RU2722357C2 - Immunogenic anti-inflammatory compositions - Google Patents

Abstract

FIELD: medicine.SUBSTANCE: invention can be used for treating an individual suffering ulcerative colitis. That is ensured by administering an effective amount of an antigen composition containing whole killed E. coli cells. Composition is applied either intracutaneously or subcutaneously in the form of serially administered doses with a dose interval of at least one hour.EFFECT: invention provides use of an anti-inflammatory composition for treating an ulcerative colitis in an individual.13 cl, 48 dwg, 10 tbl, 13 ex

Description

FIELD OF THE INVENTION

In various aspects, the invention relates to immunological therapy for treating a condition characterized by inflammation. In alternative embodiments, the invention relates to methods for producing antigenic compositions for the treatment of inflammatory conditions.

BACKGROUND

More than one in three people in developed countries is diagnosed with a malignant tumor. More than one in four people die from a malignant tumor. Cancer therapy is mainly based on treatments such as surgery, chemotherapy and radiation. However, such methods, although they are useful in the case of certain types and stages of a malignant tumor, have been shown to have limited effectiveness in the case of many common types and stages of malignant tumors. For example, surgical treatment of a tumor requires complete removal of the malignant tissue to prevent relapse. Similarly, radiation therapy requires the complete destruction of malignant cells. Such a result is difficult to achieve, since theoretically one malignant cell can proliferate enough to cause a relapse of the malignant tumor. Also, surgical treatment and radiation therapy are aimed at localized areas of the malignant tumor and are relatively ineffective when the malignant tumor metastasizes. Often, surgery or radiation is used in combination with systemic methods such as chemotherapy. However, chemotherapy is associated with the problem of indiscrimination and the concomitant problem of harmful side effects, as well as the possibility of the development of resistance of malignant cells to drugs.

The inherent weaknesses of chemotherapy have led to other attempts to involve various aspects of the immune system for the treatment of malignant tumors. Part of this work relates to immunization with microorganism-based vaccines. Although this approach has a relatively long history, as discussed in more detail below, this area is a very confusing mixture of sometimes curious successes and many failures, which together did not lead to the development of a holistic therapeutic approach suitable for widespread use in the clinic.

Alternative approaches to the treatment of malignant tumors included methods of therapy that include enhancing the function of the immune system, such as cytokine therapy (for example, recombinant interleukin 2 and gamma interferon in case of kidney cancer), dendritic cell-based therapy, autologous antitumor therapy vaccine, genetically modified vaccine therapy, lymphocyte-based therapy and microbial vaccine therapy, it being believed that the latter involves the host system in a non-specific manner. Microbial vaccines have been used to vaccinate subjects against pathogens that are associated with a malignant tumor, such as human papillomavirus. Immunostimulating microbial vaccines that are not targeted by organisms that cause malignant tumors, i.e. non-specific immunostimulating vaccines, such as pyrogenic vaccines, have a long clinical history, which includes reports of successes and failures in the treatment of various malignant tumors. For example, Kolya's vaccine (a combination of Streptococcus pyogenes and Serratia marcescens) has been reported to be useful for treating sarcomas and lymphomas (see, for example, Nauts NS, Fowler GAA, Bogato FH. A review of the influence of bacterial infection and of bacterial products [Coley's toxins ] on malignant tumors in man. Acta Med. Scand. 1953; 145 [Suppl. 276]: 5-103). Clinical trials reportedly showed a positive result for treatment with the Kolya vaccine for lymphoma and melanoma (see, for example, Kempin S, Cirrincone C, Myers J et al: Combined modality therapy of advanced nodular lymphomas: the role of nonspecific immunotherapy [MBV] as an important determinant of response and survival. Proc Am Soc Clin Oncol 1983; 24: 56; Kolmel KF, Vehmeyer K. Treatment of advanced malignant melanoma by a pyrogenic bacterial lysate: a pilot study. Onkologie 1991; 14: 411-17).

It has been suggested that the efficacy of certain nonspecific bacterial anti-cancer vaccines is due to specific bacterial components or products, such as bacterial DNA or endotoxin (LPS), or is due to the fact that they induce the expression of specific factors, such as tumor necrosis factor (TNF) or interleukin -12. Accordingly, a wide range of physiological mechanisms were attributed to such treatment methods, ranging from the generalized effects of fever to anti-angiogenic mechanisms. In accordance with these various principles, a wide variety of microbial vaccines have been tested as general immunostimulants for the treatment of malignant tumors. Although most were shown to be negative, several vaccines have been shown to produce interesting results of interest in some contexts, which are discussed below.

Intradermal treatment with BCG vaccine (Mycobacterium bovis) has been reported to be effective in treating gastric cancer (see, for example, Ochiai Τ, Sato J, Hayashi R, et ai: Postoperative adjuvant immunotherapy of gastric cancer with BCG-cell wall endoskeleton. Three-to six -year follow-up of a randomized clinical trial. Cancer Immunol Immunother 1983; 14: 167-171) and colon cancer (Smith RE, Colangelo L, Wieand HS, Begovic M, Wolmark N. Randomized trial of adjuvant therapy in colon carcinoma : 10-Year results of NSABP protocol C-01. J. NCI 2004; 96 [15]: 1128-32; Uyl-de Groot CA, Vermorken JB, Hanna MG, Verboon P, Groot MT, Bonsel GJ, Meijer CJ, Pinedo HM. Immunotherapy with autologous tumor cell-BCG vaccine in patients with colon cancer: a prospective study of medical and economic benefits Vaccine 2005; 23 [17-18]: 2379-87).

It was found that treatment with Mycobacterium w vaccine in combination with chemotherapy and radiation significantly improves the quality of life and response to treatment in patients with lung cancer (see, for example, Sur Ρ, Dastidar A. Role of Mycobactehum w as adjuvant treatment of lung cancer [non-small cell lung cancer]. J Indian Med Assoc 2003 Feb; 101 [2]: 118-120). Similarly, Mycobacterium vaccae vaccine therapy has been found to improve quality of life (see, for example, O'Brien Μ, Anderson H, Kaukel Ε, et al. SRL172 [killed Mycobacterium vaccae] in addition to standard chemotherapy improves quality of life without affecting survival, in patients with advanced non-small-cell lung cancer: phase III results. Ann Oncol 2004 Jun; 15 [6]; 906-14) and controls the symptoms (Harper-Wynne C, Sumpter K, Ryan C, et al. Addition of SRL 172 to standard chemotherapy in small cell lung cancer [SCLC] improves symptom control. Lung Cancer 2005 Feb; 47 [2]: 289-90) in patients with lung cancer.

A vaccine based on Corynebacterium parvum has been associated with a tendency to increased survival in the treatment of melanoma (see, for example, Balch CM, Smalley RV, Bartolucci iA, et al. A randomized prospective trial of adjuvant C parvum immunotherapy in 260 patients with clinically localized melanoma [ stage I]. Cancer 1982 Mar 15; 49 [6]: 1079-84).

Intradermal treatment with a Streptococcus pyogenes vaccine has been found to be effective in treating gastric cancer (see, for example, Hanaue H, Kim DY, Machimura Τ, et al. Hemolytic streptococcus preparation OK-432; beneficial adjuvant therapy in recurrent gastric carcinoma. Tokai J Exp Clin Med 1987 Nov; 12 [4]: 209-14).

A vaccine based on Nocardia rubra has been found to be effective in treating lung cancer (see, for example, Yasumoto K, Yamamura Y. Randomized clinical trial of nonspecific immunotherapy with cell-wall skeleton of Nocardia rubra. Biomed Pharmacother 1984; 38 [1]: 48 -54; Ogura T. Immunotherapy of respectable lung cancer using Nocardia rubra cell wall skeleton. Gan To Kagaku Ryoho 1983 Feb; 10 [2 Pt 2]: 366-72) and is associated with a tendency to increased survival in the treatment of acute myelogenous leukemia ( Ohno R, Nakamura H, Kodera Y, et al. Randomized controlled study of chemoimmunotherapy of acute myelogenous leukemia [AML] in adults with Nocardia rubra cell-wall skeleton and irradiated allogeneic AML cells. Cancer 1986 Apr 15; 57 [8]: 1483 -8).

It was found that treatment with a Lactobacillus casei-based vaccine in combination with radiation is more effective in treating cervical cancer than radiation alone (see, for example, Okawa Τ, Kita M, Arai Τ, et al. Phase II randomized clinical trial of LC9018 concurrently used with radiation in the treatment of carcinoma of the uterine cervix. Its effect on tumor reduction and histology. Cancer 1989 Nov 1; 64 [9j: 1769-76).

Pseudomonas aeruginosa-based vaccine treatment has been shown to increase the effectiveness of chemotherapy in treating lymphoma and lung cancer (see, for example, Li Li, Nao D, Zhang Η, Ren L, et al. A clinical study on PA_MSHA vaccine used for adjuvant therapy of lymphoma and lung cancer. Hua Xi Yi Ke Da Xue Xue Bao 2000 Sep; 31 [3]: 334-7).

It has been found that childhood vaccination with smallpox vaccine (i.e. vaccine virus vaccine) is associated with a reduced risk of developing melanoma in the elderly (see, for example, Pfahlberg A, Kolmel KF, Grange JM. Et al. Inverse association between melanoma and previous vaccinations against tuberculosis and smallpox: results of the FEBIM study. J Invest Dermatol 2002 [119]: 570-575), as well as reduced mortality in those patients who developed melanoma (see, for example, Kolmel KF, Grange JM, Krone B, et al. Prior immunization of patients with malignant melanoma with vaccinia or BCG is associated with better-survival. European Organization for Research and Treatment of Cancer cohort study on 542 patients. EurJ Cancer 41 [2005]: 118-125 )

Rabies virus vaccine treatment was found to lead to temporary remission in 8 of 30 patients with melanoma (see, for example, Higgins G, Pack G. Virus therapy in the treatment of tumors. Bull Hosp Joint Dis 1951; 12: 379-382 ; Pack G. Note on the experimental use of rabies vaccine for melanomatosis. Arch Dermatol 1950; 62: 694-695).

Despite increased efforts to engage the immune system in the fight against malignant tumors using non-specific immunostimulating microbial vaccines, the vast majority of such attempts have been unsuccessful, and there is little clinical or research evidence of great success in increasing survival in populations of patients with malignant tumors. Although it was clear that approaches using immunostimulating microbial vaccines were promising, it was also clear that significant problems were present in this area (see, for example, Ralf Kleef, Mary Ann Richardson, Nancy Russell, Cristina Ramirez. "Endotoxin and Exotoxin Induced Tumor Regression with Special Reference to Coley Toxins: A Survey of the Literature and Possible Immunological Mechanisms. "Report to the National Cancer Institute Office of Alternative and Complementary Medicine August 1997; DL Mager." Bacteria and Cancer: Cause, Coincidence or Cure? A Review. "Journal of Translational Medicine 28 March 2006 4 [14]: doi: 10.1186 / 1479-5876-4-14).

Inflammatory bowel disease (IBD) is the name often given to a group of inflammatory conditions of the colon and small intestine, generally characterized by similar symptoms and an uncertain etiology. The main subtypes of IBD are known clinically as Crohn’s disease and ulcerative colitis. In addition to Crohn’s disease and ulcerative colitis, IBD can also include conditions known as any of the following conditions: collagenous colitis, lymphocytic colitis, ischemic coligg, colitis in the disconnected gut, Behcet syndrome or undifferentiated colitis . The difference between these conditions is mainly related to the position and nature of the inflammatory changes in the gastrointestinal tract (GIT). Crohn's disease, for example, is commonly known as a disease that potentially affects any part of the gastrointestinal tract, from the oral cavity to the anus, with recurrent and remitting granulomatous inflammation of the digestive tract in the terminal ileum and colon, for most cases. On the contrary, it is generally believed that ulcerative colitis is limited to the colon and rectum. Various areas of the gastrointestinal tract in which symptoms of such inflammatory conditions may occur include: the intestine, including: the small intestine (which has three parts: the duodenum, jejunum, and ileum); the large intestine (which has three parts: the cecum, the colon, which includes the ascending colon, the transverse colon, the descending colon, and the sigmoid curve; and the rectum); and anus.

The concept of inflammatory bowel diseases is developing, but still remains incomplete in many ways (see, for example, Baumgart DC, Carding SR (2007) "Inflammatory bowel disease: cause and immunobiology" The Lancet 369 (9573): 1627-40; Baumgart DC, Sandborn WJ (2007) "Inflammatory bowel disease: clinical aspects and established and evolving therapies" The Lancet 369 (9573): 1641-57; Xavier RJ, Podolsky DK (2007) "Unravelling the pathogenesis of inflammatory bowel disease" Nature 448 (7152 ): 427-34; JH Cho (2008) "The genetics and immunopathogenesis of inflammatory bowel disease" Nature Reviews Immunology 8, 458-466).

Anti-inflammatory drugs and immunosuppressants can be used to treat IBD, such as sulfasalazine (azulfidine ™), mesalamine (asacol ™, rovasa ™), corticosteroids (e.g. prednisone), azathioprine (imuran ™), mercaptopurine (purinetol ™), infliximab (rem ™), adalimumab (humira ™), certolizumab pegol (cimzia ™), methotrexate (rheumatrex ™), cyclosporine (gengra ™, neoral ™, sandimmun ™) or natalizumab (tisabri ™).

Alternative methods for treating IBD have been proposed, including the use of various biological agents, or treatments that are thought to regulate the natural intestinal flora, sometimes called probiotic treatments (US 2007/0258953; US 2008/0003207; WO 2007/076534; WO 2007/136719; WO 2010/099824). For example, it has been reported that IBD can be treated using intentional infection with parasitic worms, for example, by taking live eggs of the helminth Trichuris suis (Summers et al. (2003) "Trichuris suis seems to be safe and possibly effective in the treatment of inflammatory bowel disease". Am. J. Gastroenterol. 98 (9): 2034-41; Buning et al., (2008) "Helminths as governors of inflammatory bowel disease" Gut 57: 1182-1183; Weinstock and Elliott (2009) "Helminths and the IBD hygiene hypothesis "Inflamm Bowel Dis. 2009 Jan; 15 (1): 128-33).

SUMMARY OF THE INVENTION

In one aspect, the invention relates to a method for producing an anti-inflammatory composition for treating a condition characterized by inflammation in a particular organ or tissue. The method includes the selection of at least one pathogen; which is pathogenic in a particular organ or tissue; obtaining an antigenic composition containing antigenic determinants that together are specific for the pathogen; and obtaining an antigenic composition for administration as an anti-inflammatory composition capable of inducing an anti-inflammatory response in a particular organ or tissue, wherein the condition characterized by inflammation is not a malignant tumor.

The method may further include a diagnostic step of identifying a particular organ or tissue in which inflammation is symptomatic before obtaining an antigenic composition. Optionally, a tumor or proliferative condition may occur in a particular organ or tissue.

Optionally, an antigenic composition may be prepared for subcutaneous injection or intradermal injection. Optionally, an antigenic composition may be prepared for injection to obtain a localized cutaneous immune response at the injection site. Optionally, a method is described in detail in this publication, wherein when the particular tissue or organ is X, the pathogen is selected from the group consisting of Y. More specifically, it is believed that the following combinations are included within the scope of this method:

In addition, a method is provided that is described in detail in this publication, wherein when the particular tissue or organ is X, the pathogen is selected from the group consisting of Y. More specifically, the following combinations are considered to be within the scope of this method:

Optionally, an antigenic composition may be prepared for repeated subcutaneous or intradermal administration. Optionally, an antigenic composition may be prepared for administration by a route that is not enteral. Optionally, the pathogen described in detail in this publication is a bacterium, virus, protozoa, fungus, or helminth. In addition, the method may include killing the pathogen to produce an antigenic composition in the form of a composition of whole dead pathogens. In addition, the pathogen may be representative of a species that relates to the endogenous flora of a particular organ or tissue. In addition, the pathogen may be an exogenous species.

In another aspect, a method for treating an individual in connection with a condition characterized by inflammation in a particular organ or tissue is provided. The method includes administering to an individual an anti-inflammatory composition comprising antigenic determinants. Antigenic determinants are selected and prepared so that together they are specific for at least one pathogen that is pathogenic in a particular organ or tissue. Optionally, the anti-inflammatory composition may be administered at the injection site in the form of sequentially administered doses with an interval between doses of one hour to one month, over a dosing period of at least two weeks.

In another aspect, the use of an anti-inflammatory composition for treating an individual in connection with a condition characterized by inflammation in a particular organ or tissue is disclosed. The anti-inflammatory composition contains antigenic determinants selected or prepared so that together they are specific for at least one microbial pathogen that is pathogenic in a particular organ or tissue.

In another aspect, the use of an anti-inflammatory composition for the manufacture of a medicament for treating an individual in connection with a condition characterized by inflammation in a particular organ or tissue is disclosed. The anti-inflammatory composition contains antigenic determinants selected or prepared so that together they are specific for at least one microbial pathogen that is pathogenic in a particular organ or tissue.

Optional uses disclosed herein include those in which the individual has a malignant tumor located in an organ or tissue. In addition and optionally, the anti-inflammatory composition may be administered at the injection site in the form of sequentially administered doses with an interval between doses of one hour to one month. over a dosing period of at least two weeks.

In one aspect, a method for comparing immune responses is provided. The method includes administering to an animal having an organ or tissue a medicament containing an antigenic composition having antigenic determinants selected or prepared so that together the antigenic determinants are specific for at least one microbial pathogen that is pathogenic in the organ or tissue, isolating a quantifiable immune sample from an organ or tissue, measuring an immune response characteristic in an organ or tissue, a quantifiable immune sample after drug administration, and comparing an immune response characteristic in a quantifiable immune sample with a corresponding immune response characteristic in a reference immune sample, derived from the appropriate organ or tissue.

Optionally, a reference immune sample can be obtained from an appropriate organ or tissue of an animal before the drug administration step.

Optionally, a reference immune sample can be obtained from the corresponding organ or tissue of a second animal. Optionally, the animal may have a malignant tumor located in an organ or tissue.

Comparison of the characteristics of the immune response can consist in comparing, in quantitatively measured and reference immune samples, the number of any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class II + cells, T- CD4 + cells, CD8 + T cells, or NK cells. Optionally, macrophages may include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. In addition, comparing the characteristics of the immune response may consist in comparing the shift in the state of activation of macrophages.

Optionally, a shift of macrophages from M2-like macrophages to M1-like macrophages can occur. In addition and optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

Optionally, comparing the characteristics of the immune response may consist in identifying, in quantifiable and reference immune samples, cell markers on any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class II + cells, CD4 + T cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages.

Optionally, a comparison of the characteristics of the immune response can consist in identifying in quantitatively measured and reference immune samples cytokines produced by any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class II + cells, CD4 + T cells, CD8 + T cells, or NK cells. As described in detail in this publication, macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Optionally, cytokines are produced as a result of a shift in macrophage activation state. Optionally, macrophages shift from M2-like macrophages to M1-like macrophages. In addition and optionally, macrophages shift from M1-like macrophages to M2-like macrophages.

Optionally, a comparison of the characteristics of the immune response may consist in identifying in quantitatively measured and reference immune samples differential gene expression in any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class II + cells , CD4 + T cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Optionally, differential gene expression occurs as a result of a shift in macrophage activation state. Optionally, a shift of macrophages from M2-like macrophages to M1-like macrophages can occur. In addition, and optionally a shift of macrophages from M1-like macrophages to M2-like macrophages occurs.

Optionally, the drug can be administered at the place of administration in the form of sequentially administered doses with an interval between doses of one hour to one month over a dosing period of at least one week. Optionally, the drug may be administered intradermally or subcutaneously. Optionally, the drug may be administered in a dose so that each dose is effective, eliciting a visible localized inflammatory immune response at the injection site. Optionally, the drug can be administered so that a visible localized inflammation at the injection site occurs between 1 and 48 hours. In addition and optionally, the animal may be a mammal. Optionally, the animal may be a human or a mouse.

In another aspect, a method of selecting a therapeutic drug suitable for treating an individual in connection with a malignant tumor in a particular organ or tissue is provided. The method includes obtaining an animal having a malignant tumor located in a specific organ or tissue, obtaining a test preparation containing one or more antigenic determinants of a microbial pathogen that is pathogenic in a corresponding specific organ or tissue in a healthy individual, measuring an immune response characteristic in a reference an immune sample obtained from an organ or tissue of an animal, administering a test preparation to an animal, measuring an immune response characteristic in a quantifiable immune sample obtained from a corresponding organ or tissue of an animal, comparing an immune response characteristic in a reference and quantitatively measured immune samples, and processing an enhanced immune response characteristic in a quantifiable immune sample compared to a reference immune sample as an indicator of the suitability of the test drug as a therapeutic drug. Optionally, the animal is sacrificed before obtaining a quantifiable immune sample.

Optionally, a comparison of the characteristics of the immune response can consist in comparing, in quantitatively measured and reference immune samples, the number of any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class II +, T cells CD4 + cells, CD8 + T cells, or NK cells. Optionally, macrophages may include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Optionally, comparing the characteristics of the immune response may consist of comparing the shift in the state of activation of macrophages. Optionally, a shift of macrophages from M2-like macrophages to M1-like macrophages can occur. In addition, and optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

Optionally, a comparison of the characteristics of the immune response can consist in identifying in a quantifiable and reference immune samples cell markers on any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class II + cells, CD4 + T cells, CD8 ⁺ T cells, or NK cells. Optionally, macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages.

Optionally, a comparison of the characteristics of the immune response may consist in identifying in a quantifiable and reference immune samples cytokines produced by any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class II + cells, CD4 + T cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Optionally, cytokines are produced as a result of a shift in macrophage activation state. Optionally, a shift of macrophages from M2-like macrophages to M1-like macrophages can occur. In addition, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

In addition and optionally, a comparison of the characteristics of the immune response can consist in identifying, in quantitatively measured and reference immune samples, differential gene expression carried out in any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 cells, dendritic cells, cells CD11c + MHC class II +, CD4 + T cells, CD8 + T cells, or NK cells. Optionally, macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Optionally, differential gene expression may occur as a result of a shift in macrophage activation state. Optionally, a shift of macrophages from M2-like macrophages to M1-like macrophages can occur. In addition, and optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

In another aspect, a method is provided for selectively targeting an immune response with respect to a malignant tissue or organ in humans. The method includes administering to a subject a medicament containing an effective amount of an antigenic composition of a microbial pathogen, wherein the microbial pathogen may be pathogenic in a particular malignant organ or tissue of the subject, and the antigenic composition contains antigenic determinants that together are specific for the microbial pathogen. Optionally, the antigenic composition may comprise a composition of whole killed bacterial cells. Optionally, the drug can be administered to the subject in an amount and over a period of time that are effective for upregulating the immune response in a malignant organ or tissue of the subject. Optionally, the method may further include measuring the characteristics of the immune response. The method also includes the treatment of precancerous lesions, including without limitation actinic keratosis, cervical dysplasia and colon adenomas.

In another aspect, a method for treating a person in connection with a malignant tumor located in a tissue or organ is provided. The method includes administering to a subject a medicament containing an effective amount of an antigenic composition of a microbial pathogen, wherein the antigenic composition contains a composition of whole killed bacterial cells, wherein the microbial pathogen is pathogenic in a particular organ or tissue of the subject in which the malignant tumor is located. A medicament can be administered to a subject in an amount and over a period of time that are effective for modulating the immune response. Optionally, the modulation of the immune response may be a shift in the state of activation of macrophages. Optional modulation of the immune response may include a shift from the response of M2-like macrophages to the response of M1-like macrophages. The modulation of the immune response may consist of a shift from M1-like macrophages to M2-like macrophages, as defined herein. Optionally and without limitation, the method may further include measuring the characteristics of the immune response.

Optionally, a comparison of the characteristics of the immune response may consist in comparing, in quantitatively measured and reference immune samples, the number of any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class T cells CD4 +, T cells, CD8 + or NK cells. Optionally, macrophages may include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Optionally, comparing the characteristics of the immune response may consist of comparing the shift in the state of activation of macrophages. In addition, and optionally, a shift of macrophages from M2-like macrophages to M1-like macrophages can occur. Optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

In addition, and without limitation, a comparison of the characteristics of the immune response can consist in identifying, in quantitatively measured and reference immune samples, cell markers on any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 cells, dendritic cells, CD11c + MHC cells class II +, CD4 + T cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Optionally, a comparison of the characteristics of the immune response may consist in identifying in a quantifiable and reference immune samples cytokines produced by any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class II + cells, CD4 + T cells, CD8 + T cells, or NK cells. Optionally, macrophages may include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. In addition, cytokines can be produced as a result of a shift in the state of activation of macrophages. Macrophage shifts from M2-like macrophages to M1-like macrophages can occur. Optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

In addition and optionally, a comparison of the characteristics of the immune response may consist in identifying, in quantitatively measured and reference immune samples, differential gene expression carried out by any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 cells, dendritic cells, CD11c + cells MHC class II +, CD4 + T cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Optionally, differential gene expression may occur as a result of a shift in macrophage activation state. In addition, and optionally, a shift of macrophages from M2-like macrophages to M1-like macrophages can occur. Macrophage shifts from M1-like macrophages to M2-like macrophages can occur.

In another aspect, a method for monitoring the effectiveness of a treatment regimen in an individual being treated in connection with a malignant tumor in a particular organ or tissue is provided. The method includes measuring the characteristics of the immune response in an immune sample after treatment, obtained from a specific organ or tissue after the individual has been subjected to a treatment regimen for a certain period of time, while having an immune response characteristic that exceeds the value that as might be expected, an individual who has not undergone this treatment regimen is an indicator of the effectiveness of the treatment regimen; and the treatment regimen includes administering a preparation containing one or more antigenic determinants of a microbial pathogen that is pathogenic in a corresponding specific organ or tissue in a healthy subject.

The method described in detail in this publication may further include measuring the characteristics of the immune response in the reference sample obtained before treatment, wherein the reference sample obtained before treatment is obtained from a specific organ or tissue before, at or after the start of the treatment regimen, but before receiving an immune sample after treatment, and comparing the characteristics of the immune response in samples obtained before treatment and after treatment, while an increase in the magnitude of the immune response in the immune sample after treatment compared with the reference sample obtained before treatment is an indicator of the effectiveness of the treatment regimen. Optionally, measuring the response of the immune response may be to determine an indicator of the number of inflammatory monocytes in an organ or tissue sample. Optionally, measuring the response of the immune response may consist of determining an indicator of the number of macrophages in an organ or tissue sample. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages.

Optionally, measuring the response of the immune response may be to determine an indicator of the number of CD11b + Gr-1 + cells in a sample of an organ or tissue, or to determine an indicator of the number of dendritic cells in a sample of an organ or tissue. In addition and optionally, measuring the response of the immune response may consist of determining an indicator of the number of cells of the CD11c + MHC class 11+ in a sample of an organ or tissue, or in determining an indicator of the number of CD4 + T cells in a sample of an organ or tissue, or in determining an indicator of the number of T cells CD8 + in an organ or tissue sample.

Optionally, measuring the magnitude of the immune response may consist in determining an indicator of the number of NK cells in an organ or tissue sample. In addition and optionally, a comparison of the characteristics of the immune response may consist of identification of cell markers in the reference and immune samples on any one or more of the following cell types, inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class II + cells , CD4 + T cells, CD8 + T cells, or NK cells. Optionally, macrophages may include any one or more of the following cell types: M1-like macrophages or M2-like macrophages.

In addition and optionally, a comparison of the characteristics of the immune response may consist in identifying in the reference and immune samples cytokines produced by any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class cells II +, CD4 + T cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Optionally, cytokines can be produced as a result of a shift in macrophage activation state. Macrophage shifts from M2-like macrophages to M1-like macrophages can occur. In addition and optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

Optionally, a comparison of the characteristics of the immune response can consist in identifying differential expression of genes in the reference and immune samples by any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class II + cells, CD4 + T cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Differential gene expression can be achieved as a result of a shift in the state of macrophage activation. Macrophage shifts from M2-like macrophages to M1-like macrophages can occur. Optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

As described in detail in this publication, in another aspect, the invention relates to methods for producing an immunogenic composition for treating a cancer located in a specific organ or tissue in a mammal, such as a sick person. The method may include the selection of at least one microbial pathogen, which in vivo is pathogenic in the organ or tissue of the mammal in which the malignant tumor is located. An antigenic composition can be obtained that contains antigenic determinants that together are specific or characteristic of a microbial pathogen.

You can use the diagnostic stage to identify the specific organ or tissue in which the malignant tumor is located, before obtaining an antigenic composition aimed at the location of the malignant tumor. The location of the malignant tumor may be the primary location or secondary location of the metastasis. The antigenic composition may be specific enough to be able to elicit an immune response in a mammal specific for a microbial pathogen. The antigenic composition may be a bacterial composition, for example, obtained from a species of bacteria, or a species that is endogenous to the patient’s flora, or from an exogenous species or species. In alternative embodiments, the antigenic composition may be derived from a virus or viruses. Accordingly, the microbial pathogen from which the antigenic composition is derived may be a virus. Microbial pathogen may be killed. In alternative embodiments, the microbial pathogen may be live or attenuated. Immunogenic compositions according to the invention can also be obtained or administered with anti-inflammatory drugs, such as NSAIDs. The place of administration can be a place located at a certain distance from the location of the malignant tumor, for example, in an organ or tissue that is not an organ or tissue in which there is a malignant tumor, for example, skin or subcutaneous tissue.

An antigenic composition may be prepared, for example, for subcutaneous injection, intradermal injection, or oral administration. In embodiments for subcutaneous or intradermal injection, the dosage or preparation of the antigenic composition can be adjusted to obtain a localized immune response visible in the skin at the injection site, for example, an area of inflammation with a diameter of 2 mm to 100 mm, appearing, for example, 2-48 hours after administration and lasting, for example, 2-72 hours or longer. The antigenic composition can be obtained for repeated subcutaneous or intradermal administration, for example, in successively changing places.

In some embodiments, the invention relates to methods for treating a mammal in connection with a malignant tumor located in a tissue or organ. In alternative embodiments, the treatment can prevent the development of a malignant tumor in the tissue, for example, if the location of the primary tumor gives reason to assume the likelihood of metastasis to a particular tissue or organ, the patient can be subjected to prophylactic treatment to prevent or reduce metastasis to this tissue or organ . The method may include administering to the subject an effective amount of an antigenic composition comprising antigenic determinants that together are specific for at least one microbial pathogen. An aspect of the invention is the use of a microbial pathogen that is pathogenic in a particular organ or tissue of a mammal in which the cancer is located. The antigenic composition may be administered, for example, by subcutaneous or intradermal injection at the injection site in the form of doses administered sequentially at intervals between doses of, for example, from one hour to one month, over a dosing period of, for example, at least 1 week, 2 weeks, 2 months, 6 months, 1, 2, 3, 4 or 5 years or more. Each injectable dose can, for example, be measured so that it is effective in order to cause the appearance of a visible localized inflammation at the injection site, for example, 1-48 hours after injection.

In another aspect, methods are provided for treating malignant tumors in a specific organ or tissue in a subject by administering one or more antigens of one or more microbial pathogens, such as bacteria or viruses that are pathogenic in a particular organ or tissue.

In alternative embodiments, the type of pathogen may be able to cause infection naturally (i.e. without human intervention) in a specific organ or tissue in a healthy subject, or could cause infection in a specific organ or tissue in a healthy subject. In alternative embodiments, the antigen can be introduced using the introduction of a whole microorganism. In alternative embodiments, the method may include, for example, administering at least two or more kinds of microorganisms or administering at least three or more kinds of microorganisms, and the microorganisms may be bacteria or viruses. In alternative embodiments, the method may further include administering an additive or adjuvant. One aspect of the invention includes the administration of antigenic compositions in order to elicit an immune response in said subject.

In alternative embodiments, the microbial pathogen in the antigenic composition may be killed and, therefore, converted to non-infectious. In some embodiments, the antigenic composition is administered at a location remote from the location of the cancer, and in selected embodiments of this type, the methods of the invention can be carried out so that they do not cause infection at the location of the cancer.

As described in detail in this publication, various aspects of the invention include the treatment of malignant tumors. In this context, treatment can be carried out in order to obtain different results. For example, treatment may: elicit an immune response that is effective in inhibiting or attenuating the growth or proliferation of a malignant tumor; inhibit the growth or proliferation of malignant cells or tumors; cause remission of a malignant tumor; to improve the quality of life; reduce the risk of cancer recurrence; inhibit malignant tumor metastases or increase the survival rate of patients in the patient population. In this context, prolonging the life span of a patient or patient population means increasing the number of patients who survive for a given period of time after a specific diagnosis is made. In some embodiments, treatment may be performed for patients who did not respond to other treatment, such as patients for whom chemotherapy or surgery was not an effective treatment. Treatment in alternative embodiments can be carried out, for example, before or after the appearance of a malignant tumor. For example, prophylactic treatment can be undertaken, for example for patients: who are diagnosed as patients for whom there is a risk of a specific malignant tumor. For example, a patient having a genetic or lifestyle-related predisposition to a malignant tumor in a particular tissue or organ can be treated with an immunogenic composition containing antigenic determinants of a pathogen that is pathogenic in that organ or tissue. Similarly, prophylactic treatment of metastases can be undertaken so that patients having a primary malignant tumor prone to metastasis to a specific tissue or organ can be treated with an immunogenic composition containing antigenic determinants of a pathogen that is pathogenic in that organ or tissue.

In another aspect, a method for treating a malignant tumor located in a lung of a subject is provided. The method includes administering to the subject an effective amount of an antigen of one or more kinds of microorganisms that are pathogenic in the lung, and administering to the subject an effective amount of a chemotherapeutic agent containing platinum. The type of microorganism may be a viral pathogen or bacterial pathogen or fungal pathogen.

The viral pathogen can be without limitation: influenza virus, adenovirus, respiratory syncytial virus, or parainfluenza virus. A bacterial pathogen may be without limitation. Streptococcus pneumoniae, Moraxella catarrhalis, Mycoplasma pneumoniae, Klebsiella pneumoniae, Haemophilus influenza, Staphylococcus aureus, Chlamydia pneumoniae or Legionella pneumophila. The fungal pathogen can be, without limitation: Aspergillus fumigatus, Blastomyces species, Coccidiodes immitis, Coccidiodes posadasii, Cryptococcus neoformans, Cryptococcus gattii, Fusarium species, Histoplasma capsulatum, Pecilli pheis morphidae species Rhizopus, Mucor species, Absidia species, Cunninghamella species, Scedosporium prolifleans, Stachybotrys chartarum, Trichoderma longibrachiatium or Trichosporon species. In addition, a chemotherapeutic agent containing platinum may be without limitation: cisplatin, carboplatin or oxaliplatin.

In another aspect, the use of an effective amount of antigen of one or more types of microorganisms that are pathogenic in the lung is provided for the manufacture of a medicament for use with a chemotherapeutic agent containing platinum for the treatment of lung cancer in a subject. In another aspect, it is proposed the use of an effective amount of antigen of one or more types of microorganisms that are pathogenic in the lung, for use with a chemotherapeutic agent containing platinum, for the treatment of lung cancer in a subject. The type of microorganism may be a viral pathogen or a bacterial pathogen, or a fungal pathogen.

The viral pathogen can be without limitation: influenza virus, adenovirus, respiratory syncytial virus, or parainfluenza virus. The bacterial pathogen may be without limitation: Streptococcus pneumoniae, Moraxella catarrhalis, Mycoplasma pneumoniae, Klebsiella pneumoniae, Haemophilus influenza, Staphylococcus aureus, Chlamydia pneumoniae or Legionella pneumophila. The fungal pathogen can be, without limitation: Aspergillus fumigatus, Blastomyces species, Coccidiodes immitis, Coccidiodes posadasii, Cryptococcus neoformans, Cryptococcus gattii, Fusarium species, Histoplasma capsulatum, Pecilli pheis morphidae species Rhizopus, Mucor spp., Absidia spp., Cunninghamella spp., Scedosporium prolificans, Stachybotrys chartarum, Trichoderma longibrachiatium or Trichosporon spp. In addition, a chemotherapeutic agent containing platinum may be without limitation: cisplatin, carboplatin or oxaliplatin.

In another aspect, an effective amount of an antigen of one or more types of microorganisms that are pathogenic in the lung is provided for the manufacture of a medicament for use with a chemotherapeutic agent containing platinum for treating lung cancer in a subject. In another aspect, an effective amount of an antigen of one or more kinds of microorganisms that are pathogenic in the lung is provided for use with a chemotherapeutic agent containing platinum for treating lung cancer in a subject. The type of microorganism may be a viral pathogen or a bacterial pathogen, or a fungal pathogen.

The viral pathogen can be without limitation: influenza virus, adenovirus, respiratory syncytial virus, or parainfluenza virus. The bacterial pathogen may be without limitation: Streptococcus pneumoniae, Moraxella catarrhalis, Mycoplasma pneumoniae, Klebsiella pneumoniae, Haemophilus influenza, Staphylococcus aureus, Chlamydia pneumoniae or Legionella pneumophila. The fungal pathogen may be, without limitation: Aspergillus fumigatus, Blastomyces species, Coccidiodes immitis, Coccidiodes posadasii, Cryptococcus neoformans, Cryptococcus gattii, Fusarium species, Histoplasma capsulatum, Pececilli pherieci lems braces apiospermum, Rhizopus spp., Mucor spp., Absidia spp., Cunninghamella spp., Scedosporium prolificans, Stachybotrys chartarum, Trichoderma longibrachiatium, or Trichosporon spp. In addition, a chemotherapeutic agent containing platinum may be without limitation: cisplatin, carboplatin or oxaliplatin.

In another aspect, a kit is provided. The kit contains an antigen of one or more types of microorganisms that are pathogenic in the lung, a chemotherapeutic agent containing platinum; and instructions for providing the antigen and chemotherapeutic agent containing platinum,

to the subject in need of them. The type of microorganism may be a viral pathogen or a bacterial pathogen, or a fungal pathogen.

The following pathogens may be a viral pathogen without limitation: influenza virus, adenovirus, respiratory syncytial virus, or parainfluenza virus. The bacterial pathogen may be without limitation: Streptococcus pneumoniae, Moraxella catarrhalis, Mycoplasma pneumoniae, Klebsiella pneumoniae, Haemophilus influenza, Staphylococcus aureus, Chlamydia pneumoniae or Legionella pneumophila. The fungal pathogen can be, without limitation: Aspergillus fumigatus, Blastomyces species, Coccidiodes immitis, Coccidiodes posadasii, Cryptococcus neoformans, Cryptococcus gattii, Fusarium species, Histoplasma capsulatum, Pecilli pheis morphidae species Rhizopus, Mucor spp., Absidia spp., Cunninghamella spp., Scedosporium prolificans, Stachybotrys chartarum, Trichoderma longibrachiatium or Trichosporon spp. In addition, a chemotherapeutic agent containing platinum may be without limitation: cisplatin, carboplatin or oxaliplatin.

In various aspects, the invention relates to methods for preparing a preparation and using an immunogenic composition for treating IBD. IBD can be, for example, IBD, which is symptomatic in one or more areas of the gastrointestinal tract in sick people, such as Crohn’s disease, ulcerative colitis, collagenous colitis, lymphocytic colitis, ischemic colitis, colitis in the disconnected intestine, Behcet's syndrome or undifferentiated colitis. Treatment of a patient may include a diagnostic step in identifying a gastrointestinal region in which IBD is symptomatic. The preparation may contain an antigenic composition containing antigenic determinants that together are specific for at least one pathogen, such as a bacterium, virus, protozoa or helminth, which are pathogenic in the affected area of the gastrointestinal tract. The drug can be obtained for administration in the form of an immunogenic composition capable of inducing an immune response for the treatment of IBD. The composition can, for example, be prepared for administration by a route that is not enteric, such as subcutaneous injection or intradermal injection, for example, in order to obtain a localized immune response in the skin, such as an inflammatory reaction, at the injection site.

BRIEF DESCRIPTION OF THE DRAWINGS

The figure 1 shows the survival curve for the cumulative series of patients who are diagnosed with inoperable cancer. lung stage 3B or 4 (all patients), with a comparison of patients treated with MRV, patients not treated with MRV, and the standard survival curve for SEER.

Figure 2 shows a survival curve for a cumulative series of patients diagnosed with inoperable lung cancer at stages 3B or 4 (patients were treated for at least 2 months using MRV), while comparing patients who were treated with MRV, presented untreated MRV and SEER standard survival curve.

Figure 3 shows a survival curve for a cumulative series of patients diagnosed with lung cancer in stages 3B or 4, illustrating the benefits of treatment using the MRV composition of the invention, with a comparison of patients treated with MRV, patients not treated with MRV, and SEER standard survival curve.

Figure 4 shows a survival curve for a cumulative series of patients diagnosed with lung cancer at stages 3B or 4, illustrating the effect of treatment for at least 2 months, while comparing patients who were treated with MRV, patients not subjected to treatment MRV, and SEER standard survival curve.

Figure 5 shows a survival curve for a cumulative series of patients diagnosed with lung cancer at stages 3B or 4, illustrating the effect of treatment for a period of at least 6 months, while comparing patients who were treated with MRV, patients untreated MRV and SEER standard survival curve.

Figure 6 shows a survival curve for a cumulative series of 52 patients with breast cancer with bone and / or lung metastases, comparing patients who were treated with MRV, patients not treated with MRV, and the standard survival curve of SEER.

The figure 7 presents a comparison of survival in the cumulative series of patients with metastatic prostate cancer who underwent surgery or radiation to destroy their prostate gland (and, therefore, the primary tumor), and who had a detectable malignant tumor limited to bone metastases with a comparison of patients treated with MRV, patients not treated with MRV, and the standard survival curve for SEER.

Figure 8 shows a survival curve for a cumulative series of patients who were initially diagnosed with stage 4 colorectal cancer, comparing patients treated with PVF, patients treated with MRV, patients not treated with antigen composition, and standard survival curve SEER.

Figure 9 shows a survival curve for a cumulative series of patients who were initially diagnosed with colorectal cancer in stage 4, and data for patients treated for 3 months after diagnosis, comparing patients who were treated with PVF, patients who were treated with MRV, untreated patients with antigenic composition, and the standard survival curve for SEER.

Figure 10 shows a survival curve for the cumulative series of patients with stage 3B lung cancer who were treated with oral antigen therapy, respivax, compared with patients who did not use the antigen composition.

11 shows a survival curve for a cumulative series of patients diagnosed with stage 3B lung cancer, illustrating the benefits of treatment using the MRV composition of the invention, comparing patients who were treated with MRV, patients not treated with MRV, and a standard curve survival rate seer.

12 shows a survival curve plotted from a first visit for a cumulative series of patients diagnosed with stage 3B lung cancer, illustrating the benefits of treatment using the MRV composition of the invention, comparing patients not treated with MRV MRV treatment, and the SEER standard survival curve.

Figure 13 shows a survival curve for a cumulative series of patients diagnosed with stage 3B lung cancer, the first visit of which is up to 3 months after diagnosis, illustrating the benefits of early treatment using the MRV composition according to the invention, while comparing patients who were treated with MRV, and patients not treated with MRV.

Figure 14 shows a photograph of the lungs of mice treated (row 1) and untreated (row 2) with a vaccine containing only K. pneumoniae cells after infection with Lewis lung carcinoma cells, as described in Example 4A in this publication. The lower row (not numbered) shows the lungs of mice that were not exposed in a murine model of lung cancer.

Figure 15 shows the average tumor size of mice treated with [AB1-AB6] and untreated [AB-7] with bacterial vaccines after infection with B16 melanoma cells, as described in Example 4B in this publication.

16 shows a survival curve in groups of mice in a model of colon cancer treated or untreated with different bacterial vaccines, as described in Example 4C in this publication.

17 shows the number of inflammatory monocytes and dendritic cells in the draining lymph nodes, lungs, and spleen after treatment with either the K. pneumoniae antigenic composition or PBS, as described in Example 5A in this publication.

Figure 18 shows the total number of monocytes and dendritic cells in the lung, peritoneum and spleen of mice after treatment with either the K. pneumoniae antigenic composition, E. coli antigenic composition, or PBS, as described in Example 5B in this publication.

Figure 19 shows the total number of CD4 + T cells, CD8 + T cells, and NK cells in mice treated with either K. pneumoniae antigenic composition, E. coli antigenic composition, or PBS as described in Example 5B in this publication.

Figure 20 shows the total number of (A) inflammatory monocytes and (B) CD4 + T cells, CD8 + T cells and NK cells either on day 9 or day 16 in mice treated with either heat-inactivated K. pneumoniae antigen composition, either a phenol inactivated K. pneumoniae antigenic composition, or PBS as described in this publication in Example 5C.

Figure 21 shows the total number (A) of inflammatory monocytes and dendritic cells and (B) CD4 + T cells, CD84 T cells and NK cells in mice treated either with heat inactivated K. pneumoniae antigenic composition or phenol inactivated antigenic composition K. pneumoniae, or PBS, as described in this publication in Example 5D.

The figure 22 shows the total number of tumor nodes in mice treated with either PBS or different doses of the K. pneumoniae antigenic composition, as described in this publication.

Figure 23 shows a photograph of the lungs of mice treated with either PBS or different doses of the K. Pneumoniae antigenic composition as described in this publication.

Figure 24 shows the total number of tumor nodes in mice treated with either PBS or different doses of K. Pneumoniae antigenic composition as described in this publication.

Figure 25 shows the total number of tumor nodes in mice treated with either PBS or doses of K. pneumoniae antigenic composition in combination (or not) with cisplatin, as described in this publication.

26 shows a survival curve for mice injected with Lewis lung carcinoma cells and treated with (i) a control vehicle; (ii) cisplatin; (iii) an antigenic composition, or (iv) an antigenic composition and cisplatin.

The figure 27 shows the percentage of CD11b + myeloid cells in the blood on day 13 of the corresponding experiment, described in detail in this publication.

Figure 28 shows (left panel) the frequency of CD11b + NK1.1 cells in the lungs of mice treated with different doses of K. pneumoniae antigenic compositions or control PBS, or (right panel) the frequency of CD11b + NK1.1 + cells in the lungs of mice treated with different doses of K. pneumoniae antigenic compositions or control PBS.

Figure 29 shows the amounts of various cytokines detected (in pg / g) in lung tissue obtained from mice treated with different doses of K. pneumoniae antigenic compositions or control PBS.

Figure 30 shows the amounts of various cytokines detected (in pg / ml) in the bronchoalveolar lavage fluid from mice treated with different doses of K. pneumoniae antigenic compositions or control PBS.

Figure 31 shows comparative ratios of NOS2 gene expression to Argl in mice treated with different doses of K. pneumoniae antigenic compositions or control PBS.

The figure 32 shows the relative frequency of expression of CD206 in macrophages of the lungs in mice treated with different doses of K. pneumoniae antigenic compositions or control PBS.

Figure 33 shows the relative frequency of expression of F4 / 80 expression in macrophages of the lungs in mice treated with different doses of K. pneumoniae antigenic compositions or control PBS.

Figure 34 shows the relative frequency of CD11b + Gr-1 + cells detected in the colon of mice treated with either K. pneumoniae or E. coli antigenic compositions or control PBS.

Figure 35 shows the relative frequency of CD11b + Gr-1 + cells detected in the lungs of mice treated with either K. pneumoniae or E. coli antigenic compositions or control PBS.

Figure 36 shows the relative frequency of CD11b + cells that were M1-like that were isolated from subcutaneous 4T1 tumors (left panel), and the relative frequency of CD11b + cells that were M2-like that were isolated from subcutaneous 4T1 tumors (right panel).

Figure 37 shows the tumor volume (mm ³ ) in mice treated with either indomethacin and PBS; either indomethacin and S. aureus antigenic composition; either EtOH and PBS; or EtOH and S. aureus antigenic composition [left panel]. The right panel of the same figure also shows the relative frequency and composition of CD11b + cells in tumors on day 11 of the corresponding experiment described in detail in this publication.

The figure 38 shows the relative frequency and composition of CD11b + cells in tumors on day 22 of the corresponding experiment, described in detail in this publication.

Figure 39 shows the tumor volume in a cohort of animals treated with indomethacin, indomethacin + antigenic compositions, excipient only, or antigenic compositions only.

Figure 40 shows the percentage of CD11b + cells in animal tumors treated with indomethacin, indochiztacin + antigenic compositions, excipient only or antigenic compositions only (data on day 11).

Figure 41 shows the percentage of CD11b + m cells in animal tumors treated with indomethacin, indomethacin + antigenic compositions, excipient only, or antigenic compositions only (data on day 22).

The figure 42 shows the percentage of CD11b + CD94 + cells in animal tumors treated with indomethacin, indomethacin + antigenic compositions, excipient only or antigenic compositions only (data on day 22).

Figure 43 shows the relative expression of (A) Fizzl and (B) Ym1 in excised tumors, as described in this publication.

Figure 44 shows the relative expression of (A) Arg1 and (B) Fizzl in tumors and spleens [(C) and (D)], as described in this publication.

Figure 45 shows the relative expression of Nos2 and Ym1 in tumors and spleens, as described in this publication.

Figure 46 shows the amount of IFN-γ produced in the lungs of mice with tumors and without tumors and in the case of treatment and without treatment with antigenic compositions, as described in this publication.

Figure 47 shows the amount of IL-10 produced by bone marrow macrophages cultured overnight with the K. pneumoniae antigen composition, LPS, and medium alone.

48 shows the relative expression of IL-10 produced in mouse tumors under the conditions described in this publication.

DETAILED DESCRIPTION OF THE INVENTION

In various aspects, an embodiment of the invention relates to the unexpected discovery that the administration, for example, to a location remote from a cancer, of microbial pathogens, such as killed microbial pathogens that are pathogenic in a particular tissue or organ, is effective in treating a cancer, located in such a specific tissue or organ. Accordingly, the invention relates to antigenic compositions obtained from such microbial pathogens, including whole killed bacteria or viruses or their components, for the treatment of malignant tumors and to methods for their use.

Based on observations in the treatment of patients, it was found that the administration of killed bacteria compositions, which included many types of bacteria that usually cause lung infection, was surprisingly and unexpectedly effective in improving the clinical course of lung cancer. Similarly, it was found that the administration of compositions containing killed Staphylococcus aureus, one of the most common causes of infection of bone, breast, skin, perineum and lymph nodes and septicemia, was surprisingly and unexpectedly effective in improving the clinical course of bone cancer, breast , skin, perineum, and lymphoma (a malignant tumor of the lymph glands) and multiple myeloma (such as a hematologic malignant tumor). Similarly, it was surprising and unexpected to find that the administration of a composition containing Escherichia coli, which is a common cause of infection of the colon, kidney, peritoneum, liver, abdominal cavity, pancreas and ovary, was effective in improving the clinical course of colon cancer, kidneys, peritoneum, liver, abdominal lymph nodes, pancreas and ovary.

The results show that a composition containing antigens of pathogenic species of microorganisms that cause infection in a particular tissue or organ will be an effective drug for treating a malignant tumor in such a tissue or organ. For example, a malignant tumor in the lung is effectively treated with a microbial composition containing one or more types of pathogens that usually cause lung infection, while a malignant tumor in the colon is effectively treated with a composition containing a pathogenic type of microorganism that usually causes colon infections.

Antigenic compositions of the invention can be prepared that contain antigenic determinants that together are specific or characteristic of a microbial pathogen. In this context, the term “specific” means that antigenic determinants are sufficiently specific for a pathogen so that they can be used to elicit an immune response, such as an adaptive immune response, against a pathogen in a patient if antigenic determinants have been introduced appropriately to cause such an effect. It will be understood that antigenic determinants should not be so specific that they are characteristic of only one particular strain or type of pathogen, since even a specific immune response against a particular pathogen can be cross-reactive with other closely related organisms that are also in natural conditions are pathogenic in the tissue or organ in which the cancer is located, and that the antigenic composition is prepared or selected in relation to the target.

In some embodiments, the composition of pathogenic microorganisms can be used to treat localization sites of primary malignant tumors and / or localization sites of metastases. Thus, for example, microbial compositions can be used to treat a malignant tumor in a particular place, regardless of whether the malignant tumor is a primary malignant tumor or metastasis. The composition may be directed to the treatment of each of the localization sites of the malignant tumor or may be a combined composition for both the primary malignant tumor and the localization site (s) of metastases. For example, to treat a malignant tumor of a kidney cancer that metastasizes to the lung and bone, three different compositions may be used containing one or more species that are known to be pathogens of the kidneys, one or more species that are known to be pathogens of the lungs, and one or more species that are known to be bone pathogens, or a combination composition of these pathogens can be used. In some embodiments, the compositions may be administered at different locations simultaneously or at different points in time.

For example, in the case of lung cancer with bone metastases, in alternative embodiments, you can use a microbial composition containing one or more types of bacteria (or viruses) that usually cause infection of the lungs, and a microbial composition containing one or more types of bacteria (or viruses ), which usually cause bone infection. Similarly, in the case of colon cancer with lung metastases, a composition of pathogenic bacteria (or viruses) containing one or more types of bacteria (or viruses) that usually cause infection of the colon and a microbial composition containing one or more types can be used bacteria (or viruses) that usually cause lung infection; in the case of prostate cancer with bone metastases, a composition of pathogenic bacteria (or viruses) containing one or more types of bacteria (or viruses) that usually cause infection of the prostate and a composition of pathogenic bacteria (or viruses) containing one or more types can be used bacteria (or viruses) that commonly cause bone infection.

The following list provides some non-limiting examples of primary malignant tumors and their usual secondary distribution sites (metastases):

In some embodiments, antigenic compositions may be useful for treating or preventing malignant tumors at primary sites or for treating or preventing metastases. For example, in long-term smokers, an antigenic composition specific for lung cancer (for example, containing antigenic determinants of one or more types of bacteria or viruses that commonly cause lung infection) can be used to properly stimulate the immune system to fight the development of malignant tumors in lung tissue. As another example, an antigenic composition specific for breast cancer (for example, containing antigenic determinants of one or more types of bacteria that commonly cause breast infection) can be used to prevent breast cancer in women who have a high family history of cancer breast cancer or having a genetic predisposition. In alternative embodiments, an antigenic composition containing one or more types of bacteria that commonly cause bone infection can be used to prevent or treat bone metastases in a patient with prostate cancer. In further alternative embodiments, an antigenic composition comprising one or more types of bacteria or viruses that typically cause lung infection can be used to prevent or treat lung metastases in a patient with malignant melanoma.

Various alternatives and examples according to the invention are described in this publication. Such variations and examples are illustrative and should not be construed as limiting the scope of the invention.

Malignant tumors

Most malignant tumors belong to three broad groups of histological classification: carcinomas, which are the predominant malignant tumors and are malignant tumors of epithelial cells or cells covering the external and internal surfaces of organs, glands or other structures of the body (e.g., skin, uterus, lung, mammary glands, prostate, stomach, intestines), and which has a tendency to metastasis; sarcomas that originate from connective or supporting tissue (e.g., bone, cartilage, tendons, ligaments, fat, muscles); and hematological tumors that originate from bone marrow and lymphatic tissue. Carcinomas can be adenocarcinomas (which usually develop in organs or glands capable of secretion, such as the mammary gland, lung, colon, prostate or bladder) or can be squamous cell carcinomas (which occur in squamous epithelium and usually develop in most areas of the body). Sarcomas can be osteosarcomas or osteogenic sarcomas (bone), chondrosarcomas (cartilage), leiomyosarcomas (smooth muscles), rhabdomyosarcomas (skeletal muscle), mesothelial sarcomas or mesothelioma (ankylar sarcomas) or fibrous lobules of the ganglion and fibrosis (blood vessels), liposarcomas (adipose tissue), gliomas or astrocytomas (neurogenic connective tissue found in the brain), myxosarcomas (primitive embryonic connective tissue) or mesenchymal or mixed mesoderm tumors (mixed types of connective tissue). Hematologic tumors can be myelomas that occur in the plasma cells of the bone marrow; leukemia, which can be "liquid malignant tumors" and malignant bone marrow tumors and can be myelogenous or granulocyte leukemia (myeloid and granulocytic leukocytes), lymphatic, lymphocytic or lymphoblastic leukemia (lymphoid cells and blood lymphocytes) or true polycythemia various blood cell products, but with a predominance of red blood cells); or lymphomas, which can be solid tumors and which develop in the glands or bridles of the lymphatic system, and which can be Hodgkin or non-Hodgkin lymphomas. In addition, mixed-type cancers also exist, such as adenosquamous carcinomas, mixed mesoderm tumors, carcinosarcomas, or teratocarcinomas.

Malignant tumors, called on the basis of the primary location, can correlate with histological classification. For example, lung cancer is usually small cell lung cancer or non-small cell lung cancer, which may be squamous cell carcinoma, adenocarcinoma, or large cell carcinoma; skin cancer is usually basal cell carcinoma, squamous cell carcinoma, or melanoma. Lymphomas can occur in the lymph nodes associated with the head, neck and chest, as well as in the abdominal lymph nodes, or in the axillary or inguinal lymph nodes. Identification and classification of types and stages of malignant tumors can be carried out using, for example, information provided by the SEER program (course, prevalence and outcomes of malignant neoplasms) of the National Cancer Institute, which is a reliable source of information on the frequency of malignant tumors and survival in the United States and is generally recognized worldwide. SEER currently collects and publishes cancer incidence and survival data from 14 population-based cancer registries and three additional registries covering approximately 2 6 percent of the US population. The program usually collects data on the demographics of the population, location of the primary tumor, morphology, stage at diagnosis, first course of treatment and subsequent vital status records, and is the only comprehensive source of population-based information in the United States that includes the stage of the malignant tumor at the time of diagnosis and survival rates at each stage. More than 3 million cases of in situ and invasive malignancies are included in the SEER database, and approximately 170,000 new cases are added each year within the SEER areas. SEER frequency and survival data can be used to obtain standard survival information for a specific location and stage of the cancer. For example, in order to provide an optimal comparison group, specific criteria can be selected from the database, including the date of diagnosis and the exact stage (for example, in the case of lung cancer described in the present description, years were selected that coincide with the time interval of the retrospective review, and stages 3B and 4 of lung cancer were selected; and in the case of the colon cancer example described herein, the years were also chosen to coincide with the flashback interval and stage 4 of colon cancer was selected).

Malignant tumors can also be named based on the organ in which they arise, i.e. “Primary location”, for example, cancer of the breast, brain, lung, liver, skin, prostate, testis, bladder, colon and rectum, cervix, uterus, etc. This name is preserved even if a malignant tumor metastasizes to another part of the body that is different from the primary location. According to the present invention, the treatment is directed to the location of the cancer, and not to the type of cancer, so that a cancer of any type that is located, for example, in the lung, can be treated based on its location in the lung.

“Malignant tumor” or “neoplasm” means any unwanted cell growth that does not serve a physiological function. In general, at the same time, a malignant cell gets out of its normal control of cell division, that is, a cell whose growth is not regulated by normal biochemical and physical factors in the environment of the cell. Thus, “malignant tumor” is a general term for diseases characterized by abnormal uncontrolled cell growth. In most cases, a malignant cell proliferates with. the formation of clonal cells that are malignant. Accumulation or cell mass, "neoplasm" or "tumor" is usually able to invade and destroy surrounding normal tissues. "Malignancy" as used in the present description means abnormal growth of any type of cell or tissue that has a detrimental effect on an organism having abnormal growth. The term "malignancy" or "malignant tumor" includes cell growth that is formally benign, but which carries risk of becoming malignant. Malignant cells can spread from their original location to other parts of the body through the lymphatic system or bloodstream in a process called “metastasis”. Many malignant tumors are immune to treatment and are fatal. Examples of malignant tumors or neoplasms include, but are not limited to, transformed and immortalized cells, tumors, carcinomas in various organs and tissues that are described in this publication or are known to those skilled in the art.

A “cell” is the basic structural and functional unit of a living organism. In higher organisms, for example, animals, cells having a similar structure and function are usually combined into “tissues” that perform specific functions. Thus, the tissue contains a combination of similar cells and surrounding intercellular substances, for example, epithelial tissue, connective tissue, muscle, nervous. An “organ” is a fully differentiated structural and functional unit in a higher organism, which may consist of various types of tissues and is specialized for a specific function, for example, kidney, heart, brain, liver, etc. Accordingly, in the present description it is understood that the term "specific organ, tissue or cell" includes any specific organ and includes cells and tissues present in this organ.

"Pathogenic" agents are agents, such as microorganisms, such as bacteria or viruses, which are known to naturally cause infection in a host, and in this sense, the term "pathogenic" is used in the context of the present invention to mean "pathogenic in nature ". Although a wide range of microorganisms may be capable of causing infection under artificial conditions, such as the artificial inoculation of a microorganism into tissue, the range of microorganisms that cause infection under natural conditions is certainly limited and well known in medical practice.

“Infection” is a status or condition in which a pathogenic agent (for example, a microorganism such as a bacterium) invades the body or part of it, which multiplies under favorable conditions and causes effects that are harmful (Taber's Cyclopedic Medical Dictionary, 14 ^th Ed ., CL. Thomas, Ed., FA Davis Company, ΡΑ, USA). Infection may not always be clinically severe and can only lead to localized cell damage. Infections can remain subclinical and temporary if the body's defense mechanisms are effective. Infections can spread locally, becoming clinically expressed as an acute, subacute or chronic clinical infection or pathological condition. A local infection can also become systemic when a pathogenic agent enters the lymphatic or vascular system (On-Line Medical Dictionary, http://cancerweb.ncl.ac.uk/omd/). Infection is usually accompanied by inflammation, but inflammation can occur without infection.

"Inflammation" is a characteristic tissue response to damage (characterized by swelling, redness, fever and pain), and includes the sequential changes that occur in living tissue when it is damaged. Infection and inflammation are different conditions, although one may arise from the other (Taber's Cyclopedic Medical Dictionary, supra). Accordingly, inflammation can occur without infection, and infection can occur without inflammation (although inflammation usually occurs as a result of infection by pathogenic bacteria or viruses). Inflammation is characterized by the following symptoms: redness (redness), fever (fever), swelling (swelling), soreness (pain). Localized visible inflammation on the skin can be manifested as a result of a combination of such symptoms, especially redness at the injection site.

Different subjects can be treated according to alternative aspects of the invention. As used herein, a “subject” is an animal, for example, a mammal, with which specific pathogenic bacteria, bacterial antigens, viruses, viral antigens, or compositions thereof, according to the invention can be administered. Accordingly, the subject may be a patient, for example, a person suffering from a malignant tumor, or a person who is suspected of having a malignant tumor or is suspected of having a risk of developing a malignant tumor. The subject may also be an experimental animal, for example, an animal model of a malignant tumor, which is described in Example 5. In some embodiments, the terms “subject” and “patient” may be used interchangeably and may include a human, non-human mammal, non-human primate human, rat, mouse, dog, etc. A healthy subject may be a person who does not suffer from a malignant tumor or who is not expected to have a malignant tumor, or who does not suffer from a chronic disorder or condition. A “healthy subject” may also be a subject that is not a weakened immune subject. Weakened immunity means any condition in which the immune system functions abnormally or inadequately. Weakened immunity may be the result of a disease, the use of certain drugs or conditions that are present at birth. Immunocompromised subjects are more likely to occur among young children, the elderly, and people undergoing intensive care with drugs or radiation.

An “immune response” includes, but is not limited to, one or more of the following responses in a mammal: the induction or activation of antibodies, neutrophils, monocytes, macrophages (including both M1-like macrophages and M2-like macrophages as described in this publication), B- cells, T cells (including helper T cells, natural killer cells, cytotoxic T cells, γδ T cells), for example, induction or activation of antigen (s) in a composition or vaccine after administration of the composition or vaccine. Thus, an immune response to a composition or vaccine typically includes the development in a host animal of a cellular and / or antibody-mediated response to a composition or vaccine of interest. In some embodiments, the immune response is such that it will also slow down or stop the progression of the cancer in the animal. The immune response includes both cellular immune responses and humoral immune responses that are known to those skilled in the art.

Bacteria and bacterial colonization and infections

Most animals are colonized to some extent by other organisms, such as bacteria, which usually exist in a symbiotic or commensal relationship with the host animal. Thus, many species of normally harmless bacteria are found in healthy animals, and they are usually located on the surface of specific organs and tissues. Often, such bacteria help the body function properly. For example, in humans, the symbiotic bacteria Escherichia coli can be found in the intestines, where they stimulate immunity and reduce the risk of infection by more virulent pathogens.

Bacteria that are usually non-hazardous, such as Escherichia coli, can cause infections in healthy subjects, the result of which can range from moderate to severe infections and even death. Whether the bacterium is pathogenic (i.e., causes an infection) or not, to a certain extent depends on such factors as the pathway of penetration and access to specific cells, tissues or organs of the host; virulence inherent in bacteria; the number of bacteria present at the site of a potential infection; or the health status of the host animal. Thus, bacteria that are normally harmless can become pathogenic under conditions favorable for infection, and even the most virulent bacterium requires special conditions in order to cause infection. Accordingly, the species of microorganisms that are representatives of the normal flora can be pathogens when they emerge from their normal ecological role in the endogenous flora. For example, endogenous species can cause infection outside their ecological niche in anatomically close areas, for example, as a result of spreading to adjacent areas. When this happens, such normally non-hazardous endogenous bacteria are considered pathogenic.

It is known that specific bacterial species and viruses cause infections in specific cells, tissues or organs in healthy subjects in other circumstances. Examples of bacteria and viruses that commonly cause infections in specific organs and tissues of the body are listed below; it will be understood that such examples are not intended to be limiting, and that a specialist will be able to easily recognize and identify infectious or pathogenic bacteria that cause infections or usually cause infections in various organs and tissues in healthy adults (and find out the relative frequency of infection with each bacterial species ), based on the information available if in the field, which is presented, for example, in the following publications: Manual of Clinical Microbiology 8th Edition, Patrick Murray, Ed., 2003, ASM Press American Society for Microbiology, Washington DC, USA; Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases 5th Edition, G.L. Mandell, J.E. Bennett, R. Dolin, Eds., 2000, Churchill Livingstone, Philadelphia, PA, USA, all of which are incorporated herein by reference.

The following bacterial species usually cause skin infections: Staphylococcus aureus, beta-hemolytic streptococcus group A, B, C or G, Corynebacterium diptheriae, Corynebacterium ulcerans or Pseudomonas aeruginosa; or viral pathogens: measles, rubella, chickenpox, echoviruses, Coxsackie viruses, adenovirus, vaccine virus, herpes simplex virus, or parvovirus B19.

The following bacterial species usually cause infections of soft tissue (for example, adipose or muscle): Streptococcus pyogenes, Staphylococcus aureus, Clostridium perfringens or other types of Clostridium; or viral pathogens: influenza virus or Coxsackie viruses.

The following bacterial species usually cause breast infections: Staphylococcus aureus or Streptococcus pyogenes.

The following bacterial species usually cause infections of the lymph nodes of the head and neck: Staphylococcus aureus or Streptococcus pyogenes; or viral pathogens: Epstein-Barr virus, cytomegalovirus, adenovirus, measles, rubella, herpes simplex virus, Coxsackie viruses or chickenpox.

The following bacterial species usually cause infections of the brachial / axillary lymph nodes: Staphylococcus aureus or Streptococcus pyogenes; or viral pathogens: measles, rubella, Epstein-Barr virus, cytomegalovirus, adenovirus or chickenpox virus.

The following bacterial species usually cause mediastinal lymph node infections: Streptococcus viridans, Peptococcus spp., Peptostreptococcus spp., Bacteroides spp., Fusobacterium spp. Or Mycobacterium tuberculosis; or viral pathogens: measles, rubella, Epstein-Barr virus, cytomegalovirus, chickenpox virus or adenovirus.

The following bacterial species usually cause infections of the lymph nodes of the lung gates: Streptococcus pneumoniae, Moraxella catarrhalis, Mycoplasma pneumoniae, Klebsiella pneumoniae, Haemophilus influenza, Chlamydophila pneumoniae, Bordetella pertussis or Mycobacterium tuberculosis; or viral pathogens: influenza virus, adenovirus, rhinovirus, coronavirus, parainfluenza virus, respiratory syncytial virus, human metapneumovirus or Coxsackie virus.

The following bacterial species usually cause intraperitoneal lymph node infections: Yersinia enterocolitica, Yersinia pseudotuberculosis, Salmonella, Streptococcus pyogenes, Escherichia coli, Staphylococcus aureus or Mycobacterium tuberculosis; or viral pathogens: measles, rubella, Epstein-Barr virus, cytomegalovirus, chickenpox virus, adenovirus, influenza virus or Coxsackie viruses.

The following bacterial species usually cause infections of the lymph nodes of the legs / inguinal region: Staphylococcus aureus or Streptococcus pyogenes; or viral pathogens: measles, rubella, Epstein-Barr virus, cytomegalovirus or herpes simplex virus.

The following bacterial species usually cause blood infections (i.e., septicemia): Staphylococcus aureus, Streptococcus pyogenes, coagulase-negative staphylococci, Enterococcus, Escherichia coli species, Klebsiella species, Enterobacter species, Proteus, Pseudomonas aeruginosa pneumococcus streptococcus, Streptococcus bacteria Group B; or viral pathogens: measles, rubella, chickenpox, echoviruses, Coxsackie viruses, adenovirus, Epstein-Barr virus, herpes simplex virus or cytomegalovirus.

The following bacterial species usually cause bone infections: Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus agalactiae, other streptococcus species, Escherichia coli, Pseudomonas spp., Enterobacter spp., Proteus spp. or viral pathogens: parvovirus B19, rubella virus or hepatitis B virus.

The following bacterial species usually cause infections of the meninges: Haemophilus influenza, Neisseria meningitides, Streptococcus pneumoniae, Streptococcus agalactiae or Listeria monocytogenes; or viral pathogens: echoviruses, Coxsackie viruses, other enteroviruses or mumps virus.

The following bacterial species usually cause infections of the brain: Streptococcus spp. (Including S. anginosus, S. constellatus, S. intermedius), Staphylococcus aureus, Bacteroides spp., Prevotella spp., Proteus spp., Escherichia coli, Klebsiella spp., Pseudomonas spp., Enterobacter spp. Borrelia burgdorferi; or viral pathogens: Coxsackie viruses, echoviruses, poliomyelitis virus, other enteroviruses, mumps virus, herpes simplex, chickenpox, flaviviruses or bunyaviruses.

The following bacterial species usually cause spinal cord infections: Haemophilus influenzae, Neisseria meningitidis, Streptococcus pneumoniae, Streptococcus agalactiae, Listeria monocytogenes or Borrelia burgdorferi; or viral pathogens: Coxsackie viruses, echoviruses, poliomyelitis virus, other enteroviruses, mumps virus, herpes simplex, chickenpox, flaviviruses or bunyaviruses.

The following bacterial species usually cause infections of the eye / eye socket: Staphylococcus aureus, Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus milleri, Escherichia coli, Bacillus cereus, Chlamydia trachomatis, Haemophilus influenza, Pseudomonas species, Klebsiella or Tre species; or viral pathogens: adenoviruses, herpes simplex virus, chickenpox virus or cytomegalovirus.

The following bacterial species commonly cause salivary gland infections: Staphylococcus aureus, streptococcus viridans (eg, Streptococcus salivarius, Streptococcus sanguis, Streptococcus mutans), Peptostreptococcus species or Bacteroides species or other oral anaerobes; or viral pathogens: mumps, flu, enteroviruses or rabies.

The following bacterial species commonly cause oral infections: Prevotella melaninogenicus, anaerobic streptococci, streptococcus viridans, Actinomyces spp., Peptostreptococcus spp. Or Bacteroides spp. Or other oral anaerobes; or viral pathogens: herpes simplex virus, Coxsackie viruses, or Epstein-Barr virus.

The following bacterial species usually cause tonsil infections: Streptococcus pyogenes or B-hemolytic group C or G streptococci; or viral pathogens: rhinoviruses, influenza virus, coronavirus, adenovirus, parainfluenza virus, respiratory syncytial virus or herpes simplex virus.

The following bacterial species usually cause sinus infections: Streptococcus pneumoniae, Haemophilus influenza, Moraxella catarrhalis, α-streptococcus, anaerobic bacteria (eg, Prevotella spp.) Or Staphylococcus aureus; or viral pathogens: rhinoviruses, influenza virus, adenovirus or parainfluenza virus.

The following bacterial species usually cause nasopharyngeal infections: Streptococcus pyogenes or B-hemolytic group C or G streptococci; or viral pathogens: rhinoviruses, influenza virus, coronavirus, adenovirus, parainfluenza virus, respiratory syncytial virus or herpes simplex virus.

The following bacterial species usually cause thyroid infections: Staphylococcus aureus, Streptococcus pyogenes, or Streptococcus pneumoniae; or viral pathogens: mumps virus or influenza virus.

The following bacterial species usually cause laryngeal infections: Mycoplasma pneumoniae, Chiamydophila pneumoniae, or Streptococcus pyogenes; or viral pathogens: rhinovirus, influenza virus, parainfluenza virus, adenovirus, coronavirus or human metapneumovirus.

The following bacterial species usually cause tracheal infections: Mycoplasma pneumoniae; or viral pathogens; parainfluenza virus, influenza virus, respiratory syncytial virus or adenovirus.

The following bacterial species usually cause infections of the bronchi: Mycoplasma pneumoniae, Chiamydophila pneumoniae, Bordetella pertussis, Streptococcus pneumoniae or Haemophilus influenzae; or viral pathogens: influenza virus, adenovirus, rhinovirus, coronavirus, parainfluenza virus, respiratory syncytial virus, human metapneumovirus or Coxsackie virus.

The following bacterial species usually cause lung infections: Streptococcus pneumoniae, Moraxella catarrhalis, Mycoplasma pneumoniae, Klebsiella pneumoniae or Haemophilus influenza; or viral pathogens: influenza virus, adenovirus, respiratory syncytial virus or parainfluenza virus.

The following bacterial species usually cause pleural infections: Staphylococcus aureus, Streptococcus pyogenes, Streptococcus pneumoniae, Haemophilus influenzae, Bacteroides f ragilis, Prevotella, Fusobacterium nucleatum, peptostreptococcus or Mycobacterium tuberculosis species; or viral pathogens: influenza virus, adenovirus, respiratory syncytial virus or parainfluenza virus.

The following bacterial species usually cause mediastinal infections: streptococcus viridans, Peptococcus spp., Peptostreptococcus spp., Bacteroides spp., Fusobacterium spp. Or Mycobacterium tuberculosis; or viral pathogens: measles, rubella, Epstein-Barr virus or cytomegalovirus.

The following bacterial species usually cause heart infections: Streptococcus spp. (Including S. mitior, S. bovis, S. sanguis, S. mutans, S. anginosus), Enterococcus spp., Staphylococcus spp., Corynebacterium diptheriae, Clostridium perfringens, Neisseria meningitidis or spp. Salmonella; or viral pathogens: enteroviruses, Coxsackie viruses, echoviruses, poliomyelitis virus, adenovirus, mumps virus, measles virus or influenza virus.

The following bacterial species usually cause infections of the esophagus: Actinomyces, Mycobacterium avium, Mycobacterium tuberculosis, or Streptococcus spp.; or viral pathogens: cytomegalovirus, herpes simplex virus, or chickenpox.

The following bacterial species commonly cause gastric infections: Streptococcus pyogenes or Helicobacter pylori; or viral pathogens: cytomegalovirus, herpes simplex virus, Epstein-Barr virus, rotaviruses, noroviruses or adenoviruses.

The following bacterial species usually cause small intestinal infections: Escherichia coli, Clostridium difficile, Bacteroides fragilis, Bacteroides vulgatus, Bacteroides thetaiotaomicron, Clostridium perfringens, Salmonella enteriditis, Yersinia enterocolitica or Shigella flexneri; or viral pathogens: adenoviruses, astroviruses, caliciviruses, noroviruses, rotaviruses or cytomegalovirus.

The following bacterial species usually cause infections of the colon / rectum: Escherichia coli, Clostridium difficile, Bacteroides fragilis, Bacteroides vulgatus, Bacteroides thetaiotaomicron, Clostridium perfringens, Salmonella enteriditis, Yersinia enterocolitica or Shigella flexneri; or viral pathogens: adenoviruses, astroviruses, caliciviruses, noroviruses, rotaviruses or cytomegalovirus.

The following bacterial species usually cause anus infections: Streptococcus pyogenes, Bacteroides spp., Fusobacterium spp., Anaerobic streptococcus, Clostridium spp., Escherichia coli, Enterobacter spp., Pseudomonas aeruginosa or Treponema pallidum; or viral pathogens: herpes simplex virus.

Perineal infections are usually caused by the following bacterial species: Escherichia coli, Klebsiella spp., Enterococcus spp., Bacteroides spp., Fusobacterium spp., Clostridium spp., Pseudomonas aeruginosa, anaerobic streptococcus, Clostridium spp. Or Enterobacter spp. or herpes simplex virus viral pathogens.

The following bacterial species usually cause liver infections: Escherichia coli, Klebsiella spp., Streptococcus (anginosus group), Enterococcus spp., Other streptococcus viridans or Bacteroides spp. or viral pathogens: hepatitis A virus, Epstein-Barr virus, herpes simplex, mumps, rubella, measles, chicken pox, Coxsackie viruses or adenovirus.

The following bacterial species usually cause gallbladder infections: Escherichia coli, Klebsiella spp., Enterobacter spp., Enterococci, Bacteroides spp., Fusobacterium spp., Clostridium spp., Salmonella enteriditis, Yersinia enterocolitica or Shigella flexneri.

The following bacterial species usually cause infections of the biliary tract: Escherichia coli, Klebsiella spp., Enterobacter spp., Enterococci, Bacteroides spp., Fusobacterium spp., Clostridium spp., Salmonella enteriditis, Yersinia enterocolitica or Shigella flexneri; or viral pathogens: hepatitis A virus, Epstein-Barr virus, herpes simplex virus, mumps, rubella, measles, chicken pox, Coxsackie viruses or adenovirus.

The following bacterial species usually cause pancreatic infections: Escherichia coli, Klebsiella spp., Enterococcus spp., Pseudomonas spp., Staphylococcal spp., Mycoplasma spp., Salmonella typhi spp., Leptospirosis spp. Or Legionella spp. or viral pathogens: mumps virus, Coxsackie virus, hepatitis B virus, cytomegalovirus, herpes simplex virus 2 or chickenpox virus.

The following bacterial species usually cause spleen infections: Streptococcus spp., Staphylococcus spp., Salmonella spp., Pseudomonas spp., Escherichia coli or Enterococcus spp.; or viral pathogens: Epstein-Barr virus, cytomegalovirus, adenovirus, measles, rubella, Coxsackie viruses or chickenpox virus.

The following bacterial species usually cause adrenal infections: Streptococcus spp., Staphylococcus spp., Salmonella spp., Pseudomonas spp., Escherichia coli or Enterococcus spp.; or viral pathogens: chickenpox virus.

The following bacterial species usually cause kidney infections: Escherichia coli, Proteus mirabilis, Proteus vulgatus, Providentia spp., Morganella spp., Enterococcus faecalis or Pseudomonas aeruginosa; or viral pathogens: VK virus or mumps virus.

The following bacterial species usually cause ureteral infections: Escherichia coli, Proteus mirabilis, Proteus vulgatus, Providentia spp., Morganella spp. Or Enterococcus spp.

The following bacterial species usually cause bladder infections: Escherichia coli, Proteus mirabilis, Proteus vulgatus, Providentia spp., Morganella spp., Enterococcus faecalis or Corynebacterium jekeum; or viral pathogens: adenovirus or cytomegalovirus.

The following bacterial species usually cause peritoneal infections: Staphylococcus aureus, Streptococcus pyogenes, Streptococcus pneumonia, Escherichia coli, Klebsiella spp., Proteus spp., Enterococci, Bacteroides fragiiis, Prevotella a melaninogenica, Peptococcus spp., Peptosterreocobocidae, Peptosterreocobocidae, or Peptosterreocobocidae.

The following bacterial species usually cause infections of the retroperitoneal region: Escherichia coli or Staphylococcus aureus.

The following bacterial species usually cause infections of the prostate: Escherichia coli, Klebsiella spp., Enterobacter spp., Proteus mirabilis, Enterococcus spp., Pseudomonas spp., Corynebacterium spp. Or Neisseria gonorrhoeae; or viral pathogens: herpes simplex virus.

The following bacterial species usually cause testis infections: Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus species, Streptococcus or Salmonella enteriditis species; wnvi viral pathogens: mumps virus, coxsackie virus or lymphocytic choriomeningitis virus.

The following bacterial species usually cause penile infections: Staphylococcus aureus, Streptococcus pyogenes, Neisseria gonorrhoeae or Treponema pallidum; or viral pathogens: herpes simplex virus.

The following bacterial species commonly cause ovarian / appendage infections: Neisseria gonorrhoeae, Chlamydia trachomatis, Gardenerella vaginalis, Prevotella species, Bacteroides species, Peptococcus species, Streptococcus or Escherichia coli species.

The following bacterial species commonly cause uterine infections: Neisseria gonorrhoeae, Chlamydia trachomatis, Gardenerella vaginalis, Prevotella spp., Bacteroides spp., Peptococcus spp., Streptococcus spp. Or Escherichia coli spp.

The following bacterial species usually cause cervical infections: Neisseria gonorrhoeae, Chlamydia trachomatis, or Treponema pallidum; or viral pathogens: herpes simplex virus.

The following bacterial species usually cause vaginal infections: Gardenerella vaginalis, Prevotella spp., Bacteroides spp., Peptococcus spp., Escherichia coli, Neisseria gonorrhoeae, Chlamydia Trachomatis or Treponema pallidum; or viral pathogens: herpes simplex virus.

The following bacterial species usually cause infections of the vulva: Staphylococcus aureus, Streptococcus pyogenes or Treponema pallidum; or viral pathogens: herpes simplex virus.

Bacterial strains / Viral subtypes

One skilled in the art will understand that bacterial species are functionally classified as groups of similar strains (which usually belong to groups that are supposedly of a common ancestor, with identifiable physiological but usually not morphological differences, and that can be identified using serological methods against surface bacterial antigens ) Thus, each bacterial species (e.g. Streptococcus pneumoniae) has numerous strains (or serotypes) that may differ in their ability to cause infection or in their ability to cause infection in a particular organ / site. For example, although at least 90 serotypes of Streptococcus pneumoniae exist, serotypes 1, 3, 4, 7, 8, and 10 are the serotypes most often responsible for pneumococcal diseases in humans.

As a second example, some strains of Escherichia coli, called extra-intestinal pathogenic strains of E. coli (ExPEC), are most likely to cause urinary tract infections or other extra-intestinal infections, such as meningitis in newborns, while other strains, including enterotoxigenic E. coli (ETEC ), enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EEC), producing Shiga toxin E. coli (STEC), enteroaggregative E. coli (EAEC), enteroinvasive E. coli (EIEC) and diffuse adherent E. coli ( DAEC) are most likely to cause a gastrointestinal infection / diarrhea. Even among the subcategory of ExPEC strains, specific virulence factors (e.g., type-1 fimbria production) allow some strains to be more able to cause bladder infection, while other virulence factors (e.g., fimbriae P production) allow other strains to be more able to cause infection in kidneys. According to the present invention, an ExPEC strain (s) that is more likely to cause an infection in the bladder can be selected for a drug aimed at a malignant tumor of the bladder, while an ExPEC strain (s) that is more likely to cause an infection in the kidney can be selected for a drug aimed at a malignant tumor of the kidneys. Similarly, one or more strains of E. coli ETEC, EPEC, EENC, STEC, EAEC, EIEC or DAEC (i.e., strains that cause colon infection) can be selected for a drug directed to a colon cancer.

Similarly, there are numerous subtypes of specific viruses. For example, there are three types of influenza viruses, influenza A virus, influenza B virus, and influenza C virus, which differ in epidemiology, host range, and clinical characteristics. For example, influenza A virus is most likely associated with a viral infection of the lungs, while influenza B virus is most likely associated with myositis (i.e., muscle infection). In addition, each of these three types of influenza virus has numerous subtypes, which may also differ in epidemiology, host range, and clinical characteristics. According to the present invention, the influenza A virus subtype most often associated with lung infection can be selected to target lung cancer, while the influenza B virus strain most often associated with myositis can be selected for the treatment of a muscle / soft tissue cancer.

It is clear that a clinical microbiologist who is a specialist in this field is able to select, based on the present description and the basic information in the field relating to bacterial strains for each type of bacteria (and virus subtypes for each type of virus), strains of a specific type of bacterium (or a subtype of a specific virus ) for targeted exposure to a specific organ or tissue.

Bacterial compositions, doses and administration

The compositions of the invention comprise antigens of pathogenic microorganisms (bacteria or viruses) that are pathogenic in a particular tissue or organ. The compositions may contain whole bacteria of a particular kind or may contain extracts or preparations of pathogenic bacteria according to the invention, such as extracts of cell walls or cell membranes, or whole cells or exotoxins, or whole cells and exotoxins. The compositions may also contain one or more isolated antigens from one or more pathogenic bacterial species according to the invention; in some embodiments, such compositions may be applicable in situations where it may be necessary to precisely administer a specific dose of a particular antigen, or may be applicable if the administration of whole bacteria of a particular species or their components (e.g., toxins) can be dangerous. Pathogenic bacterial species may be commercially available (e.g., from ATCC (Manassas, VA, USA), or may be clinical isolates obtained from a hundred subjects having a bacterial infection of a tissue or organ (e.g., pneumonia).

The microbial compositions according to the invention can be provided separately or in combination with other compounds (for example, nucleic acid molecules, small molecules, peptides or peptide analogs) in the presence of a liposome, adjuvant or any pharmaceutically acceptable carrier in a form suitable for administration to a mammal, for example, a human . As used herein, a “pharmaceutically acceptable carrier” or “excipient” includes any and all of the following components: solvents, dispersion media, coatings, antibacterial and antifungal agents, agents for isotonicity and delayed absorption, and the like, which are physiologically compatible. The carrier may be suitable for the appropriate form of administration, including subcutaneous, intradermal, intravenous, parenteral, intraperitoneal, intramuscular, sublingual, inhalation, intratumoral, or oral administration. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the manufacture of sterile injectable solutions or dispersions for immediate administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Unless any conventional medium or agent is incompatible with the active compound (i.e., specific bacteria, bacterial antigens or their compositions according to the invention), their use in pharmaceutical compositions according to the invention is contemplated. Auxiliary active compounds can also be included in the composition.

If desired, treatment with bacterial antigens according to the invention can be combined with more traditional and existing methods of treating a malignant tumor, such as chemotherapy, radiation therapy, surgery, etc., or in any other means of treatment designed to stimulate the immune system, reduce inflammation or other beneficial effects in the subject, such as nutrients, vitamins, and supplements. For example, vitamin A, vitamin D, vitamin E, vitamin C, vitamin B complex, zinc selenium, coenzyme Q10, beta-carotene, fish oil, curcumin, green tea, bromelain, resveratrol, chopped flaxseed, garlic, lycopene, milk thistle, melatonin, other antioxidants, cimetidine, indomethacin or COX-2 inhibitors (eg, celebrex ™ [celecoxib] or viox ™ [rofecoxib]) can also be administered to a subject.

You can use the usual pharmaceutical practice to obtain suitable preparations or compositions for the administration of compounds to subjects suffering from a malignant tumor. Any suitable route of administration may be used, for example, parenteral, intravenous, intracutaneous, subcutaneous, intramuscular, intracranial, intraocular, intraocular, intracranial, intracapsular, intraspinal, intraperitoneal, intranasal, inhalation, intrathoracic, intrathoracic, intrathoracic, aerosol, aerosol, aerosol, introduction. Therapeutic preparations may be in the form of liquid solutions or suspensions; in case of oral administration, the preparations may be in the form of tablets or capsules; in the case of intranasal preparations in the form of powders, nasal drops or aerosols; and in the case of sublingual preparations in the form of drops, aerosols or tablets.

Methods which are well known in the art to obtain preparations are described for example in «Remington's Pharmaceutical Sciences" (20 ^{th edition), ed. A. Gennaro} , 2000, Mack Publishing Company, Easton, PA . Formulations for parenteral administration e.g. may contain excipients, sterile water or a salt solution, polyalkylene glycols such as polyethylene glycol, vegetable oils or hydrogenated naphthalenes A biocompatible biodegradable lactide polymer, a lactide / glycolide copolymer or polyoxyethylene-polyoxypropylene copolymers can be used to control the release of compounds. Other potential delivery systems. include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. whether they can be oily solutions for administration in the form of nasal drops, or in the form of a gel. In the case of therapeutic or prophylactic compositions, the pathogenic bacterial species is administered to the individual in an amount effective to stop or slow the progression or metastasis of the malignant tumor, or to increase the viability of the subject (compared, for example, with forecasts obtained from the SEER database), depending on the disorder .

An “effective amount” of a pathogenic species of a microorganism or antigen thereof according to the invention includes a therapeutically effective amount or a prophylactically effective amount. A “therapeutically effective amount” refers to an amount effective, at dosages and for appropriate periods of time, in achieving the desired therapeutic result, such as reducing or eliminating malignant cells or tumors, preventing carcinogenesis, slowing tumor growth, or increasing survival time beyond what is expected when using, for example, the SEER database. A therapeutically effective amount of a pathogenic species of a microorganism (bacterium or virus) or its antigen (s) may vary according to factors such as the disease state, age, gender and weight of the individual and the ability of the compound to elicit the desired response in the individual. The dosage regimen can be adjusted to provide an optimal therapeutic response. A therapeutically effective amount may also be an amount: in which any toxic or harmful effects of a pathogenic bacterial species or virus or its antigen are outweighed by therapeutically beneficial effects. A “prophylactically effective amount” refers to an amount effective, at dosages and for necessary periods of time, in achieving the desired prophylactic result, such as preventing a malignant tumor, preventing metastases, slowing down tumor growth, reducing or eliminating malignant cells, tissues, organs or tumors, or an increase in the survival period beyond that expected when using, for example, the SEER database. Typically, a prophylactic dose is administered to subjects prior to or at an early stage of the cancer, so the prophylactically effective amount may be less than the therapeutically effective amount.

When administered via subcutaneous or intradermal injection, an approximate range of therapeutically or prophylactically effective amounts of one or more pathogenic bacteria can be from about 1 million to 100,000 million organisms per milliliter, or can be from 100 million to 7000 million organisms per milliliter, or can be from 500 million to 6,000 million organisms per milliliter, or may be from 1,000 million to 5,000 million organisms per milliliter, or may be from 2,000 million to 4,000 million organisms per milliliter, or any integer in the indicated ranges. The total concentration of bacteria in a milliliter can range from 1 million to 100,000 million organisms per milliliter, or can range from 50 million to 7,000 million organisms in a milliliter, or can range from 100 million to 6,000 million organisms in a milliliter, or can range from 500 million to 5,000 million organisms per milliliter, or may be from 1,000 million to 4,000 million organisms per milliliter, or any integer in the indicated ranges. The range of therapeutically or prophylactically effective amounts of antigens of a pathogenic bacterial species can be any integer in the range 0.1 nM - 0.1 M, 0.1 nM - C, 05 M, 0.05 nM - 15 μM or 0.01 nM - 10 μM.

It should be noted that the dose concentration and range may vary depending on the severity of the condition that needs to be improved, or may vary depending on the immune response of the subject. In general, the goal is to achieve an adequate immune response. In the case of administration using a subcutaneous or intradermal infection, the degree of the immune response can be determined, for example, by the size of the delayed local skin immune response at the injection site (e.g., from 0.25 inches (0.635 cm) to 4 inches (10.16 cm) in diameter ) The dose required to achieve an appropriate immune response may vary depending on the individual (and his immune system) and the desired response. You can also apply standardized doses. In the context of subcutaneous or intradermal administration, if the goal is to achieve a local skin reaction of 2 inches (5.08 cm), then the total dose of the bacterial composition may be, for example, in the range of 2 million bacteria (for example, 0.001 ml of a vaccine with a concentration of 2000 million organisms per milliliter) to more than 20,000 million bacteria (for example, 1 ml of a vaccine with a concentration of 20,000 million organisms per milliliter). You can also consider the concentration of certain types of bacteria or their antigens in the composition. For example, if the concentration of one particular pathogenic bacterial species, the size of cells of this kind or its antigenic load is much higher compared to other pathogenic bacterial species in the vaccine, then the individual’s local skin immune reaction may probably be the result of an answer to that particular bacterial species. In some embodiments, an individual’s immune system may respond more strongly to one type of bacteria in a composition than to another, depending, for example, on the history of infection of a particular species, so the dose or composition can be adjusted accordingly for that individual. However, in some embodiments described in detail in this publication, the immune response will not be monitored by skin reaction. For example, in some mouse models used in the present invention, effective treatment of such animals with antigenic compositions may lead to corresponding skin reactions. One skilled in the art will recognize that there are alternative ways in which an immune response can be controlled in addition to methods based on the presence or absence of a skin reaction.

For a particular subject, the time and dose for treatment can be adjusted over time (for example, the time of administration can be daily, every other day, weekly, monthly) in accordance with the needs of the individual professional decision of the person administering or observing the introduction of the compositions. For example, in the context of subcutaneous or intradermal administration, the compositions may be administered every other day. An initial dose of approximately 0.05 ml can be administered subcutaneously, with a subsequent increase of 0.01-0.02 ml every other day until an adequate skin reaction is achieved at the injection site (for example, a delayed reaction in the form of visible redness at the injection site with a diameter of 1 inch or more) (2.54 cm) to 2 inches (5.08 cm)). After achieving such an adequate immune response, the administration of such a dose is continued as a maintenance dose. The maintenance dose can be adjusted from time to time to achieve the desired visible skin reaction (inflammation) at the injection site. The administration of a dose may be, for example, for at least 1 week, 2 weeks, 2 months, 6 months, 1, 2, 3, 4 or 5 years or longer.

Oral doses can be, for example, in the range of 10 million to 1,000,000 million organisms per dose containing antigenic determinants of one or more species. Oral dose can be taken, for example, from 4 times a day, daily or weekly. Duration administration may be, for example, at least 1 week, 2 weeks, 2 months, 6 months, 1, 2, 3, 4, or 5 years or longer.

In some embodiments, the invention can relate to antigenic compositions administered sublingually or by inhalation, or administered to one or more epithelial tissues (i.e., into the skin by intradermal or subcutaneous injection; into the epithelium of the lung by inhalation; into the mucosa of the gastrointestinal tract by oral administration; into the oral mucosa as a result of sublingual administration) simultaneously or sequentially. Accordingly, in some embodiments, the antigenic compositions of the invention are administered to elicit an immune response in epithelial tissue. In some embodiments, one or more epithelial routes of administration can be combined with one or more additional routes of administration, such as intratumoral, intramuscular, or intravenous administration.

In various aspects of the invention, antigenic compositions that are administered to a patient can be characterized as having an antigenic characteristic, i.e. a combination of antigens or epitopes that are specific enough so that the antigenic composition is capable of eliciting an immune response that is specific for a particular pathogen, such as an adaptive immune response. An amazing and unexpected aspect of the invention is that a non-adaptive or non-specific activation of the immune response, which mediated by such specific antigenic compositions, it is effective for the treatment of malignant tumors located in tissues in which a particular pathogen is pathogenic.

Routes of administration and dose ranges indicated herein are illustrative only and do not limit the route of administration and dosage ranges that can be selected by a healthcare professional. The amount of active compound (for example, pathogenic species of bacteria or viruses or their antigens) in the composition may vary depending on factors such as the condition of the disease, age, gender and weight of the individual. Dosage regimens can be adjusted to provide an optimal therapeutic response. For example, you can enter a single bolus, you can enter several fractional doses over a certain period of time, or the dose can be proportionally reduced or increased in connection with needs. a specific therapeutic situation. It may be preferable to obtain parenteral compositions in unit dosage form for ease of administration and uniformity of dosage.

In the case of antigenic preparations (similar to a vaccine), an immunogenically effective amount of a compound, alone or in combination with other compounds, with an immunological adjuvant may be presented. The compound may also be coupled to a carrier molecule, such as bovine serum albumin or keyhole sea saucer hemocyanin, to enhance immunogenicity. An antigenic composition (“vaccine”) is a composition that contains materials that elicit the desired immune response. The antigenic composition can select, activate, or promote expansion without limitation: memory B cells, T cells, neutrophils, monocytes or macrophages of the immune system, for example, to reduce or eliminate the growth or proliferation of malignant cells or tissue. In some embodiments, a particular pathogenic microorganism, virus, viral antigens, bacteria, bacterial antigens or compositions thereof according to the invention are capable of eliciting the desired immune response in the absence of any other agent and, therefore, can be considered an antigenic composition. In some embodiments, the antigenic composition comprises a suitable carrier, such as an adjuvant, which is an agent that acts in a non-specific manner, enhancing the immune response to a particular antigen or group of antigens, making it possible to reduce the amount of antigen in any given dose of vaccine or to reduce the frequency of administration of doses necessary to create the desired immune response. A bacterial antigenic composition may contain live or dead bacteria capable of inducing an immune response against antigenic determinants normally associated with bacteria. In some embodiments, the antigenic composition may contain live bacteria that belong to less virulent strains (attenuated) and therefore cause a less severe infection. In some embodiments, the antigenic composition may comprise live, attenuated, or dead viruses capable of inducing an immune response against antigenic determinants normally associated with the virus.

An antigenic composition containing killed bacteria for administration by injection can be prepared as follows. Bacteria can be grown in suitable media and washed with saline. Then the bacteria can be centrifuged, resuspended in saline and killed by heat. Suspensions can be standardized by direct microscopic counting, mixed in the required quantities and stored in suitable containers that can be used to test safety, shelf life and sterility accordingly. In addition to pathogenic bacterial species and / or their antigens, a vaccine with killed bacteria suitable for administration to humans may contain 0.4% phenolic preservative and / or 0.9% sodium chloride. A bacterial vaccine may also contain trace amounts of cardiac extract (bull), peptones, yeast extract, agar, sheep blood, dextrose, sodium phosphate and / or other components of the medium.

In some embodiments, the bacterial vaccine can be used in the form of tablets or capsules or drops for oral administration, in the form of an aerosol for inhalation, or in the form of drops, in the form of an aerosol or tablets for sublingual administration.

In antigenic compositions containing bacteria, the concentration of specific types of bacteria in the compositions for subcutaneous or intradermal injection can be from about 1 million to 100,000 million organisms per milliliter, or can be from 100 million to 7000 million organisms per milliliter, or can be from 500 million up to 6,000 million organisms per milliliter, or may be from 1,000 million to 5,000 million organisms per milliliter, or may be from 2,000 million to 4,000 million organisms per milliliter, or any integer in the indicated ranges. The total concentration of bacteria per milliliter can range from 1 million to 100,000 million organisms per milliliter, or can range from 50 million to 7,000 million organisms per milliliter, or can range from 100 million to 6,000 million organisms per milliliter, or can range from 500 million to 5,000 million organisms per milliliter, or may be from 1,000 million to 4,000 million organisms per milliliter, or any integer in the indicated ranges.

In some embodiments, the vaccine of the selected killed bacteria against a malignant tumor of the lung tissue may contain the usual bacterial pathogens of the lungs, and may be, for example:

In some selected embodiments, the vaccine of the selected killed bacteria against a malignant tumor of the lung tissue can contain only the more common bacterial pathogens of the lungs, and can be, for example:

In the following selected embodiments, the vaccine of the selected killed bacteria against a malignant tumor of the lung tissue may contain only the most common bacterial pathogen of the lung and may be:

In some embodiments, an antigenic microbial composition for treating a malignant tumor in a specific location (e.g., a malignant tumor of the lung tissue) may contain pathogens that broadly, more widely, or most widely cause infection in such a tissue or organ (e.g., infection in the lung tissue, t .e. pneumonia).

In general, pathogenic bacterial species and their antigens according to the invention that do not cause significant toxicity should be used. The toxicity of the compounds according to the invention can be determined using standard methods, for example, testing in cell cultures or experimental animals and determining the therapeutic index, i.e. ratio between LD50 (dose lethal for 50% of the population) and LD100 (dose lethal for 100% of the population).

In some aspects, the invention relates to the use of an anti-inflammatory agent together with vaccination. In such embodiments, a wide variety of anti-inflammatory drugs can be used, including effective amounts of non-steroidal anti-inflammatory drugs (NSAIDs), including but not limited to: diclofenac potassium, diclofenac sodium, etodolac, indomethicin, trometamine ketor'olac, sulindac, sodium tomethine, celecoxib, meloxicam, valdecoxib, flactaphenin, mefenamic acid, nabumetone, meloxicam, piroxicam, tenoxicam, calcium phenoprofen, clubfrofen, ibuprofen, ketoprofen, naproxen, sodium naproxen, oxaprozin, thiaprofenic acid, acetylsalicilicinilinalicilinalicilin dialinate, trichalic anilate, caliphate, trichalate, triacylate COX1, COX2 inhibitors (e.g. Vioxx ™ and Celebrex ™). Various greens and natural healthy foods can also be used to carry out anti-inflammatory treatments, including without limitation: green tea, fish oil, vitamin D, antioxidant vitamins and minerals (e.g. B-carotene, vitamin A, vitamin C, vitamin D, vitamin E, coenzyme Q10, selenium, etc.), resveratrol, turmeric, bromelain, boswellia, feverfew, quercetin, ginger, rosemary, marjoram, cayenne pepper, cloves, nutmeg, willow bark. Alternative anti-inflammatory drugs also include lifestyle changes, such as: exercise, weight loss, smoking cessation, stress reduction, seeking social support, treating depression, managing stress, gymnastics in the form of abdominal breathing, and changing your diet (such as using the Mediterranean diet, low glycemic diet, the use of uncarbonized foods, including foods containing omega-3 fatty acids).

As described in detail in this publication and in one aspect of the invention, a method for comparing immune responses is provided. The method includes administering to an animal having an organ or tissue a medicament comprising an antigenic composition as defined herein. The antigenic composition may contain antigenic determinants selected or prepared so that together the antigenic determinants are specific for at least one microbial pathogen that is pathogenic in the organ or tissue, extracting a quantifiable immune sample from an organ or tissue, measuring the characteristics of the immune response in an organ or tissue in a quantifiable immune sample after drug administration, and comparing the characteristics of the immune response in a quantifiable immune sample with the corresponding immune response in a reference immune sample obtained from the corresponding organ or tissue. As used herein, an immune sample may contain a sufficient amount of biological material to characterize an immune response. As used herein, the “characterization” of an immune response can include, but is not limited to, a specific amount of a specific tissue of immune cells (eg, macrophages), or a specific cell marker (eg, upregulating integrin), or a gene product (eg, cytokine). The foregoing is provided as an example and is not limiting.

Optionally, a reference immune sample can be obtained from an appropriate organ or tissue of an animal before the drug administration step. In another aspect, the reference immune sample can be obtained from the corresponding organ or tissue of the second animal, so it is specifically contemplated that at least two animals (i.e., the animal from which the reference immune sample is obtained, and the second animal, from which receive a quantifiable immune sample) can be used in the methods described in this publication. Optionally, the animal may have a malignant tumor located in an organ or tissue.

Comparison of the characteristics of the immune response can consist in comparing in quantitative and reference immune samples the indicator of the number of any one or more of the following types of cells, and such cells are known to specialists in this field: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells , CD11c + MHC class II + cells, CD4 + T cells, CD8 + T cells, or NK cells. Optionally, macrophages may include any one or more of the following cell types: M1-like macrophages or M2-like macrophages.

Those skilled in the art will understand that macrophages can be defined either as "M1-like macrophages" or as "M2-like macrophages." For example, as is commonly understood by those skilled in the art, M1-like macrophages stimulate a Th1 CD4 + T-cell mediated response (see, for example, Biswas and Mantovani (2010), Nature Immunology 10: 889-96). In addition, it is generally understood that M1-like macrophages have an effective antigen-presenting ability and are capable of killing intracellular pathogens (e.g. viruses). In addition, it is generally understood that M1-like macrophages are capable, at least in comparison with M2-like macrophages, of playing an immunological role in the destruction of tumors. Those skilled in the art will understand that there are numerous biological markers that can be used to distinguish between M1-like macrophages and M2-like macrophages. For example, and as described in detail in this publication, it is usually assumed that Nos2 expression correlates with M1-like macrophages compared to M2-like macrophages (see, for example, Laskin et al. (2010) Annual Rev. Pharmacol. Toxicol. 51: 267-288). In addition, for example, it is generally understood that M1-like macrophages produce IL-12 and are effectively activated by IFN-γ via IFN-γR (Biswas and Mantovain, supra).

Those skilled in the art will generally understand that, unlike M1-like macrophages, M2-like macrophages stimulate a Th2 CD4 + T-cell mediated response (in general, see: Biswas and Mantovani (2010), Nature Immunology 10: 889 -96). In addition, it is usually understood that M2-like macrophages are effective in encapsulating and clearance of extracellular parasites, etc. Furthermore, it is generally understood by those skilled in the art that, compared to M1-like macrophages, M2-like macrophages play a more significant role in the immunological regulation of Treg cells and B cells (Biswas and Mantovain, supra). Those skilled in the art will understand that there are numerous biological markers that can be used to distinguish M2-like macrophages from M1-like macrophages. For example, and as described in this publication, it will usually be understood that reduced Nos2 expression correlates with M2-like macrophages, compared to the higher expression commonly observed in M1-like macrophages. In addition, and as detailed in the description of experiments in this publication, it is usually understood that expression of CD206 correlates with M2-like macrophages (see, for example, Choi et al. (2010) Gastroenterology 138 (7) 2399-409). In addition, and as detailed in the description of experiments in this publication, it is generally understood that expression of F4 / 80 correlates with M2-like macrophages. In addition, for example, as is commonly understood, M2-like macrophages are effectively activated by IL-4 or IL-13 via IL-4Ra (Biswas and Mantovain, supra).

In addition, comparing the characteristics of the immune response may consist in comparing the shift in the state of activation of macrophages. A shift in the state of macrophage activation may not necessarily be characterized as a shift from M2-like macrophages to M1-like macrophages or vice versa. Specialists in this field will understand that there are numerous biological markers that can be used to monitor macrophage activation. As described in detail in this publication, it will be understood by those skilled in the art that the definition of a macrophage as activated towards either an Ml-like phenotype or an M2-like phenotype may be accompanied by a selection of markers that are known to be associated with any of the corresponding phenotypes described in this publication. Diseases that are associated with M1 and M2 macrophages include at least the following diseases: atherosclerosis (see, for example, Hirata et al. (2011) J. Am. Coll. Cardiol. 58 (3): 248-255) allergic asthma (see, for example, Moreira and Hogaboam (2011) J. Interferon. Cytokine Res. 31 (6): 485-91), autoimmune prostatitis (see, for example, Zhang and Schluesener (2011) Prostate), colitis (see e.g. Waddell et al. (2011) J. Immunol. 186 (10): 5993-6003), COPD (see, e.g., Kunz et al. (2011) Respir. Res. 22: 34), glomerulonephritis (see, e.g. Fujita et al. (2010) Am. J. Pathol. 177 (3): 1143-54), inflammatory bowel disease (see, for example, Wendelsdorf et al. (2010) J. Theor. Biol. 264 (4): 1225-39 ), chronic pneumonia (see, for example, Redente et al. (2010) J. Leukoc. Biol. 88 (1): 159-68), steatohepatitis (see, for example, Rensen et al. (2009) Am. J. Pathol. 175 (4): 1473-82), pancreatitis (see, on Example, Gea-Sorli and Closa (2009) IUD Immunol. 31: 42), myocarditis (see, for example, Li et al. (2009) Cire. Res. 105 (4): 353-64), liver fibrosis (see, for example, Heymami et al. (2009) Inflamm. Allergy Drug Targets 8 (4): 307-18), cystic fibrosis (see, for example, Meyer et al. (2009) Am. J. Respir. Cell Mol. Biol. 41 (5): 590-602), inflammatory kidney disease (see, for example Wang et al. (2007) Kidney Int. 72 (3): 290-299) and silicosis (see, e.g., Misson et al. (2004) J. Leukoc. Biol. 76 (5): 926-232).

Optionally, a comparison of the characteristics of the immune response may consist in identifying, in quantitatively measured and reference immune samples, cell markers on any one or more of the following cell types in their usual meaning for those skilled in the art: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + cells of MHC class II +, CD4 + T cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. One skilled in the art will recognize that there are numerous cellular markers (both extracellular and intracellular) that can be selected and which can identify an immune response. For example, as described in this publication, it is usually assumed that the CD206 marker correlates with M2-like macrophages (see, for example, Choi et al. (2010) Gastroenterology 138 (7) 2399-409).

Optionally, a comparison of the characteristics of the immune response can consist in identifying in quantitatively measured and reference immune samples of cytokines produced by any one or more of the following cell types in their usual meaning for specialists in this field: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + cells of MHC class II +, CD4 + T-cells, CD8 + T-cells or NK cells. Those skilled in the art will understand that cytokines are small protein molecules that transmit signals in cells, and that there are numerous cytokines known in the art. For example, cytokines were grouped into type 1 and type 2 classification groups based on their role in immunological responses. Typical type J. cytokines include IFN-γ and TGF-β. Typical type 2 cytokines include, but are not limited to, IL-4 and IL-13. Cytokines can be detected in various ways known to specialists in this field. For example, and as described in detail in this publication, ELISA experiments are used to determine the production of cytokines in lung tissue (see, for example, Figure 27).

As described in detail in this publication, macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages that have been identified in the present description. Optionally, cytokines are produced as a result of a shift in macrophage activation state. Optionally, a shift of macrophages occurs, from M2-like macrophages to M1-like macrophages. In addition and optionally, macrophages shift from M1-like macrophages to M2-like macrophages.

Optionally, a comparison of the characteristics of the immune response may consist in identifying, in quantitatively measured and reference immune samples, differential gene expression carried out by any one or more of the following cell types in their usual meaning for those skilled in the art: inflammatory monocytes, macrophages, CD11b + Gr-1 cells +, dendritic cells, CD11c + MHC class II + cells, CD4 + T cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. The term "differential gene expression" is understood to mean a marked difference in the expression of a particular gene of interest in at least two experimental conditions. For example, if, in the first experimental conditions, a particular gene has a certain expression level, which is determined by methods for determining gene expression by specialists in this field, and if in the second experimental conditions the same gene has a noticeable difference in expression level, then there is differential expression of the gene of interest. Those skilled in the art will understand that there are numerous techniques by which differential gene expression can be detected. For example, you can use commercially available methods for quantitative PCR, which are described in detail in this publication with respect to determining the ratio of Nos2 / Arg1 (see, for example, figure 29). Optional differential gene expression is carried out as a result of a shift in the state of activation of macrophages. Optionally, macrophages may shift from M2-like macrophages to M1-like macrophages in the sense in which such terms are defined in this publication.

In another embodiment, the drug may be administered at the injection site in the form of sequentially administered doses with an interval between doses of one hour to one month over a dosing period of at least one week. Optionally, the drug may be administered intradermally or subcutaneously. Optionally, the drug can be administered in such doses that each dose effectively elicits a visible localized inflammatory immune response at the injection site. Optionally, the drug can be administered so that a visible localized inflammation at the injection site appears within 1 to 48 hours. However, a visible localized inflammatory immune response may not always be present in any circumstances, despite the initiation of an immune response. Specialists in this field will be clear that there are other methods by which you can observe the formation of the immune response. For example, the profile (and relative change in characteristic) of immune cells in a subject undergoing an immune response can be compared with the profile in a subject that is not undergoing an immune response.

As for the methods disclosed in the present description, in addition, and optionally, the animal may be a mammal. Optionally, the animal may be a human or a mouse. The foregoing is offered as examples and does not mean limitation.

In another aspect, a method of selecting a therapeutic drug suitable for treating an individual in connection with a malignant tumor in a particular organ or tissue is provided. The method includes obtaining an animal having a malignant tumor located in a specific organ or tissue, obtaining a test preparation containing one or more antigenic determinants of a microbial pathogen that is pathogenic in a corresponding specific organ or tissue in a healthy individual, measuring an immune response characteristic in a reference an immune sample obtained from an organ or tissue of an animal, administering a test preparation to an animal, measuring an immune response characteristic in a quantifiable immune sample obtained from a corresponding organ or tissue of an animal, comparing an immune response characteristic in a reference and quantitative immune sample, and processing an enhanced immune response characteristic in a quantifiable immune sample compared to a reference immune sample as an indicator of the applicability of the test drug as a therapeutic drug. Optionally, the animal is sacrificed to obtain a quantifiable immune sample.

Optionally, a comparison of the characteristics of the immune response can consist in comparing, in quantitatively measured and reference immune samples, the indicator of the number of any one or more of the following cell types in their usual value for those skilled in the art: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + cells of MHC class II +, CD4 + T cells, CD8 + T cells, or NK cells. Optionally, macrophages may include any one or more of the following cell types: M1-like macrophages or M2-like macrophages, in the sense in which such terms are defined in this publication. Optionally, comparing the characteristics of the immune response may consist of comparing the shift in the state of activation of macrophages. Optionally, a shift of macrophages from M2-like macrophages to M1-like macrophages can occur. In addition, and optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

Optionally, a comparison of the characteristics of the immune response may consist in identifying, in quantitatively measured and reference immune samples, cell markers on any one or more of the following cell types in their usual meaning for those skilled in the art: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, class II + CD11c + MHC cells, CD4 + T cells, CD8 + T cells, or NK cells. Optionally, macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages, in the sense in which such terms are defined in this publication.

Optionally, a comparison of the characteristics of the immune response may consist in identifying in a quantifiable and reference immune samples cytokines produced by any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 cells, dendritic cells, CD11c + MHC class II +, T cells CD4 + cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages, in the sense in which such terms are defined in this publication. Optionally, cytokines are produced as a result of a shift in macrophage activation state. Optionally, a shift of macrophages from M2-like macrophages to M1-like macrophages can occur.

In addition and optionally, a comparison of the characteristics of the immune response can consist in identifying, in quantitatively measured and reference immune samples, differential gene expression carried out by any one or more of the following cell types: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, cells CD11c + MHC class II +, CD4 + T cells, CD8 + T cells, or NK cells. Optionally, macrophages may include any one or more of the following cell types: M1-like macrophages or M2-like macrophages, in the sense in which such terms are defined in this publication. Optionally, differential gene expression may occur as a result of a shift in macrophage activation state. Optionally, a shift of macrophages from M2-like macrophages to M1-like macrophages can occur. In addition, and optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

In another aspect, a method for selectively targeting an immune response to a malignant tissue or organ in humans is provided. The method includes administering to a subject a medicament containing an effective amount of an antigenic composition of a microbial pathogen, wherein the microbial pathogen may be pathogenic in a particular malignant organ or tissue of the subject, and the antigenic composition contains antigenic determinants that together are specific for the microbial pathogen. Optionally, the antigenic composition may comprise a composition of whole killed bacterial cells. Optionally, the drug can be administered to the subject in an amount and over a period of time that are effective for up-regulating the immune response in a malignant organ or tissue of the subject. Optionally, the method may further include measuring the characteristics of the immune response.

In another aspect, a method for treating a person in connection with a malignant tumor located in a tissue or organ is provided. The method includes administering to a subject a medicament containing an effective amount of an antigenic composition of a microbial pathogen containing a composition of whole killed bacterial cells, wherein the microbial pathogen is pathogenic in a particular organ or tissue of the subject in which the malignant tumor is located. A drug can be administered to a subject in an amount and over a period of time that are effective for modulating the immune response. Optionally, the modulation of the immune response may be a shift in the state of activation of macrophages. Optionally, the modulation of the immune response may consist of a shift from the response of M2-like macrophages to the response of M1-like macrophages. The modulation of the immune response may consist of a shift from the response of M1-like macrophages to the response of M2-like macrophages. Optionally, the method may further include measuring the characteristics of the immune response.

Optionally, a comparison of the characteristics of the immune response may consist in comparing, in quantitatively measured and reference immune samples, the indicator of the number of any one or more of the following cell types in their usual value for those skilled in the art: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + MHC class II + cells, CD4 + T cells, CD8 + T cells, or NK cells Optionally, macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages, in which such terms are defined in this publication. Optionally, comparing the characteristics of the immune response may be a comparison of the shift in the state of activation of macrophages. In addition and optionally, there may be a shift of macrophages from M2-like macrophages to M1-like macrophages. Optionally, a shift of macrophages from M1- similar macrophages to M2-like macrophages.

In addition and optionally, a comparison of the characteristics of the immune response can consist in identifying, in quantitatively measured and reference immune samples, cell markers on any one or more of the following cell types in their usual meaning for those skilled in the art: inflammatory monocytes, macrophages, CD11b + Gr cells -1 + -, dendritic cells, CD11c + cells of MHC class II +, CD4 + T cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages, in the sense in which such terms are defined in this publication. Optionally, a comparison of the characteristics of the immune response may consist in the identification of quantitatively measured and reference immune samples of cytokines produced by any one or more of the following cell types in their usual meaning for specialists in this field: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells, dendritic cells, CD11c + cells of MHC class II +, CD4 + T-cells, CD8 + T-cells or NK-cells. Optionally, macrophages may include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. In addition, cytokines can be produced as a result of a shift in the state of activation of macrophages. Macrophage shifts from M2-like macrophages to M1-like macrophages can occur. Optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

In addition and optionally, a comparison of the characteristics of the immune response can consist in identifying, in quantitatively measured and reference immune samples, differential gene expression carried out by any one or more of the following cell types in their usual meaning for specialists in this field: inflammatory monocytes, macrophages, CD11b + cells Gr-1 +, dendritic cells, CD11c + cells of MHC class II +, CD4 + T-cells, CD8 + T-cells or NK-cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Optionally, differential gene expression may occur as a result of a shift in macrophage activation state. In addition and optionally, a shift of macrophages from M2-like macrophages to M1-like macrophages can occur. Macrophage shifts from M1-like macrophages to M2-like macrophages can occur.

In another aspect, a method for monitoring the effectiveness of a treatment regimen in an individual being treated in connection with a malignant tumor in a particular organ or tissue is provided. The method includes measuring the characteristics of the immune response in an immune sample after treatment, obtained from a specific organ or tissue after the individual has been subjected to a treatment regimen for a certain period of time, while having an immune response characteristic that exceeds the value that as might be expected, an individual who has not undergone this treatment regimen is an indicator of the effectiveness of the treatment regimen; and the treatment regimen includes administering a preparation containing one or more antigenic determinants of a microbial pathogen that is pathogenic in a corresponding specific organ or tissue in a healthy subject.

The method described in detail in this publication may further include measuring the characteristics of the immune response in the reference sample obtained before treatment, wherein the reference sample obtained before treatment is obtained from a specific organ or tissue before, at or after the start of the treatment regimen, but before receiving an immune sample after treatment, and comparing the characteristics of the immune response in samples obtained before treatment and after treatment, while an increase in the magnitude of the immune response in the immune sample after treatment compared with the reference sample obtained before treatment is an indicator of the effectiveness of the treatment regimen. Optionally, measuring the response of the immune response may be to determine an indicator of the number of inflammatory monocytes in an organ or tissue sample. Optionally, measuring the response of the immune response may consist of determining an indicator of the number of macrophages in an organ or tissue sample. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages.

Optionally, measuring the response of the immune response may be to determine an indicator of the number of CD11b + Gr-1 + cells in a sample of an organ or tissue, or to determine an indicator of the number of dendritic cells in a sample of an organ or tissue. In addition and optionally, measuring the response of the immune response may be to determine the CD11c + MHC class II + cell count in an organ or tissue sample, or in determining the CD4 + T-cell count in an organ or tissue sample, or in determining the CD8 + T-cell count in an organ or tissue sample.

Optionally, measuring the magnitude of the immune response may consist in determining an indicator of the number of NK cells in an organ or tissue sample. In addition and optionally, a comparison of the characteristics of the immune response may consist in identifying cell markers in the reference and immune samples on any one or more of the following cell types in their usual meaning for those skilled in the art: inflammatory monocytes, macrophages, CD11b + Gr-1 cells +, dendritic cells, CD11c + cells of MHC class II +, CD4 + T cells, CD8 + T cells, or NK cells. Optionally, macrophages may include any one or more of the following cell types: M1-like macrophages or M2-like macrophages.

In addition and optionally, a comparison of the characteristics of the immune response may consist in the identification in the reference and immune samples of cytokines produced by any one or more of the following cell types in their usual meaning for specialists in this field: inflammatory monocytes, macrophages, CD11b + Gr-1 cells +, dendritic cells, CD11c + cells of MHC class II +, CD4 + T cells, CD8 + T cells, or NK cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Optionally, cytokines can be produced as a result of a shift in macrophage activation state. Macrophage shifts from M2-like macrophages to M1-like macrophages can occur. In addition and optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

Optionally, a comparison of the characteristics of the immune response may consist in the identification in the reference and immune samples of the differential gene expression carried out by any one or more of the following cell types in their usual meaning for specialists in this field: inflammatory monocytes, macrophages, CD11b + Gr-1 + cells , dendritic cells, CD11c + cells of MHC class II +, CD4 + T-cells, CD8 + gr-cells or NK-cells. Macrophages can include any one or more of the following cell types: M1-like macrophages or M2-like macrophages. Differential gene expression can be achieved as a result of a shift in the state of macrophage activation. Macrophage shifts from M2-like macrophages to M1-like macrophages can occur. Optionally, a shift of macrophages from M1-like macrophages to M2-like macrophages can occur.

In various aspects, embodiments of the invention relate to a method for treating a cancer located in a lung of a subject. The method includes administering to the subject an effective amount of antigen of one or more types of microorganisms that are pathogenic in the lung, and administering to the subject an effective amount of a chemotherapeutic agent containing platinum. The type of microorganism may be a viral pathogen or a bacterial pathogen, or a fungal pathogen.

As used herein, the phrase “treating a malignant tumor” may include, without limitation, a decrease in the tumor load of the lung in a subject or an increase in life expectancy in a subject that has lung cancer. It will be understood that there are numerous biological indicators that those skilled in the art can use to determine whether a cancer is being treated or not.

The viral pathogen used in the present invention may be without limitation: influenza virus, adenovirus, respiratory syncytial virus, parainfluenza virus, monkeypox virus, herpes simplex virus (1 and 2), chickenpox virus, cytomegalovirus, Epstein-Barr virus, coronavirus, human metapneumovirus, Hendra virus, Nipah virus, hantavirus, Lass virus, T cell lymphotrophic virus, Coxsackie virus, echovirus, enterovirus or rhinovirus or any virus that is pathogenic in the lung.

The bacterial pathogen used in the present invention may be without limitation: Streptococcus pneumoniae, Moraxella catarrhalis, Mycoplasma pneumoniae, Klebsiella pneumoniae, Haemophilus influenza, Staphylococcus aureus, Chlamydia pneumoniae, which Legionella pneumophila or Bordatella pertussis.

The fungal pathogen used in the present invention may be, without limitation: Aspergillus fumigatus, Blastomyces spp., Coccidiodes immitis, Coccidiodes posadasii, Cryptococcus neoformans, Cryptococcus gattii, Fusarium species, Histoplasma picecillicis pimocillicis cereis, Paecilomycis cerecida cereis, Brachis papillidae, Pecilomycis cerecida cereis, Pecilomycis cerecida cereis, Pecilomycis cerecida cerebriidae boydii, Scedosporium apiospermum, Rhizopus species, Mucor species, Absidia species, Cunninghamella, Scedosporium prolificans, Stachybotrys chartarum, Trichoderma longibrachiatium, Trichosporon species or any fungus that is pathogenic in the lung.

As used herein, the term “platinum-containing chemotherapeutic agent” includes, but is not limited to: cisplatin, carboplatin or ormaplatin, oxaliplatin, DWA2114R ((-) - (R) -2-aminomethylpyrrolidine (1,1-cyclobutanedicarboxylato) platinum), zeniplatin , enloplatin, lobaplatin, CI-973 (SP-43 (R) -1,1-cyclobutanedicarboxylato (2 -) - (2-methyl-1,4-65-butanediamine-N, N ') platinum), 254-S -nedaplatin, JM-216 (bis-acetatoamindichlorocyclohexylamineplatinum (IV)), (see: Weiss, RB and Christian, M.C., New Cisplatin Analogue in Development, Drugs, 46: (03) 360-377 (993)) ; (CPA) 2Pt [DOLYM] - and (DACH) Pt [DOLYM] cisplatin (Choi et al., Arch. Pharmacal. Res. 22 (2): 151-156, 1999); analogue of 254-S-cisplatin (Koga et al., Neurol. Res. 18 (3): 244-247, 1996); cis-1,4-diaminocyclohexancisplatin analogues (Shamsuddin et al., J. Inorq. Biochem. 61 (4): 291-301, 1996); MeOH-cisplatin (Shamsuddin et al., Inorg. Chem. 36 (25): 5969-5971, 1997); analogue of CI-973-cisplatin (Yang et al., Int. J. Oncol. 5 (3): 597-602, 1994); cis-diamindichloroplatin (II) and its analogues cis-1,1-cyclobutanedicarbosylate- (2R) 2-methyl-1,4-butanediaminplatinum (II) and cis-diamine (glycolato) platinum (Claycamp & Zimbrick, J. Inorg. Biochem .26 (4): 257-67, 1986; Fan etal. Cancer Res. 48 (11): 3135-9, 1988; Heiger-Bernays et al. Biochemistry 29 (36): 8461-6, 1990; Kikkawa etal. , J. Exp. Clin. Cancer Res. 12 (4): 233-40, 1993; Murray et al. Biochemistry 31 (47): 11812-17.1992; Takahashi et al., Cancer Chemother. Pharmacol. 33 (l ): 31-5, 1993), heme diphosphonate-cisplatin analogues (FR 2683529), cisplatin analogues containing a linked dansil group (Hartwig et al., J. Am. Chem. Soc. 114 (21): 8292-3, 1992), Aminoalkylaminoanthraquinone-derived cisplatin analogues (Kitov et al., Eur. J. Med. Chem. 23 (4): 381-3, 1988), spiroplatin, carboplatin, iproplatin and JM40-platinum analogues (Schroyen et al., Eur. J. Cancer Clin. Oncol. 24 (8): 1309-12, 1988), and cisplatin analogues JM8 and JM9 (Harstrick et al., Int. J. Androl. 10 (1); 39-45, 1987).

In another aspect, the use of an effective amount of antigen of one or more types of microorganisms that are pathogenic in the lung is provided for the manufacture of a medicament for use with a chemotherapeutic agent containing platinum for the treatment of lung cancer in a subject. In another aspect, it is proposed the use of an effective amount of antigen of one or more types of microorganisms that are pathogenic in the lung, for use with a chemotherapeutic agent containing platinum, which is described in detail in this publication, for the treatment of lung cancer in a subject. The type of microorganism may be a viral pathogen or a bacterial pathogen, or a fungal pathogen, which are described in detail in this publication.

In another aspect, an effective amount of an antigen of one or more types of microorganisms that are pathogenic in the lung is provided for the manufacture of a medicament for use with a chemotherapeutic agent / containing platinum for treating lung cancer in a subject. In another aspect, an effective amount of an antigen of one or more types of microorganisms that are pathogenic in the lung is provided for use with a chemotherapeutic agent containing platinum, which is described in detail in this publication, for treating lung cancer in a subject. The type of microorganism may be a viral pathogen or a bacterial pathogen, or a fungal pathogen, which are described in detail in this publication. A chemotherapeutic agent containing platinum may be without limitation: cisplatin, carboplatin or oxaliplatin.

In another aspect, a kit is provided. The kit contains an antigen of one or more types of microorganisms that are pathogenic in the lung, a chemotherapeutic agent containing platinum; and instructions for receiving the antigen and chemotherapeutic agent containing platinum by a subject in need of such administration. The type of microorganism may be a viral pathogen or a bacterial pathogen, or a fungal pathogen, which are described in detail in this publication.

In various aspects, embodiments of the invention relate to compositions containing components of organisms that can cause infections of the gastrointestinal tract, so that the body can be characterized as a pathogen. However, an organism that is pathogenic in some cases cannot always cause a disease. Most animals are colonized to some extent by other organisms, such as bacteria, which usually exist in a symbiotic or commensal relationship with the host animal. Thus, many species of normally harmless bacteria are found in healthy animals, and they are usually located on the surface of specific organs and tissues. Often, such bacteria help the body function properly. For example, in humans, the symbiotic bacteria Escherichia coli can be found in the intestines, where they stimulate immunity and reduce the risk of infection by more virulent pathogens.

Bacteria that are usually non-hazardous, such as Escherichia coli, can cause infection in healthy subjects, the result of which can range from moderate to severe infection and even death. Whether an organism, such as a bacterium, is pathogenic (i.e., causes an infection) or not, to a certain extent depends on such factors as the pathway of penetration and access to specific cells, tissues or organs of the host; virulence inherent in bacteria; the number of bacteria present at the site of a potential infection; or the health status of the host animal. Thus, organisms that are normally harmless can become pathogenic under conditions favorable for infection, and even the most virulent organisms may require special conditions in order to cause infection. Accordingly, organisms that are representatives of the normal flora can be pathogens when they emerge from their normal ecological role in the endogenous flora. For example, endogenous species can cause infection outside their ecological niche in anatomically close areas, for example, as a result of spreading to adjacent areas. When this happens in the context of the present invention, such normally non-hazardous endogenous organisms are considered pathogenic.

It is known that specific organisms, such as bacterial species, viruses, worms and protozoa, cause infections in specific areas of the gastrointestinal tract in otherwise healthy subjects. Examples of organisms that commonly cause infections in specific areas of the gastrointestinal tract are listed below; it will be understood that such examples are not intended to be limiting, and that a specialist will be able to easily recognize and identify infectious or pathogenic organisms that cause infections or usually cause infections in various areas of the gastrointestinal tract in healthy adults, based on, for example, information about specific patient populations, which is presented, for example, in the following publications: Manual of Clinical Microbiology 8th Edition, Patrick Murray, Ed., 2003, ASM Press American Society for Microbiology, Washington DC, USA; Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases 5th Edition, G. L Mandell, J.E. Bennett, R. Dolin, Eds., 2000, Churchill Livingstone, Philadelphia, PA, USA, which are incorporated herein by reference.

The following bacterial species usually cause infections of the oral cavity: Prevotella melaninogenicus, anaerobic streptococci, streptococcus viridans, Actinomyces spp., Peptostreptococcus spp. Or Bacteroides spp., Or other oral anaerobes; or viral pathogens: herpes simplex virus, Coxsackie viruses, or Epstein-Barr virus.

The following bacterial species usually cause infections of the esophagus: Actinomyces, Mycobacterium avium, Mycobacterium tuberculosis, or Streptococcus spp.; or viral pathogens: cytomegalovirus, herpes simplex virus, or chickenpox.

The following bacterial species commonly cause gastric infections: Streptococcus pyogenes or Helicobacter pylori; or viral pathogens: cytomegalovirus, herpes simplex virus, Epstein-Barr virus, rotaviruses, noroviruses or adenoviruses.

The following bacterial species usually cause small intestinal infections: Escherichia coli, Clostridium difficile, Bacteroides fragilis, Bacteroides vulgatus, Bacteroides thetaiotaomicron, Clostridium perfringens, Salmonella enteriditis, Yersinia enterocolitica or Shigella flexneri; or viral pathogens: adenoviruses, astroviruses, calicisiruses, noroviruses, rotaviruses or cytomegalovirus.

The following bacterial species usually cause infections of the colon / rectum: Escherichia coli, Clostridium difficile, Bacteroides fragilis, Bacteroides vulgatus, Bacteroides thetaiotaomicron, Clostridium perfringens, Salmonella enteriditis, Yersinia enterocolitica or Shigella flexneri; or viral pathogens: adenoviruses, astroviruses, caliciviruses, noroviruses, rotaviruses or cytomegalovirus.

The following bacterial species usually cause anus infections: Streptococcus pyogenes, Bacteroides spp., Fusobacterium spp., Anaerobic streptococcus, Clostridium spp., Escherichia coli, Enterobacter spp., Pseudomonas aeruginosa or Treponema pallidum; or viral pathogens: herpes simplex virus.

Organisms, such as bacteria, are often functionally classified into groups of similar strains (which usually belong to groups supposedly having a common ancestor, with identifiable physiological but usually not morphological differences, and that can be identified using serological methods against bacterial surface antigens). Thus, each bacterial species (e.g. Escherichia coli) has numerous strains (or serotypes) that may differ in their ability to cause infection or in their ability to cause infection in a particular organ / site. Some strains of Escherichia coli are more likely to cause a gastrointestinal infection / diarrhea, including enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EEC) producing Shiga E. coli toxin (STEC), enteroaggregative E. coli (EAEC), enteroinvasive E. coli (EIEC) and diffuse adherent E. coli (DAEC). According to the present invention, one or more strains of ETEC, EPEC, EENC, STEC, EAEC, EIEC or DAEC of E. coli (i.e., strains that cause colon infection) can be selected to obtain a drug for the treatment of IBD.

Similarly, there are numerous subtypes of specific viruses, worms, or protozoa that are associated with a disease in a particular population, and therefore are applicable to the present invention.

Compositions according to the invention contain antigens of organisms that are pathogenic in a particular area of the gastrointestinal tract. The compositions may contain components of whole organisms, whole cells or whole virions, or may contain extracts or preparations of organisms, such as extracts of cell walls or cell membranes or exotoxins. The composition may also contain one or more isolated antigens of such organisms. Pathogens may be commercially available (for example, from the American Type Culture Collection, Manassas, VA, USA), or may constitute clinical isolates from subjects with infection.

Compositions according to the invention obtained from pathogens can be provided separately or in combination with other compounds (for example, nucleic acid molecules, small molecules, peptides or peptide analogs) in the presence of a liposome, adjuvant or any pharmaceutically acceptable carrier in a form suitable for administration to a mammal for example to a person. As used herein, a “pharmaceutically acceptable carrier” or “excipient” includes any and all of the following components: solvents, dispersion media, coatings, antibacterial and antifungal agents, agents for isotonicity and delayed absorption, and the like, which are physiologically compatible. The carrier may be suitable for the appropriate form of administration, including subcutaneous, intradermal, intravenous, parenteral, intraperitoneal, intramuscular, sublingual, inhalation, intratumoral, or oral administration. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the manufacture of sterile injectable solutions or dispersions for immediate administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Unless any conventional medium or agent is incompatible with the active compound (i.e., specific bacteria, bacterial antigens or their compositions according to the invention), their use in pharmaceutical compositions according to the invention is contemplated. Auxiliary active compounds can also be included in the composition.

Methods well known in the art for the preparation of preparations can be found, for example, in Remington's Pharmaceutical Sciences (20 ^th edition), ed. A. Gennaro, 2000, Mack Publishing Company, Easton, PA. Preparations for parenteral administration, for example, may contain excipients, sterile water or saline, polyalkylene glycols such as polyethylene glycol, vegetable oils or hydrogenated naphthalenes. A biocompatible biodegradable lactide polymer, a lactide / glycolide copolymer or polyoxyethylene-polyoxypropylene copolymers can be used to control the release of the compounds. Other potentially useful parenteral delivery systems include ethylene vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Inhalation preparations may contain excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or in the form of a gel . In the case of therapeutic or prophylactic compositions, the preparations can be administered to an individual in an amount effective to stop or slow the progression of IBD.

An “effective amount” of a pathogenic species or antigen thereof according to the invention includes a therapeutically effective amount or a prophylactically effective amount. A “therapeutically effective amount” refers to an amount effective in doses and for necessary periods of time to achieve the desired therapeutic result, such as reducing or eliminating IBD symptoms. A therapeutically effective amount of a pathogenic species or antigen (s) thereof may vary according to factors such as the condition of the disease, age, gender and weight of the individual and the ability of the compound to elicit the desired response in the individual. The dosage regimen can be adjusted to provide an optimal therapeutic response. A therapeutically effective amount may also be an amount in which any toxic or harmful effects of a pathogenic species or antigen thereof are outweighed by therapeutically beneficial effects. A “prophylactically effective amount” refers to an amount effective in dosages and for necessary periods of time to achieve the desired prophylactic result, such as preventing IBD. Typically, a prophylactic dose is administered to subjects prior to or at an early stage of IBD, so a prophylactically effective amount may be less than a therapeutically effective amount.

When administered via subcutaneous or intradermal injection, an approximate range of therapeutically or prophylactically effective amounts of one or more pathogenic bacteria can be from about 1 million to 100,000 million organisms per milliliter, or can be from 100 million to 7000 million organisms per milliliter, or can be from 500 million to 6,000 million organisms per milliliter, or may be from 1,000 million to 5,000 million organisms per milliliter, or may be from 2,000 million to 4,000 million organisms per milliliter, or any integer in the indicated ranges. The total concentration of bacteria in a milliliter can range from 1 million to 100,000 million organisms per milliliter, or can range from 50 million to 7,000 million organisms per milliliter, or can range from 100 million to 5,000 million organisms in a milliliter, or can range from 500 million to 5,000 million organisms per milliliter, or may be from 1,000 million to 4,000 million organisms per milliliter, or any integer in the indicated ranges. The range of therapeutically or prophylactically effective amounts of antigens of a pathogenic bacterial species can be any integer in the range 0.1 nM - 0.1 M, 0.1 nM - 0.05 M, 0.05 nM - 15 μM or 0.01 nM - 10 μM.

It should be noted that the dose concentration and range may vary depending on the severity of the condition that needs to be improved, or may vary depending on the immune response of the subject. In general, the goal is to achieve an adequate immune response. In the case of administration using a subcutaneous or intradermal infection, the degree of the immune response can be determined, for example, by the size of the deferred local skin immune response at the injection site (e.g., from 0.25 inches (0.635 cm) to 4 inches (10.16 cm) in diameter ) The dose required to achieve an appropriate immune response may vary depending on the individual (and his immune system) and the desired response. You can also apply standardized doses.

In the context of subcutaneous or intradermal administration, the goal is to achieve a local skin reaction of 2 inches (5.08 cm) using the bacterial composition, then the total dose may be, for example, in the range of 2 million bacteria (for example, 0.001 ml of a vaccine with a concentration of 2,000 million organisms per milliliter) to more than · 20,000 million bacteria (for example, 1 ml of a vaccine with a concentration of 20,000 million organisms per milliliter). You can also consider the concentration of certain types of bacteria or their antigens in the composition. For example, if the concentration of one particular pathogenic bacterial species, the size of cells of this kind, or its antigenic load is much higher compared to other pathogenic bacterial species in a vaccine, then the individual’s local skin immune response may probably be a consequence of his response to that particular bacterial species. In some embodiments, an individual’s immune system may respond more strongly to one type of bacteria in a composition than to another, depending, for example, on the history of infection of a particular species, so the dose or composition can be adjusted accordingly for that individual.

For a particular subject, the time and dose for treatment can be adjusted over time (for example, the time of administration can be daily, every other day, weekly, monthly) in accordance with the needs of the individual and the professional decision of the person administering or observing the introduction of the compositions. For example, in the context of subcutaneous or intradermal administration, the compositions may be administered every other day. An initial dose of about 0.05 ml can be administered subcutaneously, with a subsequent increase of 0.01-0.02 ml every other day until an adequate skin reaction is achieved at the injection site (for example, a delayed reaction in the form of visible redness at the injection site with a diameter of 1 inch or more) (2.54 cm) to 2 inches (5.08 cm)). After achieving such an adequate immune response, the administration of such a dose is continued as a maintenance dose. The maintenance dose can be adjusted from time to time to achieve the desired visible skin reaction (inflammation) at the injection site. The administration of the dose may be, for example, for at least 2 weeks, 2 months, 6 months, 1, 2, 3, 4 or 5 years or longer.

In some embodiments, the invention may relate to antigenic compositions administered to one or more epithelial tissues by a non-oral route. For example, in the skin by intradermal or subcutaneous injection; into the epithelium of the lung by inhalation. Accordingly, in some embodiments, the antigenic compositions of the invention are administered to elicit an immune response in non-enteric tissue, such as epithelial tissue. In some embodiments, one or more non-enteric routes of administration can be combined with one type of drug: several additional routes of administration, such as intratumoral, intramuscular, or intravenous administration.

In various aspects of the invention, antigenic compositions that are administered to a patient can be characterized as having an antigenic characteristic, i.e. a combination of antigens or epitopes that are specific enough so that the antigenic composition is capable of eliciting an immune response that is specific for a particular pathogen, such as an adaptive immune response.

The amount of active compound (eg, species of bacteria, viruses, protozoa or helminths or their antigens) in the composition may vary depending on factors such as the condition of the disease, age, gender and weight of the individual. Dosage regimens may be adjusted to provide an optimal therapeutic response. For example, a single bolus may be administered, multiple divided doses may be administered over a period of time, or the dose may be proportionally reduced or increased in response to the needs of a particular therapeutic situation. It may be preferable to obtain parenteral compositions in unit dosage form for ease of administration and uniformity of dosage.

In the case of antigenic preparations (similar to a vaccine), an immunogenically effective amount of a compound, alone or in combination with other compounds, with an immunological adjuvant may be presented. The compound may also be coupled to a carrier molecule, such as bovine serum albumin or keyhole sea saucer hemocyanin, to enhance immunogenicity. An antigenic composition (“vaccine”) is a composition that contains materials that elicit the desired immune response. The antigenic composition can select, activate, or promote the expansion of memory B cells, T cells, neutrophils, monocytes, or macrophages of the immune system, for example, reduce or eliminate the symptoms of IBD. In some embodiments, a particular pathogenic microorganism, virus, viral antigens, bacteria, bacterial antigens or compositions thereof according to the invention are capable of eliciting the desired immune response in the absence of any other agent and, therefore, can be considered an antigenic composition. In some embodiments, the antigenic composition comprises a suitable carrier, such as an adjuvant, which is an agent that acts in a non-specific manner, enhancing the immune response to a particular antigen or group of antigens, making it possible to reduce the amount of antigen in any given dose of vaccine or to reduce the frequency of administration of doses, necessary to create the desired immune response. A bacterial antigenic composition may contain live or dead bacteria capable of inducing an immune response against antigenic determinants, 6 normally associated with bacteria. In some embodiments, the antigenic composition may contain live bacteria that belong to less virulent strains (attenuated) and therefore cause a less severe infection. In some embodiments, the antigenic composition may comprise live, attenuated, or dead viruses capable of inducing an immune response against antigenic determinants normally associated with the virus.

An antigenic composition containing killed organisms for administration by injection can be prepared as follows. Organisms can be grown in suitable media and washed with saline. Organisms can then be centrifuged, resuspended in saline and killed by heat. Suspensions can be standardized by direct microscopic counting, mixed in the required quantities and stored in suitable containers that can be used to test safety, shelf life and sterility accordingly. In addition to the body and / or its antigens, a preparation with killed organisms suitable for administration to humans may contain a phenolic preservative (e.g., 0.4%) and / or sodium chloride (e.g., about 0.9%). The composition may also contain trace amounts of cardiac extract (bull), peptones, yeast extract, agar, sheep blood, dextrose, sodium phosphate and / or other components of the medium.

In some embodiments, the antigenic composition may be used as an aerosol for inhalation.

In general, compositions of the invention that do not cause significant toxicity should be used. The toxicity of the compounds according to the invention can be determined using standard methods, for example, testing in cell cultures or experimental animals and determining the therapeutic index, i.e. ratio between LD50 (dose lethal for 50% of the population) and LD100 (dose lethal for 100% of the population).

In some embodiments, bacteria that are representatives of the endogenous flora of a particular gastrointestinal tract can be used to produce antigenic compositions of the invention. The rows of table 1 indicate the bacterial species and biological areas in which such species can form part of the endogenous flora. For example, Abiotrophia species are typically representative of the endogenous oral flora.

Endogenous microbial flora, such as bacteria, has access to tissues in the event of pathogenesis, either through spreading based on the principle of contiguity, or through bacteremic spread. Under favorable conditions, all endogenous organisms can become pathogenic and locally penetrate and spread as a result of the distribution based on the adjacency principle to neighboring tissues and organs. The endogenous bacterial flora of the skin, oral cavity and colon is represented by species, which, as it turned out, are also susceptible to bacteremic spread. Therefore, bacteria that are representatives of a particular domain of endogenous flora can cause infection in the tissues or organs into which such bacteria can spread. Accordingly, one aspect of the invention is the use of endogenous microbial pathogens for the treatment of IBD having symptoms localized in the gastrointestinal tract, into which endogenous bacteria can spread, causing infection. The columns of Table 2 list the domains of endogenous flora. The rows in Table 2 list the gastrointestinal tract in which IBD may occur. Accordingly, one aspect of the invention is the use of endogenous microbial pathogens to produce antigenic compositions, or the selection of existing preparations containing pathogens, for the treatment of IBD that occurs in the gastrointestinal tract into which the pathogen can spread, causing infection. Accordingly, in alternative embodiments, IBD, which is symptomatic in the area indicated in the first column of Table 2, can be treated with antigenic compositions containing antigenic determinants that are specific for microbial pathogens that are representative of the endogenous flora of one or more domains of the endogenous flora listed 6 the first row of table 2, and indicated by X or a check mark in the corresponding row.

In accordance with the summary information presented in tables 1 and 2, the manifestation of IBD in a specific area of the gastrointestinal tract, indicated in column 1 of table 2, can be treated with antigenic compositions containing antigenic determinants

the corresponding bacterial species shown in table 1, so the column headings in table 2 are essentially replaceable with the bacterial species names shown in table 1.

In some embodiments, the pathogens for use in the invention may be exogenous bacterial pathogens. For example, the organisms listed in table 3 can be used as microbial pathogens to produce antigenic compositions, or antigenic compositions containing such pathogens can be selected for use in the treatment of IBD in the gastrointestinal tract indicated for the corresponding organism in table 3. In some variants, antigenic determinants of endogenous and exogenous bacterial species directed to a specific tissue or organ can be used in combination. For example, an antigenic composition derived from Clostridium difficile or specific for the species may be used to treat IBD in the colon.

In some embodiments, the pathogens for use in the invention may be viral pathogens. Table 4 provides an exemplary list of viral pathogens along with locations in tissues and organs for which each type of virus is reportedly a pathogen. Accordingly, one aspect of the invention is the use of immunogenic compositions that are specific for these viruses for the treatment of IBD in the gastrointestinal tract, which is indicated next to the name of the virus in table 4.

The summary in tables 1-4 gives a broad identification of pathogens that can be used to obtain antigenic compositions according to the invention, along with an indication of the gastrointestinal region in which such organisms are pathogenic, and accordingly the gastrointestinal region in which IBD can be treated antigenic preparation according to the invention.

In some embodiments, the pathogen selected for use in the antigenic compositions of the invention may be a pathogen that is a common cause of acute infection in the gastrointestinal tract where treatment is taking place. Table 5 lists bacterial and viral pathogens of this kind, as well as the gastrointestinal tract, in which they usually cause infection. Accordingly, in selected IBD variants, occurring in the gastrointestinal tract indicated in the first column of Table 5, it is possible to treat an antigenic composition that contains antigenic determinants of one or more pathogenic organisms listed in the second column of Table 5.

Specific organisms that commonly cause ε infection of a particular gastrointestinal tract may vary in their geographical distribution. Therefore, Table 5 is not an exhaustive list of common pathogens for all geographical locations and population groups. It is understood that a clinical microbiologist with experience in this field can identify common types of pathogens in a specific geographical region or population group for a specific gastrointestinal tract according to the invention.

Man is the host for a wide range of parasites of the gastrointestinal tract, including various protozoan helminths, which for the purposes of the present invention are gastrointestinal pathogens (Schafer, TW, Skopic, A. Parasites of the small intestine. Curr Gastroenterol Reports 2006; 8: 312- 20; Jernigan, J., Guerrant, RL, Pearson, RD Parasitic infections of the small intestine. Gut 1994; 35: 289-93; Sleisenger & Fordtran's Gastrointestinal and liver disease. 8th ed. 2006; Garcia, LS Diagnostic medical parasitology. 5th ed. 2007). Compositions according to the invention, respectively, may contain antigenic components of various protozoa, including for example: Giardia Iambiia, Cryptosporidium parvum, Cryptosporidium hominus, Isospora belli, Sarcocystis species, like coccidia of the body (Cyclospora species), Enterocytozoon bieneusi, Entamoeamoebaolyoly , Entamoeba hartmanni, Endolimax nana, Iodamoeba butschlii, Dientameoba fragilis, Blastocystis hominus, Cyclospora cayetanensis, Microsporidia, Trypanosoma cruzi, Chilomastix mesnili, Pentatrichomonas hominis, Balantidium coli. Similarly, the compositions according to the invention may contain antigenic components of various helminths, including, for example: cestodes (tapeworms), Taenia saginata, Taenia solium, Diphyllobothrium species, Hymenolepis nana, Hymenolepis diminuta, Dipylidium caninum, nematodes (roundworms, Strong lericides, Asides, Asides ,ides stercoralis, Necator americanus, Ancylostoma duodenale, Ancylostoma caninum, Tichuris trichiura, Capillaria philippinensis, Trichostrongylus spp., Trichinella spp., Necator americanus, Anisakis and sibling species, Angiostrongylus costaricensis, Enterobius vermicatericelis bushelis califis Echinostoma species, Clonorchis sinensis, Opisthorchis species, Fasciola species, Metagonimus yokogawi, Schistosoma mansoni, Schistosoma japonicum, Schistosoma mekongi, Schistosoma intercalation, Echinostoma species and Paragonimus species.

In selected embodiments, the invention includes diagnostic steps to evaluate a patient's previous exposure to the body. For example, diagnostic steps may include obtaining a patient’s medical history regarding the effects of the selected pathogens and / or evaluating the patient’s immune response to the selected pathogen. For example, a serological test can be performed to detect antibodies to selected pathogens in a patient's serum. In connection with this aspect of the invention, antigenic determinants of the selected pathogen can be selected for use in the immunogenic composition for a given patient based on a diagnostic indicator that the patient has been exposed to the pathogen one or more times, for example, based on the presence of antibodies: antigenic determinants of this pathogen in the serum of the patient.

In the following selected embodiments, the invention relates to diagnostic steps for assessing an immunological response of a patient to treatment with a selected immunogenic composition. For example, diagnostic steps may include evaluating a patient's immune response to the antigenic determinants of a given immunogenic composition, for example, using a serological test to detect antibodies to such antigenic determinants. In connection with this aspect of the invention, treatment with a selected immunogenic composition can be continued if the evaluation indicates that there is an active immunological response to the antigenic determinants of the composition, and vaccine treatment can be discontinued and alternative treatment with another immunogenic composition can be started if the evaluation indicates that there is no sufficiently active immunological response to antigenic determinants of the immunogenic composition.

Although various embodiments of the invention are disclosed in the present description, numerous modifications and modifications can be made within the scope of the invention in accordance with well-known to those skilled in the art. Such modifications include replacing known equivalents of any aspect of the invention in order to achieve the same result in substantially the same way. Different ranges involve the inclusion of numbers that define the range. The word “comprising” is used in the present description as a non-limiting term, essentially equivalent to the phrase “comprising without limitation,” and the word “comprises” has a corresponding meaning. As used herein, the singular forms include the plural, unless the context clearly dictates otherwise. Thus, for example, an indication of an “item” includes more than one such item. Citing publications in the present description does not mean that such publications constitute prior art for the present invention. Any priority document (s) and all publications, including without limitation patents and patent applications, cited in the present description, are incorporated into this description by reference in the same way as in the case where it is specifically and separately indicated that each individual publication is included by reference to the present description, and as it is given in the present description in full. The invention includes all embodiments and changes that are substantially described above and which are described with reference to examples and drawings.

In some embodiments, the invention excludes steps that include medical or surgical treatment.

The following examples illustrate embodiments of the invention.

EXAMPLE 1: Clinical Studies

Bacterial Compositions

Used the following five compositions of killed bacteria for the treatment of a wide variety of types and stages of malignant tumors in blind studies:

1. Bayer MRV ™ of Bayer MRV Corporation (Hollister-Steir Laboratories, Spokane, WA, U.S.A.) containing the following bacteria:

Organisms per milliliter

Staphylococcus aureus 1200 million Streptococcus viridans and others 200 million

non-hemolytic streptococci

Streptococcus pneumoniae 150 million Moraxella (Neisseria) catarrhalis 150 million Klebsiella pneumoniae 150 million Haemophilus influenzae 150 million

Such a vaccine was obtained for the following indications: rhinitis, infectious asthma, chronic sinusitis, nasal polyposis, and chronic average serous otitis media. Cancer treatment is not indicated as the intended use of such a vaccine. The vaccine also contained the following ingredients: 0.4% phenol, 0.9% NaCl, trace amounts of cardiac extract (bull), peptones, yeast extract, agar, sheep blood, dextrose and sodium phosphates.

2. MRV Stallergenes "Stallergenes MRV" (Laboratories des Stallergenes, S.A., Fresnes, France), containing the following components:

Organisms per milliliter Staphylococcus aureus 600 million Staphylococcus albus 600 million non-hemolytic streptococci 200 million Streptococcus pneumoniae 150 million Moraxella (Neisseria) catarrhalis 150 million Klebsiella pneumoniae 150 million Haemophilus influenzae 150 million

This vaccine was obtained for the same indications as the MRV vaccine, i.e., recurrent respiratory tract infections, and a malignant tumor is indicated as a contraindication.

As indicated below, it was unexpectedly discovered that such MRV vaccines, which contain many common lung pathogens, are effective in the treatment of lung cancer.

3. Polyvaccinum Forte (PVF; Biomed S.A., Krakow, Poland), containing the following components:

Organisms per milliliter

Staphylococcus aureus 500 million Staphylococcus epidermidis 500 million Escherichia coli 200 million Corynebacterium pseudodiphtheriticum 200 million Streptococcus pyogenes 100 million Streptococcus salivarius 100 million

(streptococcus viridans)

Streptococcus pneumoniae 100 million Moraxella (Neisseria) catarrhalis 100 million Klebsiella pneumoniae 100 million Haemophilus influenzae 100 million

The specified vaccine was received for chronic and recurrent inflammatory conditions of the upper and lower respiratory tract and genitourinary tract, including rhinopharyngitis, recurrent laryngitis, tracheitis, bronchitis, otitis media, chronic and recurrent trigeminal and occipital neuralgia, ischialgia, interchondral pleura cystoureteritis, vaginitis, adnexitis and inflammation of the endometrium. Cancer treatment has not been indicated as the intended use for such a vaccine.

It should be noted that although the total concentration of bacteria in PVF is identical to the concentration of bacteria in MRV (Bayer and Stallergenes), patients usually observed a visible inflammatory immune response to subcutaneous injection of the PVF composition at a much lower dose than the usual dose required to achieve a similar skin reaction in the case of the MRV composition, which indicates that there was probably an immune response to one of the new components in the Polyvaccinum Forte vaccine, such as E. coli. As indicated below, it was unexpectedly discovered that PVF, which contains E. Coli, a common pathogen of the colon, abdomen, kidney, ovaries, peritoneum, liver and pancreas, is effective in the treatment of malignant tumors in the colon, abdominal lymph nodes, kidney, ovary, peritoneum, liver and pancreas.

4. Staphage lysate (Delmont Laboratories Inc., Swarthmore, PA, USA) containing the following components:

Staphylococcus aureus

As indicated below, it was unexpectedly discovered that a staphage lysate that contains Staphylococcus aureus, a common pathogen in the breast and bone, is effective in treating a malignant tumor in the breast and bone.

The introduction of MRV, staphage lysate and PVF

Bacterial compositions (vaccines) were a suspension of dead bacterial cells, and therefore, the suspensions were gently shaken before use to ensure uniform distribution before taking the dose from the vial, and was administered subcutaneously three times a week on Monday, Wednesday and Friday. Patients were advised to continue treatment for at least 6 months. The required dose of the vaccine was determined by the adequacy of the immune response to the vaccine. Starting from a very low dose (0.05 cm ³ ), the dose was gradually increased (each time by 0.01-0.02 cm ³ ) until an adequate immune response was achieved. A delayed local reaction at the injection site appeared from 2 to 48 hours after the injection and lasted for 7 2 hours or longer. The goal was to achieve a round pinkish / red spot with a diameter of one to two inches (2.54 cm to 5.08 cm) at the injection site, indicating adequate immune stimulation. After achieving such a reaction, the dose was maintained at a level necessary to achieve such a reaction. If the reaction was significantly less than two inches (5.08 cm) (e.g. half an inch (1.27 cm)), the dose was increased if the reaction was significantly higher than two inches (5.08 cm) (e.g. three inches (7.62 cm)), then the dose was reduced. Such a local immune response usually occurs in the first 24 hours after the injection. Patients were asked to check for such a reaction and, if so, to measure or mark it. The maintenance dose required to achieve an adequate immune response varies considerably, depending on the individual’s immune response — only 0.001 cm ³ in some people, up to 2 cm ³ for others. The vaccine should be stored in the refrigerator (from 2 ° C to 8 ° C). The usual injection site is the upper arm (shoulder), thigh, or abdomen. The exact location of each injection is varied so as not to enter the places where they are still different. The place is pinkish / red. A known contraindication for vaccines is hypersensitivity to any component of the vaccine.

A fifth vaccine, a polymicrobial oral vaccine, was used in alternative aspects of the invention, which was the following vaccine:

5. Respivax production BB-NCIPD Ltd (Bulgaria). Specified oral vaccine contained the following freeze-dried dead species of bacteria:

Organisms in mg

Streptococcus pneumoniae 25 million Neisseria catarrhalis 25 million Streptococcus pyogenes 25 million Haemophilus influenzae 25 million Staphylococcus aureus 25 million Klebsiella pneumoniae 25 million

The introduction of respivax

The respivax oral vaccine was given to treat a chronic respiratory infection, and it contains many of the most common respiratory tract pathogens, including many of the most common lung infections. Patients were treated with a dose of one tablet (50 mg) per day, providing an equivalent of 1.25 × 10 ⁹ cells of each type per dose. Patients were prescribed the above dose for a continuous period of at least 6 months.

As indicated below, it was unexpectedly discovered that the oral respivax vaccine, which contains many common lung pathogens, is effective in the treatment of lung cancer.

EXAMPLE 1A: Cancer of the lung

This section relates to a primary malignant tumor in the lung or lung metastases treated with microbial pathogens of the lung, such as the endogenous bacterial flora of the airways.

Patients were qualified as suitable for lung cancer testing if they were first diagnosed with lung cancer at stage 3B or 4 (inoperable). The stages of lung cancer were determined using standard methods that are described, for example, in AJCC: Cancer Staging Handbook (sixth edition) 2002; Springer-Verlag New York: Editors: Fredrick Greene, David Page and Irvin Fleming, or in International Union Against Cancer: TNM Classification of Malignant Tumors (sixth edition) 2002; Wiley-Liss Geneva Switzerland: Editors: L.H. Sobin and CH. Wittekind. For example, lung cancer can be classified as follows:

Clinical and pathological classification of lung TNM

Cards with diagnostic codes 162.9 (lung cancer) and 197 (metastatic malignant tumor) were compiled manually and electronically. Information about patients was collected such as diagnostic data, death data, and the stage of the cancer. Patient cards were analyzed to confirm the diagnosis and stage of the cancer. Patients were excluded from the analysis for the following reasons: 1) the wrong stage; 2) data is missing; 3) no card; or 4) the card is not available on time for data analysis. 20 patients were excluded from the study, since their cards were not yet received or there was insufficient information, from the bottom 6 received MRV. The study group included a total of 108 patients: 50 who received the MRV vaccine, and 58 who did not receive the MRV vaccine.

Comparison of the survival of patients who were initially diagnosed with lung cancer in stages 3B and 4 who received MRV, with patients who did not receive MRV, and with standard SEER survival data for patients who were initially diagnosed with lung cancer in stages 3B and 4 ( figure 1) was carried out as shown below:

A comparison of survival (as indicated above), including only those patients who received MRV for at least 2 months (Figure 2), gave the following results

Median survival: 16.5 months

1 year survival: 7 0%;

3 year survival: 27%;

5 year survival: 15%.

Median and 1 year, 3 year, and 5 year survival were significantly better in the group treated with MRV (containing bacteria that commonly cause lung infection), confirming the efficacy of this vaccine for treating lung cancer. Patients treated with the MRV vaccine for more than 2 months had higher survival rates, which further confirms the effectiveness of such a vaccine for the treatment of lung cancer.

An alternative analysis was performed using data that included a population of patients for whom the MRV composition was not provided to eliminate the apparent possibility of a systematic error due to the fact that more sick patients are more likely to choose a new treatment (using MRV) and healthier patients are potentially less were probably treated using the antigenic compositions of the invention. A comparison of the survival of MRV patients who were given the MRV composition (labeled “lung 1”) with the survival of non-MRV patients who were not provided with the MRV composition (labeled “lung 2”) eliminates this systematic selection error, providing a clearer and more an accurate illustration of the benefits of MRV treatment, as shown in figure 3.

In some embodiments, a particularly convincing clinical advantage has been obtained by using antigenic bacterial compositions used in repeated frequent injections (i.e., three times a week) over a long period of time - such as at least 2, 3, 4, 5 6, 12 months, or 2, 3, 4, or 5 years (in the context of the later stages of a cancer, such as inoperable lung cancer, longer periods may be most useful). This kind of treatment can be carried out in order to provide sustained long-term immune stimulation. When the above analysis is limited to patients who have been treated with MRV for a minimum of 2 months, the survival benefit of MRV treatment is even more clearly illustrated in Figure 4.

As shown in FIG. 4, the one-year survival of patients with stage 3B or 4 lung cancer who were treated with MRV for at least two months was 7 0%, compared to only 48% in the case of the non-group -MRV lung studies 2 and 23% in the case of a group from the SEER database. The three-year survival of the MRV group was more than 4 times the survival of He-MRV patients and patients in the SEER registry. None of the non-MRV groups in lung study 2 survived for 5 years, while 15% of patients treated with MRV for at least a two-month period survived, were still alive 5 years after diagnosis. In the context of a disease, such as inoperable lung cancer, which is considered fatal, and which usually has a 5-year survival rate of only 3% (SEER registry), the above results are extremely encouraging and surprising.

When the analysis of patient data was limited to patients who had been treated with MRV for at least 6 months, the survival curve was actually amazing, as shown in Figure 5. More than 60% of the patients were alive by 3 years, which more than 10 times higher survival rates both in the non-MRV group and in the SEER registry. 36% (5 out of 14 patients) of patients who were treated with MRV for at least 6 months were alive 5 years after diagnosis, compared with only 3% in the SEER database and 0% in the group not -MRV. Such remarkable results in the context of a cancer diagnosis that is considered fatal are extremely encouraging and unexpected. Accordingly, in some embodiments, malignant tumors, such as advanced cancers, such as inoperable lung cancer, can be treated for a dosing period of at least 1, 2, 3, 4, 5, 6, 7, 8 , 9, 10, 11 or 12 months, 2 years, 3 years, 4 years, 5 years or indefinitely.

A restrictive analysis of those patients treated with. the use of MRV for a minimum period of time (e.g. 6 months) leads to a bias in favor of the MRV group, since MRV patients who survived for a period of time shorter than that period of time are excluded from the group (including those who died before how they could complete the 6-month treatment). A detailed statistical analysis of such a mixture with compensatory exclusion of short-term survivors in both non-MRV and SEER groups shows that this bias plays a very insignificant role in the really remarkable benefit associated with the survival of patients who were treated with MRV for at least 6 months.

In stage 3B of lung cancer, the malignant tumor is limited to the lungs, and thus a targeted antitumor response to treatment can be stimulated according to various aspects of the invention with a vaccine such as MRV consisting of pulmonary pathogens. At stage 4 of lung cancer, the malignant tumor metastasizes to distant organs not susceptible to targeted stimulation of pulmonary pathogens by the methods of the invention. Thus, in some embodiments, patients with stage 3B lung cancer can be selected for treatment with the MRV vaccine since the entire malignant tumor is restricted to the lungs and therefore will be targeted by the MRV vaccine. When analysis of patient data is limited to patients with lung cancer in stage 3B, comparison of survival curves further illustrates the benefits of MRV treatment. As shown in FIG. 11, the one-year survival of stage 3B lung cancer patients treated with MRV was 7–6%, compared with only 53% in the non-MRV lung study group 2 and 23% in the case of the group from the database SEER. 3-year survival in the MRV group was 3 times higher than in non-MRV patients and more than 6 times higher than in the SEER registry. None of the non-MRV groups survived after 5 years, while 14% of patients with stage 3B cancer who were treated with MRV were still alive 5 years after diagnosis. In the context of a disease such as stage 3B inoperable lung cancer, which is considered fatal and has a typical 5-year survival rate of only 5% (SEER registry), the above results are extremely encouraging and unexpected.

Since before the first visit of some patients after the diagnosis several months or even a year or two passed, their inclusion in the survival curves shifted the curve to. side of longer survival. To determine whether this bias affects the difference in survival curves, survival was analyzed starting from the date of the first visit, which excluded such a bias, as shown in Figure 12. Comparison of the survival curves of patients with lung cancer in stage 3B shown in Figure 12 even shows a greater advantage of MRV treatment in terms of survival of MRV treatment than shown in Figure 11, indicating that the advantage of treatment with MRV was partially hidden in Figure 11. As shown in Figure 12, 1-year survival (from the date of the first visit ) patients with stage 3B lung cancer who were treated using MRV was 57%, compared with only 21% in patients with stage 3B cancer who were not treated with MRV. While none of stage 3B lung cancer patients who were not treated with MRV survived for 3 years, the 3-year survival rate of stage 3B cancer patients treated with MRV was 33%, and The 5-year survival rate was 14%, which was an unusual and unexpected result.

When the analysis was limited to patients with stage 3B lung cancer whose first visit was within a period of up to 3 months from the date of diagnosis, the advantage of early treatment using MRV was clearly illustrated. As shown in FIG. 13, while all patients with stage 3B lung cancer who made their first visit within a period of up to 3 months from the date of diagnosis, died within 1 year of diagnosis, 70% of patients with lung cancer stages 3B, which were treated with MRV within 3 months of diagnosis, survived for 1 year, 40% survived for 3 years and 20% survived for 5 years, which is a truly astounding advantage of early treatment with MRV from the point of view of survival.

One aspect of the invention is the treatment of primary lung cancer or lung metastases with antigenic compositions that contain antigenic determinants of microbial pathogens that are known to be lung pathogens, such as exogenous lung pathogens or pathogens that are representative of the endogenous flora of the respiratory system. For example, antigenic determinants of endogenous species of bacteria of the respiratory tract flora, which are the most common causes of infection in the lung (see table 5), can be used to treat primary and metastatic malignant tumors located in the lung: Streptococcus pneumoniae, Moraxella catarrhalis, Mycoplasma pneumoniae, Klebsi pneumoniae , Haemophilus influenza. Similarly, the common viral lung pathogens from table 5 may be selected for use in some embodiments. Alternatively, a more exhaustive list of endogenous lung pathogens can be selected from table 1, based on the pathogenicity information shown in table 2. In the following alternatives, the viral lung pathogens listed in table 4 can be used. Exogenous bacterial pathogens may be used in the following alternatives. lungs from table 3 to obtain antigenic compositions according to the invention, i.e., selected from the group consisting of: Achromobacter eids, Actinomadura species, Alcaligenes species, Anaplasma species, Bacillus anthracis other Bacillus species, Balneatrix, Bartonella henselae, Bergeyella zoohelcum species, Bordetella holmesii, Bordetella parapertussis, Bordetella pertussis, Borrelia burgdorferi, Borrelia recurrentis, species Brucella, Burkholderia gladioli, Burkholderia mallei, Burkholderia pseudomallei, Campylobacterium pymphylamphyphlamphyphlamdymphyphlamphyphlamphyphlamfogmaflamphyphlamfogmaflamphyglamphyphlamphyphlamphymphylphamma phylphamma phyphlamphymphlamphymphlamphymphlamphymphlamphogmymphi phlamphamma phylophmi moniae, Chromobacterium violaceum, Chlamydophila psittaci, species of Chryseobacterium, Corynebacterium pseudotuberculosis, Coxiella burnetii, Francisella tularensis, species of Gordonia, species of Legionella, species of Leptospirosiserium, Mycobacterium tuccioerium, Myobiacerobacterium Mycobacterium myocobacterium , Pseudomonas aeruginosa, other species of Pseudomonas, species of Rhodococcus, Rickettsia conorii, Rickettsia prowazekii, Rickettsia rickettsiae, Rickettsia typhi.

For example, since MRV compositions contain many of the most common lung pathogens, such vaccines can be used to treat primary lung cancer or lung metastases, as shown by the totals presented in the present description and in a number of case histories. According to the results described above, one aspect of the invention is the treatment of primary lung cancer and lung metastases with antigenic compositions that contain antigenic determinants of microbial pathogens that are known to be pathogenic in the lung, such as exogenous lung pathogens or pathogens that are representative of the endogenous flora respiratory tract. In selected embodiments, antigenic determinants of common lung pathogens can be used to treat primary and metastatic malignant tumors located in the lung, for example, antigenic determinants from one or more of the following bacteria or virus types: Streptococcus pneumoniae, Moraxella catarrhalis, Mycoplasma pneumoniae, Klebsiella pneumoniae Haemophilus influenza, influenza virus, adenovirus, respiratory syncytial virus and parainfluenza virus. In the following selected embodiments, the antigenic determinants of Streptococcus pneumoniae, the most common cause of bacterial infection of the lungs, can be used alone or with other most common lung pathogens to treat lung cancer.

A primary malignant tumor of the lung can also arise from bronchial tissue, and therefore, in some embodiments, antigenic compositions that contain antigenic determinants of microbial pathogens that are known to cause bronchial infection can be used to treat patients with a malignant tumor located in bronchial tissue, including for example, the following common causes of bronchial infection: Mycoplasma pneumoniae, Chlamydophila pneumoniae, Bordetella pertussis, Streptococcus pneumoniae, Haemophilus influenzae, influenza virus, adenovirus, rhinovirus, coronavirus, parainfluenza virus, respiratory syncytial virus, human metapoxvirus virus. Lung cancer (or lung metastases), which are located both in the lung and in the bronchial tissue, can be treated with antigenic compositions that contain antigenic determinants of microbial pathogens that are known to cause infection of the lung and bronchi (e.g. Streptococcus pneumoniae, Haemophilus influenza and Mycoplasma pneumoniae are common pathogens of the lung and bronchi), or alternatively antigenic compositions that contain antigenic determinants of microbial pathogens that are known to cause lung infection, and antigenic determinants of microbial pathogens that are known to cause bronchial infection.

EXAMPLE 1B: Breast cancer with metastases to the bone or lung

The most common cause of breast infection and bone infection is Staphylococcus aureus. Accordingly, in one aspect of the invention, an antigenic composition comprising S. aureus antigenic determinants can be used to treat breast cancer with bone metastases. The amazing case of Patient R (PtR) treated with a Staphylococcus aureus vaccine, listed below in the Case History section, illustrates the effectiveness of this method of treating breast cancer with bone metastases. As shown in FIG. 6, in a cumulative series of 52 patients, the survival rate of patients with breast and / or lung metastases of breast cancer treated with MRV (n = 19), which contains Staphylococcus aureus, was better than the survival rate of patients. untreated with MRV vaccine (n = 33):

According to the above results, one aspect of the invention is the treatment of a primary malignant tumor in the mammary gland or metastases in the mammary gland with antigenic compositions that contain antigenic determinants of microorganisms that are known to cause infection of the mammary gland, and the treatment of the primary malignant tumor of the bone or metastases into the bone with antigenic compositions that contain antigenic determinants of the types of bacteria and viruses that are known to cause bone infection. In selected embodiments, a vaccine containing the antigenic determinants of Staphylococcus aureus, the most common cause of both breast infection and bone infection, can be used alone or in combination with other most common breast pathogens to treat a malignant tumor in the mammary gland, either alone or in combined with the other most common bone pathogens for treating a malignant tumor in the bone.

EXAMPLE 1C: Bone metastases

One of the most common metastases in patients with prostate cancer is bone. In one aspect of the invention, an MRV composition that contains the antigenic determinants of S. aureus, the most common cause of bone infection, can be used to treat bone metastases, for example, in patients who have or have had primary prostate cancer. The graph in Figure 7 shows a comparison of survival for a cumulative series of patients with metastatic prostate cancer who underwent surgery or irradiation to destroy their prostate gland (and thus the primary tumor), and who had a detectable malignant tumor, limited to bone metastases. As shown, the survival rate of patients who were treated using MRV (n = 4) was significantly higher than the survival of patients who were not treated using MRV (n = 7):

According to the above results, one aspect of the invention is the treatment of primary malignant bone tumors or bone metastases with antigenic compositions that contain antigenic determinants of microbial pathogens that are known to cause bone infections, such as exogenous bone pathogens or pathogens that are representative of the endogenous skin flora , oral cavity or colon. For example, in selected embodiments, the antigenic determinants of one or more of the following types of microorganisms from the list of common bone pathogens can be used to treat primary and metastatic malignant tumors located in the bone: Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus pyogenes, Streptocococcus pneumoniaealptia species, Streptocococcus pneumoniaealptiagia Streptococia pneumoniaealpt streptococci, Escherichia coli, Pseudomonas spp., Enterobacter spp., Proteus spp., Serratia spp., Parvovirus B19, rubella virus, hepatitis B. In the following selected variants, Staphylococcus aureus, the most common cause of bone infection, can be used alone or with other most common bone pathogens for treatment of malignant bone tumors.

EXAMPLE 1D: Malignant tumor located in the colon

Treatment with the PVF composition has been shown to increase the survival of patients with colon cancer (see figure 8), as shown by comparing the following four groups of patients with colon cancer:

- Stage 4 colon cancer patients treated with MRV;

- stage 4 colon cancer patients who have not been treated with the vaccine;

- Stage 4 colon cancer patients treated with the PVF vaccine;

- patients with stage colon cancer from the SEER database (epidemiology, survival and outcomes).

This example illustrates that patients with colon cancer treated with PVF that contains E. coli, the most common cause of bacterial infection of the colon, have significantly increased survival.

Patients were assigned to the first two groups of this study if they had stage 4 colon cancer. Patients were excluded from this analysis for the following reasons:

- incorrect diagnosis;

- wrong stage;

- Missing important data (for example, date of death);

- no card;

- the card did not arrive at the researchers at the time of the data analysis.

The patient group consisted of a total of 136 patients with colon cancer in 4 stages: 15 who were taking the PW vaccine. 56 who took the MRV vaccine; and 65 who did not take the vaccine. The following results are obtained, illustrated in figure 8:

The median survival of stage 4 colon cancer patients who were treated with PVF (which contains E. coli, one of the most common colon pathogens) was more than two times higher than patients treated with MRV (which does not contain colon pathogens), or in patients who have not been treated with the vaccine, and four times higher than in patients in the SEER registry. All 15 patients treated with PVF were still alive 10 months after diagnosis, compared with only 71% in the MRV group, 69% in the non-vaccine group, and only 45% in the SEER registry. Survival after 30 months in the PVF group was two times higher than in the MRV group and the group without the use of a vaccine and almost 4 times higher than in the SEER registry.

The Wilcoxon test shows a statistically significant difference in survival between patients treated with the PVF vaccine and both groups: the MRV group (p = 0.0246) and the group without the vaccine (p = 0.0433). This surprising consideration of the small-sized PVF group (n = 15) shows a significant therapeutic effect. The results obtained indicate that the PVF composition, which contains E. coli, which is the most common cause of bacterial infection of the colon, is an effective treatment for colon cancer guts.

The survival of such patients who were given the immunological treatment according to the invention for 3 months after diagnosis (i.e., excluding those patients who were long-lived before the treatment was provided) was also analyzed. The results of such an analysis are presented in figure 9. As shown, the survival curves of “MRV” and “without vaccine” in figure 9 are significantly shifted to the left (which indicates that the shift due to selection towards “long-livers” could artificially shift such curves to the right by figure 8), while it is noticeable that the PVF curve in figure 9 is indeed farther to the right than the curve in the figure. 8, indicating that the advantage of earlier treatment using PVF (ie, within 3 months after diagnosis) is greater than if the offset by long-lived offset, which is excluded in figure 9. This analysis provides convincing evidence of this advantage the treatment of PVF in the case of colon cancer in stage 4 may be even greater than that shown in figure 8, and the sooner treatment with the compositions according to the invention is started after diagnosis, the greater the advantage.

According to the results presented above, one aspect of the invention is the treatment of colon cancer with antigenic compositions that contain antigenic determinants of microbial pathogens that are known to be pathogens of the colon, such as pathogens that are representative of the endogenous flora of the colon or exogenous pathogens of the colon. For example, antigenic determinants of the following types of microorganisms can be used to treat primary and metastatic malignant tumors located in the colon: Escherichia coli, Clostridium difficile, Bacteroides fragilis, Bacteroides vulgatus, Bacteroides thetaiotaomicron, Clostridium perfringens, Salmonellaigitisiditis, Salmonella enteris adenoviruses, astroviruses, caliciviruses, noroviruses, rotaviruses or cytomegaloviruses. For example, malignant tumors located in the colon can be treated with a PVF composition that contains E. coli, or with alternative drugs that contain only antigenic determinants of colon pathogens. In selected embodiments, the antigenic determinants of E. coli, which are the most common cause of bacterial infection of the colon, can be used alone or together with antigenic determinants of other common pathogens of the colon to treat cancer of the colon.

EXAMPLE 1E: Use of respivax, an oral vaccine for the treatment of lung cancer

The respivax oral vaccine was administered as described above at a dose of one tablet of 50 mg per day, providing an equivalent of 1.25 × 10 ⁹ cells of each type per dose. Patients were prescribed to continue taking the above dose for at least 6 months.

As shown in FIG. 10, the survival rate of stage 3B lung cancer patients treated with oral respivax antigens was significantly higher than in patients who were not treated with the antigenic composition. Median survival was 37 months for patients who were treated with respivax, compared with only 20 months for patients who were not treated with a vaccine based on the antigenic composition. 40% of patients treated with respivax were alive 5 years after diagnosis, while none of the patients who were not treated with this treatment survived for no more than 2 years.

According to the above results, one aspect of the invention is the treatment of a primary lung cancer or lung metastasis using oral administration of antigenic compositions that contain antigenic determinants of microbial pathogens that typically cause lung infection.

EXAMPLE 2: Clinical Case Descriptions

The above descriptions of clinical cases are indicative of the patients who make up the patient populations reflected in the cumulative studies described above, and also illustrate additional aspects of the invention. In particular, the descriptions of the individual clinical cases of AN patients are illustrations of unexpected results from some patients treated with anti-inflammatory drugs, while the descriptions of the clinical cases of O-AA patients are typical of the general patient population, which include many examples of vaccine treatment that was effective in the absence of anti-inflammatory therapy.

MRV for lung cancer with and without anti-inflammatory drugs

Patient A (PtA): In September 0, PtA developed pain in the upper right chest, accompanied by wheezing. Such symptoms persisted, and in January 1, she underwent an x-ray of the breast, which revealed a large volume formation of 7 cm × 8 cm at the apex of the right lung. Fine needle aspiration biopsy was positive for non-small cell lung cancer. On January 27, 1 year, MRI showed invasion of the subclavian arteries, which made surgical resection impossible and, therefore, PtA was diagnosed with inoperable terminal lung cancer at stage 3B. She was subjected to a short course of palliative radiation therapy and low-intensity chemotherapy. She was informed that she had a malignant tumor in the terminal stage, in which the life expectancy is from 3 to 6 months.

On April 29, 1 year, PtA was started with MRV vaccine therapy three times a week. On the same day, she also began treatment with a non-steroidal anti-inflammatory drug (NSAID) indomethacin, 50 mg four times a day, and use a scheme of antioxidant supplements and vitamin D. After 8 months by October 2 years, the tumor markedly decreased in size to 3 cm in diameter, and on May 19, 5 years, four years after the start of treatment according to the combined regimen with the MRV vaccine, indomethicin, antioxidant vitamins and vitamin D, only the residual scar remained. PtA continued treatment with this combination of MRV vaccine and adjuvant anti-inflammatory therapeutic agents for more than 4 years until the end of May 5 years, by this time there were no signs of residual cancer, despite the diagnosis of terminal inoperable lung cancer more than 4 years before. More than 14 years after being diagnosed with terminal lung cancer, PtA continued to feel good with no signs of a residual cancer.

In accordance with the above results, one aspect of the invention is the treatment of lung cancers using antigenic compositions that contain antigenic determinants of microbial pathogens that typically cause lung infection.

In accordance with the above results, another aspect of the invention is the administration of immunogenic compositions repeatedly relatively often over a relatively long period of time.

The concomitant use of anti-inflammatory drugs, such as antioxidants, vitamin D and indomethicin, together with targeted MRV therapy, has been associated with significantly increased survival rates, which are higher than survival rates in cases similar in all other respects in which such adjuvant anti-inflammatory drugs were not used together with compositions according to the invention. For example, in the otherwise similar case of patient B, in which no anti-inflammatory drugs were administered, an inoperable non-small cell lung cancer was diagnosed in stage 3B, which led to death within 3 months after diagnosis. Such cases are evidence of the synergistic effect of the antigenic compositions according to the invention and anti-inflammatory drugs.

In accordance with the above results, one aspect of the invention is the treatment of malignant tumors by administering antigenic compositions that contain antigenic determinants of microbial pathogens that are pathogenic in the organ or tissue of the target, as well as adjuvanted anti-inflammatory drugs to produce a synergistic effect.

MRV in case of lung cancer with or without anti-inflammatory drugs

Patient C (PtC): In the spring of 0 year, PtC started having pains in the upper right chest area. Such pain persisted, and on October 5, he underwent an X-ray study, which revealed a large volume formation of 12 cm × 11 cm, occupying virtually the entire upper right lobe. Fine needle aspiration biopsy was positive in the relationship of low-grade non-small cell lung cancer. Diagnostic thoracotomy was performed on December 7, which revealed invasion of the tumor into the chest wall and superior vena cava, and therefore the tumor in PtC was inoperable (i.e., at stage 3B). PtC was subjected to a short course of palliative radiation therapy and low-intensity chemotherapy. He was informed of the presence of a terminal malignant tumor with a life span of 3 to 6 months. On January 27, 1 year, a rapidly growing tumor was increased in size to 14 cm × 11.5 cm.

On February 9, 1 year, PtC began treatment with indometicin, 50 mg four times a day, antioxidant vitamins and vitamin D. Three weeks later, on March 1, 1 year, PtC began treatment with the MRV vaccine three times a week. By June 1, PtC was doing well and ran 8 km 3-4 times a week. On June 4, 1 year, an X-ray examination of the breast showed that the tumor had decreased in size to 11 cm in diameter. PtC continued to feel good, leading to a full and active life with a return to full employment and continued full physical activity. PtC continued treatment using a combination of the MRV vaccine and adjuvanted anti-inflammatory therapeutic agents (indomethicin, antioxidants, and vitamin D) for more than 16 months until July 24, 2 years, at which point treatment with indomethicin was interrupted (due to decreased renal function, known potential side effect of prolonged use of indomethicin). After 6 months, in December 2 years, after 22 months of targeted vaccine therapy, MRV treatment was interrupted (since MRV was no longer available after the indicated date). PtC continued to feel good until June 6, when he was diagnosed with a relapse of a malignant tumor in both lungs, which led to his death on May 26, 7, more than 6.5 years after he was diagnosed with terminal lung cancer and he was informed that he had 3-6 months of life left.

In this case, the use of adjuvant anti-inflammatory drugs, including antioxidants, vitamin D and indomethicin, used together with targeted MRV therapy for more than 16 months, was associated with significantly longer life expectancy, contrary to the diagnosis, which usually indicates death within 1 year, this life expectancy was higher than in the rest of the case with patient D, in which such adjuvant anti-inflammatory drugs were not used together with the compositions according to the invention, and inoperable lung cancer was fatal within 8 months after diagnosis. Such cases indicate a synergistic effect of antigenic compositions according to the invention and anti-inflammatory drugs.

PVF in the case of a malignant tumor of the colon with metastases to the liver and lung and without anti-inflammatory drugs.

Patient Ε (PtE): PtE was performed surgical resection of a malignant tumor of the colon on June 17, year 0, followed by chemotherapy. On August 15, 0, he was diagnosed with a stage 4 malignant tumor with metastases in the liver and lungs, a diagnosis with a very poor prognosis. On October 20, 0, PtE started treatment with antioxidants and vitamin D, and on December 10, 0, he began treatment with PVF three times a week, which he continued in combination with antioxidants and vitamin D. In September 1, he began treatment with celebrex ™ 100 mg twice a day. Despite a very poor initial prognosis, PtE was still alive and feeling good with the last contact more than 3 years after the diagnosis of terminal metastatic colon cancer.

In accordance with the above results, one aspect of the invention is the treatment of cancer of the colon, liver, and lung using antigenic compositions that contain antigenic determinants of microbial pathogens that are known to be pathogenic in the colon, liver, and lung.

Unlike PtE, of the 15 patients who were diagnosed with colon cancer in stage 4 and who were treated with PVF, the patient with the shortest life expectancy, patient F, was not treated with anti-inflammatory drugs. Such cases provide convincing evidence that the anti-inflammatory drugs (i.e., Celebrex ™, antioxidants and vitamin D) taken with targeted PVF therapy had a synergistic effect, contributing to a longer PtE life expectancy, which was longer. than life expectancy in otherwise otherwise similar cases in which adjuvanted anti-inflammatory drugs have not been used together with the compositions of the invention.

PVF in the case of a malignant tumor of the colon with metastases to the lung with anti-inflammatory drugs

Patient G (PtG): PtG developed rectal bleeding in May 0, and was diagnosed with colon cancer. He was subjected to surgery, chemotherapy and radiation therapy, but lung metastases (stage 4 of a malignant tumor) developed on August 16, 1 year, the final diagnosis with a poor prognosis. He began taking the antioxidant vitamins and vitamin D regimen in June 0, and on September 23, 1, he began taking NSAIDs of Celebrex at 100 mg twice a day. In March 3 years, he started taking the PVF vaccine three times a week, which lasted until April 4 years, at which time brain metastases developed that led to his death on June 2, 4 years, almost 3 years after he was diagnosed with terminal colorectal cancer guts in 4 stages. PtG lived significantly longer than would normally be expected with a diagnosis of stage 4 colon cancer with lung metastases. In this context, the invention relates to the use of anti-inflammatory drugs together with immunogenic compositions, such as PVF, to obtain a synergistic effect.

Patient H (PtH): PtH was diagnosed with colon cancer with liver and lung metastases on February 13, 0. On January 11, 1 year, he was assigned a regimen with antioxidants and vitamin D. However, in March 1, he entered a chemotherapy study and at that time stopped taking such supplements at the request of the study coordinators. He was not treated with NSAIDs. On May 12, 1 year, he began treatment with PVF, which he took three times a week until his death, only 2.5 months later. Compared with similar cases in which the use of anti-inflammatory drugs was included, this case illustrates that if adjuvant anti-inflammatory drugs are not taken simultaneously with targeted therapy using antigenic activation, then there is no synergistic effect, which otherwise could occur with the concomitant use of adjuvant anti-inflammatory drugs funds.

In conclusion, in cases of colorectal cancer in stage 4 treated with targeted therapy with the PVF vaccine, the use of adjuvant anti-inflammatory drugs, including antioxidants, vitamin D and celebrex, used together with targeted therapy based on antigenic activation, is associated with significantly increased survival. much higher than survival in two cases in which the indicated adjuvant anti-inflammatory drugs were not used together with the vaccine, which is evidence of a synergistic effect.

PVF with anti-inflammatory drugs and without anti-inflammatory drugs in the case of a malignant tumor of the pancreas with metastases to the lungs, liver and abdominal lymph nodes

Patient I (Ptl): PtI was diagnosed with pancreatic cancer in August 1, at which time he had an operation to remove the pancreas (i.e., Whipple's surgery). However, in July 2 years, he developed bilateral lung metastases, and in February 4 years, he recurred a malignant tumor in the pancreas with abdominal metastases and liver metastases. This is a terminal diagnosis with a very poor prognosis. PtI started taking antioxidant vitamins, vitamin D, large doses of turmeric, fish oil (9 grams per day), resveratrol and green tea (the equivalent of 36 cups per day) on September 27, 2 years, while all of these drugs were anti-inflammatory, and all he continued to take. In March 3 years, he began treatment with celebrex at 100 mg twice a day, which he took more than 20 months. Ptl began PVF treatment three times a week in May 4 years, which he continued to use regularly for more than 3 years. PtI lived for 5 years after being diagnosed with terminal metastatic pancreatic cancer, a surprisingly long life span in the context of a diagnosis that has an extremely poor prognosis. This case is evidence that high doses of many anti-inflammatory drugs (i.e., celebrex, antioxidants, vitamin D, turmeric, fish oil, resveratrol, green tea) taken with PVF formulations led to a synergistic effect that contributed to the surprising survival of PtI for 5 years after the development of metastatic pancreatic cancer, a diagnosis that is usually fatal within 6 months.

In accordance with the above results, one aspect of the invention is the treatment of a malignant tumor of the pancreas, abdominal lymph nodes, liver and lung using antigenic compositions that contain antigenic determinants of microbial pathogens that are known to cause infection in the pancreas, abdominal lymphatic nodes, liver and lungs.

Patient J (PtJ) had a diagnosis substantially identical to the diagnosis of PtI (i.e., pancreatic cancer with metastases to the abdominal lymph nodes, lungs, and liver). PtJ, which did not take any other anti-inflammatory drugs with the PVF vaccine, with the exception of antioxidants and vitamin D, died within 4 months of diagnosis, while PtI, which took large doses of various other anti-inflammatory drugs (i.e., celebrex, turmeric, fish oil, resveratrol and green tea), together with the PVF vaccine, survived 5 years after diagnosis. These cases are evidence of the synergistic action of many high-dose anti-inflammatory drugs and targeted vaccine therapy.

MRV in case of breast cancer with bone metastases

Patient K (PtK): In March 0, PtK developed pains in the neck and back that persisted. On July 28, at 0, she was diagnosed with stage 4 breast cancer with metastases to the cervical spine, a diagnosis of incurable disease. She underwent surgery to remove two breast seals (axillary lymph nodes positive) and palliative radiation therapy for spinal metastases. On January 18, 1 year, PtK began treatment with doses of antioxidants and vitamin D, as well as NSAIDs with 50 mg indomethicin four times a day. Three days later, on January 21, 1 year, she started treatment with the MRV composition, which contains Staphylococcus aureus, the most common pathogen of both the breast and bone. Although there was no document on the exact duration of the time period, such treatment with the combination of MRV / indomethicin / antioxidants / vitamin D was continued, the patient received a sufficient dose of the vaccine (20 ml) for about 2 years of treatment at the usual dose and at the usual frequency (i.e. ., three times a week), and PtK claimed that she had completed the recommended course of treatment at home. Amazingly, PtK was still alive at its last contact 13 years after being diagnosed with stage 4 metastatic breast cancer with bone metastases.

In accordance with the above results, one aspect of the invention is the treatment of malignant breast and bone tumors using antigenic compositions that contain antigenic determinants of microbial pathogens that are known to be pathogenic in breast and bone infections.

Unlike patient K, patient L (PtL) was diagnosed with breast cancer with bone metastases on October 11, 0 year. She was not prescribed NSAIDs or other anti-inflammatory drugs. PtL began treatment with MRV on February 27, 1 year. She died 9 months later on November 4, 1 year, a little more than one year after being diagnosed with stage 4 breast cancer with bone metastases. The difference in the rest between similar cases of PtK and PtL illustrate the potentially synergistic treatment with anti-inflammatory drugs and antigenic compositions according to the invention.

MRV with anti-inflammatory drugs and without anti-inflammatory drugs in the case of a malignant breast tumor with bone metastases

Patient M (PtM): PtM was diagnosed with stage 4 breast cancer with bone metastases on June 15, 0 year. She started taking 250 mg of naprosin twice a day NSAIDs on an ongoing basis to relieve pain in October 3 years. She started taking doses of antioxidants and vitamin D. Three months later, on January 15, 4 years, she began treatment with the MRV vaccine (which contains Staphylococcus aureus, the most common the pathogen of the mammary gland and bones) in combination with such anti-inflammatory medications (i.e., naprosin, antioxidants and vitamin D). PtM lived more than 9 years after the first diagnosis of metastatic breast cancer in stage 4 with bone metastases, an unusually long lifespan, given the usual poor prognosis associated with such a diagnosis.

In accordance with the above results, one aspect of the invention is the treatment of malignant tumors of the breast and bone using the introduction of antigenic compositions that contain antigenic determinants of microbial pathogens, which are known to be common causes of infection of the breast and bone.

Unlike PtM, patient N (PtN): PtN was diagnosed with a stage 4 malignant tumor with bone metastases on April 8, year 0. She began taking doses of antioxidants and vitamin D on April 24, 0 years. However, before the start of MRV, she was prescribed the anticoagulant warfarin, which limits the supplementation of vitamin Ε and vitamin C, two important antioxidants that can lead to possible complications if used together with warfarin. In addition, NSAIDs could not be prescribed in this case, since they are contraindicated in the case of warfarin. On June 2, 1 year, PtN started treatment using MRV. She died 14 months later in August 2 years. In this context, it is possible that the use of targeted vaccine therapy without the synergistic effect of adjuvanted anti-inflammatory drugs (i.e., NSAIDs, vitamin Ε, and therapeutic doses of vitamin C) has limited potential benefits.

In conclusion, in cases of stage 4 breast cancer with bone metastases being treated using targeted MRV therapy described in detail above, the use of adjuvant anti-inflammatory drugs along with MRV was associated with a significantly higher survival rate, much greater than the survival rate in two cases when such adjuvant anti-inflammatory drugs have not been used together with the vaccine, which is evidence of a synergistic effect.

MRV in case of lung metastases

In June, patient O (PtO) was diagnosed with kidney cancer with bilateral metastases to the lungs and bone (left thigh). Such a diagnosis is usually considered an incurable deadly diagnosis with a poor prognosis. He began treatment using MRV in August 0, and continued regular treatment (three times a week) for 16 months (after which MRV was no longer available). In September 0, he began a 7-month treatment with an experimental drug, pegylated interferon alfa-2a. His left thigh was “pinned” because of the risk of fracture due to metastases, but due to surgical complications, amputation of the left leg was required below the middle of the thigh. In September 2 years, his malignant right kidney was removed. In October 2 years, a PET scan revealed no signs of a malignant tumor in the lungs or additional signs of bone metastases. PtO is alive without signs of a malignant tumor in the lungs for more than 9 years after a diagnosis of bilateral pulmonary metastases, which is a remarkable result.

In accordance with the above results, one aspect of the invention is the treatment of lung metastases using antigenic compositions that contain antigenic determinants of microbial pathogens that are known to be lung pathogens.

MRV in case of bone and lung metastases

Patient Ρ (PtP) was diagnosed with kidney cancer in July 0, and he underwent removal of his right kidney. In December 4, he developed bone metastases (bilaterally in the femur) and lungs (bilaterally). PtP refused the usual treatment and started MRV treatment in April 5, which he continued regularly three times a week for 18 months. PtP's health status improved, and he returned to normal daily activity. X-ray examination and imaging of the chest and thigh bones did not reveal progression and showed a stable disease in the lungs and thigh bones for 18 months, during which PtP was treated with MRV.

In accordance with the above results, one aspect of the invention is the treatment of lung and bone metastases using antigenic compositions that contain antigenic determinants of microbial pathogens that are common causes of lung and bone infection.

MRV in case of lung metastases

Patient Q (PtQ) was diagnosed with colon cancer with possible lung metastases in June 0. At this time, the primary tumor of the colon was excised, and only a few metastases in the lungs remained. PtQ began MRV treatment on December 11 · 0 year, which she continued three times a week for 4 months. On April 19, 1 year after 6 months of chemotherapy treatment, she underwent surgery to remove only the remaining visible lung lesion, which was confirmed as metastatic damage. A diagnosis of colon cancer with metastases to the lungs has a poor prognosis even in the context of chemotherapy after the surgical removal of visible metastases. Despite the initial poor prognosis, PtQ maintains excellent health with no evidence of a malignant tumor for more than 10 years after an initial diagnosis with metastases to the lung and treatment using MRV.

S. aureus antigens in case of breast cancer with bone metastases

Patient R (PtR): In May 0, PtR was diagnosed with breast cancer with metastases to the sternum, femur and cervical spine, a non-coarse malignant tumor with a poor prognosis. She was treated with radiation therapy and tamoxifen. In May of 4 years, she developed an additional metastatic region in the lumbar spine, and she began treatment with megeis. In November 4, she began treatment with a vaccine (a staphage lysate vaccine) containing only Staphylococcus aureus, which is the most common cause of infection in both the mammary gland and bones, and therefore has been selected as a drug for treating malignant tumors of the mammary gland and bones. She continued regular therapy with such a vaccine for 5 years. Despite being diagnosed with metastatic breast cancer with multiple bone metastases, PtR has lived for more than 17 years, amazing survival in the context of non-curable metastatic breast cancer, and evidence of the potential for targeted vaccine therapy for breast cancer.

In accordance with the above results, one aspect of the invention is the treatment of malignant tumors of the breast and bone using the introduction of antigenic compositions that contain antigenic determinants of microbial pathogens, which are known to be the most common cause of infection of the breast and bone.

This option demonstrates that a drug that contains antigenic determinants of only the most common pathogenic organism or organisms in a particular tissue can provide special benefits, which are also shown on the basis of the data obtained in the mouse model described below. In accordance with the aforementioned, the inventors found an increased effectiveness of respivax compared to MRV in the treatment of malignant tumors located in the lung, which reflects the fact that the respivax preparation is somewhat more optimal, since it contains higher relative concentrations of pathogenic species that most often cause lung infection (i.e., 67% of the number of bacterial cells of respivax are represented by the species that are the most common cause of lung infection, while only 30% of the MRV vaccines are composed of species that are the most common cause of lung infection).

In accordance with the above results, one aspect of the invention is to provide antigenic compositions so that antigenic determinants of microbial pathogens, which are known to be common causes of infection, are preferred in terms of the proportion of the drug, with the most common cause of infection being the most preference. For example, the proportion of antigenic determinants that are derived from pathogens that are known to be a common cause of infection can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%.

Accordingly, in some embodiments, the invention relates to antigenic compositions that utilize a limiting relative content of antigenic determinants selected according to the invention, compared with any other antigenic determinants in the composition. For example, antigenic compositions may contain more than X% antigenic determinants derived from a pathogenic (or often pathogenic or most often pathogenic) species, where X may mean, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95 or 100 (or any integer from 10 to 100). For example, at least X% of the antigenic determinants in the antigenic composition may be specific for microbial pathogens that are pathogenic (or often pathogenic, or most often pathogenic) in the particular organ or tissue of the patient in which the cancer is located. When using an alternative criterion, the total number of microbial pathogens in the antigenic composition, at least X% can be selected from microbial pathogens that are pathogenic (or often pathogenic or most often pathogenic) in the specific organ or tissue of the patient in which the cancer is located . In some embodiments, the antigenic composition, respectively, may consist essentially of antigenic determinants of one or more microbial pathogens, each of which is pathogenic in a particular organ or tissue in which the cancer is located. In selected embodiments, the antigenic composition may consist essentially or entirely of antigenic determinants of microbial pathogens, which are often pathogenic in a particular organ or tissue of patients in which the cancer is located. In the following selected embodiments, the antigenic composition may consist essentially or completely of the antigenic determinants of the microbial pathogen (or pathogens) that are most often pathogenic in the particular organ or tissue of the patients in which the cancer is located.

In the context of various aspects of the invention, organisms are characterized by the frequency with which they are pathogenic. In this context, the invention also relates to the frequency with which the endogenous flora is pathogenic. For clarity in this regard, the description of the pathogenicity frequency given in the present description, such as the indication “widely pathogenic,” refers, in general, to the proportion of infection in a particular organ or tissue, which is usually attributed to the action of a particular organism, and not to the frequency with which colonization tissue organisms passes into a pathogenic infection. In North America, most human infections have been found to be caused by endogenous organisms, even though such organisms are usually present as part of the endogenous flora without causing infection. For example, although S. pneumoniae is a common cause of lung infection (ie, pneumonia) in humans (and is therefore called “widely pathogenic” in the lung), it is also true that S. pneumoniae is widespread as part of the endogenous airway flora, without causing infection, and therefore, in the form of endogenous colonization is usually not pathogenic.

MRV in case of multiple myeloma

Patient S (PtS) was diagnosed with multiple myeloma (stage 3A) at the end of 0 year with multiple lesions detected by scanning bones, including the skull, humerus and ilium. He was treated with standard chemotherapy (melphalan and prednisone) for 6 months. However, in December 3, he developed a pathological fracture of his right femur as a result of his illness, which required the installation of pins and local radiation. On April 28, 4 years, PtS began treatment for MRV, which contains Staphylococcus aureus, a common cause of septicemia, which he continued for more than 13 years until the vaccine was no longer available in December 17. It is noteworthy that PtS is still alive almost 25 years after the diagnosis of multiple myeloma, a truly extraordinary result, given its “lethal” diagnosis.

In accordance with the above results, one aspect of the invention is the treatment of hematological malignancies using antigenic compositions that contain antigenic determinants of microbial pathogens that are known to cause septicemia.

In accordance with the above results and as shown in the medical histories of other patients described in detail in this publication, another aspect of the invention involves the administration of immunogenic compositions repeatedly relatively often over a relatively long period of time, as described elsewhere in this publication.

PVF in case of colon cancer with metastases in the liver and abdominal lymph nodes

Colon cancer was diagnosed in patient Τ (PtT), and she was treated by excising the primary tumor (and subsequent chemotherapy) in September 0. Ten months later, she developed liver metastasis, which was surgically excised on July 1. PtT felt good until June 7, when she had a recurrent disease - inoperable bulk mass of the abdominal lymph nodes near the aorta and spine, obstruction of the left ureter, requiring the insertion of a nephrostomy tube. PtT was considered terminally ill and was treated using palliative radiation therapy in October 7 years. She began PVF treatment on November 17, 7, which she continued every other day. PtT lived almost 4 years after being diagnosed with terminal recurrent metastatic colorectal cancer.

In accordance with the above results, one aspect of the invention is the treatment of a malignant tumor in the abdominal lymph nodes using antigenic compositions that contain antigenic determinants of microbial pathogens that are known to cause infection in the abdominal lymph nodes.

MRV in case of metastases to the skin and perineum

Patient U (PtU) was diagnosed with colon cancer and treated by excising a primary tumor in November 0. He was diagnosed with stage 4 cancer in July 2 years with metastases to the perineum (i.e., to the soft tissues of the canal / genital area) and skin. He underwent the following operation to remove, as much as possible, a malignant tumor in the perineum (the malignant tumor spread beyond the borders of the surgical field), followed by radiation and chemotherapy. The only known remaining areas of the malignant tumor were in the skin and perineum. PtU began treatment for MRV, which contains Staphylococcus aureus, a common cause of skin and perineal infections, on May 25, 3 years, which he continued three times a week for 5 months. Despite its initial poor prognosis, PtU has been in excellent health for over 10 years after being diagnosed with stage 4 cancer with metastases to the perineum and skin.

In accordance with the above results, one aspect of the invention is the treatment of cancer of the skin and perineum using antigenic compositions that contain antigenic determinants of microbial pathogens, which are known to be common causes of infection in the skin and perineum.

PVF in case of peritoneal metastases

Patient V (PtV) was diagnosed with breast cancer in May 0, at which time she underwent mastectomy with adjuvant chemotherapy. In January 12, she developed abdominal pain and ascites, and was diagnosed with peritoneal metastases, a diagnosis with a poor prognosis. On August 5, 12, PtV began treatment with PVF, which contains E. coli, a common cause of peritoneal infections, which is about ;; and continued regularly for 1 year. Tumor markers and ascites decreased, and in August 13, after one year of PVF treatment, she underwent abdominal surgery for an unrelated medical condition, and the surgeon could not find any signs of a previous peritoneal cancer. PtV discontinued use of the vaccine. PtV was still alive at the last contact, 3 years and 9 months after the diagnosis of terminal peritoneal metastases.

In accordance with the above results, one aspect of the invention is the treatment of peritoneal metastases using antigenic compositions that contain antigenic determinants of microbial pathogens that are known to cause peritoneal infection.

PVF for ovarian and pelvic cancer

Patient W (PtW) was diagnosed with low-grade ovarian cancer at stage 3B at the end of 0 year. She underwent surgery in November 0 with the removal of the left ovary, but the malignant tumor could not be completely excised, and therefore there was a very high risk of relapse for the woman. She completed a full course of postoperative chemotherapy. However, at 2 years old she began to increase the level of tumor markers and in January 3 years she was diagnosed with a relapse in the region of the right ovary. She underwent surgery to remove a bulky lesion in her right ovary in February 3, but again the malignant tumor might not have been completely excised and she was given subsequent chemotherapy. However, again in December 3 years, the next relapse in the pelvic region occurred, and retroperitoneal lymphadenopathy developed. She began treatment with a PVF vaccine that contains E. coli, which causes ovarian and pelvic infections, on January 5, 4 years, which she continued for 6 months. The tumor markers, which rose to 2600, fell to a range of 300. PtW was alive and feeling very good at the last contact 2 years and 9 months after the diagnosis of recurrent ovarian cancer. Noteworthy is the drop in her tumor marker levels after PVF treatment.

In accordance with the above results, one aspect of the invention is the treatment of cancer of the ovary and pelvis using antigenic compositions that contain antigenic determinants of microbial pathogens that are known to cause infection in the ovary and pelvic region.

MRV in case of follicular non-Hodgkin lymphoma

Patient Y (PtY) was diagnosed with stage 4A follicular non-Hodgkin's lymphoma with extensive severe lymphadenopathy (i.e., enlarged lymph nodes). He refused all the usual treatment. PtY began treatment with the MRV composition, which contains many pathogens that usually cause infection of the lymph nodes of the head and neck, armpits, mediastinum and inguinal region. In addition, he began treatment according to a regimen using many vitamins / supplements, a healthy diet, and other immune-enhancing therapies. He continued to use this vaccine regularly for more than 3 years, by which time his lymph nodes began to decrease in size and he felt yourself well. This resolution of lymphadenopathy continued, and imaging showed an almost complete resolution of previously extensive lymphadenopathy. PtY felt well and limadenopathy was not palpable: undoubtedly an amazing cure. Five years after his initial diagnosis of follicular non-Hodgkin's lymphoma at stage 4A, PtY had no signs of relapse, and he moved on to an active and healthy life. MRV vaccine treatment resulted in complete remission of stage 4A follicular non-Hodgkin lymphoma.

In accordance with the above results, one aspect of the invention is the treatment of lymphoma using the administration of antigenic compositions that contain antigenic determinants of microbial pathogens, which are known to be common causes of lymph node infections in the area in which the lymphoma is located.

PVF in case of colorectal cancer with liver and kidney metastases

Patient Ζ (PtZ) has been diagnosed with metastasis of previously treated colon cancer with liver metastases and possible other metastases in both kidneys. Liver metastases were excised. The prognosis for this stage (i.e., stage 4) of colon cancer is poor, and the benefits of further conventional treatment (i.e., chemotherapy) are limited. PtZ refused chemotherapy from the start. Three months after the diagnosis of metastatic colorectal cancer, PtZ began treatment with Polyvaccinum Forte (PVF), which contains Ε. coli, a common cause of infection of the colon, liver, and kidneys. Additionally, PtZ began treatment with a regimen using a variety of vitamins / supplements and a healthy diet. He continued the regular use of such a vaccine and the regimen of vitamins and supplements, and began chemotherapy. Although the general course of the disease progressed slowly, with the development of lung metastases and liver metastases relapse, he had a stable mass and good energy level 28 months after the initial diagnosis of metastatic disease. Three years (36 months) after being diagnosed with stage 4 colon cancer, PtZ felt good, with the exception of nausea and moderate weight loss associated with chemotherapy.

In accordance with the above results, one aspect of the invention is the treatment of cancer of the colon, liver, and kidneys using antigenic compositions that contain antigenic determinants of microbial pathogens that are known to be pathogenic in the colon, liver, and kidneys.

PVF in case of colon cancer with metastases to the liver, lymph nodes of the liver gate and lung

Patient AA (PtAA) was diagnosed with metastatic colorectal cancer with metastases to the liver, lymph nodes of the gates of the liver and lungs. The prognosis for this stage (ie, stage 4) of colon cancer is very poor (ie, a “terminal” malignant tumor), and the benefits of conventional treatment (ie, chemotherapy) are limited. PtAA started chemotherapy, but stopped treatment about 5 months after being diagnosed due to side effects, at which time he started treatment using Polyvaccinum Forte (containing the types of bacteria that cause infection in the colon, liver, abdominal lymph nodes and lungs) every other day, as well as a regimen using many vitamins / supplements and a healthy diet. A subsequent CT scan of PtAA showed that the necrotic lymph nodes of the liver gates have not changed in size since the diagnosis, and there was no change in the size of lung metastases, although the two liver metastases slightly increased in size (from 3.4 cm to 4.5 cm and from 1.2 cm to 3.0 cm). Despite a very poor prognosis, PtAA continued to feel pretty good almost a year after being diagnosed with a terminal malignant tumor.

In accordance with the above results, one aspect of the invention is the treatment of a malignant tumor of the colon, liver, abdominal lymph nodes and lungs using antigenic compositions that contain antigenic determinants of microbial pathogens that are known to be pathogenic in the colon, liver, abdominal lymph nodes and lungs.

EXAMPLE 3: Microbial pathogens

In alternative aspects, the invention uses microbial antigens, such as bacterial or viral antigens, to produce antigenic compositions, the microorganisms being selected based on tissue or an organ in which the microorganism is known to cause infections. Bacterial resident flora is represented by the most common bacterial pathogens that cause the vast majority of bacterial infections in most animals, including humans. The resident flora can, for example, become infected through primary adhesion or adhesion and invasion after mucosal damage, as a result of, for example, vascular damage, trauma, chemical stroke, or damage resulting from a primary infection.

In the case of microbial pathogens, virulence and infectious potential are a combination of the microorganism's ability to adhere, the ability to produce enzymes, survive under the influence of immunological products (complement, antibodies) and survive under the microbiocidal activity of macrophages and neutrophils. Some bacteria, including endogenous bacteria, may be virulent enough to cause monomicrobial infections, while others are more effective in case of synergy in polymicrobial infections. In general, it is often impossible to pinpoint the specific role of individual microorganisms in a mixed infection. Since acute infection in some cases can provide more optimal immune stimulation, accordingly, in some embodiments, the invention uses types of microorganisms that are involved in acute infection.

In some embodiments, bacteria that are representative of the endogenous flora of a particular area can be used to produce antigenic compositions of the invention. The rows in table 6 indicate some types of bacteria and biological areas in which each species can form part of the endogenous flora. For example, Abiotrophia species are usually representatives of the endogenous flora of the respiratory tract and oral cavity.

Endogenous microbial flora, such as bacteria, has access to tissues in the event of pathogenesis, either through the principle of os on the principle of contiguity of distribution, or through bacteremic spread. Under favorable conditions, all endogenous organisms can become pathogenic and locally penetrate and spread as a result of the distribution based on the adjacency principle to neighboring tissues and organs. The endogenous bacterial flora of the skin, oral cavity and colon is represented by species, which, as it turned out, are also susceptible to bacteremic spread. Therefore, bacteria that are representatives of a particular domain of endogenous flora can cause infection in the tissues or organs into which such bacteria can spread. Accordingly, one aspect of the invention is the use of endogenous microbial pathogens for the treatment of a cancer of a tissue or organ into which endogenous bacteria can spread, causing infection. The columns of Table 7 list 9 domains of the endogenous flora: skin, respiratory system, genitals, genitourinary system, oral cavity, stomach, duodenum / jejunum, ileum, and colon. The rows of table 7 lists the organs and tissues in which malignant tumors can be located. Accordingly, one aspect of the invention is the use of endogenous microbial pathogens to produce antigenic compositions, or the selection of existing preparations containing pathogens, for the treatment of malignant tumors located in tissues or organs into which the pathogen can spread, causing infection. Accordingly, in alternative embodiments, tumors located in the tissues or organs listed in the first column of Table 7 can be treated with antigenic compositions containing antigenic determinants that are specific for microbial pathogens that are representative of the endogenous flora of one or more domains of the endogenous flora listed in the first row of table 7, and indicated by X or a check mark in the corresponding row. For example, tumors located in the prostate can be treated with an antigenic composition containing antigenic determinants specific for a microbial pathogen or pathogens endogenous to the genitourinary system and / or reproductive system. Some types of bacteria that are endogenous to the domains of the endogenous flora listed in table 7 are indicated with the corresponding domains of the endogenous flora in table 6. Accordingly, one aspect of the invention is the treatment of a cancer located in the tissue indicated in table 7 with an antigenic composition, containing antigenic determinants of the types of bacteria that are listed in table 6, while the areas of endogenous flora associated with the location of the tumor in table 7 coincide with the areas of endogenous flora associated with the types of bacteria in table 6.

According to the summarized information given in Tables 6 and 7, malignant tumors localized in the tissues or organs indicated in column 1 of Table 7 can be treated with antigenic compositions containing antigenic determinants of the corresponding bacterial species shown in Table 6, so that the column headings in Table 7 is essentially replaceable by the names of the types of bacteria indicated in Table 6.

In some embodiments, the microbial pathogens for use in the invention may be exogenous bacterial pathogens. For example, the organisms listed in table 8 can be used as microbial pathogens to produce antigenic compositions, or antigenic compositions containing such pathogens can be selected for use in the treatment of malignant tumors located in the tissues or organs indicated with the corresponding organism in the table 8. In some embodiments, antigenic determinants of both endogenous and exogenous species of bacteria targeted by a particular tissue or organ can be used in combination. For example, an antigenic composition obtained or specific for Clostridium difficile can be used to treat a malignant tumor located in the colon.

Table 8 Exogenous bacterial human pathogens and their infection sites Types of bacteria Places of localization in tissues / organs Species of Achromobacter hematological, skin, soft tissue, lung / trachea / bronchi, peritoneum, membranes

brain, bile duct, gall bladder, kidney, bladder, ureter Species Actinomadura skin, soft tissue, lung / trachea / bronchi, mediastinum, brain, spinal cord, hematological, membranes of the brain Types of Aerobacter small intestine, colon, hematological, peritoneum Types of Aerococcus hematological, heart, bone, kidney, bladder, ureter, cerebral membranes Species of Alcaligenes lung / trachea / bronchi Views of Anaplasma hematological membranes of the brain, liver, spleen, bone, lung / trachea / bronchi Bacillus anthracis lung / trachea / bronchi, lymph nodes of the gates of the lung, mediastinum, membranes of the brain, skin, nasopharynx, tonsil, oral cavity, small intestine, colon, hematological Bacillus cereus colon, eye, hematologic Other species of Bacillus hematological, bone, membranes of the brain, brain, heart, lung / trachea / bronchi, mediastinum, skin, soft tissue, colon, stomach, small intestine, eye Species of Balneatrix lung / trachea / bronchi, membranes of the head

hematological brain Bartonella bacilli form is skin, hematological, liver, lymph nodes Bartonella henselae brain, spinal cord, hematological, skin, liver, bone, pleura, lung / trachea / bronchi, mediastinum, axillary and inguinal lymph nodes, eye Bartonella quintana skin, hematological, liver, spleen Bergeyella zoohelcum skin, soft tissue, meninges, hematologic, lung / trachea / bronchi Bordetella holmesii lung / trachea / bronchi, hematological Bordetella parapertussis nasopharynx, tonsil, lung / trachea / bronchi Bordetella pertussis nasopharynx, tonsil, lung / trachea / bronchi Borrelia burgdorferi brain membranes, brain, spinal cord, skin, eye, hematological, inguinal / axillary / cervical lymph nodes, muscle, liver, spleen, nasopharynx, lung / trachea / bronchi, testes Borrelia recurrentis brain, spinal cord, hematological, small intestine, liver, spleen, salivary glands, lung / trachea / bronchi, lymph nodes, eye, skin

Views of Brevundimonas peritoneum, hematological, skin, soft tissue Views of Brucella lung / trachea / bronchi, lymph nodes of the gates of the lung, brain membrane, brain, spinal cord, lymph nodes, mediastinum, bone, eye, small intestine colon, liver, biliary tract, kidney, ureter, bladder, hematological, skin , testes, spleen, prostate Burkholderia gladioli hematologic, meninges, lung / trachea / bronchi Burkholderia mallei lung / trachea / bronchi, skin, soft tissue, liver, spleen, muscle, lymph nodes of the gates of the lung, mediastinal lymph nodes, mediastinum, lymph nodes of the head and neck, hematological Burkholderia pseudomallei lung / trachea / bronchi, skin, kidney, bladder, ureter, soft tissue, bone, brain, spinal cord, muscle, hematological, prostate, kidney, ureter, cerebral membranes Calymmatobacterium granulomatis skin, penis, vulva, soft tissue, vagina, cervix, bone, hematological, inguinal lymph nodes Campylobacter coli small intestine, colon

Campylobacter fetus lung / trachea / bronchi, small intestine, colon, lining of the brain, brain, peritoneum, bone, gall bladder, ovaries, hematological, heart, kidney, bladder, ureter Campy1obacter jejuni colon, hematologic, gall bladder, pancreas, bladder, bone, meninges Campylobacter sputorum small intestine, colon Sapnophthophaga canimorsus skin, soft tissue, membranes of the brain, hematological, bone, lung / trachea / bronchi, eye Capnostyophagus cynodegmi skin, soft tissue, membranes of the brain, hematological, bone, lung / trachea / bronchi, eye CDC groups EF-4a and EF-4b hematological, eye, skin, soft tissue Chlamydia pneumoniae lung / trachea / bronchi, lymph nodes of the gates of the lung, liver, brain, meninges, skin, thyroid gland, pancreas, hematological Chlamydia psittaci lung / trachea / bronchi, lymph nodes of the gates of the lung, mediastinum, liver, brain, membranes of the brain,

hematological, skin, thyroid gland, pancreas Chlamydia trachomatis inguinal lymph nodes, penis, vulva, vagina, cervix, uterus, ovaries and appendages, peritoneum, prostate, eye Chlamydophila pneumoniae larynx, trachea / bronchi, hematological Chromobacterium violaceum hematological, liver, spleen, lung / trachea / bronchi, kidney, bladder, ureter, eye / eye socket, bone, brain, meninges, spinal cord Chlamydophila psittaci lung / trachea / bronchi Species of Chryseobacterium lining of the brain, lung / trachea / bronchi, hematological Clostridium bifermentans small intestine, colon, stomach, skin, soft tissue, hematological Clostridium botulinum colon, small intestine, skin Clostridium difficile colon Clostridium indolis small intestine, colon, stomach, skin, soft tissue, hematological Clostridium mangenolii small intestine, colon, stomach, skin, soft tissue, hematological Clostridium small intestine, colon, stomach, skin,

perfringens soft tissue, hematological, heart Clostridium sordellii small intestine, colon, stomach, skin, soft tissue, hematological Clostridium sporogenes small intestine, colon, stomach, skin, soft tissue, hematological Clostridium subterminale small intestine, colon, stomach, skin, soft tissue, hematological Clostridium tetani leather, soft fabric Views of Comamonas hematological, peritoneum, eye Corynebacterium pseudotuberculosis cervical / axillary / inguinal / mediastinal lymph nodes, lymph nodes of the lung gate, lung / trachea / bronchi, mediastinum Coxiella burnetii lung / bronchi / trachea, brain, spinal cord, liver, bone Edwarsiella tarda skin, soft tissue, liver, meninges, small intestine, colon, bone, uterus, ovaries Views of Ehrlichia brain membranes, brain, spinal cord, hematological, bone, liver, kidney, spleen, lymph nodes Erysipelothrix rhusiopathiae skin, hematological, bone, brain, peritoneum Francisella tularensis nasopharynx, oral cavity, tonsil, lung / trachea / bronchi, skin, axillary / head and neck / inguinal lymph nodes, hematological, eye,

small intestine Species of Fusobacterium skin, soft tissue, hematological Views of Gordonia skin, soft tissue, lung / trachea / bronchi, mediastinum, brain, spinal cord, hematological, brain membranes, eye Haemophilus ducreyi skin, inguinal lymph nodes, penis, vulva, vagina Helicobacter pylori stomach Types of Legionella lung / trachea / bronchi, lymph nodes of the gates of the lung, hematological, brain, spinal cord, muscle, pancreas Species of Leptospirosis lung / trachea / bronchi, pancreas, membranes of the brain, brain, spinal cord, skin, lymph nodes, eye, hematological, nasopharynx, oral cavity, tonsil, kidney, liver, spleen Listeria monocytogenes hematological, brain, meninges, spinal cord, small intestine, colon Species of Me thylobacterium hematological, peritoneum, skin, soft tissue, bone Mycobacterium avium lung / bronchi / trachea, lymph nodes of the gates of the lung, prostate, pancreas, spleen, skin, lymph nodes

neck, esophagus, bone, hematological Mycobacterium bovis colon, small intestine Mycobacterium kansasii lung / bronchi / trachea, lymph nodes of the gates of the lung, prostate, bone Mycobacterium leprae skin, soft tissues, testes, eye Mycobacterium marinum skin, soft tissue, bone Mycobacterium scrofulaceum lymph nodes of the head and neck Mycobacterium tuberculosis lung / bronchi / trachea, lymph nodes of the gates of the lung, prostate, peritoneum, pancreas, spleen, lymph nodes, small intestine, membranes, brain, brain, spinal cord, kidney, ureter, bladder ,. muscle, esophagus, colon, testes, eye, ovaries, cervix, vagina, uterus, mediastinum, larynx, skin, hematological, pleura Mycobacterium ulcerans leather, soft fabric Other species of Mycobacterium lung / bronchi / trachea, lymph nodes of the gates of the lung, skin, soft tissues, bone, lymph nodes of the head and neck Types of Myroides kidney, bladder, ureter, skin,

hematological soft tissue Neisseria gonorrhoeae nasopharynx, oral cavity, tonsil, prostate, penis, vagina, cervix, uterus, ovaries / appendages, peritoneum, skin, muscle, bone, liver, hematological, lymph nodes of the head and neck and inguinal and intraperitoneal lymph nodes, anus Neorickettsia sennetsu hematological, bone, lymph nodes, liver, spleen Types of Nocardia lung / bronchi / trachea, pancreas, membranes of the brain, spinal cord, brain, skin, soft tissue, eye, bone, kidney, heart, hematological Orientia tsutsugamushi brain membranes, brain, spinal cord, hematological, skin, inguinal and axillary lymph nodes, spleen, lung / bronchi / trachea Views of Pandoraea lung / trachea / bronchi, hematological Pasteurella canis skin, soft tissue, hematological Pasteurella dagmatis skin, soft tissue, hematological Pasteurella stomatis skin, soft tissue, hematological Species of Pediococcus hematological, liver, colon Pityrosporum ovale leather Plesiomonas small intestine, colon

shigelloides hematological, membranes of the brain, bone, gall bladder, skin, soft tissue Pseudomonas aeruginosa lung / trachea / bronchi, hematological, skin, soft tissue, bone, membranes of the brain, brain, eye, kidney, bladder, ureter, heart Other species Pseudomonas skin, soft tissue, lung / trachea / bronchi, mediastinum, hematological Views of Ralstonia hematological, membranes of the brain, bone Species of Rhizobium hematologic, peritoneum, eye, kidney, bladder, ureter Species of Rhodococcus lung / trachea / bronchi, hematological, brain, skin, lymph nodes, bone, mediastinum, liver, spleen, soft tissue, spinal cord, meninges Rickettsia akari leather Rickettsia conorii lung / bronchi / trachea, lymph nodes of the gates of the lung, brain membrane, brain, spinal cord, hematological, skin, kidney, liver, spleen, pancreas Rickettsia felis skin, brain, spinal cord Rickettsia prowazekii brain membranes, brain, spinal cord, hematological, lung / bronchi / trachea, skin, spleen

Rickettsia rickettsiae lung / bronchi / trachea, lymph nodes of the gates of the lung, meninges, brain, spinal cord, hematological, muscle, small intestine, liver, skin Rickettsia slovaca skin, lymph nodes of the head and neck Rickettsia typhi membranes of the brain, hematological, liver, kidney, brain; brain, lung / bronchi / trachea, spleen Views of Roseomonas hematological, peritoneum, skin, soft tissue, bladder, kidney, ureter Species of Salmonella lung / bronchi / trachea, pancreas, spleen, intraperitoneal lymph nodes, stomach, small intestine, colon, membranes of the brain, skin, muscle, bone, hematological, heart Views of Shewanella skin, soft tissue, eye, bone, hematological, peritoneum Shigella boydii colon Shigella dysenteriae colon Shigella flexneri colon Shigella sonnei colon Species of Sphingobacterium brain, meninges, spinal cord, eye, skin, soft tissue Views of Sphingomonas hematological, membranes of the brain,

peritoneum, skin, soft tissue, kidney, bladder, ureter Spirillum minus skin, axillary / inguinal / lymph nodes of the neck, hematological, liver, spleen Other species of Spirillum colon Stenotrophomona smaltophilia brain membranes, hematological, peritoneum, lung / trachea / bronchi, eye, kidney, bladder, ureter, skin, soft tissue Streptobacillus moniliformis skin, bone, hematological, lung / trachea / bronchi, meninges, brain, liver, spleen Streptococcus iniae skin, hematological, soft tissue Streptococcus zooepidemicus small intestine, nasopharynx, bone, membranes of the brain, hematological, lymph nodes of the head and neck Types of Streptomices skin, soft tissue, lung / trachea / bronchi, mediastinum, brain, spinal cord, hematological, membranes of the brain Treponema pallidum nasopharynx, tonsil, oral cavity, membranes of the brain, brain, spinal cord, penis, vulva, vagina, anus, cervix, eyes, hematological, inguinal and lymph nodes of the head and neck Tropheryma whipplei brain, spinal cord,

hematologic, small intestine, colon, heart, lung / trachea / bronchi, eye Types of Tsukamurella skin, soft tissue, lung / trachea / bronchi, mediastinum, brain, spinal cord, hematological, membranes of the brain Vibrio cholerae colon, small intestine Vibrio cincinnatiensis hematological, membranes of the brain Vibrio damsela leather, soft fabric Vibrio fluvialis small intestine, colon Vibrio furnissii small intestine, colon Vibrio hollisae small intestine, colon, skin, soft tissue Vibrio metschnikovii hematological Vibrio parahaemolyticus colon, small intestine Vibrio vulnificus soft tissue, blood, skin Yersinia enterocolitica nasopharynx, tonsil, small intestine, intraperitoneal lymph nodes, colon, muscle, lung / trachea / bronchi, liver, spleen, hematological Yersinia pestis lung / trachea / bronchi, lymph nodes of the gates of the lung, inguinal / axillary / lymph nodes of the neck, cavity, tonsil, hematological,

leather Yersinia pseudotuberculosis small intestine, colon, abdominal lymph nodes

In some embodiments, microbial pathogens for use in the invention may be viral pathogens. Table 9 presents an exemplary list of viral pathogens along with localization sites in tissues and organs for which each type of virus is reportedly a pathogen. Accordingly, one aspect of the invention is the use of immunogenic compositions that are specific for these viruses for treating a cancer located in the organs or tissues that are indicated near the name of the virus in Table 9. For example, an antigenic composition derived from or specific for a vaccine virus , can be used to treat a malignant tumor located in the skin, hematological tissues, lymph nodes, brain, spinal cord, eye or heart.

Table 9 Human viral pathogen and their infection sites Virus Places of localization in tissues / organs Vaccine skin, hematological, lymph nodes, brain, spinal cord, eye, heart Smallpox (smallpox) skin, hematological, lymph nodes, brain

Pox monkey skin, hematological, lymph nodes of the head and neck, brain, eye, lung / trachea / bronchi, lymph nodes of the gates of the lung, mediastinum, nasopharynx Cowpox skin, hematological, lymph nodes Parapoxviruses leather Molluscum contagiosum leather Tanapoxviruses skin, hematological, axillary and inguinal lymph nodes Herpes simplex virus (1 and 2) nasopharynx, oral cavity, tonsil, hematological, lung / bronchi / trachea, pancreas, membranes of the brain, brain, spinal cord, inguinal lymph nodes and lymph nodes of the head and neck, penis, vulva, perineum, esophagus, liver, eye, skin, rectum, tonsil, mediastinum, anus, vagina, cervix Chickenpox nasopharynx, sinus, lung / trachea / bronchi, lymph nodes of the gates of the lung, hematological, pancreas, membranes of the brain, brain, spinal cord, esophagus, liver, eye, skin, heart, mediastinum

Cytomegalovirus nasopharynx, lymph nodes, tonsil, hematologic, lung / trachea / bronchi, pancreas, abdominal lymph nodes, brain, spinal cord, esophagus, small intestine, colon / rectum, eye, liver, heart, skin, mediastinum, esophagus Epstein-Barr virus nasopharynx, tonsil, oral cavity, lymph nodes, hematological, lung, abdominal lymph nodes, brain, spinal cord, muscle, esophagus, liver, heart, skin, spleen, kidney, muscle, heart, lung / trachea / bronchi, lymph nodes collar of the lung, mediastinum Herpes virus 6 people skin, hematological, lung / trachea / bronchi, lymph nodes of the gates of the lung, brain, meninges, liver Herpes virus 7 people skin, brain, liver Human Herpes Virus 8 nasopharynx, tonsil, hematological, skin, spleen, lymph nodes of the head and neck Herpes simplex virus B brain, spinal cord, skin, hematological, lymph nodes

Adenovirus nasopharynx, oral cavity, larynx, trachea, bronchi, lung, lymph nodes, shells of the brain, brain, spinal cord, small intestine, colon, liver, intraperitoneal lymph nodes, mediastinum, bladder, sinus, hematological, ureter, kidney, bladder, thyroid, heart VK virus bud Human papillomavirus skin, anus, penis, vulva, cervix, vagina, oral cavity Hepatitis b virus liver, pancreas, hematological Hepatitis D virus liver Parvovirus B19 skin, hematological, nasopharynx, bone, kidney, heart, liver, brain, meninges Orthoreoviruses nasopharynx, small intestine, colon, oral cavity, nasal sinus, lymph nodes, skin, lung / trachea / bronchi, meninges, brain, spinal cord, liver Orbiviruses brain, muscle, hematologic, Coltiviruses hematological, skin, muscle, oral cavity, spleen, lymph nodes, meninges, brain

Rotaviruses small intestine, colon, liver, hematologic, pancreas, nasopharynx, bile duct, meninges, brain Alphaviruses brain, spinal cord, small intestine, colon, hematologic, skin, bone Rubella skin, hematological, lymph nodes of the head and neck, spleen, nasopharynx, bone, brain, tonsil, bronchi, liver, heart Yellow fever virus hematological, liver, lung / trachea / bronchi, kidney, adrenal gland, spleen, lymph nodes, stomach, kidney Dengue fever virus hematological, lymph nodes, skin, spleen, muscle, liver, brain, nasopharynx Japanese encephalitis virus brain, hematological, spinal cord West Nile Encephalitis Virus brain, hematological, spinal cord, lymph nodes, liver, spleen, pancreas, meninges St. Louis Encephalitis Virus brain, hematological, spinal cord, meninges, muscle, nasopharynx Tick-borne encephalitis virus brain, hematological, spinal cord, muscle, meninges

Other flaviviruses hematological, brain, membranes of the brain, bone, muscles, skin, lymph nodes Hepatitis C virus hematological, liver Hepatitis G virus liver Coronaviruses nasopharynx, sinus, oral cavity, tonsil, larynx, lung / trachea / bronchi, lymph nodes of the gates of the lung, small intestine, colon, tonsil, hematological Toroviruses small intestine, colon, hematological Parainfluenza viruses nasopharynx, sinus, tonsil, oral cavity, larynx, lung / trachea / bronchi, lymph nodes of the gates of the lung, meninges, hematological, mediastinum Virus
mumps salivary glands, pancreas, brain, spinal cord, liver, testes, hematological, membranes of the brain, ovaries, bone, heart, kidney, thyroid gland, prostate, mammary gland Respiratory syncytial virus nasopharynx, tonsil, sinus, lung / trachea / bronchi, lymph nodes of the gates of the lung, mediastinum, hematological, oral cavity, pleura

Human metapneumovirus nasopharynx, lung / trachea / bronchi, easy lymph nodes of the gates, tonsil, sinus, mediastinum, hematological, oral cavity, pleura, larynx, eye, skin, small intestine, colon Measles nasopharynx, sinus, hematological, lung / trachea / bronchi, lymph nodes of the gates of the lung, intraperitoneal lymph nodes, membranes of the brain, brain., spinal cord, liver, spleen, lymph nodes, skin, thymus, eye, mouth, heart Hendra virus brain, meninges, lung / trachea / bronchi, kidney, hematologic, muscle, Nipah virus brain, meninges, spleen, lymph nodes, thymus, lung / trachea / bronchi, kidneys, brain, spinal cord, meninges, hematological Vesicular Stomatitis Virus hematologic, muscle, oral cavity, tonsil, nasopharynx, lymph nodes, small intestine, colon

Rabies virus skin, membranes of the brain, brain, spinal cord, oral cavity, nasopharynx, salivary glands, hematological Lissaviruses brain, spinal cord Flu virus nasopharynx, larynx, lung / trachea / bronchus, lymph nodes of the gates of the lung, brain membrane, muscle, hematological, mediastinum, muscle, nasal sinus, tonsil, oral cavity, eye, pleura, brain, spinal cord, salivary glands, thyroid gland , a heart California encephalitis virus hematological, brain, meninges Hantaviruses hematologic, kidney, eye, skin, oral cavity, muscle, lung / trachea / bronchi Other bunyaviruses brain, hematological, muscle, lining of the brain, spinal cord Lymphocytic Choriomeningitis hematological, lymph nodes, skin, brain, meninges, testes, bone Lassa virus nasopharynx, brain, spinal cord, lung / trachea / bronchi, lymph nodes of the gates of the lung, mediastinum, muscle, testes, eye, heart,

Machupo virus brain, brain membranes, hematological, muscle, eye, skin, lymph nodes, nasopharynx, small intestine, colon Junin Virus brain, brain membranes, hematological, muscle, eye, skin, lymph nodes, nasopharynx, small intestine, colon T cell lymphotropic human virus hematological, skin, lymph nodes, muscle, eye, bone, lung, lymph nodes of the gates of the lung, spinal cord, brain Polio virus nasopharynx, lung / trachea / bronchi, lymph nodes of the gates of the lung, small intestine, cervical and intraperitoneal lymph nodes, colon, hematological, liver, spleen, skin, brain, spinal cord, membranes of the brain, heart Coxsackie viruses nasopharynx, larynx, oral cavity, tonsil, lung / trachea / bronchi, lymph nodes of the gates of the lung, mediastinum, pancreas, muscle, brain, membranes of the brain, small intestine, cervical and intraperitoneal lymph nodes, colon, hematological, spleen, skin, eye, sinus, liver, testes, bone, pleura, salivary glands, heart

Echoviruses nasopharynx, oral cavity, tonsil, lung / trachea / bronchi, lymph nodes of the gates of the lung, muscle, brain, membranes of the brain, small intestine, cervical and intraperitoneal lymph nodes, colon, hematological, mediastinum, spleen, skin, eye, nasal sinus, liver, pancreas, testes, bone, salivary glands, heart Other enteroviruses lung / trachea / bronchi, lymph nodes of the gates of the lung, meninges, brain, skin, heart Hepatitis A virus small intestine, colon, hematological, liver, spleen, brain, spinal cord, gall bladder, pancreas, kidney Rhinoviruses nasopharynx, sinus, oral cavity, tonsil, larynx, lung / trachea / bronchi, lymph nodes of the gates of the lung Noroviruses and Other Caliciviruses small intestine, colon Astroviruses small intestine, colon Picobirnaviruses small intestine, colon Hepatitis E virus liver, small intestine, colon, hematological

The summary information given in Tables 6-9 gives a broad identification of microbial pathogens that can be used to obtain preparations of antigenic compositions according to the invention, along with the indication of tissues or organs in which such organisms are pathogenic, and accordingly the tissues and organs in which located malignant, which can be treated with an antigenic drug.

In some embodiments, the microbial pathogen selected for use in the antigenic compositions of the invention may be a pathogen that is a common cause of acute infection in the tissue or organ in which the cancer being treated is located. Table 10 lists bacterial and viral pathogens of this kind along with the tissues and organs in which they usually cause infection. Accordingly, in selected embodiments, a cancer located in the tissue indicated in the first column of Table 10 can be treated with an antigenic composition that contains antigenic determinants of one or more pathogenic organisms listed in the second column of Table 10. For example, a cancer located in the skin, can be treated with an antigenic composition containing antigenic determinants of one or more of the following organisms: Staphylococcus aureus, beta-hemolytic streptococci of groups A, B, C and G, Corynebacterium diptheriae, Corynebacterium ulcerans, Pseudomonas aeruginosa, measles, measles, rubella virus, rubella Coxsackie viruses, adenovirus, vaccinia virus, herpes simplex virus or parvovirus B19.

In selected embodiments, specific microbial pathogens may be suitable for the treatment of specific malignant tumors, examples of selected options are shown in table 10. These options are illustrative and not an exhaustive list of alternative drugs for use according to the invention.

Specific microorganisms that usually cause infection in a particular tissue or organ may vary in their geographical location. For example, Mycobacterium tuberculosis is a more common cause of lung infection in some geographic areas and populations than in others, and therefore, although M. tuberculosis may not be a common lung pathogen in some geographic and population groups, this bacterium may be a common lung pathogen in other groups. Thus, Table 10 is not an exhaustive list of pathogens common in all geographical areas and population groups. It is understood that a clinical morphologist who is a specialist in this field can identify common pathogenic species in a particular geographical area or population group for a particular location in a tissue or organ according to the invention. For use in veterinary medicine, there will certainly be specific pathogens that are common in selected tissues of the selected species, and they may also vary depending on geographic area.

In selected embodiments, the invention relates to diagnostic steps for evaluating a patient's previous exposure to microbial pathogens. For example, diagnostic steps may include obtaining a patient’s medical history regarding the effects of the selected pathogens and / or evaluating the patient’s immune response to the selected pathogen. For example, a serological test can be performed to detect antibodies to selected pathogens in a patient's serum. In connection with this aspect of the invention, antigenic determinants of a selected microbial pathogen can be selected for use in an immunogenic composition for a selected patient based on a diagnostic indicator that the patient has been exposed to the pathogen one or more times, for example, based on the presence of antigenic antibodies determinants of this pathogen in the serum of the patient.

In the following selected embodiments, the invention relates to diagnostic steps for assessing an immunological response of a patient to treatment with a selected immunogenic composition. For example, diagnostic steps may include evaluating a patient's immune response to the antigenic determinants of a given immunogenic composition, for example, using a serological test to detect antibodies to such antigenic determinants. In connection with this aspect of the invention, treatment with a selected immunogenic composition can be continued if the evaluation indicates that there is an active immunological response to the antigenic determinants of the composition, and vaccine treatment can be discontinued and alternative treatment with another immunogenic composition can be started if the evaluation indicates that there is no sufficiently active immunological response to antigenic determinants of the immunogenic composition.

As discussed in the context of Patient R, in selected embodiments, the microbial pathogen selected for use in the antigenic compositions of the invention may be a pathogen that is the most common cause of acute infection in a tissue or organ in which there is a cancer being treated, which may provide specific benefits, as shown in case of patients R. For example, in the case of treating bone cancer, the selected bacterial species may be Staphylococcus aureus; Streptococcus pneumoniae may be selected for the treatment of a malignant tumor in the lung tissue; Staphylococcus aureus may be selected for the treatment of breast cancer; Escherichia coli may be selected for the treatment of kidney or bladder cancer; and for the treatment of colon cancer, the selected bacterial species may be Escherichia coli. It is understood that a clinical morphologist skilled in the art can determine the most common pathogenic species, bacterial or viral, for each particular tissue or organ according to the invention. In selected embodiments, only antigenic determinants of the most common pathogen in a particular tissue or organ can be used to treat malignant tumors in such a tissue or organ. In alternative embodiments, antigenic determinants of the most common pathogen for a particular tissue or organ can be used in combination with antigenic determinants of other pathogens that are known to be pathogenic in that particular tissue or organ, preferably choosing from more common pathogens.

In some embodiments, the invention relates to antigenic compositions that utilize the ultimate relative content of selected antigenic determinants according to the invention, compared to any other antigenic determinants in the composition. For example, antigenic compositions may contain more than X% antigenic determinants derived from a pathogenic (or often pathogenic or most often pathogenic) species, where X may mean, for example, 10, 30, 40, 50, 60, 70, 80, 90, 95 or 100 (or any integer from 10 to 100). For example, at least X% of the antigenic determinants in the antigenic composition may be specific for microbial pathogens that are pathogenic (or often pathogenic, or most often pathogenic) in the particular organ or tissue of the patient in which the cancer is located. When using an alternative criterion, the total number of microbial pathogens in the antigenic composition, at least X% can be selected from microbial pathogens that are pathogenic (or often pathogenic or most often pathogenic) in the specific organ or tissue of the patient in which the cancer is located . In some embodiments, the antigenic composition, respectively, may consist essentially of antigenic determinants of one or more microbial pathogens, each of which is pathogenic (or often pathogenic or most often pathogenic) in a particular organ or tissue in which the cancer is located. The following data illustrate the unexpected effectiveness of such selected drugs:

(1) The use of MRV (which contains many common pathogens of the respiratory tract and Staphylococcus aureus, the most common pathogen of both breast and bone) has been found to be useful for treating breast cancer with bone metastases (see figure 6). However, the survival benefit (survival of patients who were treated with MRV compared to patients who were not treated with this vaccine) was small (i.e., median survival of 31 months for patients treated with the vaccine compared to 26 months for patients who have not been treated with the vaccine). On the other hand, in one patient (patient R) who was treated with a vaccine specifically directed against breast and bone cancer (i.e., containing only Staphylococcus aureus, which is undoubtedly the most common cause of infection and breast and bone), an unusual benefit in terms of survival, with the patient living for more than 17 years. Inclusion in MRV of other types of bacteria that are not (or less often are) the cause of bone infection and often cause infection in other places (i.e., in the respiratory ways), apparently, significantly reduces the use of such a vaccine for the treatment of malignant tumors of the breast and bone.

(2) The survival rate of stage 3B lung cancer patients treated with respivax ™ (i.e., median survival of 38 months and 40% 5-year survival) was significantly higher than the survival rate of stage 3B lung cancer patients treated using MRV (i.e., median survival of 18 months and 14% 5-year survival). Respivax ™ contains significantly higher relative concentrations of bacterial species that usually cause lung infection than MRV. 67% of the total number of bacterial cells in respivax ™ are represented by the types of bacteria that are common causes of lung infection, while only 30% of the total number of bacteria cells in the MRV are represented by types of bacteria that are common causes of lung infection. Thus, it has been shown that a composition containing a large proportion of the bacteria that most often cause lung infections, respivax ™, is more effective for treating lung cancer than MRV.

(3) The survival rate of stage 4 colon cancer patients who were treated using MRV (which does not contain any colon pathogens) was worse than patients who were not treated with the vaccine. This result suggests that treatment with antigenic determinants that are not derived from microorganisms that are pathogenic in the organ or tissue in which the cancer is located can not only be ineffective, but it can also be harmful.

(4) The mouse studies described below, and in particular, the data obtained in the model of malignant cells in which treatment with Klebsiella pneumoniae antigenic determinants was used only, compared with treatment with Klebsiella pneumoniae antigens together with additional antigens.

The data presented in the present description, respectively, is evidence of a gradual increase in the benefits of the transition from pathogenic to often pathogenic and most often pathogenic organisms in the treatment of malignant tumors in a particular organ or tissue using targeted antigenic compositions that are derived from microbial pathogens that are pathogenic in such a specific organ or tissue.

In some embodiments, the invention relates to the use of bacterial or viral vaccines that are approved for other purposes (e.g., polio vaccine, H. influenza vaccine, meningococcal vaccine, pneumococcal vaccine, influenza virus vaccine, hepatitis B vaccine, hepatitis vaccine A, diphtheria vaccine, tetanus vaccine, pertussis vaccine, measles vaccine, mumps vaccine, rubella vaccine, chickenpox vaccine, BCG vaccine, cholera vaccine, Japanese encephalitis vaccine, rabies vaccine, typhoid vaccine yellow fever, smallpox vaccine, etc.) for use as a means of treating a malignant tumor, by selecting a vaccine containing a pathogen (or antigenic component of a pathogen) that is pathogenic in a particular organ or tissue of the patient in which the malignant tumor is located referring to data set out in tables 6-10. For example, a vaccine based on S. pneumoniae, or a vaccine containing whole cells, or a vaccine consisting of one or more antigenic components of S. pneumoniae (for example, a 23-valent pneumococcal polysaccharide) can be used to treat a malignant tumor in any of the following localization sites in which S. pneumoniae, as indicated in table 10, is a common pathogen: lymph nodes of the gates of the lung, hematological malignant tumors, bone, membranes of the brain, spinal cord, eye / eye socket, nasal sinus, thyroid gland, bronchi, lungs , pleura or peritoneum. As a further example, a hepatitis B vaccine can be used to treat a malignant tumor at any of the following localization sites where, as indicated in Table 9, the hepatitis B virus is a pathogen: liver, pancreas, or hematologic malignancies.

In some embodiments, the selected compositions and methods are specifically excluded from the scope of the invention. For example, the use of the following microbial pathogens in the treatment of the following malignant tumors is excluded from some variants, so that the claimed invention can extend to specific variants with the exception of one or more of the following components:

a) BCG (Mycobacterium bovis) for the treatment of gastric cancer and colon cancer, for example, by injection;

b) Mycobacterium w for the treatment of lung cancer, for example, by injection;

c) Mycobacterium vaccae for the treatment of non-small cell para lung, for example, by injection;

d) Corynebacterium parvum for the treatment of melanoma, for example, by injection;

e) Streptococcus pyogenes for the treatment of gastric cancer, for example, by injection;

f) Nocardia rubra for the treatment of cancer of the lung or acute myelogenous leukemia, for example, by injection;

g) Lactobacillus casei for the treatment of cervical cancer, for example, by injection;

h) Pseudomonas aeruginosa for the treatment of lymphoma and lung cancer, for example, by injection;

i) a vaccine virus for the treatment of melanoma, for example, by injection;

j) rabies virus for the treatment of melanoma, for example, by injection;

k) a composition consisting of combined antigens of the following bacterial species for veterinary treatment (or alternatively for human treatment), for example, by oral administration in the case of primary (or alternatively metastatic) malignant tumors located in the lung: Streptococcus pneumoniae; Neisseria catarrhalis; Streptococcus pyogenes; Haemophilus influenza; Staphylococcus aureus; Klebsiella pneumoniae.

l) a composition consisting of the combined antigens of the following bacterial species for veterinary treatment (or, alternatively, for the treatment of humans), for example, by oral administration in the case of primary (or alternatively metastatic) malignant tumors located in the lung: Streptococcus pneumoniae; Neisseria catarrhalis; Streptococcus pyogenes; Haemophilus influenza; Staphylococcus aureus; Klebsiella pneumoniae; Klebsiella ozaenae; Streptocbccus viridans.

EXAMPLE 4: Studies on mice

In the following mouse studies, the following materials were used: PBS (Gibco) and 7-week old female C57BL / 6 mice.

Example 4A: Lung Cancer

This section relates to a murine model of Lewis lung carcinoma. The following bacterial vaccines were used in this experiment: Streptococcus pneumoniae vaccine [cells and broth] (lot No. J049-1 [2 × 10 ⁹ ]; Klebsiella pneumoniae vaccine [cells and broth] (lot No. J046-1 [2 × 10 ⁹ ]; Staphylococcus aureus vaccine [cells and broth] (lot No. J041-2 [10 × 10 ⁹ ]; Escherichia coli vaccine (colon isolate) [cells and broth] (lot No. J047-1 [6 × 10 ⁹ ]; salmonella enterica vaccine [cells and broth] (lot No. J31 [15 × 10 ⁹ ]; vaccine Klebsiella pneumoniae [only cells] (lot No. J048-1 [2 × 10 ⁹ ]; and only medium (medium Klebsiella pneumoniae) (lot No. J046-1 ). Mice were treated in accordance with the experimental groups defined in table 11.

In particular, groups of mice were pre-treated subcutaneously with bacterial vaccines at -10, -8, -6, -4 and -2 days. On day 0, mice were intravenously infected with a dose of 10 ⁵ Lewis lung carcinoma cells (Cedarlane, lot No. 508714). Then the mice were treated with subcutaneous injections of the vaccine every other day during the experiment, as indicated in table 11. The control group was treated only with medium. Animal weights were measured and recorded every 4 days. When mortality began to appear in mice, the experiment was stopped. Then, all mice were humanely sacrificed, and the lungs were removed surgically and weighed. The lungs were placed in vials of Buen fluid and the number of lung nodules in each group was counted. The results obtained are shown in table 12. Typical examples of such lungs are shown in figure 14.

The lung weights of mice injected with tumor cells were then compared with the lung weights of mice injected with PBS alone to determine the tumor burden and thus the therapeutic effect of the vaccine treatment. The results obtained are shown in table 13.

Example 4B: Skin Cancer

This section relates to a murine model of skin cancer. The following bacterial vaccines were used in this experiment: Streptococcus pneumoniae vaccine [cells and broth] (lot No. J049-1 [2 × 10 ⁹ ]; Klebsiella pneumoniae vaccine [cells and broth] (lot No. J046-1 [2 × 10 ⁹ ]; Staphylococcus aureus vaccine [cells and broth] (lot No. J041-2 [10 × 10 ⁹ ]; Escherichia coli vaccine (colon isolate) [cells and broth] (lot No. J047-1 [6 × 10 ⁹ ]; salmonella enterica vaccine [cells and broth] (lot No. J31 [15 × 10 ⁹ ]; vaccine Staphylococcus aureus [cells only] (lot No. J041-2 [10 × 10 ⁹ ]; and only medium (medium from 5. aureus) (lot No. J041 -1) .Mice were treated in accordance with the experimental groups shown in table 14.

In particular, groups of mice were pre-treated subcutaneously with bacterial vaccines at -10, -8, -6, -4 and -2 days. On day 0, mice were intravenously infected with a dose of 2 × 10 ⁶ B16 melanoma cells (batch No. 3995448; ATCC CRL-6323). Then the mice were treated with subcutaneous injections of the vaccine every other day during the experiment, as indicated in table 14. The control group was treated only with medium. Animal weights were measured and recorded every 4 days. After palpable tumors appeared, the diameter of the tumors was measured every other day using calipers. When mortality began to appear in mice or tumor diameters reached 20 mm in any group, the experiment was completed. Then all mice were killed in a humane manner. The average volumes of tumors present in the groups of mice described in this section are shown in FIG. 15.

Example 4C: Colon Cancer

This section relates to a mouse model of colon cancer. The following bacterial vaccines were used in this experiment: Streptococcus pneumoniae vaccine [cells and broth] (lot No. J049-1 [2 × 10 ⁹ ]; Klebsiella pneumoniae vaccine [cells and broth] (lot No. J046-1 [2 × 10 ⁹ ]; Staphylococcus aureus vaccine [cells and broth] (lot No. J041-2 [10 × 10 ⁹ ]; Escherichia coli vaccine (colon isolate) [cells and broth] (lot No. J047-1 [6 × 10 ⁹ ]; Escherichia coli vaccine (prostate isolate) [cells and broth] (lot No. J040-2 [6 × 10 ⁹ ]; Salmonella enterica vaccine [cells and broth] (lot No. J31 [15 × 10 ⁹ ]; and only medium (medium from E. coli ) (lot No. J040-1). Mice were treated in accordance with the experimental groups shown in table 15.

In particular, groups of mice were pre-treated subcutaneously with bacterial vaccines at -10, -8, -6, -4 and -2 days. On day 0, mice were intravenously infected with a dose of 2 × 10 ⁵ MC-38 colon adenocarcinoma cells (gift from the laboratory of Dr. Jeff Schlom, NCI). Then the mice were treated with subcutaneous injections of the vaccine every other day during the experiment, as indicated in table 15. The control group was treated only with medium. Mice were observed for the following clinical factors: weight, cold to the touch, diarrhea, rapid breathing, closed eyes, decreased mobility, piloerection and convulsions. When the mouse began to show signs of clinical death, the mouse was humanely killed and this day was defined as the day of death. Survival data obtained in this example are shown in FIG. 16.

In addition, the health and morbidity / mortality of the mice used in this example were evaluated on day 29 of the experiment, as indicated in table 16.

Overall Comparison Survival:

Logarithmic rank test (Cox-Mantel test) p = 0.001

Breslow test (generalized Wilcoxon test) p = 0.003

Taron-Vare criterion p = 0.002

Example 4. Conclusion

Skin model:

There is a pronounced therapeutic advantage in the group treated with Staph aureus (cells only). This study shows the efficacy of a dead S. aureus vaccine for treating skin cancer in a mouse model, consistent with the fact that S. aureus is the most common cause of skin infection in mice. The data are consistent with the use of immunogenic compositions according to the invention for slowing down or inhibiting the growth of a malignant tumor. The S. aureus cell-only vaccine (from which the medium and exotoxins were removed by centrifuging the cells and broth to collect only the cells, which are then diluted with saline) was more effective than the S. aureus and broth-cell vaccine (which contains the medium and exotoxins). The result may be due to the fact that exotoxins of S. aureus inhibit immune function, such as leukocidins, which can kill white blood cells. The invention accordingly includes variants in which antigenic determinants that can be used in immunogenic compositions are separated from immunomodulatory compounds produced by the microbial pathogen of interest.

Lung model

The data presented in this example show that there is significant inhibition of the tumor with an immunogenic composition derived from K. pneumoniae, which is consistent with the fact that K. pnuemoniae is a common cause of lung infection in mice. In mice (but usually not in humans) S. enterica can cause pneumonia, which is consistent with the healing effect of such a vaccine in a mouse lung model. Unlike a person for whom S. pneumoniae is a common lung pathogen, S. pneumoniae is relatively rare as a lung pathogen in mice (although S. pneumoniae can induce pneumonia in mice). E. coli and S. aureus rarely can cause lung infection in mice, which is consistent with their weak beneficial effect shown in this example. This example demonstrates that a vaccine based on killed K. pneumoniae is extremely effective for the treatment of lung cancer in mice, especially in cases in which the immunogenic composition contains antigens of only the most common pathogenic organism (see group 2 compared to group 6).

Colon model

S. enterica is one of the most common causes of gastrointestinal and intraperitoneal infections in mice, which is consistent with the beneficial effect shown in this example in the treatment of gastrointestinal and intraperitoneal malignancies in mice.

Of the immunogenic compositions used in this example (i.e., S. enterica, Ε. Coli, S. aureus, K. pneumoniae, S. pneumoniae), S. enterica is the most common gastrointestinal / intraperitoneal pathogen in mice. E. coli is the next most common gastrointestinal / intraperitoneal pathogen in mice. S. aureus and K. pneumoniae can occur as part of the colon flora and can cause a gastrointestinal / intraperitoneal infection, although much less frequently. S. pneumoniae does not cause a gastrointestinal / intraperitoneal infection. Accordingly, the S. enterica vaccine has been shown to be highly useful in this mouse model of a colon tumor, the E. coli vaccine has been shown to be moderately useful, the S. aureus and K. pneumoniae vaccines have been shown to be of little use, and it has been shown that S. pneumoniae vaccine has no beneficial effect. In humans, Salmonella spp. Causes an infection of the gastrointestinal tract, and therefore, a vaccine based on S. enterica and other Salmonella spp. Can be useful for treating colon cancer in humans.

EXAMPLE 5: Animal Models

Example 5A: Illustration of the effect of antigenic composition based on heat inactivated Klebsiella pneumoniae on populations of monocytes / macrophages and dendritic cells in mice

In this example, the following methods and materials were used:

The mice. For these studies, female C57BL / 6 mice of 7-8 week old age were obtained from Harlan Labs (Livermore, CA).

Antibodies and reagents. The following antibodies were used in this example: anti-I-A / I-E-FITC (MHC class II; M5 / 114.15.2); anti-Gr-1 PE (RB6-8C5); anti-CD11b PerCP-Cy5 (M1 / 70); anti-CD11c APC (N418); anti-CD4-FITZ (GK1.5); anti-NK1.1 PE (PK136); anti-CD8a eFluor780 (53-6.7); anti-CD44 APC (IM7). All antibodies were purchased from eBioscience (San Diego, CA). Liberase TM and DNase I were purchased from Roche. All media were from HyClone (Fisher).

Treatment with antigenic compositions. Killed by heating K. pneumoniae with phenol (KO12 [5.0 OD600 units]) was diluted 1/10 in PBS containing 0.4% phenol, and 100 μl were injected subcutaneously in 0, 2, 4 and 6 day 4 mice. Control mice (n = 5) were injected with PBS at 0, 2, 4, and 6 days.

Bronchoalveolar lavage. On day 7, mice were sacrificed and bronchoalveolar lavage (BAL) was performed by opening the trachea and then inserting a 22G caliber catheter connected to a 1 ml syringe. 1 ml of PBS was injected into the lungs and removed and placed in a 1.5 ml microcentrifuge tube. Then the lungs were washed 3 more times using 1 ml of PBS and the fluid was combined. The liquid after the first wash from each mouse was centrifuged at 400 × g and the supernatant was frozen to analyze cytokines. The final 3 ml of wash liquid was centrifuged and the cells were combined with the cell pellet from the first wash liquid. Cells were counted and stained with antibodies specific for MHC class II, Ly6G / C, CD11b and CD11c. After staining, the cells were washed and analyzed in a FACS Calibur flow cytometer.

Splitting of the lung. After BAL, the lungs were placed in 5 ml RPMI containing 417.5 μg / ml TL (Roche) liberala and 200 μg / ml DNase I (Roche). Then the lungs were cleaved at 37 ° C for 30 minutes. After cleavage, the lungs were rubbed through a sieve with 70 μm cells to obtain a suspension of individual cells. The cells were then centrifuged, washed, resuspended in FACS buffer (PBS with 2% FCS and 5 mM EDTA) and counted. After counting, the cells were stained and analyzed using FACS using the same antibodies as for BAL cells.

Peritoneal lavage. 1 ml of PBS was injected into the peritoneum of mice using a 1 ml syringe connected to a 25G needle after BAL. The abdomen was massaged for 1 minute. 0.5 ml of PBS was removed from the peritoneum using a 1 ml pipette. The wash liquid was placed in a 1.5 ml centrifuge tube, centrifuged at 400 xd for 5 minutes and resuspended in FACS buffer before staining and FACS analysis.

Analysis of the spleen and lymph nodes. The spleen and draining lymph nodes were removed after BAL and peritoneal lavage and placed in PBS. The spleen was destroyed by rubbing through a sieve with 70 μm cells (Fisher) and the lymph node was destroyed using the rubber end of the 1 ml syringe plunger. After destruction, the suspension of individual cells from the spleen and lymph nodes was centrifuged, washed once with FACS buffer and resuspended in FACS buffer before counting, staining and FACS analysis.

FACS analysis. Cells were stained on ice for 20 minutes in 96-well plates using 50 μl of antibodies diluted in FACS buffer. After 20 minutes, 100 μl of FACS buffer was added to the wells, and the plates were centrifuged at 400 × g for 5 minutes. Then the medium was removed and the cells were washed 1 more time with FACS buffer. After the last wash, the cell was resuspended in 200 μl FACS buffer and data were obtained using a FACS Calibur flow cytometer (BD). A minimum of 20,000 live cases were collected for all samples, with the exception of the BAL, where a minimum of 5,000 cases were collected.

In this example, the following results were obtained.

Normal tumor-free mice were treated with K. pneumoniae antigenic composition at 0, 2, 4, and 6 days. On day 7, mice were sacrificed and bronchoalveolar lavage fluid, lung tissue, peritoneal lavage fluid, lymph nodes and spleen were analyzed for changes in monocytes and macrophages. An increase in the number of blood monocytes / macrophages characteristic of acute inflammation was observed, which was determined by the high expression of CD11b and Gr-1 (the same marker as Ly6c) and F4 / 8 0 in the lymph node draining the injection site of the K. pneumoniae antigenic composition (see figure 17A). These monocytes / macrophages, characteristic of acute inflammation, also express very high levels of MHC class II molecules, indicating exposure to bacterial antigens. It is important to note that treatment of mice with the K. pneumoniae antigenic composition for one week resulted in a marked increase in acute inflammatory monocytes in the bronchoalveolar lavage fluid in the lungs (i.e., in the target organ), but not in the spleen or peritoneum of the treated mice, which indicates that treatment can induce homing of monocytes specifically into the lungs without affecting other organs (see figure 17B). Monocytes can differentiate into dendritic cells (DC) in the lungs, and in accordance with the observations of the inventors, a noticeable increase in monocyte recruitment was also observed that there was a noticeable increase in the frequency of cells with mature DC markers (see Figure 17C).

As shown in FIG. 17, treatment with the K. pneumoniae antigenic composition for 7 days resulted in a marked increase (compared with placebo treatment = PBS) of both acute inflammatory monocytes and dendritic cells in the lungs of mice. As shown in FIG. 17, mice were treated with either K. pneumoniae antigenic composition or PBS on days 0, 2, 4, and 6. On day 7, mice were sacrificed and the total number of A) and B) inflammatory monocytes (CD11b + Gr-1 + cells) and C) dendritic cells (CD11c + MHC class 11+ cells) in the lung and spleen were determined using flow cytometry. Error bars depicted in Figure A) were obtained when determining the average for 4-5 mice per group.

Example 5B Illustration of the influence of the antigenic composition of heat-inactivated Klebsiella pneumoniae and the antigenic composition of heat-inactivated E. coli on populations of monocyte / macrophage cells, dendritic cells and effector cells in mice

In this example, the following methods and materials were used:

The mice. For these studies, female C57BL / 6 mice of 7-8 week old age were obtained from Harlan Labs (Livermore, CA).

Antibodies and reagents. The following antibodies were used: anti-I-A / I-E FITC (MHC class II; M5 / 114.15.2); anti-Gr-1-PE (RB6-8C5); anti-CD11b PerCP-Cy5 (M1 / 70); anti-CD11c APC (N418); anti-CD4-FITZ (GK1.5); anti-NK1.1 PE (PK136); anti-CD8a eFluor780 (53-6.7); anti-CD44 APC (IM7). All antibodies were purchased from eBioscience (San Diego, CA). Liberase TM and DNase I were purchased from Roche. All media were from HyClone (Fisher).

Treatment with antigenic compositions. Killed by heating K. pneumoniae with phenol {K. pneumoniae batch KO12; 5.0 OD600 units) was diluted 1/10 in PBS containing 0.4% phenol, and 100 μl was injected subcutaneously in 0, 2, 4 and 6 day 5 mice. Heat-killed E. coli (batch; 5.0 OD600 units) was diluted 1/10 in PBS containing 0.4% phenol, and 100 μl were injected subcutaneously in 0, 2, 4, and 6 day 5 mice. Control mice (n = 5) were injected with PBS at 0, 2, 4, and 6 days.

Bronchoalveolar lavage. On day 7, mice were sacrificed and bronchoalveolar lavage (BAL) was performed by opening the trachea and then inserting a 22G caliber catheter connected to a 1 ml syringe. 1 ml of PBS was injected into the lungs and removed and placed in a 1.5 ml microcentrifuge tube. Then the lungs were washed 3 more times using 1 ml of PBS and the fluid was combined. The liquid after the first wash from each mouse was centrifuged at 400 × g and the supernatant was frozen to analyze cytokines. The final 3 ml of wash liquid was centrifuged and the cells were combined with the cell pellet from the first wash liquid. Cells were counted and stained with antibodies specific for MHC class II, Ly6G / C, CD11b and CD11c. After staining, the cells were washed and analyzed in a FACS Calibur flow cytometer.

Splitting of the lung. After BAL, the lungs were placed in 5 ml RPMI containing 417.5 μg / ml TL (Roche) liberala and 200 μg / ml DNase I (Roche). Then the lungs were cleaved at 37 ° C for 30 minutes. After cleavage, the lungs were rubbed through a sieve with 70 μm cells to obtain a suspension of individual cells. The cells were then centrifuged, washed, resuspended in FACS buffer (PBS with 2% FCS and 5 mM EDTA) and counted. After counting, the cells were stained and analyzed using FACS using the same antibodies as for BAL cells.

Peritoneal lavage. 1 ml of PBS was injected into the peritoneum of mice using a 1 ml syringe connected to a 25G needle after BAL. The abdomen was massaged for 1 minute. 0.5 ml of PBS was removed from the peritoneum using a 1 ml pipette. Wash liquid was mixed into a 1.5 ml centrifuge tube, centrifuged at 400 * d for 5 minutes and resuspended in FACS buffer before staining and FACS analysis.

Analysis of the spleen and lymph nodes. The spleen and draining lymph node were removed after BAL and peritoneal lavage and placed in PBS. The spleen was destroyed by rubbing through a sieve with 70 μm cells (Fisher) and the lymph node was destroyed using the rubber end of the 1 ml syringe plunger. After destruction, the suspension of individual cells from the spleen and lymph nodes was centrifuged, washed once with FACS buffer and resuspended in FACS buffer before counting, staining and FACS analysis.

FACS analysis. Cells were stained on ice for 20 minutes in 96-well plates using 50 μl of antibodies diluted in FACS buffer. After 20 minutes, 100 μl of FACS buffer was added to the wells, and the plates were centrifuged at 400 × g for 5 minutes. Then the medium was removed and the cells were washed 1 more time with FACS buffer. After the last wash, the cells were resuspended in 200 μl FACS buffer and data were obtained using a FACS Calibur flow cytometer (BD). A minimum of 20,000 live cases were collected for all samples, with the exception of the BAL, where a minimum of 5,000 cases were collected.

In this example, the following results were obtained: As shown in FIG. 18, mice were treated on days 0, 2, 4 and 6 with either the K. pneumoniae antigenic composition, or E. coli antigenic composition, or PBS. On day 7, mice were sacrificed and the total number of inflammatory monocytes (CD11b + Gr-1 + cells) and dendritic cells (CD11c + MHC class 11+ cells) were determined in flow cytometry in peritoneal lavage fluid, lungs, lymph nodes, and spleen. The error bars in FIG. 18 represent the standard deviation obtained from the analysis of 5 mice. * P-value <0.05 when using t-student test.

Figure 18 illustrates that treatment with an antigenic composition of K. pneumoniae, but not treatment with an antigenic composition of E. coli, markedly increased the number of monocytes and DCs in the lungs of mice. Unlike the lungs, K. pneumoniae did not lead to an increase in the number of monocytes in the peritoneum of mice, whereas E. coli led to such an increase. It is important to note that there was only a slight increase in the number of inflammatory monocytes, and there was no increase in the amount of DC in the spleen of mice treated with either K. pneumoniae or E. coli, which indicates that the effects of therapy are not common, but in reality are specific to a specific organ site. In addition to studying the effects of treatment on inflammatory monocytes and DCs in the lungs of mice, we also examined changes in other white blood cells, such as CD8 cytotoxic T cells, CD4 T helper cells, and natural killer (NK) cells, which could potentially play a role in antitumor immunity.

Figure 19 illustrates that the K. pneumoniae antigenic composition, but not the PBS and not the E. coli antigenic composition, resulted in a marked increase in the frequency and total number of NK cells, CD4 and CD8 T cells in the lungs of the treated mice. This example, as far as the authors know, is the first demonstration that subcutaneous injection of killed bacteria of species that usually cause an infection of the lungs can contribute to the accumulation of leukocytes in the lungs in the absence of any inflammation at this site. In addition, the inventors showed that such an effect is specific to the target site, and that it is also specific to the bacterial components used for treatment.

As shown in FIG. 19, mice were treated on days 0, 2, 4, and 6 with either the K. pneumoniae antigenic composition, or E. coli antigenic composition, or PBS. On day 7, mice were sacrificed and the total number of CD4 T cells, CD8 T cells, and natural killer (NK) cells was determined using flow cytometry. Error bars represent standard deviations of the values obtained for 5 mice per group. * P-value <0.05 when using t-student test.

Example 5C. Illustration of the effects of heat and phenol inactivated antigenic compositions Klebsiella pneumoniae (K. pneumoniae) on the antitumor response in mice and the status of inflammatory monocytes and dendritic cells after treatment of mice bearing tumors

In this example, the following methods and materials were used:

Inoculation of tumor cells. The Lewis lung carcinoma cell line obtained from mice with a C57BL / 6 background was purchased from ATCC (Manassas, VA). Cells were maintained in Dulbecco's modified Eagle medium (ATCC, Manassas, VA) containing 10% FCS. Cells were grown in a humidified incubator at 37 ° C and 5% CO2. Before tumor inoculation, cells were detached from the culture dishes using 0.25% trypsin and 0.53 mM EDTA. Cells were washed in PBS and resuspended at a concentration of 8 × 10 ⁶ cells / ml and 200 μl (4 × 10 ⁵ cells) were injected intravenously into mice.

Treatment with an antigenic composition. The following antigenic compositions were used in this study: heat-inactivated K. pneumoniae antigenic composition with phenol (batch KO12) and phenol-inactivated K. pneumoniae antigenic composition (batch KO25). Heat inactivated K. pneumoniae and phenol inactivated K. pneumoniae were concentrated to 5.0 OD600 units. 0.1 ml of K. pneumoniae diluted 1/10 in PBS with 0.4% phenol was injected subcutaneously every 2 days, starting 2 days after tumor injection.

Analysis of inflammatory monocytes, DCs, T cells and NK cells.

All analyzes were carried out according to the methods used in example 5B above.

In this example, the following results were obtained: This example is intended to determine whether the presence of a tumor affected the recruitment of cells into the lungs, and whether the treatment effect increased over time, leading to a further increase in cell recruitment as the treatment continued, and thus probably more optimal therapeutic effect with long-term treatment. In addition, the inventors wanted to determine whether the antigenic composition of K. pneumoniae inactivated by phenol is more effective than the antigenic composition of K. pneumoniae inactivated by heat.

Figure 20 clearly demonstrates that on day 9 (i.e., 4 treatments with the K. pneumoniae antigenic composition), there is already a marked increase in the number of acute inflammation monocytes, DCs, T cells and NK cells in the lungs of mice treated with the antigenic composition K . pneumoniae inactivated by heat or phenol is many times greater than in the lungs of placebo-treated mice (saline = PBS), and again clearly demonstrates a pronounced targeted cellular immune response in the lungs triggered by therapy with the K. pneumoniae antigenic composition. On day 9, there were manifestations that phenol inactivation was more effective than heat inactivation, but this trend was reversible by day 16. However, it is important to note that, judging by the number of cells in the lungs on Day 9 and 16, it is obvious that there is a cumulative effect of treatment by bacteria on the recruitment of cells into the lungs. For example, in the group treated with the phenol inactivated antigenic composition K. pneumoniae, there are approximately 100,000 acute inflammation monocytes in the lungs of mice on day 9, and their number significantly increases to 400,000 on day 16, indicating a significant increase in response during continued treatment. A slight increased response to treatment when continued is observed in mice treated with heat-inactivated bacteria. It is important to note that the cumulative effect of the treatment is also observed in the case of all other analyzed cell types. In this study, there was no apparent statistically significant difference in the recruitment of immune cells when using heat-inactivated or phenol-inactivated K. pneumoniae antigenic compositions.

As shown in FIG. 20, mice were injected with 4 × 10 ⁵ Lewis lung carcinoma cells intravenously on day 0. Then the mice were treated every other day, starting from day 2, with the K. pneumoniae antigenic composition obtained by heat inactivation or phenol inactivation, or PBS. On day 9 and day 16, the mice were sacrificed and the total number of (A) inflammatory monocytes (CD11b + Gr-1 +) and DC (CDllc + lab +) or (B) CD4 T cells, CD8 T cells, and natural killer cells ( NK) using flow cytometry. The columns represent, respectively: a group treated with PBS, mice treated with heat inactivated antigenic composition K. pneumoniae, and mice treated with phenol inactivated antigenic composition K. pneumoniae. Error bars represent standard deviations of the values obtained for 5 mice per group. * P-value <0.05 when using t-student test.

The results of this study demonstrate an increasing immune response in the target tissue with continued treatment.

Example 5D Illustration of the effects of inactivation by heating, irradiation, and phenol on K. pneumoniae antigenic compositions, including the recruitment of leukocytes into the lungs of mice, and the effects of phenol as a preservative that has a definite effect.

In this example, the following methods and materials were used:

The mice. For these studies, female C57BL / 6 mice of 7-8 week old age were obtained from Harlan Labs (Livermore, CA).

Antigenic compositions. In this study, we used the antigenic composition of heat-killed K. pneumoniae with phenol (KO12), the antigenic composition of heat-killed K. pneumoniae without phenol (KO25), the antigenic composition of irradiated K, pneumoniae without phenol (KO24) and the antigenic composition of K. pneumoniae killed by phenol without phenol (KJ25). All bacterial preparations had a concentration of 5.0 OD units in physiological saline. To dilute 1/10, 1 ml of the bacterial preparation was added to 9 ml of DPBS and mixed immediately and then again before injection. To dilute 1/100, 0.1 ml of the bacterial preparation can be added to 9.9 ml of DPBS and mixed immediately and then again before injection. In the case of dilutions of the antigenic composition of heat-killed Klebsiella pneumoniae with phenol, dilutions were performed as described above using a DPBS solution containing 0.4% phenol (w / v). To obtain 0.4% phenol in DPBS, a 5% phenol solution was first prepared by adding 0.5 g of solid phenol (Sigma Aldrich, St. Louis, MO) to 10 ml of DPBS (Hyclone, Logan, UT). The resulting solution was filtered through a 0.22 μm filter (Millipore, Billerica, MA) and stored at 4 ° C. Immediately before use, a 5% phenol solution was diluted using 1 ml in 12.5 ml DPBS and used to prepare bacterial preparations.

Treatment with antigenic compositions. 5 mice per group were treated subcutaneously on days 0, 2, 4 and 6 using 0.1 ml of antigenic composition killed by heating K. pneumoniae diluted 1/10 in PBS or PBS with 0.4% phenol, 0.1 ml of irradiated antigenic a composition of K. pneumoniae diluted 1/10 in PBS or an antigenic composition of phenol inactivated K. pneumoniae diluted 1/10 in PBS or PBS with 0.4% phenol. On day 7, mice were sacrificed and leukocyte recruitment into the lungs was analyzed as described in Example 5B.

In this example, the following results were obtained: In this example, the inventors used leukocyte recruitment into the lungs as an indicator of replacement for efficacy in order to compare the effectiveness of K. pneumoniae antigenic compositions inactivated in different ways. Figure 21 shows that in the case of both K. pneumoniae antigenic compositions killed by heat and phenol killed, the addition of phenol (0.4%) as a preservative increased the efficiency, judging by measurements of cell recruitment. In some embodiments, a small amount of phenol (i.e., 0.4% as a preservative) can stabilize the bacterial cell wall component, for example, a component that is important for recognizing the antigen pattern and activating an optimal targeted response. When comparing 3 drugs containing phenol as a preservative (i.e., those killed by heat, killed by phenol and killed by radiation), the irradiated antigenic composition of K. pneumoniae led to the highest recruitment of acute inflammatory monocytes, DCs, NK cells and T cells into lungs, then followed the antigenic composition of K. pneumoniae killed by phenol, and the antigenic composition of K. pneumoniae killed by heating led to the least recruitment of cells.

As shown in FIG. 21, mice were treated on day 0, 2, 4, and 6 with a heat inactivated K. pneumoniae antigenic composition, with phenol preservative (HKWP) or phenol inactivated preservative (ΗΚnp), with phenol preservative (PKWP) or without phenol preservative (PKnp), or irradiated inactivated K. pneumoniae antigenic composition, with phenol preservative (IRWP). On day 7, mice were sacrificed and the total number of (A) inflammatory monocytes (CD11b + Gr-1 +) and DC (CD11c + lab +) or (B) CD4 T cells, CD8 T cells, and natural killer (NK) cells was determined. using flow cytometry. Error bars represent standard deviations for 5 mice per group. * P-value <0.05 when compared with mice treated with IRWP, using t-student test.

EXAMPLE 6: Clinical studies on advanced epithelial malignancies

General description of treatment

The following patients with various malignant tumors at a late stage were treated with heat inactivated targeted bacterial antigenic compositions. Fully informed written consent was obtained from each patient and in each case. The treatment consisted of repeated (3x / week) subcutaneous injections of the exact amount of vaccine in the abdomen. Doses were gradually increased in each patient in order to achieve a sufficient skin reaction (redness of 3-5 cm, lasting about 24 hours). For each patient, an individual registration card (CRF) documented a skin reaction and possible clinical effects and / or side effects associated with treatment. The treatment characteristics and concomitant therapy are briefly described, as well as the patients response to therapy.

Patient No. 1:

53-year-old male patient with advanced stage melanoma, ICD10: C43, first diagnosed 11/2005 lesion under the toe of the right toe, histology after a year 12/2006: malignant melanoma in the late stage; the patient refused amputation of the thumb; 5/2008 lymphatic metastases in the right leg, at the time of the initial examination for targeted treatment with the bacterial antigenic composition (9/2008), the leg was swollen with a 100% increase in circumference: Karnowski index of 80%, without prior treatment.

Treatment for 6 months 09 / 2008-04 / 2009:

- 12 × intraperitoneal insufflation with ozone (03);

- 42 × local-regional radio-frequency hyperthermia (13.56 MHz);

- 18 × moderate hyperthermia 38.5 ° C;

- 6-month treatment with the antigenic composition Staph, aureus subcutaneously;

- orthomolecular therapy: infusion of high doses of vitamin C (0.5 g / kg / body weight), vitamin D3 2000 int. units / day, artesunate 200 mg / day, celebrex 100 mg / day, low-dose naltrex, medicinal mushrooms (cordyceps, reishi, shiitake), selenium 200 μg / day, curcumin 3000 mg / day, proteolytic enzymes (Wobemugos)

Epicrisis Details:

- PET 7/2008: SUV in the big toe of the right foot 4.81, knee: 5.01;

- PET 12/2008: SUV in the big toe of the right foot 3.80, knee: 4.02;

- the inventors began treatment at the end of 9/2008;

- at this point (9/2008) there were already clinically palpable lymph nodes in the groin that were not visible on PET from 7/2008.

- 05/2010: good clinical condition, PET confirms complete remission, Karnowski index of 100%.

Patient No. 2:

48-year-old female patient with late-stage bilateral breast cancer, ICD10: C50.9, first diagnosed 4/2008; histology: ductal infiltrating breast adenocarcinoma, ER / PR positive, Her2 unknown, T1 / T2, N1 (signal axillary node), M0 G3; repeated treatment with injections of sodium bicarbonate and reoperation on both mammary glands; the patient refused the proposed bilateral mastectomy and never underwent “in sano” resection (for example, the borders during lumpectomy were never without tumor cells). The patient also refused chemotherapy and / or hormonal therapy. Karnowski index of 90%, without prior treatment.

Treatment for 8 months 03 / 2009-11 / 2009:

- 3 × therapy with autologous dendritic cells in combination with:

- 3 × prolonged moderate hyperthermia of the whole body 40 ° C for 8 hours;

- 57 × local regional radio-frequency hyperthermia of both mammary glands (13.56 MHz);

- 6-month treatment with the Staph antigenic composition. aureus subcutaneously;

- orthomolecular therapy: infusion of vitamin C in high doses (0.5 g / kg / body weight), naltrexone in low doses, medicinal mushrooms (cordyceps, reishi, shiitake), turmeric 3000 mg / day, zinc

Epicrisis Details:

- Treatment began at the end of 3/2009.

- 05/2010: bilateral MRI of the mammary glands did not reveal abnormalities, good clinical condition, Karnowski index of 100%.

Patient No. 3:

73-year-old female patient with advanced non-small cell lung cancer (NSCLC) FIGO IIe, ICD10: C34, first diagnosed 6/2009; histology: clear cell lung adenocarcinoma, T4, N1, M0 G3; she was treated with neoadjuvant chemotherapy; re-determination of the stage after 3 cycles of neoadjuvant chemotherapy. showed the presence of a T2 tumor; then she underwent an ectomy of the left lung, R0 resection, and mediastinal lymphadenectomy; Karnowski index of 90%.

Treatment for 7 months 08 / 2009-03 / 2010:

- 08/2009: chemotherapy with taxane / cisplatin was started up to 10/2009 in combination with:

- 4 × prolonged moderate hyperthermia of the whole body of 40 ° C for 8 hours (1-2 / 2009);

- 20 × local regional radiofrequency hyperthermia of the chest (13.56 MHz) (8-10 / 2009);

- 10/2009 pneumectomy, R0-resection (oncological data versus further adjuvant chemotherapy);

- 6-month treatment with the antigenic composition Klebsiella pneumoniae subcutaneously (08 / 2009-02 / 2010);

- orthomolecular therapy: intramuscular thymus peptides, indomethacin, cimetidine, high-dose vitamin C infusions (0.5 g / kg / body weight), ALA / N protocol (low-dose naltrexone and alpha lipoic acid), medicinal mushrooms (reishi ), turmeric 3000 mg / day, zinc, melatonin, inhalation of ionized oxygen.

Epicrisis Details:

- We began treatment at the end of 08/2009.

- 05/2010: Chest CT and tumor markers CEA, NSE and CYFRA showed complete remission, good clinical condition, Karnowski index of 100%.

Patient No. 4:

50-year-old female patient with advanced breast cancer, ICD10: C50, with disseminated liver and lung metastases, first diagnosed 8/1990; histology: undifferentiated cirrhoidal breast adenocarcinoma, pT1c, N1, M0 G3; she underwent multiple chemotherapy courses for 20 years; 11/2004 first reappearance of the scar; 12/2004 removal of the left breast, 6 × chemotherapy with epitax and irradiation of the chest wall; 9/2005 first diagnosis of disseminated liver and lung metastases: again 8 × chemotherapy with epitax up to 3/2006. Repeated determination of the stage showed a progressive disease, at which time she began treatment with a targeted bacterial antigenic composition. Karnowski index of 90%.

Treatment for 4 years 03 / 2006-03 / 2010:

- 03/2006: began treatment with the Polyvaccinum forte vaccine in combination with:

- 3 × therapy with autologous dendritic cells in combination with (6-8 / 2006):

- 3 × prolonged moderate hyperthermia of the whole body (LD-WBH) 40 ° C for 8 hours (1-2 / 2009);

- 25 × local regional radiofrequency hyperthermia of the chest and liver (13.56 MHz) (3-6 / 2006);

- 8-month treatment with the antigenic composition Klebsiella pneumoniae (11 / 2008-7 / 2009);

- 10/2009: TM CEA and CA15 / 3 started to rise again;

- 02-03 / 2009: 2x therapy with autologous dendritic cells without LD-WBH;

- 04/2010: thermal ablation of liver metastases (without changing lung metastases);

- orthomolecular therapy: intramuscular thymus peptides, indomethacin, cimetidine, high-dose vitamin C infusions (0.5 g / kg / body weight), turmeric 3000 mg / day, zinc, proteolytic enzymes.

Epicrisis Details:

- The inventors began treatment at the end of 03/2006.

- 05/2010: A CT scan of the chest showed a stable disease for 4 years, a progressive disease of metastases in the liver, good clinical condition, Karnowski index of 100%.

Patient No. 5:

66-year-old male patient with advanced prostate cancer, ICD10: C61, with disseminated bone to lymph metastases, first diagnosed 01/1997; histology: undifferentiated prostate adenocarcinoma, pT3, N1, M1 G3; he was subjected to multiple hormonal and chemotherapy for 13 years; a patient in good clinical condition lives with metastatic prostate cancer for 13 years after diagnosis; Karnowski index of 90%.

Treatment for 11 years 11 / 1999-05 / 2010:

- 13 years old antiandrogen with suprefact, zoladex, casodex, trenantone, estracyte, β-sitosterol;

- 06 / 2006-12 / 2007: treatment of a mixed bacterial vaccine using the Polyvaccinum forte vaccine has begun;

- from 03/2008 regular chemotherapy with Taxotere 140 mg every 3-4 weeks;

- 50 × moderate hyperthermia of the whole body 39 ° C for 3 hours (1999-2009);

- 18-month treatment with the antigenic composition Staph, aureus (11 / 2008-05 / 2010, continuously);

- 05-06 / 2009: 2 × therapy with autologous dendritic cells with moderate WBH 39 ° C, 3 hours;

- orthomolecular therapy: wheat germ, cimetidine, zometa, high-dose vitamin C infusions (0.5 g / kg / body weight), turmeric 3000 mg / day, Boswellia serrata (Indian) 400 mg 4 × 4 / day, zinc, proteolytic enzymes.

Epicrisis Details:

- the inventors began treatment at the end of 1999.

- 05/2010: a bone scan showed a stable disease; PSA is currently 8 9 ng / ml, good clinical condition, 90% Karnowski index.

Patient No. 6:

52-year-old female patient with a late-stage primary malignant tumor of the peritoneum, ICD10: C48.2, with disseminated peritoneal carcinosis, first diagnosed 06/2003; histology: undifferentiated peritoneal adenocarcinoma, pT3, N1, M1 G3; she underwent cytoreductive surgery with bilateral ovariectomy and hysterectomy and adjuvant chemotherapy with taxol / paraplatin: a progressive disease and the transition to taxol / paraplatin with a stable disease up to 8/2008; progressive disease with disseminated peritoneal metastases in the left kidney and the 3rd line of chemotherapy with carboplatin and the beginning of treatment with a targeted bacterial antigenic composition; the patient was in good clinical condition; Karnowski index is 100%.

Treatment for 4 months 05-09 / 2009:

- 5 × chemotherapy with carboplatin (3rd line), and then:

- 5 × prolonged moderate hyperthermia of the whole body (LD-WBH) 40 ° C for 8 hours (05-09 / 2009);

- 20 × locally-regional radiofrequency hyperthermia of the abdomen (13.56 MHz) (05-09 / 2009);

- 2-month treatment with the antigenic composition of E. coli (colon) (05-07 / 2009);

- orthomolecular therapy: infusion of vitamin C in high doses (0.5 g / kg / body weight), in high doses, extracts of artichoke and silymarin (liver).

Epicrisis Details

- The inventors began treatment at the end of 5/2009.

- 04/2010: CT scans of the abdominal cavity and tumor markers indicated complete remission; good clinical condition, Karnowski index 100%.

Patient No. 7:

50-year-old female patient with inoperable pancreatic cancer, ICD10: C25.9, with a large tumor infiltrating large vessels; sonographic and CT data indicated invasion of the superior mesenteric vein, first diagnosed 02/2009; histology: undifferentiated pancreatic adenocarcinoma, pT3, N1, M1 G3 with peritoneal carcinosis; she was exposed to local radiation and low doses of xeloda as a sensitizer of the effects of radiation; when she began treatment in the clinic of the inventors, the malignant tumor was still inoperable; Karnowski index is 100%.

Treatment for 2 months 06-07/2009: (E. coll SSI for 11 months);

- 1 × therapy with autologous NDV-primed dendritic cells in combination with:

- 1 × prolonged moderate hyperthermia of the whole body 40 ° C for 8 hours (7-10 / 2009);

- 4 × moderate hyperthermia of the whole body 38.5 ° C:

- 15 × local-regional radiofrequency hyperthermia of the abdomen (13.56 MHz) (06-07 / 2009);

- 11-month treatment with the antigenic composition E. coli (colon) (06/2009 to the present day continues);

- orthomolecular therapy: thymus peptides intramuscularly; medicinal mushrooms (reishi, cordyceps, shiitake), high-dose vitamin C infusions (0.5 g / kg / body weight), therapy with high doses of proteolytic enzymes (wobenzym, phlogenzyme), cimetidine.

Epicrisis Details:

- The inventors began at the end of 6/2009.

- 05/2010: complete remission, NED; PET 02/2010 showed a lack of glucose uptake; tumor marker normal CA19 / 9: 4; good clinical condition, Karnowski index 100%.

EXAMPLE 7: Dose studies (study QB28)

When trying to investigate the role of dosing, mice were treated with either different doses of the K. pneumonia antigenic composition or with control PBS. All mice (C57BL / 6) were treated with K. pneumonia or PBS antigenic compositions at - 10, -8, -6, -4 and -2 days using the following injection sites (1st injection: right ventral inguinal; 2nd injection: ventral axillary on the right, 3rd injection: ventral axillary on the left; 4th injection: ventral inguinal on the left, etc.). Then, all mice received inoculation of the tumor at a dose of 3 × 10 ⁵ Lewis lung carcinoma cells by intravenous injection into the lateral tail vein of mice. Doses of antigenic compositions or PBS were as follows: i) PBS 0.1 ml; ii) K. pneumoniae 0.1 ml, OD600 = 1.67; iii) K. pneumoniae 0.1 ml, OD600 = 0.5. Mice received treatment with an antigenic composition of K. pneumoniae or PBS on days 2, 4, 6, and 8. The experiment was completed on day 10; all mice were sacrificed, their lungs were surgically removed, washed in water, weighed, and then placed in Buen liquid for fixation and counted after 24 hours. As shown in FIG. 22, each data point represents the number of tumor nodes from one mouse. Photographs of typical lungs in such experiments are shown in Figure 23. Figure 23 shows that a significant number of nodes were observed in the lungs of mice treated with control PBS. For comparison, figure 23 shows that in the lungs of mice treated with the K. pneumoniae antigenic composition, there are fewer nodes in a ratio equivalent to the ratio shown in figure 22.

Study QB30. In the following studies on the effect of the dose of K. pneumoniae antigenic compositions, it was shown that if the dose of K. Pneumoniae antigenic composition is too small, it is not effective for treating lung cancer. In such studies, the results of which are shown in FIG. 24, treatment of all mice (C57BL / 6) with the K. pneumoniae antigenic composition or PBS was started at −10, −8, −6, −4, and −2 days using the following injection sites (1 2nd injection: ventral inguinal on the right; 2nd injection: ventral axillary on the right; 3rd injection: ventral axillary on the left; 4th injection: ventral inguinal on the left, etc.). Then, all mice received inoculation of the tumor at a dose of 3 × 10 ⁵ Lewis lung carcinoma cells by intravenous injection into the lateral tail vein of mice. Doses of antigenic compositions or PBS were as follows: i) PBS 0.1 ml; ii) K. pneumoniae 0.1 ml, OD600 = 0.5; iii) K. pneumoniae 0.1 ml, OD600 = 0.05. Mice continued to receive treatment with antigenic compositions of K. pneumoniae or PBS on days 2, 4, 6, 8, 10, 12, 14 and 16. The experiment was completed on day 18; all mice were sacrificed, their lungs were surgically removed, washed in water, weighed, and then placed in Buen liquid for fixation and counted after 24 hours. As shown in FIG. 24, each data point represents the number of tumor nodes from one mouse.

The results of the QB28 and QB30 studies indicate that extremely high doses of K: Pneumoniae antigenic compositions are ineffective, possibly due to overstimulation of the host immune system. The results of such studies also indicate that low doses are ineffective, probably due to insufficient stimulation of the host immune system. EXAMPLE 8: Studies on the efficacy of cisplatin In an attempt to investigate the role distribution between cisplatin and chemotherapy and doses of K. pneumoniae antigenic compositions, a QB38 study was performed. Briefly, all mice received inoculation of a tumor at a dose of 3 × 10 ⁵ Lewis lung carcinoma cells by intravenous injection into the lateral caudal vein on day 0 of the study. After such inoculation, all mice were combined into one cell and then randomly distributed to the respective cells to avoid unevenly distributed data. In the morning + 2 days of this study, mice in the cisplatin treatment group were injected intraperitoneally with 10 mg / kg of this drug. Control mice were injected with control (PBS). Then, in the second half +2 days of this study, mice received antigenic compositions of K. pneumoniae or PBS; such injections were continued on days 4, 6, 8, 10, and 12. The study was completed on day 14; then all the mice were sacrificed, their lungs were surgically removed, washed in water, weighed and then placed in Buen liquid for fixation and counted after 24 hours. As shown in FIG. 25, each data point represents the number of tumor nodes from one mouse in the case of any treatments: PBS, K. pneumoniae antigenic compositions, K. pneumoniae antigenic compositions in combination with cisplatin or cisplatin alone. The results summarized in FIG. 25 show that there were fewer nodes in mice treated with K. pneumoniae antigenic compositions and cisplatin, compared with cisplatin-treated mice, K. pneumoniae antigenic compositions alone, or control PBS.

The following study is designed to determine if therapy with the K. pneumoniae antigenic composition can work in synergy with platinum-based chemotherapy to increase the survival of mice bearing Lewis lung tumors. Four groups of five female C57BL / 6 mice each received 10 ⁵ lung carcinoma cells Lewis intravenously at 0 day. On day 2, groups 3 and 4 received a single intraperitoneal dose of 10 mg / kg cisplatin. Starting from day 4, mice received either K. pneumoniae or placebo (PBS) every 2 days until death. Figure 26 illustrates the survival of all mice, and the table shows p-values of different survival curves calculated using the logarithmic rank test. Treatment of mice with cisplatin alone increased the survival of mice with lung tumors, with median survival increasing from 16 days in the PBS group to 23 days in the PBS + cisplatin group. Treatment only with K. pneumoniae also increased the survival of mice compared to PBS (median survival of 19 days in the case of K. pneumoniae compared to 16 days in the case of PBS). Most importantly, cisplatin chemotherapy combined with K. pneumoniae therapy yielded the greatest therapeutic benefit (32-day median survival), which demonstrates the synergy between platinum-based chemotherapy and antigenic therapy in the mouse lung cancer model. P-values for the data obtained in the described study QB4 5 are shown in table 19 below.

As shown in this example, antigenic compositions can be used on the same day as cisplatin or in a certain period after administration of cisplatin. As used herein, the term “antigenic composition” refers to a composition that contains antigens of one or more types of microorganisms. As used herein, the term “species of microorganisms” may refer to a viral pathogen or bacterial pathogen, or a fungal pathogen, as described in detail in this publication.

The following study is intended to determine if there is any synergy between platinum-based chemotherapy and therapy with the K. pneumoniae antigenic composition in the treatment of lung cancer in mice. All mice received 10 ⁵ Lewis lung carcinoma cells intravenously on day 0. Mice received antigenic compositions or PBS subcutaneously every 2 days, starting at day 0. On day 12, some mice were treated with cisplatin (10 mg / kg) intraperitoneally. The next day (day 13), blood was drawn from 3 mice from each group and blood cells were stained with anti-CD11b antibody and analyzed using FACS. The graphs in figure 27 shows the frequency of occurrence of CD11b + myeloid cells in blood on day 13. Each dot represents one mouse. The results of this study show that therapy with antigenic compositions can increase the frequency of myeloid cells (monocytes, macrophages, granulocytes, dendritic cells) in the blood when administered with cisplatin. This can enhance the immunity in animals due to the greater number of such natural myeloid cells that are able to respond to tumors or pathogens. In addition, since bone marrow suppression is a clinically important side effect of chemotherapy treatment, resulting in a decrease in the number of myeloid cells in the blood, which can lead to the delay / interruption of chemotherapy or sensitivity to infection, the increase in the number of myeloid cells during therapy with antigenic compositions during chemotherapy time may be useful to reduce the risk of such an important and clinically significant side effect of chemotherapy.

EXAMPLE 9: Macrophage studies (MOA13 study)

To investigate the role of macrophages in relation to embodiments of the invention, an MOA13 study was performed. Briefly, mice were either inoculated with 3 × 10 ⁵ Lewis lung carcinoma cells or injected with HBSS as a control vehicle. In the case of mice inoculated with Lewis lung carcinoma cells, they were combined in one cell, from where they were then randomly transferred to the corresponding cells. Then, the mice were treated with either K. pneumoniae antigenic compositions or PBS on days 2, 4, 6, and 8. Then all mice were killed on day 9. To obtain information on the frequency of myeloid and NK cells, lungs were surgically removed from 20 mice (5 from each group), and the lungs were digested using TL liberalization and DNase. After cleavage of the receiving cells, a suspension of individual cells was prepared. Then, part of the cells was transferred to a 96-well round-bottom plate for staining using myeloid-specific antibodies (CD11b +, NK1.1 +) and NK-specific antibodies (NK1.1 +, CD11b +). For the first type of cells, transmittance was used to select only CD11b + and NK1.1- cell populations. Cell data were then processed using BD FACSCalibur, and analysis was performed using FlowJo. Statistical analysis and graphical representations were performed using Excel and GraphPad Prism. The results are shown in Figure 28. Briefly, treatment with K. pneumoniae antigenic compositions leads to an increase in both myeloid cells (probably monocytes and macrophages) and CD11b + NK cells in the lungs of mice subjected to such treatment.

Focusing on obtaining information about cytokines produced in lung tissue, the following experiments were performed. Mice were either inoculated with 3 × 10 ⁵ Lewis lung carcinoma cells or injected with HBSS as a control vehicle. In the case of mice inoculated with Lewis lung carcinoma cells, they were combined in one cell, from where they were then randomly transferred to the corresponding cells. Then, the mice were treated with either K. pneumoniae antigenic compositions or PBS on days 2, 4, 6, and 8. Then all mice were killed on day 9. To obtain information about cytokines in lung tissue, bronchoalveolar lung lavage was performed. The lungs were then surgically removed immediately after lavage and placed in pre-weighed vials containing PBS and protease inhibitors. The lung tissue was then homogenized, centrifuged, and the supernatant was applied to ELISA kits (eBioscience); ELISA analysis was performed according to the manufacturer's guidelines. Statistical analysis and graphical representations were performed using Excel and GraphPad Prism. Data are presented as picograms of cytokine per milligram of the original lung tissue. Each data point in Figure 29 represents a value for one mouse. As shown in FIG. 29, treatment with K. pneumoniae antigenic compositions leads to an increase in the production of antitumor cytokines (IL-12, MCP-1, GMCSF, IL-6) in lung tissue.

Focusing on obtaining information on cytokine production in bronchoalveolar lavage fluid (BAL), the following experiments were performed. Mice were either inoculated with 3 × 10 ⁵ Lewis lung carcinoma cells or injected with HBSS as a control vehicle. In the case of mice inoculated with Lewis lung carcinoma cells, they were combined in one cell, from where they were then randomly transferred to the corresponding cells. Then, the mice were treated with either K. pneumoniae antigenic compositions or PBS on days 2, 4, 6, and 8 of the experiment. Then all mice were killed on day 9. To obtain information about cytokines in the lungs, bronchoalveolar lavage of the lungs of mice was performed. The fluid after lavage was placed in vials and stored at -80 ° C until the ELISA was performed. The activities were carried out by ELISA according to the manufacturer's manual. Statistical analysis and graphical representations were performed using Excel and GraphPad Prism. Data are presented as pg / ml lavage fluid, as shown in Figure 30. Each data point represents a value obtained for one mouse. As shown in FIG. 30, treatment with K. pneumoniae antigenic compositions does not affect the production of cytokines in bronchoalveolar lavage fluid.

Focusing on the study of phenotypes of M1 / M2 macrophages in the model described in this publication, we observed the levels of NOS2 and Arg1 in the lung. The experiments were performed as follows: briefly, mice were either inoculated with 3 × 10 ⁵ Lewis lung carcinoma cells or injected with HBSS as a control vehicle. In the case of mice inoculated with Lewis lung carcinoma cells, they were combined in one cell, from where they were then randomly transferred to the corresponding cells. Then, the mice were treated with either K. pneumoniae antigenic compositions or PBS on days 2, 4, 6, and 8 of the experiment. Then everything ;: mice were killed on day 9. To obtain information on the expression of the NOS2 and Arg1 genes, lungs were surgically removed from 20 0 mice (5 from each group). A small portion of these lungs was then cut off using a sterile method and placed in an RNAlater to stabilize RNA material for future gene analysis. Total RNA was extracted from lung tissue using the Qiagen kit according to the manufacturer's protocol. A cDNA kit was used to convert a certain amount of RNA into cDNA (Qiagen), also following the manufacturer's instructions. K-PCR was performed using primers designed for specific amplification of Nos2 and Arg1 (Nos2: direct — CGCTTTGCCACGGACGAGA; reverse AGGAAGGCAGCGGGCACAT; Arg1: direct — GGTCCACCCTGACCTATGTG; reverse —GCAGCCAT. Statistical analysis was performed using Excel and GraphPad Prism. As shown in FIG. 31, treatment with K. pneumoniae antigenic compositions leads to an increase in the ratio of Nos2 / Arg1 in the lungs, which correlates with an increased antitumor response.

Focusing on the study of the M1 / M2 response in the in vivo model described in this publication, the expression of CD206 (mannose receptor) was investigated. Briefly, mice were either inoculated with 3 × 10 ⁵ Lewis lung carcinoma cells or injected with HBSS as a control vehicle. In the case of mice inoculated with Lewis lung carcinoma cells, they were combined in one cell, from where they were then randomly transferred to the corresponding cells. Then, the mice were treated with either K. pneumoniae antigenic compositions or PBS on days 2, 4, 6, and 8 of the experiment. Then all mice were killed on day 9. In order to obtain information on the expression of CD206, lungs were surgically removed from 20 mice (5 from each group) and digested using TL liberalization and DNase. After cleavage of the receiving cells, a suspension of individual cells was prepared. Part of the cells was transferred to 96-well round-bottom plates for staining using CD206-specific antibodies (clone MR5D3) purchased from Cedarlane Labs (Burlington, ON). Since CD206 is localized both inside the cells and outside the cells, the cells were first fixed using paraformaldehyde and stained with antibody in a solution for permeabilization. The analysis was performed using FlowJo. Statistical analysis and graphical representations were performed using Excel and GraphPad Prism. The results are shown in Figure 32. As shown in Figure 32, treatment with K. pneumoniae antigenic compositions results in decreased expression of CD206 on lung macrophages both in the presence of (PBS + LL2 and K. pneumoniae 1 / 10X + LL2) and in the absence of lung tumors (PBS and K. pneumoniae 1 / 10X). In the presence of a lung cancer, K. pneumoniae antigenic compositions reduce the CD206 expression rate from about 20% (PBS + LL2 group) to about 10% (K. pneumoniae 1 / 10X + LL2 group). A similar decrease in CD206 expression was observed in animals treated with K. pneumoniae without lung cancer (PBS and K. pneumoniae 1 / 10X).

Focusing on the study of M1 / M2 phenotypes in the in vivo model described in this publication, macrophage expression of F4 / 80 + was studied. Briefly, mice were either inoculated with 3 × 10 ⁵ Lewis lung carcinoma cells or injected with HBSS as a control vehicle. In the case of mice inoculated with Lewis lung carcinoma cells, they were combined in one cell, from where they were then randomly transferred to the corresponding cells. Then, the mice were treated with either K. pneumoniae antigenic compositions or PBS on days 2, 4, 6, and 8 of the experiment. Then all mice were killed on day 9. To obtain information on the expression of F4 / 80 + in macrophages, lungs were surgically removed from 20 mice (5 from each group) and digested using TL liberalization and DNase. After cleavage of the receiving cells, a suspension of individual cells was prepared. A portion of the cells was transferred to 96-well round-bottom plates for staining using F4 / 80 monoclonal antibodies. Cell data was obtained using BD FACSCalibur. The analysis was performed using FlowJo. Statistical analysis and graphical representations were performed using Excel and GraphPad Prism. As shown in figure 33, treatment with antigenic compositions of K. pneumoniae leads to a decrease in the number of macrophages F4 / 80 + in the lungs. It is believed that such a decrease correlates with a decrease in the number of M2-like macrophages.

EXAMPLE 10: Study of site specificity (study MOA14)

Focusing on the study of M1 / M2 phenotypes in the in vivo model described in this publication, which was used together with the antigenic compositions described in this publication, the following experiments were carried out. Briefly, 5 mice in each group were treated on days 0, 2, 4, and 6 with either PBS, or antigenic compositions of E. coli colon, or antigenic compositions of K. pneumoniae. On day 7 of the experiment, the mice were sacrificed and bronchoalveolar lavage was performed. Then the lungs and the proximal colon were removed and digested with enzymes. After cleavage, the extracted cells were washed and stained with antibodies specific for I-A / I-E with FITC (MHC class II; M5 / 114.15.2); anti-Gr-1 PE (RB6-8C5_; anti-CD11b PerCP-Cy5 (M1 / 70); anti-CD11c APC (N418). All antibodies were purchased from eBioscience (San Diego, CA). Lung cells were counted to determine the total number of cells (colon cells were not counted, as the authors did not extract equal amounts of colon in different samples). After staining for 20 minutes, the cells were washed and analyzed using FACS. Each data point shown in the corresponding figure 34 represents the frequency of occurrence CD11b + Gr-1 + cells among skipped live cells for one mouse As shown in Figure 34, treatment with E. coli antigenic compositions leads to an increased incidence of inflammatory monocytes in the colon in the treated mice.

In addition, and as shown in FIG. 35, when monocytes in the lungs were examined based on experimental methods described in detail in this publication, it was found that although antigenic compositions and E. coli and K. pneumoniae increased the incidence of monocytes in the lungs of mice, antigenic K. pneumoniae compositions were more effective, judging by the calculations of the total number. As can be seen in figure 35, the left panel shows the frequency of occurrence of cells CD11b + Gr-1 + (inflammatory monocytes) cells in the lungs; the right panel shows the total number of CD11b + Gr-1 + cells in the lung.

Trying to determine the phenotype of macrophages present in tumors using the in vivo model described in this publication, which was used along with the antigenic compositions described in this publication, M1-like and M2-like macrophages were examined. As can be seen in Figure 35, the frequency of occurrence of M1-like (see the left panel in Figure 36) TAMs (associated with macrophage tissue) or M2-like (see the right panel in Figure 36) in 4T1 subcutaneous tumors on day 8 after implantation of the tumors is presented. As described in detail in this publication, M1-like macrophages were defined as macrophages with a high content of CD11b + / Gr-1- / MHC Class II; M2-like macrophages were defined as macrophages with a low CD11 b + / Gr-1- / MHC Class II content.

EXAMPLE 11: Studies of the effectiveness of indomethacin and anti-inflammatory drugs

An attempt was made to investigate combinations of antigenic treatment with indomethacin treatment. Briefly, experiments were conducted in which 10 or 11 mice were used in each of 4 groups for all treatments, starting from 4 days after tumor inoculation. All mice received 50,000 4T1 breast carcinoma cells subcutaneously on day 0. Then 4 groups were treated as follows: 1) indomethacin daily (in drinking water) + PBS subcutaneously every 2 days; 2) indomethacin daily (in drinking water) + antigenic composition S. aureus subcutaneously every 2 days; 3) a control excipient daily (in drinking water) + PBS subcutaneously every 2 days; and 4) a control vehicle daily (in drinking water) + S. aureus antigenic composition subcutaneously every 2 days. As for figure 37, the left panel of the figure shows the volume of tumors in various groups on day 15 of the experiment. The right panel shows the frequency and composition of CD11b + cells in tumors on day 11 of the experiment. The frequency of CD11b + cells significantly increased in both groups treated with indomethacin, compared with the control. The results show that the effectiveness of the combination of antigenic compositions of Staph, aureus with anti-inflammatory drugs such as indomethacin. In addition, and as shown in FIG. 38 in the present description, at a time point of 22 days, treatment with indomethacin led to an increase in the number of CD11b + cells.

In order to further investigate the efficacy of combining treatment with antigenic compositions with indomethacin, the following study was performed. Briefly, four (4) groups of 10-11 Balb / c mice per group received 10,000 4T1 carcinoma cells subcutaneously on day 0. Then the following treatments were carried out: the first group received indomethacin (14 μg / ml in water), starting from 4 days + PBS on 4, 6, 8 days, etc .; the second group received indomethacin (14 μg / ml in water) and S. aureus antigenic compositions [0.1 ml of the initial solution of 0.5 OD 600 nm], starting from 4 days + PBS on 4, 6, 8 days, etc. d .; the third group received PBS on days 4, 6, 8, etc .; and the fourth group received antigenic compositions 5. aureus [0.1 ml of the initial solution of 0.5 0D 600 nm] on days 4, 6, 8, etc. Tumor volume measurements were performed on days 15, 19, and 22, and the data obtained are presented in Figure 39 for four (4) groups of mice. The data depicted in FIG. 39 show that there is synergy between treatment with antigenic compositions and anti-inflammatory agents (eg, indomethacin) in a subcutaneous cancer model.

On day 11 of the experiment, described in detail above, the tumors were excised and cleaved. The split tumors were then stained with anti-CD11b and analyzed using FACS (n = 3 per group of mice). The results are shown in FIG. 40 in this publication and demonstrate that there is an increased incidence of CD11b + cells in tumors of mice treated with indomethacin on day 11 after inoculation.

On day 22 of the experiment described in detail above, the tumors were excised and cleaved. The split tumors were then stained with anti-CD11b and analyzed using FACS (n = 7-8 per group of mice). The results are shown in FIG. 41 in this publication and demonstrate that there is an increased incidence of CD11b + cells in tumors of mice treated with indomethacin on day 22 after inoculation. In addition, Figure 42 demonstrates that treatment with indomethacin causes an increase in the number of CD11b + CD94 + myeloid cells in tumors, which is detected 22 days after inoculation.

To further examine whether treatment with antigenic compositions is associated with an anti-inflammatory response, on day 22 of the experiment described above, whole tumor samples were subjected to quantitative PCR by known methods. The targets were the Fizzl and Ym1 gene products. Fizz and Ym1 are reported to be associated with M2 macrophages (see, for example, Wong et al., (2010) Eur. J. Immunol. 40 (8): 2296-307). The results are depicted in figure 43 in this publication. As shown in figure 43, the relative expression of Fizz1 and Ym1 increased in tumors when treated with both indomethacin and antigenic compositions (compared, for example, with treatment with indomethacin alone).

Relative expression levels of Arg1 and Fizz1 were investigated in tumors and spleens of mice on day 22 of the experiment. As shown in figure 44, the expression of both Arg1 and Fizz1 increased in the spleens of mice treated with indomethacin and antigenic compositions. Relative expression levels of Nos2 and Ym1 were studied in tumors and spleens of mice on day 22 of the experiment. Relative expression levels are depicted in Figure 45 in this publication for four (4) groups of mice.

In order to investigate the anti-inflammatory response associated with treatment with antigenic compositions, an experiment of the following design was carried out. Briefly, mice received Lewis lung tumors on day 0 [PBS and K. pneumoniae antigenic composition] or did not receive tumors [PBS (no tumor)] or K. pneumoniae antigenic composition (no tumor)]. Mice received the K. pneumoniae antigenic composition [0.1 sludge stock solution 0.5 OD 500 nm] or PBS on days 2, 4, 6, 8. Mice were euthanized on day 9 and their lungs were removed and homogenized. IFNγ was measured in lung homogenate using an ELISA. The results are shown in figure 4-6 in this publication. Treatment with the K. pneumoniae antigenic composition reduced IFNγ production in the lungs of mice with and without lung tumors.

To further investigate the anti-inflammatory response associated with treatment with antigenic compositions, an experiment of the following design was carried out. Briefly, bone marrow macrophages were cultured overnight either in medium, or in medium supplemented with LPS, or in medium supplemented with K. pneumoniae antigenic compositions. The medium was tested in the relationship of IL-I2 and IL-10. The results are shown in FIG. 47 in this publication and demonstrate that IL-12 was not detected. As shown in FIG. 47, bone marrow macrophages cultured overnight with K. pneumoniae antigenic compositions produced IL-10. IL-10 is known to be associated with an anti-inflammatory response (see, for example, Bazzoni et al., (2010) Eur. J. Immunol. 40 (9): 2360-8).

To further investigate the anti-inflammatory response associated with treatment with antigenic compositions, an experiment of the following design was carried out. Briefly, a 4T1 tumor model was used to determine the effects of therapy with the antigenic compositions Staph, aureus (SA) working synergistically with the anti-inflammatory drug indomethacin. In this study, four (4) groups of 10 female Ba1b / c mice were used, all of which received 50,000 4T1 breast carcinoma cells subcutaneously on day 0. Group 1 received PBS subcutaneously every 2 days starting on day 4. Group 2 received SA [0.1 ml 0.5 OD 600 nm] subcutaneously every 2 days starting on day 4. Groups 3 and 4 received 14 μg / ml of indomethacin in drinking water and received PBS and SA subcutaneously, every 2 days, starting from 4 days. On day 22, mice were sacrificed and tumors from 7-8 mice per group were collected and placed in an RNA preservative. The authors then analyzed the expression of IL-10 in tumors using real-time PCR. The results in figure 4-8 show that in mice treated with indomethacin; and PBS there was a significant increase in the expression of IL-10 in tumors. Treatment with indomethacin and SA led to even more IL-10, which indicates that SA enhances the anti-inflammatory effects of indomethacin in this tumor model. Since it is widely known that IL-10 is an anti-inflammatory cytokine, the results demonstrate that SA works synergistically with indomethacin, providing an anti-inflammatory effect. It is important to note that the tumors in the PBS-treated group were the largest, followed by the SA-treated group and the indomethacin-PBS-treated group. Tumors in the indomethacin-SA treated group were the smallest on day 22. The anti-inflammatory properties described in detail in this publication can be used when used against various inflammatory diseases (see table 20 in this publication).

EXAMPLE 12: Studies of inflammatory bowel disease

This example illustrates the clinically effective use of an antigenic preparation containing killed E. coli for the treatment of a patient with Crohn's disease during a three-month course of treatment. During treatment, the patient disappeared symptoms, and he stopped using anti-inflammatory drugs.

The patient at the initial examination reported pain in the colon, despite treatment with prednisone and imuran ™.

Treatment began with a subcutaneous inoculation of the preparation of whole killed E. coli obtained from an E. coli strain collected from a patient with E. coli infection in the colon. The dosing schedule included a subcutaneous dose every second day, starting with a dose of 0.05 ml, gradually increasing the volume until a skin light pink / red reaction with a diameter of 2 inches (5.08 cm) within 24 hours after injection at the injection site. Ultimately, the dose required to achieve such a skin reaction in this patient was 0.09-0.11 ml, and this dose was continued to be administered as a maintenance dose every second day.

A week after the start of treatment with the antigenic preparation of the whole killed E. coli, the patient reported that the pain disappeared. After about two months, the patient stopped treatment with prednisone, although he continued to take daily doses of 150 mg of Imuran ™. Then the patient also stopped using Imuran ™.

Two months after the start of treatment with the composition of E. coli, the patient himself administered 0.09-0.11 ml of the drug E. coli every other day. The patient himself adjusted this dose so as to cause a local inflammatory reaction, visible on a pink spot with a diameter of about 2 inches (5.08 cm), which existed at the injection site for about two days.

EXAMPLE 13: Research fungi

Experiments were carried out using the model system on the lungs of mice, described in detail in this publication, in which it was determined that in mice that received water with impurities of a specific type of fungus (Penicillium marneffei), which is known to cause respiratory infection in both mice and and in humans, there is a reduced tumor burden, as has been shown and as discussed in connection with bacterial pathogens of the lungs.

It is known that many types of fungi are associated with various organs or tissues, which are described in detail in table 21 below, so that water with impurities of species of fungi can also be used. Accordingly, and based on the principles of the experiment described in detail in this publication, the specificity shown in this publication for bacterial and viral pathogens can also be extended to fungal pathogens.

OTHER OPTIONS

Although various embodiments of the invention are disclosed in this publication, many improvements and modifications can be made within the scope of the invention in accordance with well-known information to specialists in this field. Such modifications include replacing known equivalents of any aspect of the invention to achieve the same result in substantially the same way. Numeric ranges include numbers that define the range. In the description, the word “comprising” is used as an unlimited term, essentially equivalent to the phrase “including without limitation,” and the word “contains” has a corresponding semantic meaning. The citation of publications in the present description should not be construed as recognition that such publications constitute prior art with respect to the present invention. All publications are incorporated into this description by reference, as is the case when it is specifically and separately indicated that each individual publication is incorporated by reference into the present description, and as if fully cited in this publication. The invention includes all variations and changes that are essentially described above, together with examples and drawings.

Claims (13)

1. The use of an effective amount of an antigenic composition containing whole dead E. coli cells for the manufacture of a medicament for the treatment of an individual suffering from ulcerative colitis, where the composition is administered intradermally or subcutaneously in the form of successively administered doses with an interval between doses of at least one hour. 2. The use according to claim 1, wherein two or more doses are administered over a period of time from 4 days to 1 week. 3. The use according to claim 1, wherein the antigenic composition is administered subcutaneously every day or every other day. 4. The use of claim 1, wherein the doses are administered over a dosing period of at least one week. 5. The use of claim 2, wherein the doses are administered over a dosing period of at least one week. 6. The use of claim 3, wherein the doses are administered over a dosing period of at least one week. 7. The use of claim 4, wherein the duration of the dose is at least two weeks. 8. The use of claim 5, wherein the duration of the dose is at least two weeks. 9. The use according to claim 6, in which the introduction of a dose of duration is at least two weeks. 10. The use according to any one of paragraphs. 1-9, in which the antigenic composition is administered in such a way that each dose is effective in order to induce a visible localized inflammatory immune response at the injection site. 11. The use according to p. 10, in which the antigenic composition is administered so that a visible localized inflammation at the injection site occurs in the range from 1 to 48 hours. 12. The use according to any one of paragraphs. 1-9, wherein the whole killed E. coli cells are E. coli strain cells selected from a patient suffering from E. coli colon infection. 13. The use of claim 10, wherein the whole killed E. coli cells are E. coli strain cells selected from a patient suffering from E. coli colon infection.

Images