JP5234445B2 - Drug - Google Patents

Description

  The present invention relates to a drug useful for the treatment of allergic diseases represented by atopic dermatitis.

  Currently, when developing a drug, a single enzyme or protein is targeted and a method of searching for a compound with a clear structure that inhibits this (anti-agonist) or mimics this biological activity (agonist) is taken. . This method is the same in genome drug discovery that has shown explosive development in recent years. In short, the underlying biological concept is a one-to-one reaction between a substance and a biologically active substance in vivo. However, the above concept of drug development is often ineffective for intractable diseases. On the other hand, it is no exaggeration to say that a disease that does not lead to the therapeutic effect derivation is called an intractable disease. For example, there are almost no therapeutic drugs for intractable infections (infections caused by drug-resistant bacteria and viruses), cancer, and many autoimmune diseases. More specifically, it is said that the number of patients with atopic dermatitis and hay fever, which are one of autoimmune diseases, reaches 1 in 6 (20 million) in Japan. Only coping therapy drugs such as corticosteroids are used. However, these drugs have been reported to cause serious side effects such as drowsiness and dullness, and adrenal cortex hormones such as serious allergic diseases and atrophy of the adrenal glands. A warning bell is sounded as being extremely large compared to the allergic effect. In other words, for atopic dermatitis and hay fever, which are now called national diseases, it is possible to provide drugs that have fundamentally different pharmacological expression mechanisms and less side effects from antihistamines and anti-inflammatory corticosteroids. There is a strong demand.

  Up to now, we believe that the activation control of macrophages, which is the earliest involved in foreign body exclusion, is the control mechanism of the homeostasis itself, and therefore various intractable diseases can be treated or prevented through the activation control of macrophages ( This has been demonstrated (see Non-Patent Document 1). This macrophage activation control is a mechanism unique to living organisms that focuses on multiple types of cytokines known to be produced and secreted by macrophages and maintains homeostasis through the network formed by these cytokines. Is achieved by manipulating One end is as follows. Macrophages are activated through binding to bacterial cell membrane components such as lipopolysaccharide (LPS) peptidoglycan and toll-like receptors (TLRs) expressing foreign substances such as nucleic acids on the macrophage cell membrane. During this time, foreign body information is transmitted into macrophage cells, transcription factors such as NF-kB and AP-1 are activated, and induction of cytokine groups (tumor necrosis factor (TNF), interleukin 1β (IL-1β)) IL-4, IL-6, IL-8, IL-10, IL-12p40, IL-15, IL-21, C-C chemokine, CX-C chemokine, interferon-α (IFN-α), Granulosite colony stimulating factor (GM-CSF), macrophage colony stimulating factor (M-CSF), fast ligand, transforming growth factor (TGF-β), nerve cell growth factor (NGF), fibroblast growth factor (FGF) ) Etc.). The elimination of foreign substances is one of the consequences of these cytokine networks, and it goes without saying that the elimination of foreign substances is an important role for maintaining the homeostasis of living organisms.

  By the way, a specific immune reaction characterized by lymphocytes being effector cells occurs in vertebrates, especially mammals after the invasion of foreign matter. Specific immunity involves humoral immunity mainly consisting of antibody production and cytotoxicity. It is divided into cellular immunity that induces T cells. On the other hand, it is known that IgE antibody production is involved in the onset of atopic dermatitis and hay fever (see Non-Patent Document 3), and induction of humoral immunity has occurred. The direction of humoral immunity and cellular immunity established after foreign body invasion is greatly influenced by the cytokines produced. That is, humoral immunity is induced when IL-4 is predominant, and cellular immunity is induced when IL-12 is predominant. In addition, IL-4 is known to inhibit induction of cellular immunity, and IL-12 is known to inhibit humoral immunity (see Non-Patent Document 4).

Conversely, induction of IL-12 induces suppression of humoral immunity, suppresses production of IgE antibody, which is the main cause of allergies, and enables suppression of atopic dermatitis and hay fever. In other words, if macrophages are activated and an immune response mainly composed of IL12 can be induced, it is expected that allergy treatment and hay fever prevention can be achieved through activation control of macrophages.
Soma GI. Mizuno D., et al. "Exogenous and endogenous tumour necrosis factor therapy.", Cancer Surv. 8, 1989, p. 838-852 Tatsumi Genichiro et al., “Tissue-specific nature of alveolar macrophages in natural picture immunity”, Membrane, 2002, 27 (5), p. 244-251 “Harrison Internal Medicine (11th edition)”, Yodogawa Shoten, Volume 1, Part 2, Chapter 2, p. 663 “Immunology Illustrated”, Nankodo, p. 149 "Pharmaceutical Interview Form", revised 3rd edition, September 2004, Japanese standard product classification number 875559 Koichi Takahashi et al., “Pharmacotherapy”, 1977, 10 (8.9), p. 1205 Koichi Takahashi et al., “Pharmacological Action of Exalbe”, Pharmacology and Treatment, 1977, 5 (2), p. 397-406 Bos, JD. Meinardi, MM. "The 500 dalton rule for the skin penetration of chemical compounds and drugs.", Experimental Dermatology, 2000, 9, p. 165-169

  There are only a few cases where fungal cells are used as therapeutic agents, and only postalisan and exalbe are approved as therapeutic agents for local skin diseases. A postalisan preparation is a hemorrhoid treatment drug that is clinically recognized for its infection-protecting action and wound-healing action, and the active ingredient of this preparation is a suspension of E. coli (see Non-Patent Documents 5 and 6). Moreover, these drugs have few side effects and are well-established as clinically extremely useful drugs. Exalbe ointment is a skin disease treatment that has been reported to be effective for dermatitis, eczema, burns, surgical wounds, and pyoderma. It is a mixture of killed bacteria of Escherichia coli, staphylococci, streptococci, and Pseudomonas aeruginosa. (See Non-Patent Document 7). Both drugs have been reported to cause infection protection by leukocyte migration and promote wound healing by promoting granulation. However, little is known about the mechanism of action. It is not known at all that it is effective as an antiallergic drug. On the other hand, postalisan and exalbe contain gram-negative and gram-positive bacteria. These components contain LPS as a component. LPS is also known as endotoxin, and is one of the substances that are most strongly activated among macrophages currently known. We thought that the effects of posterizan and exalbe were expressed as follows. That is, the cells activate macrophages percutaneously and produce cytokines such as IL-1β, TNF-α, IL-6, IL-8, IL-12, TGF-β, and FGF-α. These cytokines act on macrophages, NKcell, neuophile, Tcell, Bcell, fibroblast, mastcell, vascular endothelial cells, etc., accumulate inflammatory effector cells, and activate the bactericidal action by reactive oxygen and proteolytic enzymes. Promotes wound healing by growing vascular endothelial cells and fibroblasts. This strongly suggests that the bacterial cell induces a cytokine network through macrophage activation and expresses a disease treatment effect. If so, if the bacterial cells activate macrophages and induce an immune response mainly composed of IL12, it is expected that allergy treatment and hay fever prevention can be achieved through activation control of macrophages. Based on the above, the drugs and drugs characterized by using gram-negative bacteria or dead bacteria of gram-positive bacteria alone or in combination are useful as safe antiallergic treatments, including posterizan and exalbe. Inspired.

  In order to solve the above-mentioned problem, it is necessary to use bacterial cells by transdermal administration. However, the size of molecules absorbed by transdermal administration is about 500 in the textbook (see Non-Patent Document 8). Lipopolysaccharide, peptidoglycan and the like are macromolecules having molecular weights of several tens of thousands as expected as macrophage-activating cell components contained in postalisan and exalbe, and it is difficult to imagine that skin absorption occurs. However, postalisan and exalbe used clinically are used transdermally. Therefore, we confirmed that there was a therapeutic effect on allergies by transdermal administration of bacterial cells using postalisan and exalbe cells used in clinical practice.

E. coli killed, or Escherichia coli killed, Pseudomonas aeruginosa killed, the mixed bacterial death bacteria Staphylococcus aureus killed and Streptococcus killed as an active ingredient, characterized in that it is for the treatment refractory atopic dermatitis .

  Moreover, it is desirable that the pharmaceutical form is an ointment, cream, liquid, mousse, spray, gel or solid preparation.

  Further, it is desirable that the use form is an intradermal administration agent, a transdermal administration agent, a bath preparation, a suppository, a mouthwash, a troche, a nasal spray, a patch, a pulmonary administration agent, or a healthcare agent.

  If an autoimmune disease can be treated or prevented by bacteria contained in posterizan or exalbe, it will be treated by an unprecedented mechanism. Currently, there are no drugs for atopic dermatitis that are resistant to steroids, which significantly reduces the quality of life of patients. In addition, since antihistamines are accompanied by drowsiness and fatigue, it is dangerous to take them before driving. It is possible to provide a drug that is effective against such steroid-resistant atopic dermatitis and has no side effects such as sleepiness.

  Hereinafter, the best mode for carrying out the present invention will be described in detail.

First, E. coli Bacterial Float, Staphylococcus aureus Bacterial Float, Streptococcus Bacterial Float, Pseudomonas aeruginosa Bacterial Float, and Mixed Dead Bacterial Float in C3H / HeJ Mice and Chinese Hamster Peritoneal Cells IL-12
The inducing effect of mRNA is shown.

  Next, it shows the inhibitory effect of IgE-dependent allergic reaction in vivo using mice by administration of E. coli dead bacteria suspension and mixed death bacteria suspension (E. coli, Staphylococcus aureus, Streptococcus, Pseudomonas aeruginosa) to the skin. .

IL- of Escherichia coli death suspension, Pseudomonas aeruginosa death suspension, staphylococcal death suspension, streptococcus death suspension and mixed death suspension using C3H / HeJ mice and Chinese hamster peritoneal cells MRNA induction effect of 12p40 subunit

[Experimental material]
(1). Animal: C3H / HeJ mouse male (Claire Japan), Chinese hamster male (National Institute of Animal Health and Animal Science)

(2). Preparation of Escherichia coli dead fungus suspension:
Escherichia coli is spread on an ordinary agar medium for bacterial culture and cultured at 37 ° C. As the agar medium, for example, standard agar medium, brain heart infusion agar medium, or the like can be used. One colony that has emerged can be taken, and a normal liquid medium such as Tryptosoya broth or Nutrient broth (Becton Dickinson) can be used in a suitable culture flask such as a 3 liter Sakaguchi flask. Shaking culture was performed overnight at 37 ° C. Phenol was added to the culture solution so that the final concentration of phenol was 1 to 3% to prepare an E. coli killed bacterial suspension. The bacterial count was measured with a bacterial count calculator. For example, a Petroff-Hauser calculator can be used.

  Pseudomonas aeruginosa is spread on a normal agar culture medium and cultured at 37 ° C. As the agar medium, for example, standard agar medium, brain heart infusion agar medium, or the like can be used. One emerged colony can be picked up and used in a normal liquid medium such as commercially available tryptocer broth, brain heart infusion medium, or nutrient broth in an appropriate culture flask such as a 3 liter Sakaguchi flask. It is. Shaking culture was performed overnight at 37 ° C. Phenol was added to the culture so that the final concentration of phenol was 1 to 3% to prepare a suspension of Pseudomonas aeruginosa killed bacteria. The bacterial count was measured with a bacterial count calculator. For example, a Petroff-Hauser calculator can be used.

  Staphylococci are spread on an agar medium for normal bacterial culture and cultured at 37 ° C. As the agar medium, for example, standard agar medium, brain heart infusion agar medium, or the like can be used. One emerged colony can be picked up and used in a normal liquid medium such as commercially available tryptocer broth, brain heart infusion medium, or nutrient broth in an appropriate culture flask such as a 3 liter Sakaguchi flask. It is. Shaking culture was performed overnight at 37 ° C. Phenol was added to the culture solution so that the final concentration of phenol was 1 to 3% to prepare a staphylococcal killed bacterial suspension. The bacterial count was measured with a bacterial count calculator. For example, a Petroff-Hauser calculator can be used.

  Streptococcus is spread on a normal bacterial culture agar medium and cultured at 37 ° C. As the agar medium, for example, a standard agar medium, a brain heart infusion agar medium, or the like can be used. One emerged colony can be picked up and used in a normal liquid medium such as commercially available tryptocer broth, brain heart infusion medium, or nutrient broth in an appropriate culture flask such as a 3 liter Sakaguchi flask. It is. Shaking culture was performed overnight at 37 ° C. Phenol was added to the culture solution so that the final concentration of phenol was 1 to 3% to prepare a streptococcal budding solution. The bacterial count was measured with a bacterial count calculator. For example, a Petroff-Hauser calculator can be used.

  E. coli dead bacteria floating liquid: Staphylococcus dead bacteria floating liquid: Pseudomonas aeruginosa dead bacteria floating liquid: Streptococcus dead bacteria floating liquid becomes 10: 10: 1: 1. The mixed solution was used as a mixed killed fungus floating solution.

(3). Competitor DNA: A commercially available kit (Takara Shuzo) was used to prepare the competitor DNA. Competitor DNA containing primer sequences of various cytokines was synthesized, and the resulting product was purified by ultrafiltration, and the copy number of the competitor DNA was determined from the absorbance value. For the actual competitive PCR, solutions of various concentrations of 10 ¹ to 10 ⁷ copies / μl were prepared and used.
C3H / HeJ mouse PCR primers: sense (S), antisense (A) primer IL-12p40 (PCR product: cDNA 431 bp, competitor DNA 290 bp)
(S) 5 'ACTGGACCAAAGGGACTATG 3'
(A) 5 ′ AATACGGATCCTGAGCTTGC 3 ′
Chinese hamster PCR primers: sense (S), antisense (A) primer IL-12p40 (PCR product: cDNA 260 bp, competitor DNA 344 bp)
(S) 5 'GCAAGACTCTGAGCACTACTAC 3'
(A) 5 'CTCTGTCTGCAGAGAAGGTCACA 3'

(4). Other reagents:
Phosphate buffered saline (PBS), RPMI 1640 medium (Nikken Medical Science), fetal bovine serum (Gibco) TRIzol reagent (Gibco BRL), M-MLV-reverse transcriptase (Gibco BRL), oligo dT12-18 (Amersham Pharmacia) ), TaqDNA polymerase (Takara Shuzo)
Agarose ME (Iwai Chemical), ethidium bromide (Wako Pure Chemicals), thioglycolate medium II (Nissui)

(5). Equipment and tools:
24-well culture plate (Sumitomo), CO ₂ incubator, thermal cycler PC-700 (Astech), electrophoresis device Moupid (Cosmo Bio), gel photography device (Photodyne)

[experimental method]
(1). Pretreatment of various dead bacteria suspensions E. coli death suspensions, Staphylococcus aureus death suspensions, mainly for the purpose of removing the phenol concentration in various death bacteria suspensions to such an extent that in vitro cells are not damaged. The streptococcal killed cell suspension, the Pseudomonas aeruginosa killed cell suspension, and the mixed killed cell suspension were dialyzed separately. 2 ml of each dead cell suspension was put in a dialysis tube, and dialyzed for 3 hours or more at a time under ice-cooling using 40 ml of LPS-free PBS as an external solution. This operation was repeated four times, and the phenol content in each specimen was adjusted to 1/1000 to 1/2000 (the phenol content of each dialyzed external solution was monitored by measuring the absorbance), thereby reducing the phenol concentration to 0.001% or less. . Further, dialyzed against 40 ml of RPMI 1640 medium (no serum added), each dead bacterial suspension was exchanged from PBS to medium.

(2). Preparation of C3H / HeJ mouse peritoneal macrophages and various killed bacteria treatment 2 ml of 3.0 (w / v) thioglycolate medium was administered into the peritoneal cavity of C3H / HeJ mice, and peritoneal cells containing peritoneal macrophages were collected 4 days later did. The collected peritoneal cells were washed with RPMI1640 medium (medium), further prepared to 1 × 10 ⁶ cells / ml using a medium containing 5% FBS, and 0.5 ml was added to 24 well plate (5 × 10 ⁵ cells / well). /0.5 ml) and cultured in a 5% CO ₂ incubator. After 2 hours, the medium was changed, and non-adherent cells were removed to form peritoneal macrophages. Then, 1 ml of each killed cell suspension and 1 ml of mixed killed cell suspension diluted with the medium was added thereto and cultured.

Each dead bacteria suspension was used at concentrations of 1 × 10 ⁴ , 1 × 10 ⁵ , 1 × 10 ⁶ , 1 × 10 ⁷ and 1 × 10 ⁸ / ml. An unstimulated control was added with medium alone.

  Three hours after the addition, the medium was removed, washed with PBS, 400 μl of TRIzol was added, and total RNA was extracted according to the attached method.

(3). Preparation of Chinese hamster peritoneal macrophages and various killed bacteria treatments were performed in the same manner as C3H / HeJ mice.

(4). PCR and competitive PCR
CDNA was synthesized from the total amount of RNA extracted from each cell (340-1280 ng) using reverse transcriptase (200 units) and oligo dT. Synthesized cDNA (10 ng in terms of total RNA) was added to a PCR tube, and PCR was performed in the presence of the above primer (5 pmole) and Taq polymerase (0.3 unit, Takara Shuzo) in the usual manner in a reaction system with a total volume of 10 μl. After heating at 94 ° C. for 1 min, gene amplification was performed by repeating 35-40 cycles using a thermal cycler with 94 ° C. for 1 min, 55 ° C. (annealing) for 1 min and 72 ° C. for 1 min as one cycle. Competitive PCR was performed by adding a competitor DNA of each concentration in addition to cDNA and performing a PCR reaction in the same manner. The amount of PCR product was quantified by image analysis, and the standard of the expressed gene was standardized with beta-actin, one of the most commonly used house keeping genes.

The PCR product was subjected to 2.0% agarose electrophoresis in the presence of ethidium bromide, and the band of the PCR product was confirmed by UV irradiation.

[result]
IL-12 mRNA inducing ability at various treatment concentrations of various cell suspensions and mixed killed cell suspensions using C3H / HeJ mice and Chinese hamster peritoneal macrophages is expressed as the induction ratio when the unstimulated control is 1. 1 and 2.

表２ チャイニーズハムスターの腹腔マクロファージの各種死菌浮遊液及び混合死菌浮遊液のＩＬ−１２のｍＲＮＡの誘導作用

In the peritoneal macrophages of C3H / HeJ mice, the dead rate of each killed cell suspension was increased in both the killed cell suspension and the mixed killed cell suspension because the IL-12 mRNA induction rate increased in a bacterial number-dependent manner compared to the unstimulated control. It was found that both the liquid and the mixed dead suspension had an IL-12 mRNA induction effect. In the case of using peritoneal macrophages of Chinese hamsters, the IL-12 mRNA induction rate was increased in a bacterial count-dependent manner compared to the non-stimulated control. 12 It was found that there was an effect of inducing mRNA.

Table 1. Induction of IL-12 mRNA in various killed suspensions and mixed killed suspensions of peritoneal macrophages of C3H / HeJ mice

Table 2. Induction of IL-12 mRNA in various killed and mixed suspensions of peritoneal macrophages of Chinese hamsters

  Anti-allergic effect of E. coli killed suspension and mixed killed suspension using IgE allergy model mice

[Experimental material]
(1). Preparation of Escherichia coli dead fungus suspension:
Escherichia coli is spread on an ordinary agar medium for bacterial culture and cultured at 37 ° C. As the agar medium, for example, standard agar medium, brain heart infusion agar medium, or the like can be used. One colony that has emerged can be taken, and a normal liquid medium such as Tryptosoya broth or Nutrient broth (Becton Dickinson) can be used in a suitable culture flask such as a 3 liter Sakaguchi flask. Shaking culture was performed overnight at 37 ° C. Phenol was added to the culture solution so that the final concentration of phenol was 1 to 3% to prepare an E. coli killed bacterial suspension. The bacterial count was measured with a bacterial count calculator. For example, a Petroff-Hauser calculator can be used.

  Pseudomonas aeruginosa is spread on a normal agar culture medium and cultured at 37 ° C. As the agar medium, for example, standard agar medium, brain heart infusion agar medium, or the like can be used. One emerged colony can be picked up and used in a normal liquid medium such as commercially available tryptocer broth, brain heart infusion medium, or nutrient broth in an appropriate culture flask such as a 3 liter Sakaguchi flask. It is. Shaking culture was performed overnight at 37 ° C. Phenol was added to the culture so that the final concentration of phenol was 1 to 3% to prepare a suspension of Pseudomonas aeruginosa killed bacteria. The bacterial count was measured with a bacterial count calculator. For example, a Petroff-Hauser calculator can be used.

  Staphylococci are spread on an agar medium for normal bacterial culture and cultured at 37 ° C. As the agar medium, for example, standard agar medium, brain heart infusion agar medium, or the like can be used. One emerged colony can be picked up and used in a normal liquid medium such as commercially available tryptocer broth, brain heart infusion medium, or nutrient broth in an appropriate culture flask such as a 3 liter Sakaguchi flask. It is. Shaking culture was performed overnight at 37 ° C. Phenol was added to the culture solution so that the final concentration of phenol was 1 to 3% to prepare a staphylococcal killed bacterial suspension. The bacterial count was measured with a bacterial count calculator. For example, a Petroff-Hauser calculator can be used.

  Streptococcus is spread on a normal bacterial culture agar medium and cultured at 37 ° C. As the agar medium, for example, a standard agar medium, a brain heart infusion agar medium, or the like can be used. One emerged colony can be picked up and used in a normal liquid medium such as commercially available tryptocer broth, brain heart infusion medium, or nutrient broth in an appropriate culture flask such as a 3 liter Sakaguchi flask. It is. Shaking culture was performed overnight at 37 ° C. Phenol was added to the culture solution so that the final concentration of phenol was 1 to 3% to prepare a streptococcal budding solution. The bacterial count was measured with a bacterial count calculator. For example, a Petroff-Hauser calculator can be used.

  E. coli dead bacteria floating liquid: Staphylococcus dead bacteria floating liquid: Pseudomonas aeruginosa dead bacteria floating liquid: Streptococcus dead bacteria floating liquid becomes 10: 10: 1: 1. The mixed solution was used as a mixed killed fungus floating solution.

(2). Animal: BALB / c mouse, male, 5-6 weeks old (CLEA Japan)

(3). Other reagents, etc. Anti-DNP-mouse monoclonal IgE, physiological saline (Otsuka Pharmaceutical), Thickness gauge (DIAL THICKNESS GAUGE model G-7 OZAKI MFG), 2,4-dinitro-fluorobenzene (Wako Pure Chemical), acetone (Wako Pure Chemical) Medicine), olive oil (Nacalai)

[experimental method]
(1). Pretreatment of killed bacterial suspension The main purpose of removing the concentration of phenol in the E. coli killed suspension and mixed killed suspension to the extent that there is no damage to cells in vivo is the main purpose. The bacterial suspension was dialyzed. 2 ml of E. coli killed bacterial suspension and 2 ml of mixed killed bacterial suspension were each put into a dialysis tube, and dialyzed for 3 hours or more at a time under ice-cooling using 40 ml of LPS-free PBS (-) as an external solution. This operation was repeated 4 times, and the phenol content was adjusted to 1/1000 to 1/2000 (the phenol content of each dialysis external solution was monitored by measuring the absorbance), and the phenol concentration in each sample was 0.001% or less. Further, dialyzed against 40 ml of RPMI 1640 medium (no serum added), the suspension was exchanged from PBS (−) to the medium.

(2). Measurement of inhibitory effect on IgE-dependent allergic reaction BALB / c mice were divided into 4 groups as shown below. Add 5 μl of 1 mg / ml anti-dinitrophenyl, mouse IgE monoclonal antibody to 995 μl of 1% (v / v) mouse serum-containing physiological saline, mix well, dilute to a concentration of 5 μg / ml (1 μg / 200 μl / mouse), 200 μl Was administered intravenously. One hour after the injection of the anti-dinitrophenyl-mouse IgE monoclonal antibody (anti-DNP antibody), the E. coli killed bacterial suspension and the mixed dead bacterial suspension were washed with physiological saline (2 × 10 ⁸ cells / ml; 1 × 10 ⁷ The sample or physiological saline was injected into the abdominal skin using an intradermal needle (1/5). One hour after administration, the thickness of the auricle (right) was measured using a thickness gauge. Immediately thereafter, 20 μl of acetone-olive oil (4: 1) containing 0.25% 2,4-dinitro-fluorobenzene was applied to the auricle as an allergen. The pinna thickness was measured 1, 2, 24 and 48 hours after application. The difference (Δ) from the thickness immediately before application was defined as the degree of edema. The effect of drug administration is that the early response observed 1 hour after allergen administration and the inhibition rate of late response induced 24 hours later [percent inhibition = (1−Δswelling (drug +) / Δswelling (drug −)) × 100].

[Statistical processing]
The average difference in the degree of edema (Δ) between each group was performed by Student's t test. A significance level of 5% (P <0.05) or less was regarded as a significant difference.

[result]
The mixed killed bacteria suspension and the E. coli killed bacteria suspension were subjected to two experiments, and the results of the two experiments were collectively subjected to statistical processing (Table 4). Allergen application to IgE-sensitized mice is known to induce biphasic (1 and 24 hours) edema. The mixed dead bacteria suspension showed significant inhibition of 80% (P <0.001) after 1 hour and 100% (P <0.001) after 24 hours. The E. coli killed bacteria suspension was found to be significantly suppressed as the mixed killed bacteria suspension. In addition, in the mixed killed bacterial suspension administration group and the E. coli killed bacteria suspension administration group, significant suppression was observed 2 hours and 48 hours after administration. In addition, there was no significant difference between the two groups of the mixed killed bacterial suspension administration group and the E. coli killed bacterial suspension administration group at each measurement time point.

Table 4. Inhibitory effects of IgE-dependent allergic reactions

Therapeutic effect of postalisan and exalbe on atopic dermatitis A 44-year-old woman diagnosed with refractory atopic dermatitis with moderate to severe symptoms with rash on both hands and 2 grams of postalisan in the right hand Was applied to the affected area once a day with 2 grams of exalbe on the left hand. In both hands, subjective symptoms (itchiness) improved slightly after 1 day. Furthermore, when continued for 2 weeks, the skin of both hands returned to normal, and itching almost disappeared.

[Summary of results]
In Example 1, Escherichia coli killed buoyant liquid, Pseudomonas aeruginosa killed buoyant liquid, Staphylococcus killed buoyant liquid, Streptococcus moribacterial buoyant liquid each alone and mixed bacterium killed buoyant liquid, It was shown that it has the ability to induce mRNA. In Example 2, the E. coli killed bacterial suspension alone and the mixed bacterial killed suspension inducing IL-12 mRNA showed an inhibitory effect on IgE-dependent allergic reactions.
This drug is effective for the treatment of intractable atopic dermatitis, an allergic disease . In addition, this drug can be effectively used as an ointment, cream, liquid, mousse, spray or gel . Furthermore, it can be effectively used as an intradermal administration agent, a transdermal administration agent, a bath preparation , a patch, or a health care agent, which is a usage form of these agents. For the treatment of refractory atopic dermatitis, it can be suitably used in the form of an ointment or in the form of a transdermal agent.

Claims (3)

E. coli killed, or Escherichia coli killed, Pseudomonas aeruginosa killed, a mixed bacterial death bacteria Staphylococcus aureus killed and Streptococcus killed as an active ingredient, characterized in that it is for the treatment refractory atopic dermatitis Drug. The drug according to claim 1 , wherein the drug shape is an ointment, cream, liquid, mousse, spray or gel . The agent according to claim 1 or 2 , wherein the use form is an intradermal agent, a transdermal agent, a bath agent , a patch, or a health care agent.