellets by centrifugation for 5 min at 1500K for lysis and protein isolation. Protein lysates were analyzed using a modified method combined from two primary sources (Hou et al. (2001) 43(3) 519-524 and Nature Protocols (2006) 1 (3) 1583-1590). Lysates were prepared by adding 80 µl 10 mM Tris-EDTA, 1% NP-40, 10% glycerol, 150 mM NaCI, 1 mM MgCl ₂ , 250 µM sodium deoxycholate, 100 µM AEBSF, 5 mM 2-mercaptoethanol buffer and incubation on ice within 30 min. The lysates were centrifuged for 15 min at maximum speed and at 4°C to precipitate cell debris. Protein yield from purified lysates was quantified using the BCA assay (ThermFisher catalog # 23252) and subjected to TRAP qPCR analysis for relative telomerase activity (Power SYBR Green PCR Master Mix - ThermFisher catalog # 4367659) using the ViiA7 real-time PCR system from ThermoFisher . In this assay, protein lysates are exposed to synthetic oligonucleotides mimicking telomeric sequences in the presence of excess dNTPs and SYBR green dye. The more telomerase activity, the more extension of synthetic primers and hence more staining.

- 24 040521 nucleic acid and the signal generated by the SYBR dye. This signal is compared to a standard curve of a control protein lysate to determine the relative telomerase activity among the samples.

Forward primer: 5' - AATCCGTCGAGCAGAGTT - 3' (SEQ W NO:7)

Reverse primer: 5' - GCGCGGCTTACCCTTACCCTTACCCTAACC - 3' (SEQ W NO: 8)

Results on molecular interactions

Bar graphs indicating telomerase activity after 48 and 96 hours of treatment with sodium imetelstat and/or ABT-199 are shown in FIG. 10. After 48 hours, ABT-199 had no effect on telomerase activity in both KG-1 cells and MOLM-13 cells when used as the sole agent. After 96 hours of treatment with ABT-199, telomerase activity was reduced to about 80% in KG-1 and about 70%, indicating that ABT-199 had little effect on telomerase activity. Imelstat sodium demonstrated a decrease in telomerase activity in KG-1 and MOLM-13 cell lines. In MOLM-13 cells, the reduction from control was comparable at both time points (37% at 48h, 44% at 96h). KG-1, however, showed a greater decrease in telomerase activity with imetelstat sodium treatment after 96 hours (64% at 48 hours, 16% at 96 hours). In combined treatment, KG-1 showed minimal differences from sodium imetelstat as the sole agent, whereas in MOLM-13, the reduction in telomerase activity was virtually undetectable by PCR analysis.

Example 3. Finding out the synergy of the combination

Treatment of the model cell line MOLM-13 of AML tumor cells was repeated in the experimental format described in Example 1 with the following changes: the compounds imetelstat sodium, incompletely complementary control and non-complementary control were tested at higher concentrations from 0 to 75 μM (seven concentrations in total) and ABT-199 was tested at concentrations of 20 pM - 1 μM (nine concentrations in total). Treated cells were analyzed by flow cytometry for staining with annexin V and propidium iodide as described previously.

Results collected from the apoptotic population (V+ annexations/propidium+ iodide) were used to determine synergy scores for the combination matrix. These combinations were analyzed using the Horizon Chalice™ Analyzer Software (Horizon Discovery Group, Cambridge, UK). Additionally, an in vitro experiment was performed with MOLM-13 as well as the HL-60 cell line to evaluate the synergy of imetelstat sodium plus ABT-199 at a single exposure to the combination (ie, without repeated administration after 48 hours). Dose ranges of ABT-199 were slightly modified (500 pM - 100 nM, five concentrations in total) and compared with equivalent data points in the experiment described above, where cells were dosed a second time 48 hours later. Incompletely complementary and complementary controls were not used in this experiment.

For statistical evaluation of the effects observed in treated MOLM-13 cells, dosage combinations were evaluated using the web-based Horizon Chalice™ Analyzer Software, which aggregates raw data from isobolic analysis with a fixed dosing ratio according to the method of Chou and Talalay (Chou TC, Talalay P., Adv Enzyme Regul 1984; 22:27-55). The combination modes are subjected to isobolar analysis to generate a combination index and a graphical representation of the behavior of the combination, with synergistic pairs falling below the isobologram and antagonistic pairs falling above it (additive combinations are expected to hit the line). The Horizon Chalice™ Analyzer software additionally provides a synergy score, with values greater than 1 indicating synergy.

A graph of % apoptotic cells (double labeling) versus concentration of ABT-199 at different concentrations of sodium imetelstat for 48 hours treatment is shown in FIG. 11. in the table. 19 shows the excess additivity calculations (Loewe model) for each combination for MOLM-13 cells after 48 hours of treatment. Values greater than zero are in the upper right quadrant of the table. 19, where ABT-199 concentrations are greater than or equal to 20 nM and sodium imetelstat concentrations are greater than or equal to 25 μM. The Horizon Chalice™ Analyzer software additionally provides a synergy score, with values greater than 1 indicating synergy. For cells treated with sodium imetelstat, after 48 hours, the synergy score was found to be 5.12. This is compared to scores of 0.22 and 0.41 for incompletely complementary and non-complementary controls (Tables 20 and 21), respectively. A graph of % apoptotic cells (double labeling) versus concentration of ABT-199 at different concentrations of sodium imetelstat for 48 hours treatment is shown in FIG. 12A and 12B for incompletely complementary and non-complementary controls, respectively.

- 25 040521

Table 19. Additivity Exceedance Calculations (Loewe Model) for 48 Hour Treatment with Sodium Metelstat

Excess Loewe; Synergy score = 5.12 Imelstat sodium, µM 0 1 5 10 25 50 75 AVT-199, nM 1000 -4 -2 -3 3 45 56 56 500 5 10 1 2 44 54 54 100 5 9 12 6 33 51 54 20 0 1 4 1 22 40 51 5 -4 -1 -4 0 7 25 39 1 1 0 -1 -5 -4 6 24 0.2 3 5 7 1 -1 2 14 0.04 13 10 10 9 0 1 8 0 9 7 1 -4 4 2

Table 20. Calculations of excess additivity (Loewe model) for 48-hour treatment with incompletely complementary control

Excess Loewe; Synergy score = 0.22 Incompletely complementary, µM 0 1 5 10 25 50 75 AVT-199, nM 1000 -4 1 -1 -1 -AND -16 -16 500 5 4 3 -4 -10 -15 -14 100 5 1 2 -3 -9 -16 -19 20 0 2 3 -4 -9 -16 -18 5 -4 -8 -9 -7 -13 -12 -13 1 1 0 -2 -3 -4 0 2 0.2 3 5 2 1 2 0 0 0.04 13 7 4 3 2 2 0 0 4 2 -1 1 0 0

Table 21. Calculations of excess additivity (Loewe model) for 48-hour treatment with non-complementary control

Excess Loewe; Synergy score = 0.41 Non-complementary, µM 0 1 5 10 25 50 75 n - Os' 1000 -4 -4 -4 -7 -12 -15 -6 500 5 0 7 6 -1 -7 -7 100 5 9 6 6 0 -8 -eleven 20 0 3 -1 -5 -7 -5 -8 5 -4 -7 -6 -6 -8 -10 -6 1 1 3 0 -1 -3 -2 -3 0.2 β 6 3 0 0 -1 2 0.04 13 8 6 2 2 -1 2 0 6 -1 -2 -1 -2 1

A graph of % apoptotic cells (double labeling) versus concentration of ABT-199 at various concentrations of sodium imetelstat for a 96 hour treatment is shown in FIG. 13. in the table. 22 shows calculations of excess additivity (Loewe model) for each combination for MOLM-13 cells after 96 hours of treatment. Values greater than zero are in the upper right diagonal of the table. 19. Surprisingly, even the lowest concentrations of ABT-199 (0.04 and 0.2 nM) show synergism with sodium imetelstat at 50 and 75 µM sodium imetelstat, respectively, and the lowest concentrations of sodium imetelstat (1 and 5 µM) show synergism with AVT-199 at 500 and 100 nM, respectively. The Horizon Chalice™ Analyzer software additionally provides a synergy score, with values greater than 1 indicating synergy. For cells treated with sodium imetelstat, after 96 hours, the synergy score was found to be 11.33. This is compared to scores of 0.03 and 0.06 for incompletely complementary and non-complementary controls (Tables 23 and 24), respectively. A graph of % apoptotic cells (double labeling) versus ABT199 concentration at various concentrations of sodium imetelstat for a 96 hour treatment is shown in FIG. 14A and 14B for incompletely complementary and non-complementary controls, respectively.

- 26 040521

Table 22. Excess Additivity Calculations (Loewe Model) for 96 Hour Treatment with Sodium Metelstat

Excess Loewe; Synergy score = 11.33 Imelstat sodium, µM 0 1 5 10 25 50 75 AVT-199, nM 1000 -1 5 26 61 71 65 61 500 4 10 24 63 70 65 61 100 0 3 12 38 70 64 61 20 -7 -2 6 22 69 64 59 5 -2 -3 -1 6 19 64 55 1 1 6 0 -1 -1 38 56 0.2 4 4 1 -2 -5 13 53 0.04 9 9 6 0 -5 0 36 0 6 3 -1 -5 -2 5

Table 23. Calculations of excess additivity (Loewe model) for 96-hour treatment with ______________ incompletely complementary control ______________

Excess Loewe; Synergy score = 0.33 Incompletely complementary, µM 0 1 5 10 25 50 75 AVT-199, nM 1000 -1 -2 -3 -6 -13 -12 -14 500 4 -4 0 -5 -14 -12 -10 100 0 -2 0 -3 -19 -9 -13 20 -7 -3 -4 -4 -5 -7 -5 5 -2 -6 -5 -6 -8 -6 1 1 1 -1 -1 -3 -5 -2 2 0.2 4 2 2 2 -1 1 3 0.04 9 3 2 1 -1 -2 0 0 1 0 -1 -2 -1 1

Table 24. Calculations of excess additivity (Loewe model) for 96-hour treatment with non-complementary control

Excess Loewe; Synergy score = 0.06 Non-complementary, µM 0 1 5 10 25 50 75 AVT-199, nM 1000 -1 4 -7 -9 -16 -21 -23 500 4 3 -5 -10 -16 -21 -22 100 0 -2 -4 -5 -10 -19 -19 20 -7 -4 -2 -5 -3 -14 -17 5 -2 0 -6 -4 -5 -5 -10 1 1 3 0 -1 0 -2 -2 0.2 4 1 0 -1 -2 -3 -1 0.04 9 1 -1 1 1 -1 -4 0 1 0 -1 -1 -1 1

Apoptotic population (double-labeling) 96 hours after single dose treatment is shown for MOLM-13 (FIG. 17A) and AML cell line HL-60 (FIG. 17B). In this experiment, a smaller dose range of ABT-199 was used to evaluate the effectiveness of co-treatment with imetelstat sodium. in table. 25 shows the excess additivity calculations (Loewe model) calculated using the Horizon Chalice™ Analyzer software for each combination of MOLM-13, while Table. 26 - for HL-60. Despite synergism in both lines, higher synergy was observed in MOLM-13, as evidenced by both a higher score and an enhanced effect on apoptosis at lower (5 and 10 µM) concentrations of sodium imetelstat. The combination with sodium imetelstat shows promise with ABT-199 concentrations up to doses of 1-5 nM.

- 27 040521

Table 25. Calculations of excess additivity (Loewe model) for 96-hour treatment with a single dose of sodium have a test for MOLM-13

Excess Loewe; Synergy score = 3.24 Imelstat sodium, µM 0 5 10 25 50 75 AVT-199, nM 100 -1 10 thirty 62 69 69 20 5 14 25 43 60 67 5 -3 4 9 24 26 48 1 0 3 5 9 12 15 0.5 0 -1 0 3 2 5 0 13 1 -2 1 1 0

Table 26. Calculations of excess additivity (Loewe model) for 96-hour treatment with a single dose of sodium have a test for HL-60

Excess Loewe; Synergy score = 1.77 Imelstat sodium, µM 0 5 10 25 50 75 AVT-199, nM 100 0 1 7 29 46 63 20 1 -4 -2 19 45 57 5 0 -1 -2 9 33 49 1 3 2 4 4 9 17 0.5 3 2 2 0 2 7 0 2 1 0 -3 -1 2

For comparison, the data shown in Fig. 13 and used to create the table. 22 were re-analyzed with the Horizon Chalice™ Analyzer software only for the doses used in FIG. 17A and tab. 25. As indicated in the table. 27, the synergy score is almost twice as far (from 11.33 to 6.06) from the upper levels of the ABT-199 titration curve. This score is about twice that (6.06 vs. 3.24) that was obtained after 96 h in the single dose regimen (Table 25), suggesting that the greater synergy of the combination of AVT-199 with imetelstat sodium is induced with continuous exposure.

Table 27. Additivity Excess Calculations (Loewe Model) for 96 Hour Treatment, Redosed at 48 for MOLM-13 (Recreated from Fig. 13)

Excess Loewe; Synergy score = 6.06 Imelstat sodium, µM 0 5 10 25 50 75 AVT-199, nM 100 2 14 40 69 63 60 20 -4 8 25 67 63 58 5 0 1 8 18 63 53 1 4 2 0 -2 37 54 0 4 0 -6 -1 4

Example 4 Telomerase Inhibitor Imetelstat Sodium in Combination with BCL-2

Venitoclax inhibitor enhances ex vivo apoptosis in AML patient samples

Acute myeloid leukemia (AML) is an aggressive cancer with limited treatment options other than chemotherapy, so therapeutic agents are needed to meet this unmet need. Both hTERT, the catalytic subunit of telomerase, and BCL-2, a regulator of apoptosis, are overexpressed in AML, correlated with disease severity and poor prognosis, respectively. Imelstat sodium is the first in its class competitive telomerase inhibitor with clinical activity in hematological malignancies. Venitoclax (AVT-199), an approved BCL-2 inhibitor for CLL patients who have a 17p deletion and who have received at least one prior therapy, has demonstrated promising clinical benefit in patients with AML.

The study in this example examined the effect of imetelstat sodium or venitoclax alone, or in combination, on AML cells in vitro.

AML cell lines (see Example 1) and patient peripheral blood mononuclear cell (PBMC) samples, which were obtained from whole blood of AML patients after purification by Ficoll, were treated with sodium imetelstat alone or venitoclax, or both in combination, and method flow cytometry examined viable and apoptotic cell populations. Telomerase activity, hTERT expression, and mitochondrial dysfunction were studied by the mechanism of action. PBMC of AML patients were dosed with imetelstat sodium (0, 25 and 50 μM), venitoclax (AVT-199) (0, 20 and 100 nM), or a combination thereof, for either 16 or 40 h. Apoptosis was measured by flow cytometry, with stained with annexin V and propidium iodide. Unstained (ie, double negative) cells are viable cells remaining after treatment.

- 28 040521

Specifically, whole blood from AML patients (n = 4) was purified using Ficoll-Paque Plus (GE Healthcare catalog # 17-1440-03) to isolate PBMCs. Ficoll was loaded into 50 ml SepMate centrifuge tubes (StemCell Technologies catalog # 85450) and the patient's blood was pre-diluted with phosphate-buffered saline (PBS; ThermoFisher catalog # 20012-027) supplemented with 2% fetal bovine serum (FBS) with HyClone FBS (№ SH30070.02 ThermoFisher catalog) 1:1 before loading over ficoll. Blood was centrifuged to separate PBMCs from erythrocytes, granulocytes, etc., and the remaining PBMCs were washed twice with PBS + 2% PBS. Cells were plated at a density of about 300,000 cells/well in 96-well polystyrene U-bottom tissue culture plates (Corning #353777) in RPMI-1640 (ThermoFisher #11875-085) supplemented with 10% HyClone FBS mentioned above and grown. in an incubator with 37°C in a humidified atmosphere with 5% CO ₂ . Antibiotics were not used with ex vivo PBMCs. Cells were immediately treated with sodium imetelstat (Janssen Biotech, Inc.) prepared in RPMI-1640 supplemented with 10% FBS and/or ABT-199 (Selleckchem catalog # S8048) prepared as a 1000x stock solution in DMSO, diluted 1:100 in the FSB (carrier). Imelstat sodium was tested from 0 to 50 µM, and venitoclax (AVT199) was tested from 0 to 100 nM.

After 16- and 40-hour treatment, cells were checked for healthy, early apoptotic and apoptotic populations using the flow cytometric assay kit with annexin V (stains the inside of the cell membrane) and propidium iodide (PI, a DNA-binding dye) (catalog #640914 BioLegend) as described in Example 1. In addition, PBMCs were stained for the following differentiation markers: CD45 (conjugated to V500; BD cat. no. 560777), and CD34 (conjugated to Pacific Blue; cat. No. 343512, Biolegend). Results were pooled first for CD45 positivity and then for CD34 positivity before being assessed with Annexin V/propidium iodide as described in Example 1 above. Means and standard deviations were determined for four patients for the CD45+ (leukocyte) and CD45+/CD34+ (leukemic stem cell) populations.

Results of ex vivo treatments

Fig. 15A-15D show the mean response of PBMC samples from four AML patients exposed ex vivo to imetelstat sodium and/or venitoclax (AVT-199). Graphs of % viable cells after treatment for 16 hours for treatment of CD45+ leukocytes and CD45+/CD34+ leukemic stem cells of AML patients with different concentrations of venitoclax (AVT-199) and/or imetelstat sodium are shown in FIG. 15A (CD45+ leukocytes) and 15B (CD45+/CD34+ leukemic stem cells). Graphs of % viable cells after treatment for 40 hours for treatment of CD45+ leukocytes and CD45+/CD34+ leukemic stem cells of AML patients with various concentrations of venitoclax (AVT-199) and/or imetelstat sodium are shown in FIG. 15C (CD45+ leukocytes) and 15D (CD45+/CD34+ leukemic stem cells). In general, viability of CD45+ leukocytes derived from AML patients was generally unaffected by treatment with imetelstat sodium alone, and was only moderately affected by venitoclax as a single agent after 16-hour and 40-hour exposure. However, when imetelstat sodium was used in combination with venitoclax, a decrease in cell viability was observed. Similar results were observed for the CD45+/CD34+ leukemic stem cell population; noted a dose-dependent activity in the form of a decrease in cell viability when imetelstat sodium was used in combination with venitoclax, at both control points in time, and it was the strongest after 40 hours. combined with venitoclax (see example 1). For example, for the MOLM-13 cell line, imetelstat sodium and venitoclax alone had a moderate apoptotic effect at 48 h (22 and 30%, respectively), but in combination reached 88% at 48 h and almost 100% at 96 h. was also observed in samples from four patients with AML. Molecular analysis showed that the combination of imetelstat sodium with venitoclax reduced hTERT expression and telomerase activity more than either of these drugs alone. This example demonstrates that the combination of imetelstat sodium with venitoclax in AML has a synergistic effect on the induction of apoptosis in cell lines and in vitro patient samples.

Example 5 The Telomerase Inhibitor Imetelstat Sodium in Combination with the BCL-2 Inhibitor Venitoclax Improves In Vivo Survival in Acute Myeloid Leukemia

As discussed in Example 4, acute myeloid leukemia (AML) is an aggressive cancer with limited treatment options other than chemotherapy, and therefore curative agents are needed. In Example 4, the telomerase inhibitor imetelstat sodium in combination with the BCL-2 inhibitor venitoclax was shown to enhance apoptosis in vitro. The study in this example examined the effect of imetelstat sodium or venitoclax alone or in combination in an in vivo model of acute myeloid leukemia.

Ways

To evaluate efficacy and survival, an in vivo study was conducted in the MOLM-13 mouse model of disseminated AML. In particular, on day 0 of the study, tumor cells

- 29 040521

MOLM-13 AML were implanted in mice. Mice were treated for 31 days with: (i) vehicles (MM+PEG400/Phosal50/ETOH); (ii) imetelstat sodium (30 mg/kg), (iii) venitoclax ABT-199 (100 mg/kg), (iv) MM (incompletely complementary oligonucleotide control) (30 mg/kg) and ABT-199 (100 mg/kg) kg); and (v) sodium imetelstat (30 mg/kg) and ABT-199 (100 mg/kg). The survival rate of mice was evaluated as a function of time (days after tumor cell implantation). The study lasted a total of 108 days (77 days after stopping treatment).

Fifty female SCID-beige mice (6 weeks of age, Jackson Laboratory) were intravenously injected with 1 million MOLM-13 cells and divided randomly into five groups. On the first day after injection, mice were treated with any of the five regimens listed in Table 1. 28.

Table 28. Treatment regimen of SCID-beige mice inoculated with MOLM-13 in a disseminated AML model

Group Medicine Dose η Route of administration Scheme of introduction 1 Media: MM 30 mg/kg 10 ip TRN x 4 weeks PEG400, Phosal50, ETON RO qd (7x) x 4 weeks 2 imetelstat sodium 30 mg/kg 10 ip TRN x 4 weeks 3 venitoclax (AVT-199) 100 mg/kg 10 RO qd (7x) x 4 weeks 4 MM 30 mg/kg 10 ip TRN x 4 weeks venitoclax (AVT-199) 100 mg/kg RO qd (7x) x 4 weeks 5 imetelstat sodium 30 mg/kg 10 ip TRN x 4 weeks venitoclax (AVT-199) 100 mg/kg RO qd (7x) x 4 weeks

Abbreviations: ip - intraperitoneally; ro - orally; TRN - three times a week; QD once a day; mg/kg, milligram of drug per kilogram of animal weight

Mice were examined daily and body weights were measured twice a week. The survival of mice in each group was monitored. The study was terminated on the 108th day, that is, 77 days after the last treatment. Extended life expectancy (ELS) was assessed for each group, and % LLS compared to control was calculated as:

where T is the median survival of the treated group and C is the median survival of the control group.

Results of the in vivo study

A Kaplan-Meier survival plot for the MOLM-13 AML model with dissemination at day 108 is shown in FIG. 16. In particular, FIG. 16 shows the survival percentage of mice as a function of day after tumor cell implantation. Median survival and % life expectancy (LLS) calculated for different treatment groups are shown in Table 1. 29. The results show that the median survival time for mice treated with imetelstat sodium as the only agent was 26.5 days, corresponding to 20.4% LLL (p = 0.0009) compared with vehicle. Treatment with venitoclax (AVT-199) as the only agent resulted in a median survival of 30 days and 36.3% life expectancy (p<0.0001). ABT-199, in combination with an incompletely complementary (MM) oligo control, showed similar effects to ABT-199 alone: the median survival time was 31 days and 40.9% life expectancy (p<0.0001). The combination of imetelstat sodium with AVT-199 gave the best result with a median survival time of 37 days and a significant efficacy of 68.1% LLL (p<0.0001). In addition, four mice (40%) from this combination treatment group lived long lives to more than 108 days, demonstrating a beneficial increase in survival.

- 30 040521

Table 29. Median survival time and percentage increase in lifespan (% LS; compared with control) of MOLM-13 implanted mice treated with imetelstat sodium and/or venitoclax (AVT-199) or MM (non-matching oligonucleotide control)

Group Median survival (days) %PLL R Media: MM 22 — — imetelstat sodium 26.5 20.4 0.0009 AVT-199 thirty 36.3 0.0001 MM+ABT-199 31 40.9 0.0001 sodium imetelstat+AVT-199 37 68.1 0.0001

All mice tolerated the combination of imetelstat sodium with venitoclax, and increased survival was observed compared to imetelstat sodium alone (39.6%, p = 0.0011) or venitoclax alone (23.3%, p = 0.0001).

In the combination group, 40% of the treated mice were alive 77 days after cessation of treatment, demonstrating a significant survival advantage with potential cure. The results of this example, as well as example 4, demonstrate that the combination of imetelstat sodium with venitoclax in AML has a synergistic effect on the induction of apoptosis in cell lines and in vitro patient samples, which translates into extended survival and potential cure in xenograft models.

Equivalents and inclusion by reference

Although the present invention has been described with reference to specific embodiments thereof, those skilled in the art will appreciate that various changes may be made and equivalents may be substituted without departing from the scope of the invention. In addition, many modifications can be made to tailor a particular state, material, composition of matter, process, process step or process steps to achieve the benefits provided by this invention without departing from the scope of this invention. All such modifications are intended to be within the scope of the appended claims.

All publications and patent documents cited in this document are incorporated herein by reference as if each such publication or document were specifically and separately indicated for inclusion in this document by reference. The citation of publications and patent documents is not intended to indicate that any such document is prior art and does not constitute any admission as to its content or date.

Claims (31)

1. A method for the treatment of acute myeloid leukemia comprising administering imetelstat and ABT-199 to a subject with acute myeloid leukemia. 2. The method according to claim 1, characterized in that the imetelstat is sodium imetelstat. 3. The method according to claim 1 or 2, characterized in that imetelstat is administered for 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 dosing cycles, and each cycle includes: (a) intravenous administration of about 7-10 mg/kg imetelstat once every four weeks; (b) intravenous administration of about 7-10 mg/kg imetelstat once a week for four weeks; or (c) intravenous administration of about 2.5-7 mg/kg imetelstat once every three weeks; or (d) intravenous administration of about 0.5-9.4 mg/kg imetelstat once every four weeks. 4. The method according to claims 1-3, characterized in that AVT-199 is administered at a dose of: (a) 50-400 mg ABT-199 daily; (b) 2 mg AVT-199 on Day 1, increased daily to a final dose of 800 mg on Day 6 and daily thereafter, or (c) 25 mg AVT-199 on Day 1, increased daily to a final dose 400 mg on the 5th day and thereafter daily. 5. The method according to claims 1-4, characterized in that the administration of AVT-199 is carried out one day before, one day after or on the same day when imetelstat is administered. 6. Use of imetelstat or imetelstat sodium for the treatment of acute myeloid leukemia in a patient being treated with ABT-199 or a pharmaceutically acceptable salt thereof. 7. Use of ABT-199 or a pharmaceutically acceptable salt thereof for the treatment of acute myeloid leukemia in a patient treated with imetelstat or imetelstat sodium. - 31 040521 8. Use according to claims 6, 7, wherein the imetelstat is sodium imetelstat. 9. Use according to claims 6-8, wherein imetelstat is administered for 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 dosing cycles, with each cycle including: (a) intravenous administration of about 7-10 mg/kg imetelstat once every four weeks; (b) intravenous administration of about 7-10 mg/kg imetelstat once a week for four weeks; c) intravenous administration of about 2.5-7 mg/kg of imetelstat once every three weeks; or (d) intravenous administration of about 0.5-9.4 mg/kg of imetelstat once every four weeks. 10. Use according to claims 6-9, and AVT-199 is intended for administration at a dose of: (a) 50-400 mg ABT-199 daily; (b) 2 mg AVT-199 on Day 1, increased daily to a final dose of 800 mg on Day 6 and daily thereafter, or (c) 25 mg AVT-199 on Day 1, increased daily to a final dose 400 mg on the 5th day and thereafter daily. 11. Use according to claims 6-10, wherein the administration of AVT-199 is possible one day before, one day after or on the same day when imetelstat is administered. 12. The use of a combination containing imetelstat and ABT-199 for the treatment of acute myeloid leukemia in a patient. 13. Use according to claims 6 to 12, wherein the imetelstat is sodium imetelstat. 14. Use according to claims 12, 13, wherein imetelstat is administered for 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 dosing cycles, with each cycle including: (a) intravenous administration of about 7-10 mg/kg imetelstat once every four weeks; (b) intravenous administration of about 7-10 mg/kg imetelstat once a week for four weeks; or c) intravenous administration of about 2.5-7 mg/kg imetelstat once every three weeks; or (d) intravenous administration of about 0.5-9.4 mg/kg imetelstat once every four weeks. 15. Use according to claims 12-14, and AVT-199 is intended for administration at a dose of: (a) 50-400 mg ABT-199 daily; (b) 2 mg AVT-199 on Day 1, increased daily to a final dose of 800 mg on Day 6 and daily thereafter, or (c) 25 mg AVT-199 on Day 1, increased daily to a final dose 400 mg on the 5th day and thereafter daily. 16. Use according to claims 12-15, wherein the administration of AVT-199 is possible one day before, one day after or on the same day when imetelstat is administered. 17. Use according to claims 12, 13, wherein the combination is a pharmaceutical composition. 18. The use of imetelstat and AVT-199 in the preparation of a drug for the treatment of acute myeloid leukemia. 19. Use according to claim 16, wherein the imetelstat is sodium imetelstat. 20. Use according to claims 12-15, wherein the combination of imetelstat and ABT-199 induces apoptosis of acute myeloid leukemia cells. 21. The use of imetelstat sodium for the treatment of acute myeloid leukemia (AML) comprising administering imetelstat sodium and ABT-199 in combination to a subject in need thereof. 22. The use of ABT-199 for the treatment of acute myeloid leukemia (AML) comprising administering a combination of ABT-199 and imetelstat sodium to a subject in need thereof. 23. The use according to any one of claims 21, 22, wherein imetelstat sodium is intended to be administered for 1, 2, 3, 4, 5, 6, 7, 8 or more than 8 dosing cycles, each cycle includes: (a) intravenous administration of about 7-10 mg/kg imetelstat sodium once every four weeks; (b) intravenous administration of about 7-10 mg/kg imetelstat sodium once a week for four weeks; (c) intravenous administration of about 2.5-7 mg/kg imetelstat sodium once every three weeks; or (d) intravenous administration of about 0.5-9.4 mg/kg imetelstat sodium once every four weeks. 24. Use according to any one of claims 21-23, moreover, ABT-199 is intended for administration at a dose of: (a) about 50-400 mg of ABT-199 daily; (b) about 2 mg of ABT-199 on Day 1 with daily increases to a final dose of about 800 mg on Day 6 and daily thereafter, or (c) about 25 mg of ABT-199 on Day 1 with daily increases to a final dose of about 400 mg on day 5 and daily thereafter. 25. The use according to any one of claims 21-24, wherein the administration of ABT-199 is carried out one day before, one day after or on the same day when imetelstat sodium is administered. 26. An in vitro method for inducing apoptosis in an acute myeloid leukemia (AML) cell, comprising contacting the cell with a therapeutically effective amount of imetelstat and bringing into - 32 040521 cell contact with a therapeutically effective amount of ABT-199. 27. The method according to claim 26, wherein the imetelstat is sodium imetelstat. 28. Kit for the treatment of acute myeloid leukemia, containing: (a) a dose of imetelstat in an amount effective when administered to induce apoptosis of acute myeloid leukemia cells; (b) a dose of ABT-199 or a pharmaceutically acceptable salt thereof in an amount effective when administered to induce apoptosis of acute myeloid leukemia cells. 29. The kit according to claim 28, characterized in that the imetelstat is sodium imetelstat. 30. Pharmaceutical composition for the treatment of acute myeloid leukemia containing imetelstat and ABT-199. 31. Pharmaceutical composition according to claim 30, characterized in that imetelstat is sodium imetelstat.