RU2758269C1 - Escherichia coli strain with the inactivated lysp gene - l-threonine producer - Google Patents

Abstract

FIELD: microbiology.

SUBSTANCE: proposed is an Escherichia coli strain RNCIM B-13774 with the inactivated lysP gene, constituting an L-threonine producer.

EFFECT: invention provides a possibility of expanding the range of Escherichia coli strains producing L-threonine.

1 cl, 1 dwg, 1 tbl, 2 ex

Description

The present invention relates to the microbiological industry, in particular, to the microbiological synthesis of the amino acid L-threonine using a bacterium of the species Escherichia coli.

Traditionally, L-amino acids are produced on an industrial scale by fermentation of producer strains. Microorganisms isolated from natural sources and their derivatives are used as producers (US 4278765).

An increase in the production of L-amino acids is achieved by increasing the activity of enzymes involved in the biosynthesis of amino acids and / or decreasing the sensitivity of the target enzyme to inhibition by the final product - produced by the L-amino acid (WO 9516042, US 5661012, US 6040160).

For the production of L-threonine, strains with increased activities of enzymes involved in the biosynthesis of L-threonine are used (US 5175107; US 5661012; US 5705371; US 5939307; EP 219027), strains resistant to L-threonine and its analogs (WO 0114525, EP 301572, US 5376538), strains with inactivated enzymes of the L-threonine degradation system (US 5939307 and US 6297031), strains in which the sensitivity of the target enzyme to inhibition by the produced amino acid or its byproducts by the feedback type is eliminated (US 5175107 and US 5661012) ...

Known E. coli L-threonine-producing strain VKPM B-3996 (SU 1694643, US 5175107 and US 5705371), obtained by introducing the following mutations and plasmids into the E. coli strain VKPM B-7:

- mutant thrA gene (thrA ⁴⁴² mutation), which encodes the protein aspartokinase-homoserine dehydrogenase I, resistant to feedback inhibition by L-threonine;

- mutant gene ilvA (mutation ilvA ⁴⁴² ), which encodes a protein threonine deaminase, which has a reduced activity, which is expressed in a reduced level of biosynthesis of L-isoleucine, and in the phenotype a lack of L-isoleucine of the "leaky"type; in the presence of the ilvA ⁴⁴² mutation, transcription of the thrABC operon is not repressed by L-isoleucine, which has a positive effect on the production of L-threonine;

- inactivated tdh gene, which leads to the prevention of degradation of L-threonine,

- genetic determinants of sucrose assimilation (scrKYABR genes);

- plasmid pVTC40 containing the mutant thrA ⁴⁴² BC threonine operon, which provides an increase in the expression of genes that control the biosynthesis of L-threonine.

The E. coli strain VKPM B-3996 during fermentation in test tubes produces 13 g / L of L-threonine (RU 2182173), and when cultured in a fermenter, 85 g / L of L-threonine (US 5175107).

When designing producers, it is also important to search for new target genes, the modification of which leads to an increase in the production of L-threonine.

The technical problem to be solved by the present invention is to expand the arsenal of Escherichia coli strains capable of producing L-threonine.

The problem is solved by the fact that the obtained strain of the bacterium Escherichia coli VKPM B-13 774 with an inactivated gene lysP, which has the ability to produce L-threonine.

The term "lysP gene is inactivated" means that a naturally occurring gene has been modified to encode a mutant protein with reduced activity, or a completely inactive protein. It is also possible that natural expression of the modified DNA region is not possible due to deletion of the target gene or part of it, shift of the reading frame of this gene, or introduction of missense / nonsense mutations or modifications of regions adjacent to the gene that include sequences that control gene expression, such as the promoter ( s), enhancer (s), attenuator (s), ribosome binding site (s), etc.

Gene inactivation is carried out by any possible method, for example, mutagenesis using UV radiation or treatment with nitrosoguanidine (N-methyl-N'-nitro-N-nitrosoguanidine), site-directed mutagenesis, gene inactivation using homologous recombination, and / and insertion-deletion mutagenesis (Yu, D. et al., Proc. Natl. Acad. Sci. USA, 2000, 97:12: 5978-83); (Datsenko K. A. and Wanner B. L., Proc. Natl. Acad. Sci. USA, 2000, 97:12: 6640-45), also called "Red-dependent integration".

In the claimed strain, the lysP gene is inactivated by replacing the open reading frame of this gene with the selectable marker aadA, which is a gene for resistance to speccinomycin.

The invention is illustrated by the following graphical figures:

FIG. 1. Scheme of plasmid pISA.

Example 1. Construction of a strain with an inactivated lysP gene

Gene inactivation is carried out in the Escherichia coli strain VKPM B-13207, which is obtained on the basis of the wild Escherichia coli K-12 MG1655 strain (ATCC 47076) as a result of several stages of mutagenesis with various mutating agents in order to select the mutants most resistant to L-threonine, and subsequent introduction of targeted genetic modifications: replacement of the threonine operon gene promoter, introduction of a desensitizing mutation in the thrA gene, rhtA overexpression, inactivation of the sstT gene, inactivation of the roxB gene encoding pyruvate oxidase.

Deletion of the lysP gene is carried out by replacing its ORF (sequence number according to the GenBank database NC_000913.3 (2247063..2248532), with a selective marker for spectinomycin resistance, by PCR using the following oligonucleotides:

lysPinsF 5'-aatcgtctgctacaatcgcgcctcatttttaagatggatagcatttttgtcagggttttcccagtcacga

lysPinsR 5'-attgaaaaagccctctcggttgagagggcttagcaaggaagggaggaaacatgttgtgtggaattgtgagc

The pISA plasmid is used as a matrix for synthesis (Biotechnology 2019 Vol. 35 No. 4 pp. 42-54). In its composition, this plasmid (Fig. 1) carries the following genetic elements: the aadA gene, which determines the resistance of cells to spectinomycin for direct selection of transformants; phage sequences λ attL and attR - recognition sites of the Int / Xis recombination system; repA - replicon; the bla gene, encoding beta-lactamase, which confers resistance to ampicillin.

The fragment is amplified using KAPA polymerase (KAPAbiosystems) to avoid sequence errors. Use the following temperature profile for PCR: denaturation at 95 ° C for 3 min; 25 cycles: 20 sec at 98 ° C, 20 sec at 60 ° C, 2 min at 72 ° C; and final polymerization: 2 minutes at 72 ° C. PCR product with a size of 2161 bp. purified by extraction from agarose gel and then used to transform the VKPM B-13207 strain, which is previously transformed with the pKD46 plasmid, which is necessary for the integration of the PCR product into the chromosome of the strain. Plasmid pKD46 (Datsenko, K.A. and Wanner, BL, Proc. Natl. Acad. Sci. USA, 2000, 97: 12: 6640-45) contains a λ phage DNA fragment (GenBank accession number J02459) length 2.154 nucleotides (31088-33241), and also contains the Red genes of the homologous recombination system (β, γ, exo genes) under the control of the ParaB promoter; induced by arabinose.

Electrocompetent cells are prepared as follows: an overnight culture of E. coli VKPM B-13207 is grown at 30 ° C in a liquid LB medium (wt%): tryptone - 1, NaCl - 1, yeast extract - 0.5, water - the rest, pH 7.0 with the addition of ampicillin (125 mg / l), diluted 100 times with 5 ml of SOB medium (wt%): tryptone 2, yeast extract - 0.5, MgCl ₂ - 0.0956, MgSO ₄ ⋅ 7H ₂ O - 0.252, NaCl - 0.0058, KCl - 0.0185, water - the rest with the addition of ampicillin (100 mg / l) and L-arabinose (1 mM). The resulting culture is grown with stirring at 30 ° C until the optical density OD _{660 nm is} 0.6 units, then the grown cells are given electrocompetence by concentrating their mixture 100 times and washing three times with ice deionized water. Electroporation is performed using 40 μl of cells and 1 μg of PCR product. After electroporation, cells are incubated in 1 ml of SOC medium (wt%): tryptone 2, yeast extract - 0.5, glucose - 0.36, MgCl ₂ - 0.0956, MgSO ₄ ⋅7H ₂ O - 0.252, NaCl -0 , 0058, KCl - 0.0185, water - the rest at 37 ° C for 2.5 hours, then plated on plates with LA medium (wt%): agar-agar - 2, tryptone - 1, NaCl - 1 , yeast extract - 0.5, water - the rest, pH 7.0 with the addition of spectinomycin (75 μg / ml).

The selection of transformants carrying a deletion in the lysP gene is carried out on plates with LA medium supplemented with spectinomycin. The presence of an insertion at the lysP locus in the selected clones was confirmed by PCR. To amplify the fragment, Taq polymerase (Thermo Fisher Scientific) and the following oligonucleotides are used:

lysP-out-F 5'- ttcagcatgcattcgccaga

lysP-out-R 5'- aagccggaacagcctctgat

The following temperature profile is used for PCR: denaturation at 94 ° C for 4 min; 25 cycles: 20 sec at 94 ° C, 20 sec at 55 ° C, 2 min at 72 ° C; and final polymerization: 5 min at 72 ° C.

Availability of 2386 bp product confirms the integration of the cassette into the target locus. To remove the auxiliary plasmid pKD46, 2 passages are carried out on LA medium with spectinomycin at 42 ° C and the resulting colonies are tested for sensitivity to ampicillin.

As a result, 5 clones with a deletion in the lysP gene were selected.

Example 2. Obtaining the claimed strain by selecting the most productive clone with a lysP deletion

To confirm the effect of deletion of the lysP gene on the production of L-threonine, test-tube fermentation of five selected clones is carried out; the parental strain of E. coli VKPM B-13207 is used as a control strain.

The strains are grown on plates with LA medium for 24 hours at 37 ° C. To prepare the inoculum, use the inoculum medium of the following composition (wt%):

Yeast extract 3.5 Glucose 0.25 NaCl 0.25 KN ₂ RO ₄ 0.25 Water rest

In test tubes with a volume of 50 ml with a working volume of 5 ml of the inoculum medium, the biomass of cells is added to the starting value of optical density equal to OD _660nm 0.1 units. The tubes are incubated on a rotary shaker for 5 hours at 37 ° C and a stirring speed of 220 rpm. For the main fermentation process, a medium of the following composition (wt%) is used:

Glucose 4.0 (NH ₄ ) ₂ SO ₄ 3.0 Corn 1.0 extract KN ₂ RO ₄ 0.25 MgSO ₄ ⋅7H ₂ O 0.2 Lemon 0.0192 acid FeSO _{4 ⋅7H 2} O 0.003 MnSO ₄ ⋅H ₂ O 0.0021 CaCO3 2.0 Water rest

Solutions of glucose, manganese sulfate and magnesium sulfate are sterilized separately by autoclaving at 121 ° C. for 40 minutes. Weighed portions of CaCO ₃ , 40 mg each, are sterilized in glass tubes by autoclaving at 121 ° C for 20 minutes. The pH is adjusted to 7.0. The ferrous sulfate solution is sterilized by filtration through a 22 µm membrane.

The resulting inoculum is introduced into 50 ml test tubes with a working volume of 2 ml of the fermentation medium until the starting optical density OD ₆₆₀ nm is 0.1 units. The cells are cultured for 24 hours at 37 ° C on a rotary shaker (220 rpm).

The amount of L-threonine accumulated in the medium is determined by HPLC (Waters 2695, Alliance). The fermentation results for 5 clones are shown in table.

table

Clones carrying a deletion in the lysP gene L-threonine production, g / l clone 1 16.5 clone 2 16.9 clone 3 17.1 clone 4 16.3 clone 5 16.7 Control - strain E. coli VKPM B-13207 15.1

As can be seen from the table, the greatest amount of L-threonine in comparison with the control E. coli strain VKPM B-13207 accumulates clone 3. The selected clone was deposited in the Bioresource Center All-Russian Collection of Industrial Microorganisms (BRC VKPM) NRC "Kurchatov Institute" - GosNIIgenetika as Escherichia coli VKPM B-13774.

The inventive strain of Escherichia coli VKPM B-13774 is characterized by the following features:

Cultural and morphological characteristics

Gram negative bacteria. The daily culture in a liquid LB medium is represented by weakly motile cells of a round shape, 1 μm in diameter. When cultured on L-agar for 18-24 hours at 37 ° C, it forms round, whitish, translucent colonies of 1-2 mm colonies, the surface of the colony is smooth, the edges are even or slightly wavy, the center of the colonies is raised, the structure is homogeneous, the consistency is pasty , easily emulsifies. When cultivated on Endo agar medium (wt%: peptone - 1, lactose - 1, Na ₂ SO ₃ - 0.33, K ₂ HPO ₄ - 0.25, basic fuchsin - 0.03, agar-agar - 2% , water - the rest) at 37 ° C, colonies are formed, round in shape with a smooth, well-defined edge of a crimson-red color with a metallic sheen. The diameter of the colonies is 0.5-1.5 mm.

Physiological and biochemical characteristics.

Optional anaerobic. Sugar does not ferment. Assimilates: D-glucose, L-arabinose, D-mannitol, D-xylose, to a lesser extent: D-galactose, D-lactose. There is no ability to hydrolyze starch. There is no need for growth factors. The strain is resistant to spectinomycin. The optimum pH for growth is 7.2-7.4. Does not grow at temperatures above 45 ° C. The optimum growth temperature is 37 ° C. The strain is not pathogenic.

Thus, the obtained Escherichia coli strain VKPM B-13774 with an inactivated lysP gene, capable of synthesizing up to 17.1 g / L of L-threonine when cultured in test tubes.

Claims (1)

Escherichia coli strain VKPM B-13774 with an inactivated lysP gene is a producer of L-threonine.

Images