RU2721709C1 - Method for prediction of risk of renal cell carcinoma - Google Patents
Method for prediction of risk of renal cell carcinoma Download PDFInfo
- Publication number
- RU2721709C1 RU2721709C1 RU2019130024A RU2019130024A RU2721709C1 RU 2721709 C1 RU2721709 C1 RU 2721709C1 RU 2019130024 A RU2019130024 A RU 2019130024A RU 2019130024 A RU2019130024 A RU 2019130024A RU 2721709 C1 RU2721709 C1 RU 2721709C1
- Authority
- RU
- Russia
- Prior art keywords
- cell carcinoma
- renal cell
- restriction
- predisposition
- mutation
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Настоящее изобретение относится к области медицины, в частности онкологии, и может быть использовано для диагностики предрасположенности к почечно-клеточному раку человека из европейской популяции людей (код EUR в соответствии с номенклатурой проекта 1000 Genomes).The present invention relates to medicine, in particular oncology, and can be used to diagnose a predisposition to human renal cell carcinoma from the European human population (EUR code in accordance with the nomenclature of the 1000 Genomes project).
Почечно-клеточный рак (ПКР) является серьезной проблемой для здравоохранения. Зарегистрированные во всем мире показатели по данному заболеванию колеблются от 0,6 случаев на 100000 населения до 14,7 случаев на 100000 населения [Parkin D.M., Pisani P., Ferlay J. 1999. Estimates of the worldwide incidence of 25 major cancers in 1990. Int J Cancer. 80, 827-841]. Большинство опухолей находят в пятой-седьмой декаде жизни человека, с медианой возраста смерти 70 лет. Заболеваемость в два-три раза выше у мужчин, чем у женщин [Chow W.H., Devesa S.S., Warren J.L., Fraumeni J.F. 1999. Rising incidence of renal cell cancer in the United States. JAMA. 281, 1628-1631].Renal cell carcinoma (RCC) is a serious public health problem. Worldwide registered disease rates range from 0.6 cases per 100,000 to 14.7 cases per 100,000 [Parkin DM, Pisani P., Ferlay J. 1999. Estimates of the worldwide incidence of 25 major cancers in 1990. Int J Cancer. 80, 827-841]. Most tumors are found in the fifth to seventh decade of human life, with a median age of death of 70 years. The incidence is two to three times higher in men than in women [Chow W.H., Devesa S.S., Warren J.L., Fraumeni J.F. 1999. Rising incidence of renal cell cancer in the United States. JAMA. 281, 1628-1631].
Определенные генетические условия ассоциированы с повышенной частотой ПКР, включая болезнь фон Гиппеля-Линдау, наследственный папиллярный рак почек и, возможно, туберозный склероз [Bjornsson J., Short М.Р., Kwiatkowski D.J., Henske E.P. 1996. Tuberous sclerosis-associated renal cell carcinoma: clinical, pathological, and genetic features. Am J Pathol. 149, 1201-1208]. ПКР также чаще встречается при приобретенной кистозной болезни почек. Наследственный ПКР является аутосомно-доминантной формой заболевания, ассоциированной с мультифокальными папиллярными опухолями почек. Другие предполагаемые факторы риска включают курение сигарет; ожирение; использование диуретиков; воздействие нефтепродуктов, хлорированных растворителей, кадмия, свинца, асбеста и ионизирующего излучения; высокобелковые диеты; гипертоническую болезнь; трансплантацию почек и ВИЧ-инфекцию [Ng C.S., Wood C.G., Silverman P.M., Tannir N.M., Tamboli P., Sandler C.M. 2008. Renal cell carcinoma: diagnosis, staging, and surveillance. AJR Am J Roentgenol. 191(4), 1220-1232].Certain genetic conditions are associated with an increased incidence of RCC, including von Hippel-Lindau disease, hereditary papillary renal cancer and possibly tuberous sclerosis [Bjornsson J., Short M. P., Kwiatkowski D. J., Henske E. P.. 1996. Tuberous sclerosis-associated renal cell carcinoma: clinical, pathological, and genetic features. Am J Pathol. 149, 1201-1208]. RCC is also more common with acquired cystic kidney disease. Hereditary RCC is an autosomal dominant form of the disease associated with multifocal papillary kidney tumors. Other suspected risk factors include cigarette smoking; obesity; the use of diuretics; exposure to petroleum products, chlorinated solvents, cadmium, lead, asbestos and ionizing radiation; high protein diets; hypertension kidney transplantation and HIV infection [Ng C.S., Wood C.G., Silverman P.M., Tannir N.M., Tamboli P., Sandler C.M. 2008. Renal cell carcinoma: diagnosis, staging, and surveillance. AJR Am J Roentgenol. 191 (4), 1220-1232].
Тремя основными прогностическими маркерами, используемыми для ПКР в настоящее время, являются VHL, фактор роста эндотелия сосудов (VEGF) и карбоангидраза IX (CAIX) [Mickley A., Kovaleva О., Kzhyshkowska J., Gratchev А. 2015. Molecular and immunologic markers of kidney cancer- potential applications in predictive, preventive and personalized medicine. EPMA J. 6, 20].The three main prognostic markers currently used for RCC are VHL, vascular endothelial growth factor (VEGF) and carbonic anhydrase IX (CAIX) [Mickley A., Kovaleva O., Kzhyshkowska J., Gratchev A. 2015. Molecular and immunologic markers of kidney cancer- potential applications in predictive, preventive and personalized medicine. EPMA J. 6, 20].
До сих пор нет надежных растворимых маркеров ПКР, которые можно обнаружить в крови или моче. Поэтому необходимы более сложные стратегии для раннего выявления или прогнозирования ПКР в соответствии с принципами профилактической и персонализированной медицины. Среди таких стратегий прогнозирование риска возникновения ПКР на основе анализа ДНК пациента будет являться важным инструментом снижения смертности от данного заболевания, который позволит вовремя проводить превентивные диагностические мероприятия и выявлять рак на ранних этапах.There are still no reliable soluble markers of RCC that can be found in blood or urine. Therefore, more complex strategies are needed for the early detection or prediction of RCC in accordance with the principles of preventive and personalized medicine. Among these strategies, predicting the risk of RCC on the basis of a patient’s DNA analysis will be an important tool to reduce mortality from this disease, which will allow for timely preventive diagnostic measures and early detection of cancer.
Известен способ прогнозирования риска возникновения злокачественных новообразований женских половых органов и молочных желез (RU 2578459 С1, опубл. 27.03.2016, Бюл. №9). Для осуществления проверки у женщин репродуктивного возраста выявляют признаки наследственных нарушений (ННСТ) соединительной ткани в разных системах и органах, как минимум одного генетического и как минимум одного анамнестического факторов тромбогенного риска (ФТР) и инфицирования генитального тракта. В соответствии с выявленными признаками устанавливают низкий, средний или высокий риск возникновения злокачественных новообразований женских половых органов и молочных желез. Важным недостатком данного способа является потребность в оценки сразу нескольких факторов, в том числе генетических, что длительно как по времени, так и по трудозатратам. Способ не позволяет выявить предрасположенность к почечно-клеточному раку.A known method for predicting the risk of malignant neoplasms of the female genital organs and mammary glands (RU 2578459 C1, publ. 03/27/2016, Bull. No. 9). To check women of reproductive age, signs of hereditary disorders (NNST) of connective tissue in different systems and organs of at least one genetic and at least one anamnestic factors of thrombogenic risk (PTF) and genital tract infection are revealed. In accordance with the identified signs, a low, medium or high risk of malignant neoplasms of the female genital organs and mammary glands is established. An important disadvantage of this method is the need to evaluate several factors at once, including genetic, which is long in time and in terms of labor. The method does not allow to identify a predisposition to renal cell carcinoma.
Известен способ прогнозирования наследственной предрасположенности к раку молочной железы на основе идентификации мутации в гене BLM (RU 2522501 С1, опубл. 20.07.2014, Бюл. №20). Способ характеризуется тем, что проводят амплификацию коротких фрагментов гена BLM протяженностью до 200 п.о., с последующим высокоразрешающим плавлением, включающим оптимизированный для гена BLM этап формирования гетеродуплексов: быстрый нагрев до 95°С и медленное снижение температуры до 50°С; выбирают один фрагмент с аберрантным профилем плавления для секвенирования, секвенируют выбранный фрагмент и при выявлении мутации гена BLM прогнозируют наследственную предрасположенность к раку молочной железы. Недостатком данного способа является потребность в секвенировании фрагмента ДНК, что увеличивает трудоемкость, время и стоимость анализа. Способ не позволяет выявить предрасположенность к почечно-клеточному раку.A known method for predicting a hereditary predisposition to breast cancer based on the identification of mutations in the BLM gene (RU 2522501 C1, publ. 20.07.2014, Bull. No. 20). The method is characterized in that the amplification of short fragments of the BLM gene with a length of up to 200 bp is carried out, followed by high-resolution melting, including the stage of heteroduplex formation optimized for the BLM gene: rapid heating to 95 ° C and slow temperature decrease to 50 ° C; one fragment with an aberrant melting profile is selected for sequencing, the selected fragment is sequenced and a hereditary predisposition to breast cancer is predicted when a mutation of the BLM gene is detected. The disadvantage of this method is the need for sequencing a DNA fragment, which increases the complexity, time and cost of analysis. The method does not allow to identify a predisposition to renal cell carcinoma.
Известен способ диагностики предрасположенности к раку молочной железы (RU 2470998 С2, опубл. 27.12.2012, Бюл. №36). Это способ выявления повышенного риска заболевания субъекта-человека раком молочной железы, основан на результатах анализа образца ДНК на наличие SNP в позициях 142, 355 и 4326 гена CYP1B1; делеционных вариантов 1100 delC, del5395, а также IVS2+1G>A гена СНЕК2 и замены С5972Т в гене BRCA2. При этом в способе определены комбинированные генотипы по всем указанным позициям трех названных генов, при которых риск развития рака молочной железы превышает сумму эффектов, определяемых соответствующими вариантами каждого из трех генов в отдельности, которые рассматриваются как признак особой предрасположенности субъекта к заболеванию (непропорционально высокого риска заболевания) раком молочной железы. Данный способ определения предрасположенности к раку путем идентификации генотипических комбинаций специфичных вариантов генов cyplb1, brca2 и СНЕК2, взят за прототип. Недостатком данного способа является отсутствие лабораторной методики детекции приведенных мутаций ассоциированных с предрасположенностью к раку почки. Кроме того, в способе не уточняется, для какого именно рака почки определяется предрасположенность.A known method for the diagnosis of susceptibility to breast cancer (RU 2470998 C2, publ. 12/27/2012, Bull. No. 36). This is a method for detecting an increased risk of a human subject having breast cancer, based on the analysis of a DNA sample for the presence of SNP at positions 142, 355 and 4326 of the CYP1B1 gene; deletion variants of 1100 delC, del5395, as well as IVS2 + 1G> A of the CHEK2 gene and C5972T substitution in the BRCA2 gene. Moreover, the method determines combined genotypes for all the indicated positions of the three named genes, in which the risk of developing breast cancer exceeds the sum of the effects determined by the corresponding variants of each of the three genes separately, which are considered as a sign of a particular susceptibility of the subject to the disease (disproportionately high risk of the disease ) breast cancer. This method of determining a predisposition to cancer by identifying genotypic combinations of specific variants of the genes cyplb1, brca2 and CHEC2 is taken as a prototype. The disadvantage of this method is the lack of laboratory methods for the detection of these mutations associated with a predisposition to kidney cancer. In addition, the method does not specify for which kidney cancer a predisposition is determined.
В ходе проведенных исследований на базе Воронежского государственного университета, при котором с помощью высокопроизводительного секвенирования были проанализированы генотипы пациентов больных почечно-клеточным раком, была выявлена мутация chr10:43613843_G/T (регион rs1800861), которая ассоциирована с почечно-клеточным раком. Идентификация мутации в описываемом способе осуществляется на основе рестрикционного анализа путем проведения ПЦР-ПДРФ (полимеразной цепной реакции - полиморфизма длин рестрикционных фрагментов).In the course of studies at the Voronezh State University, in which the genotypes of patients with renal cell carcinoma were analyzed using high-throughput sequencing, the mutation chr10: 43613843_G / T (region rs1800861), which is associated with renal cell carcinoma, was analyzed. Identification of the mutation in the described method is carried out on the basis of restriction analysis by PCR-RFLP (polymerase chain reaction - polymorphism of the lengths of restriction fragments).
Технический результат - выявление предрасположенности к почечно-клеточному раку у человека из европейской популяции в течение 4,5-6 часов (в зависимости от выбранного способа выделения ДНК) без необходимости секвенирования образцов ДНК.The technical result is the identification of a predisposition to renal cell carcinoma in humans from the European population for 4.5-6 hours (depending on the chosen method of DNA extraction) without the need for sequencing of DNA samples.
Технический результат достигается тем, что в способе диагностики предрасположенности к почечно-клеточному раку на основе ПЦР-ПДРФ, включающем выделение ДНК из предварительно отобранного биологического материала пациентов с проведением реакции ПЦР, согласно изобретению используют прямой праймер GCAGGCCTCTCTGTCTGAAC (SEQ ID NO: 1) и обратный праймер GATGACATGTGGGTGGTTGA (SEQ ID NO: 2), а также проводят рестрикционный анализ полученного ампликона, при этом для рестрикции ампликона используют рестриктазу Tsel, которая образует уникальные фрагменты рестрикции при наличии мутаций и в норме - 31 п.н., 61 п.н. и 104 п.н. в норме; 92 п.н. и 104 п.н. при наличии мутации. При выявлении мутации в ходе реакции человек из европейской популяции имеет предрасположенность к почечно-клеточному раку по отношению к общей европейской популяции людей.The technical result is achieved by the fact that in the method for diagnosing a predisposition to renal cell carcinoma based on PCR-RFLP, comprising DNA extraction from pre-selected biological material of patients with the PCR reaction, the direct primer GCAGGCCTCTCTGTCTGAAC (SEQ ID NO: 1) and the reverse are used according to the invention primer GATGACATGTGGGTGGTTGA (SEQ ID NO: 2), as well as restriction analysis of the resulting amplicon is carried out, and for the restriction of the amplicon use restriction enzyme Tsel, which forms unique restriction fragments in the presence of mutations and normal - 31 bp, 61 bp and 104 bp normal; 92 bp and 104 bp in the presence of a mutation. When a mutation is detected during a reaction, a person from the European population is predisposed to renal cell carcinoma in relation to the general European human population.
Способ выявления предрасположенности к почечно-клеточным раку на основе амплификации региона rs1800861 с последующим рестрикционным анализом амплифицированного региона реализуется следующим образом:A method for detecting a predisposition to renal cell carcinoma based on the amplification of the rs1800861 region with subsequent restriction analysis of the amplified region is implemented as follows:
1. Осуществляется выделение ДНК из крови пациента. Для этого могут быть использованы как методы органической экстракции, так и коммерческие доступные наборы для выделения ДНК и крови.1. Is the extraction of DNA from the blood of the patient. For this, both organic extraction methods and commercially available kits for DNA and blood isolation can be used.
2. Проводится реакция ПЦР со следующими праймерами и условиями реакции: прямой праймер GCAGGCCTCTCTGTCTGAAC (SEQ ID NO: 1), обратный праймер GATGACATGTGGGTGGTTGA (SEQ ID NO: 2); условия реакции: 94°С 4 мин, 35 циклов: 94°С 30 сек, 59°С 30 сек, 72°С 30 сек., конечная элонгация 72°С 5 мин. В ходе реакции ПЦР формируется продукт ПЦР длиной 196 п. н., который используется для реакции рестрикции по следующей схеме: берут 10 мкл ПЦР продукта, добавляют 1,5 мкл 10Х реакционного буфера, и 5-10 ед. рестриктазы Tsel. Объем доводят до 15 мкл деионизированной водой. Инкубируют смесь в течение 2 часов при 65°С. Визуализацию продуктов рестрикции проводят с помощью электрофореза в 3% агарозном геле. В отсутствии мутации (в норме) будут три фрагмента рестрикции длиной 31 п.н., 61 п.н. и 104 п.н. При наличии мутации на электрофореграмме будет видно два продукта рестрикции - 104 п.н. и 92 п.н.2. The PCR reaction is carried out with the following primers and reaction conditions: forward primer GCAGGCCTCTCTGTCTGAAC (SEQ ID NO: 1), reverse primer GATGACATGTGGGTGGTTGA (SEQ ID NO: 2); reaction conditions: 94 ° C 4 min, 35 cycles: 94 ° C 30 sec, 59 ° C 30 sec, 72 ° C 30 sec., final elongation 72 ° C 5 min. During the PCR reaction, a 196 bp PCR product is formed, which is used for the restriction reaction according to the following scheme: take 10 μl of the PCR product, add 1.5 μl of 10X reaction buffer, and 5-10 units. restriction enzymes Tsel. The volume was adjusted to 15 μl with deionized water. Incubate the mixture for 2 hours at 65 ° C. The restriction products are visualized by electrophoresis on a 3% agarose gel. In the absence of mutation (normal) there will be three fragments of restriction with a length of 31 bp, 61 bp and 104 bp If there is a mutation on the electrophoregram, two restriction products will be seen - 104 bp. and 92 bp
При выявлении мутации в ходе реакции человек из европейской популяции имеет предрасположенность к почечно-клеточному раку.If a mutation is detected during the reaction, a person from the European population has a predisposition to renal cell carcinoma.
Предлагаемый способ выявления предрасположенности к ПКР на основе амплификации региона rs1800861 с последующим рестрикционным анализом амплифицированного региона является высокочувствительным, хорошо воспроизводимым и экономичным. В зависимости от способа выделения ДНК из биологических образцов анализ занимает от 4,5 до 6 часов. Анализ можно проводить в лабораториях, имеющих термоциклер, центрифугу, камеру для электрофореза и сопутствующие реактивы и расходные материалы.The proposed method for detecting a predisposition to RCC on the basis of amplification of the rs1800861 region with subsequent restriction analysis of the amplified region is highly sensitive, well reproducible and economical. Depending on the method of DNA extraction from biological samples, the analysis takes from 4.5 to 6 hours. The analysis can be carried out in laboratories with a thermal cycler, a centrifuge, an electrophoresis chamber, and related reagents and consumables.
Claims (1)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2019130024A RU2721709C1 (en) | 2019-09-25 | 2019-09-25 | Method for prediction of risk of renal cell carcinoma |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2019130024A RU2721709C1 (en) | 2019-09-25 | 2019-09-25 | Method for prediction of risk of renal cell carcinoma |
Publications (1)
Publication Number | Publication Date |
---|---|
RU2721709C1 true RU2721709C1 (en) | 2020-05-21 |
Family
ID=70803192
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
RU2019130024A RU2721709C1 (en) | 2019-09-25 | 2019-09-25 | Method for prediction of risk of renal cell carcinoma |
Country Status (1)
Country | Link |
---|---|
RU (1) | RU2721709C1 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2470998C2 (en) * | 2006-06-22 | 2012-12-27 | Ян Любински | Determination of cancer susceptibility by identification of genotypic combinations of specific versions of cyp1b1, brca2 and chek2 genes |
RU2578459C1 (en) * | 2014-09-02 | 2016-03-27 | Федеральное государственное автономное образовательное учреждение высшего образования "Новосибирский национальный исследовательский государственный университет (Новосибирский государственный университет, НГУ) | Method for prediction of risk of malignant growths in female genital organs and mammary glands |
-
2019
- 2019-09-25 RU RU2019130024A patent/RU2721709C1/en active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2470998C2 (en) * | 2006-06-22 | 2012-12-27 | Ян Любински | Determination of cancer susceptibility by identification of genotypic combinations of specific versions of cyp1b1, brca2 and chek2 genes |
RU2578459C1 (en) * | 2014-09-02 | 2016-03-27 | Федеральное государственное автономное образовательное учреждение высшего образования "Новосибирский национальный исследовательский государственный университет (Новосибирский государственный университет, НГУ) | Method for prediction of risk of malignant growths in female genital organs and mammary glands |
Non-Patent Citations (3)
Title |
---|
/s13167-015-0042-2. * |
AMANDA MICLEY, et al, Molecular and immunologic markers of kidney cancer - potential applications in predictive, preventive and personalized medicine, The EPMA journal, 2015, p. 1-7, * |
AMANDA MICLEY, et al, Molecular and immunologic markers of kidney cancer - potential applications in predictive, preventive and personalized medicine, The EPMA journal, 2015, p. 1-7, DOI 10.1186/s13167-015-0042-2. * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1781814B3 (en) | Methods and kit for the prognosis of breast cancer | |
EP3327141B1 (en) | Method for identifying the quantitative cellular composition in a biological sample | |
JP6883179B2 (en) | Gene compositions for cell proliferation anomaly detection or disease degree grading and their uses | |
BRPI0708534A2 (en) | molecular assay to predict recurrence of colon cancer dukes b | |
CN104745681A (en) | Multi-element generic composition and use thereof | |
KR20180007291A (en) | Method of detecting a risk of cancer | |
CN109402252A (en) | Acute myelogenous leukemia risk assessment gene marker and application thereof | |
JP4088694B2 (en) | Hematopoietic tumor testing method and kit | |
JP5522348B2 (en) | Prognostic method and kit for adult T-cell leukemia / lymphoma | |
EP2341150A1 (en) | Breast cancer metastasis determination method and blood serum evaluation method | |
RU2721709C1 (en) | Method for prediction of risk of renal cell carcinoma | |
US20130288918A1 (en) | Colorectal Cancer Screening Method | |
US7217515B2 (en) | HURP gene as a molecular marker for bladder cancer | |
KR20200025968A (en) | Gender-specific biomarker for the diagnosis and treatment strategy of lung adenocarcinoma | |
CN106460047A (en) | Method and kit for identifying precancerous colorectal polyps and colorectal cancers | |
RU2723090C1 (en) | Diagnostic technique for predisposition to renal cell carcinoma based on pcr-rflp | |
JP5009289B2 (en) | MALT lymphoma testing method and kit | |
CA3089406A1 (en) | Molecular signature and use thereof for the identification of indolent prostate cancer | |
CN104293958B (en) | A kind of test kit predicting susceptibility of ankylosing spondylitis and method | |
US20110236890A1 (en) | Method of screening for cancer by detecting mutations in the delta-catenin gene promoter and 5'-untranslated region | |
JP2020014415A (en) | Diagnostic biomarker for cancer | |
KR20190134121A (en) | Association of RNF213 single nucleotide polymorphism with the risk of Moyamoya disease in a Korean population | |
CN117327796A (en) | Composition for detecting urothelial cancer and use thereof | |
CN117004727A (en) | Composition for detecting bladder cancer and application thereof | |
CN117305450A (en) | Nucleic acid composition for detecting methylation of bladder cancer-associated gene, and corresponding kit and application thereof |