CN117327796A

CN117327796A - Composition for detecting urothelial cancer and use thereof

Info

Publication number: CN117327796A
Application number: CN202311559047.7A
Authority: CN
Inventors: 吴宁宁; 刘斯文; 彭勇飞; 蔡海利; 吴振; 杨亚东; 周光朋
Original assignee: Biochain Beijing Science and Technology Inc
Current assignee: Biochain Beijing Science and Technology Inc
Priority date: 2023-11-21
Filing date: 2023-11-21
Publication date: 2024-01-02

Abstract

The present application provides a composition for detecting urothelial cancer and uses thereof, the composition comprising: a nucleic acid for detecting methylation status of a target gene, wherein the target gene is one or more of a VIM gene, a KCNA3 gene, a TMEM220 gene, and a PPM1N gene. The application also provides a kit comprising the composition and application of the composition in preparing a kit for detecting urothelial cancer in vitro.

Description

Composition for detecting urothelial cancer and use thereof

Technical Field

The application belongs to the field of molecular biology, relates to gene detection, and in particular relates to a nucleic acid composition for detecting methylation of a urothelial cancer related gene, and a corresponding kit and application thereof.

Background

Urothelial cancer is one of the most common malignant tumors of the urinary system, and is also one of malignant tumors which seriously threaten the health of people. The prognosis for men is better than for women in patients with the same stage of urothelial cancer. If the early urothelial cancer patients can be diagnosed in time, the chance of bladder retention during operation can be increased, and the life quality and the overall survival rate of the patients can be improved.

The current clinical approaches for urothelial cancer screening and diagnosis mainly include urocytology, tumor marker examination and imaging (including ultrasound, CT and CT urography (computed tomogr aphy urography, CTU), MRI and MRI (magnetic resonance urography, MRU), intravenous urography (intravenous urography, IVU), chest X-ray or chest CT, etc.). Wherein, the sensitivity of the urine abscission cytology examination is 13-75%, and the specificity is 85-100%. The sensitivity of the compound is positively correlated with the grading of tumors, and the positive rate of high-grade tumors (including carcinoma in situ) reaches 84%; the sensitivity of G1 and low grade tumors was 16%. In addition, the sensitivity of urine tumor marker detection is high but the specificity is low, so that the urine tumor marker detection has not been widely applied clinically. Cystoscopy and biopsy are currently the most reliable methods of diagnosing urothelial cancer. However, such invasive screening may cause complications such as urinary male reproductive system infection, urinary tract and bladder bleeding, urinary tract injury, and urinary tract stenosis. Therefore, there is an urgent need to find a non-invasive screening method with high accuracy.

The liquid biopsy technology takes body fluid such as blood, saliva, urine and the like as a detection material, takes tumor markers and the like as detection indexes, realizes early screening and early diagnosis of cancers, assists stage separation, prognosis and recurrence monitoring, guides medication and the like, and has the advantages of no wound, high efficiency, accuracy and the like. Among them, the abnormal change of DNA methylation level is used as a marker for tumor molecular diagnosis, which is one of the current research hotspots and gradually becomes the consensus of the scientific and medical communities.

Disclosure of Invention

Based on the problems of the existing detection of urothelial cancer, it is an object of the present application to provide a composition for in vitro detection of urothelial cancer, a kit and use thereof, a method for performing detection based on the kit, and use for detecting urothelial cancer.

The specific technical scheme of the application is as follows:

1. a composition for in vitro detection of urothelial cancer, the composition comprising:

nucleic acid for detecting methylation status of a target gene,

wherein the methylation state of the target gene is characterized by methylation of a target sequence of the target gene,

wherein the target gene is one or more than two of VIM gene, KCNA3 gene, TMEM220 gene and PPM1N gene.

2. The composition of item 1, wherein the target sequence of the VIM gene is shown as SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4, or the target sequence of the VIM gene comprises a sequence shown as SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4.

3. The composition according to item 1, wherein the target sequence of the KCNA3 gene is shown as SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8, or the target sequence of the KCNA3 gene comprises a sequence shown as SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8.

4. The composition of item 1, wherein the TMEM220 target sequence is shown as SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12, or the TMEM220 target sequence comprises a sequence shown as SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12.

5. The composition of item 1, wherein the target sequence of the PPM1N gene is shown as SEQ ID NO. 13 or SEQ ID NO. 14 or SEQ ID NO. 15 or SEQ ID NO. 16, or the target sequence of the PPM1N gene comprises a sequence shown as SEQ ID NO. 13 or SEQ ID NO. 14 or SEQ ID NO. 15 or SEQ ID NO. 16.

6. The composition according to any one of items 1 to 5, wherein the nucleic acid for detecting methylation status of a target gene comprises:

a primer that is a fragment of at least 9 nucleotides in a target sequence of the target gene, the fragment comprising at least one CpG dinucleotide sequence.

7. The composition according to any one of items 1 to 6, wherein the nucleic acid for detecting methylation status of a target gene comprises:

a probe which is a fragment of at least 15 nucleotides hybridised to the target sequence of the target gene under moderately stringent or stringent conditions,

The fragment comprises at least one CpG dinucleotide sequence.

8. The composition of any one of items 1-7, further comprising:

an agent that converts an unmethylated cytosine base at position 5 of a target sequence of a target gene into uracil.

9. The composition according to item 8, wherein,

the at least 9 nucleotide fragment is the sequence of SEQ ID NO. 17 and SEQ ID NO. 18, or the sequence of SEQ ID NO. 20 and SEQ ID NO. 21, or the sequence of SEQ ID NO. 23 and SEQ ID NO. 24, or the sequence of SEQ ID NO. 26 and SEQ ID NO. 27;

the fragment of at least 15 nucleotides, which is the sequence of SEQ ID NO. 19, or the sequence of SEQ ID NO. 22, or the sequence of SEQ ID NO. 25, or the sequence of SEQ ID NO. 28.

10. An oligonucleotide for detecting urothelial cancer in vitro, comprising:

a fragment of at least 9 nucleotides of SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof comprising at least one CpG dinucleotide sequence; and/or

A fragment of at least 9 nucleotides of said SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof comprising at least one CpG dinucleotide sequence; and/or

A fragment of at least 9 nucleotides of said SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof comprising at least one CpG dinucleotide sequence; and/or

The fragment of at least 9 nucleotides of SEQ ID NO. 13 or SEQ ID NO. 14 or SEQ ID NO. 15 or SEQ ID NO. 16 or the complement thereof and comprising at least one CpG dinucleotide sequence.

11. The oligonucleotide of item 10, further comprising:

a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of said SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or

A fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of said SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or

A fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of said SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or

A fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of said SEQ ID NO. 13 or SEQ ID NO. 14 or SEQ ID NO. 15 or SEQ ID NO. 16 or the complement thereof and which comprises at least one CpG dinucleotide sequence.

12. An oligonucleotide for detecting urothelial cancer in vitro, comprising:

SEQ ID NO. 17 and SEQ ID NO. 18.

13. The oligonucleotide of item 12, further comprising:

SEQ ID NO. 19.

14. An oligonucleotide for detecting urothelial cancer in vitro, comprising:

SEQ ID NO. 20 and SEQ ID NO. 21.

15. The oligonucleotide of item 14, further comprising:

SEQ ID NO. 22.

16. An oligonucleotide for detecting urothelial cancer in vitro, comprising:

SEQ ID NO. 23 and SEQ ID NO. 24.

17. The oligonucleotide of item 16, further comprising:

SEQ ID NO. 25.

18. An oligonucleotide for detecting urothelial cancer in vitro, comprising:

the sequences of SEQ ID NO. 26 and SEQ ID NO. 27.

19. The oligonucleotide of item 18, further comprising:

SEQ ID NO. 28.

20. A kit comprising the composition of any one of claims 1-9 or comprising the oligonucleotide of any one of claims 10-19.

21. The kit of item 20, further comprising at least one additional component selected from the group consisting of:

nucleoside triphosphates, DNA polymerase and buffers required for the function of the DNA polymerase.

22. The kit of item 20 or 21, wherein the sample for detection of the kit comprises: cell lines, histological sections, tissue biopsies/paraffin-embedded tissues, body fluids, faeces, colonic exudates, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof.

23. The kit according to any one of items 20 to 22, further comprising: and (3) a specification.

24. Use of the composition of any one of claims 1-9 or the oligonucleotide of any one of claims 10-19 for the preparation of a kit for in vitro detection of urothelial cancer.

25. The use of item 24, wherein the kit for in vitro detection of urothelial cancer detects urothelial cancer by a method comprising the steps of:

1) Isolating a DNA sample comprising a target sequence of a target gene or a fragment thereof from a biological sample to be tested;

2) Determining the methylation status of the target sequence of the target gene;

3) Judging the state of the biological sample according to the detection result of the methylation state of the target sequence of the target gene, thereby realizing in-vitro detection of urothelial cancer.

26. The use according to item 25, wherein the method comprises the steps of:

Extracting genome DNA of a biological sample to be detected;

treating the extracted genomic DNA with a reagent to convert the unmethylated cytosine base at position 5 to uracil or other bases;

contacting the DNA sample treated by the reagent with a DNA polymerase and a primer of a target sequence of a target gene to perform DNA polymerization reaction;

detecting the amplified product with a probe; and

determining the methylation status of at least one CpG dinucleotide of the target sequence of the target gene based on the presence or absence of the amplification product.

27. The use according to item 26, wherein the reagent is a bisulphite reagent.

Use of one or more of vim gene, KCNA3 gene, TMEM220 gene, and PPM1N gene in the preparation of a kit for in vitro detection of urothelial cancer.

29. The use of item 28, wherein the target sequence of the VIM gene is as shown in SEQ ID No. 1 or SEQ ID No. 2 or SEQ ID No. 3 or SEQ ID No. 4, or the target sequence of the VIM gene comprises a sequence as shown in SEQ ID No. 1 or SEQ ID No. 2 or SEQ ID No. 3 or SEQ ID No. 4.

30. The use according to item 28, wherein the target sequence of the KCNA3 gene is shown as SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8, or the target sequence of the KCNA3 gene comprises a sequence shown as SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8.

31. The use according to item 28, wherein the TMEM220 target sequence is shown as SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12, or the TMEM220 target sequence comprises a sequence shown as SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12.

32. The use of item 28, wherein the target sequence of the PPM1N gene is as shown in SEQ ID No. 13 or SEQ ID No. 14 or SEQ ID No. 15 or SEQ ID No. 16, or the target sequence of the PPM1N gene comprises a sequence as shown in SEQ ID No. 13 or SEQ ID No. 14 or SEQ ID No. 15 or SEQ ID No. 16.

33. A method of detecting urothelial cancer comprising the steps of:

isolating a DNA sample comprising a target sequence of a target gene or a fragment thereof from a biological sample to be tested;

determining the methylation status of the target sequence of the target gene; and

judging the state of the biological sample according to the detection result of the methylation state of the target sequence of the target gene, thereby realizing in-vitro detection of urothelial cancer.

34. A method of detecting urothelial cancer comprising the steps of:

extracting genome DNA of a biological sample to be detected;

detecting the amplified product with a probe; and

35. The method of item 33 or 34, wherein,

the target gene is one or more than two of VIM gene, KCNA3 gene, TMEM220 gene and PPM1N gene.

36. The method of item 35, wherein the VIM gene has a target sequence as set forth in SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4.

37. The method according to item 35, wherein the target sequence of the KCNA3 gene is shown as SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8.

38. The method according to item 35, wherein the TMEM220 gene has a target sequence as shown in SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12.

39. The method of item 35, wherein the PPM1N gene has a target sequence as shown in SEQ ID NO. 13 or SEQ ID NO. 14 or SEQ ID NO. 15 or SEQ ID NO. 16.

40. The method of item 34, wherein the reagent is a bisulphite reagent.

41. The method of item 34, wherein the primer is:

42. The method of item 34, wherein the probe is:

43. The method of item 41, wherein the primer is the sequence of SEQ ID NO. 17 and SEQ ID NO. 18, or it is the sequence of SEQ ID NO. 20 and SEQ ID NO. 21, or it is the sequence of SEQ ID NO. 23 and SEQ ID NO. 24, or it is the sequence of SEQ ID NO. 26 and SEQ ID NO. 27.

44. The method of item 42, wherein the probe is the sequence of SEQ ID NO. 19, or the sequence of SEQ ID NO. 22, or the sequence of SEQ ID NO. 25, or the sequence of SEQ ID NO. 28.

The application has the following beneficial effects:

the application screens 4 related markers which can sensitively and specifically detect the urothelial cancer, and determines the methylation area of the related markers. By detecting the target sequences of the methylation genes of the VIM gene, the KCNA3 gene, the TMEM220 gene, and/or the PPM1N gene, the methylation state of the genes can be sensitively and specifically detected, and thus can be used for detecting episomal DNA in urine. The detection of urine samples from patients with urothelial cancer and normal control individuals showed that: the composition and the detection method can sensitively and specifically detect the urothelial cancer, thereby ensuring the correctness and the reliability of detection results. Therefore, the application provides a composition, a kit and a detection method for detecting the urothelial cancer in vitro, which can conveniently, quickly and effectively detect the urothelial cancer and have important clinical application value.

The application utilizes the epigenetic group and bioinformatics technology, finds a plurality of methylation genes related to the urothelial cancer by analyzing genome methylation data of the urothelial cancer, determines a target sequence of methylation abnormality of the urothelial cancer methylation genes, and can sensitively and specifically detect the methylation state of the genes through the target sequence of the methylation genes, thereby being capable of being used for detecting free DNA in urine.

The composition is used for screening asymptomatic people in a non-invasive mode, harm caused by invasive detection is reduced, and the composition has higher sensitivity and accuracy and can realize real-time monitoring.

Detailed Description

The present application is described in detail below. While specific embodiments of the present application are shown, it should be understood that the present application may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the disclosure to those skilled in the art.

Unless otherwise indicated, practice of the present application will employ conventional molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and genetics techniques, which are within the skill of the art. Such techniques are described in detail in the literature as Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al, 1989); oligonucleotide Synthesis (M.J.Gait, 1984); animal Cell Culture (R.I. Freshney, 1987); methods in Enzymology Cluster books (American academic Press Co., ltd.); current Protocols in Molecular Biology (F.M. Ausubel et al, 1987 edition, and periodic updates); PCR The Polymerase Chain Reaction (Mullis et al, 1994). Primers, probes and kits used in the present application can be prepared using standard techniques well known in the art.

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

Definition of the definition

"precancerous" in this application means a cell that is at an early stage of, or is prone to be transformed into, a cancer cell. Such cells may exhibit one or more phenotypic traits characteristic of cancer cells.

"stringent hybridization conditions" and "high stringency" in this application refer to conditions under which a probe hybridizes to its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. For detailed guidance on nucleic acid hybridization, reference may be made to Tijssen, biochemical and molecular biological techniques-nucleic acid probe hybridization, "review of hybridization principles and nucleic acid assay strategies. Typically, stringent conditions are those about 5-10deg.C below the melting point (Tm) for a specific nucleic acid at a defined ionic strength pH. At Tm temperatures (at defined ionic strength, pH and nucleic acid concentration), 50% of the probes complementary to the target hybridize uniformly to the target sequence. Stringent conditions can also be achieved with the addition of destabilizing agents. For selective or specific hybridization, the positive signal is twice, preferably 10 times, that of the background hybridization. Exemplary stringent hybridization conditions are as follows: hybridization was performed at 42℃in a solution of 50% formamide, 5 XSSC and 1% SDS, or at 65℃in a solution of 5 XSSC and 1% SDS, followed by washing at 65℃in a solution of 0.2XSSC and 0.1% SDS.

Also, if the polypeptides encoded by the nucleic acids are substantially similar, the nucleic acids are substantially similar even if they are not capable of hybridizing under stringent conditions. In this case, the nucleic acid is typically hybridized under moderately stringent hybridization conditions. As an example, "moderately stringent hybridization conditions" include hybridization in a solution of 40% formamide, 1M sodium chloride and 1% SDS at 37 ℃ and washing in a solution of 1xSSC at 45 ℃. It will be apparent to one of ordinary skill in the art that guidance in achieving the conditions to achieve the same stringency is available in the prior art. For PCR, temperatures around 36℃are typically suitable for low stringency amplification, while annealing temperatures range between 32℃and 48℃based on the length of the primer. For highly stringent PCR amplification, it is typically at 62℃and the annealing temperature for highly stringent hybridization ranges between 50℃and 65℃based on the length and specificity of the primers. For cycling conditions of high stringency and low stringency amplification, typically, include: the denaturation phase is continued for 30 seconds to 2 minutes at 90-95 ℃, the annealing phase is continued for 30 seconds to 2 minutes, and the extension phase is continued for 1 to 2 minutes at about 72 ℃. Tools and guidelines for low and high stringency amplification reactions are available in the prior art.

"oligonucleotide" in this application refers to a molecule consisting of two or more nucleotides, preferably three or more nucleotides, the exact size of which may depend on a number of factors, which in turn are determined by the ultimate function and use of the oligonucleotide. In certain embodiments, the oligonucleotide may comprise a length of 10 nucleotides to 100 nucleotides. In certain embodiments, the oligonucleotides may comprise a length of 10 nucleotides to 30 nucleotides, or may have lengths of 20 and 25 nucleotides. In some particular embodiments, oligonucleotides shorter than these lengths are also suitable.

"primer" in this application means an oligonucleotide capable of acting as a point of initiation of synthesis, whether it is naturally occurring in a purified restriction digest or synthetically produced, when placed under conditions that induce synthesis of a primer extension product complementary to a nucleic acid strand, i.e., in the presence of a nucleotide and an inducer such as a DNA or RNA polymerase, and at a suitable temperature and pH. The primer may be single-stranded or double-stranded and must be long enough to prime the synthesis of the desired extension product in the presence of the primer. The exact length of the primer depends on a variety of factors, including temperature, primer source and method used. For example, for diagnostic and prognostic applications, an oligonucleotide primer will typically contain at least or more than about 9, 10, or 15, or 20, or 25 or more nucleotides, depending on the complexity of the target sequence, but it may contain fewer nucleotides or more nucleotides. Factors involved in determining the appropriate length of the primer are well known to those skilled in the art.

"primer pair" in this application means a primer pair that hybridizes to the opposite strand of a target DNA molecule or to a region of the target DNA flanked by nucleotide sequences to be amplified.

"primer site" in this application refers to a region of target DNA or other nucleic acid to which a primer hybridizes.

The term "probe" as used herein, when referring to a nucleic acid sequence, is used in its ordinary sense to refer to a selected nucleic acid sequence that hybridizes to a target sequence under defined conditions and can be used to detect the presence of the target sequence. Those skilled in the art will appreciate that in some cases, probes may also be used as primers, and primers may be used as probes.

"DNA methylation" in this application refers to the addition of a methyl group to the 5-position of cytosine (C), which is typically (but not necessarily) the case with CpG (cytosine followed by guanine) dinucleotides. As used herein, "increased degree of methylation" or "substantial degree of methylation" refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancerous cell or tissue sample or a DNA sample treated for methylation of DNA residues) is unmethylated, and in certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more C can be methylated, wherein the C at these positions in the control DNA sample is unmethylated.

In embodiments, a variety of different methods may be used to detect DNA methylation changes. Methods for detecting DNA methylation include, for example, methylation-sensitive restriction endonuclease (MSRE) assays using southern or Polymerase Chain Reaction (PCR) assays, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (MS-SnuPE), high Resolution Melting (HRM) assays, bisulfite sequencing, pyrosequencing, methylation-specific single strand conformation assays (MS-SSCA), combinatorial bisulfite restriction assays (COBRA), methylation-specific gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve assays (MS-MCA), methylation-specific high performance liquid chromatography (MS-DHPLC), methylation-specific Microarray (MSO). These assays may be PCR assays, quantitative assays using fluorescent markers or southern blot assays.

"methylation determination" in this application refers to any determination that determines the methylation state of one or more CpG dinucleotide sequences within a DNA sequence.

"detecting" in this application refers to any process of observing a marker or a change in a marker (e.g., a change in the methylation state of a marker or the expression level of a nucleic acid or protein sequence) in a biological sample, whether or not the marker or the change in the marker is actually detected. In other words, the act of detecting the marker or a change in the marker of the sample is "detecting" even if the marker is determined to be absent or below the sensitivity level. The detection may be quantitative, semi-quantitative, or non-quantitative observation, and may be based on comparison to one or more control samples. It is to be understood that detecting urothelial cancer as disclosed herein includes detecting pre-cancerous cells that begin to develop into or are about to develop into urothelial cancer cells, or have an increased propensity to develop into urothelial cancer cells. Detecting urothelial cancer may also include detecting a possible probability of death or a possible prognosis of a disease condition.

"homology", "identity" and "similarity" in this application refer to sequence similarity between 2 nucleic acid molecules. The positions in each sequence can be compared to determine "homology", "identity" or "similarity", and the sequences can be aligned for comparison purposes. When an equivalent position in the compared sequences is occupied by the same base, the molecules are identical at that position; when an equivalent site is occupied by the same or a similar amino acid (e.g., similar in steric or charged properties) residue, the molecule may be said to be homologous (similar) at that position. Expression of homology/similarity or percent identity refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences. "unrelated" or "non-homologous" sequences share less than 40% identity, preferably less than 25% identity, with the sequences of the present application. The absence of residues (amino acids or nucleic acids) or the presence of redundant residues also reduces identity and homology/similarity when comparing 2 sequences. In particular embodiments, two or more sequences or subsequences are considered substantially or significantly homologous, similar or identical if their sequences are about 60% identical, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical over a defined region when compared and aligned for maximum correspondence over a comparison window or defined region, as determined using BLAST or BLAST 2.0 sequence comparison algorithms having default parameters described below, or as determined by manual alignment and visual inspection provided on-line by, for example, the national center for biotechnology information (National Center for Biotechnology Information (NCBI)). The definition also relates to or can be used to test the complement of a sequence. Thus, for example, if a nucleotide sequence can be predicted to occur naturally in a DNA duplex, or can occur naturally in the form of one or both of the complementary strands, the nucleotide sequence that is complementary to a specified target sequence or variant thereof is itself considered "similar" to the target sequence, and when reference is made to a "similar" nucleic acid sequence, includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing, to the extent permitted by the context herein. The circumstances in which similarity must be limited to analysis of a single nucleic acid strand sequence may include, for example, detection and quantification of expression of a particular RNA sequence or coding sequence in a cell. The definition also includes sequences with deletions and/or additions, as well as sequences with substitutions. In embodiments, identity or similarity may be over a region of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25 or more nucleotides in length, or over a region of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more than about 100 nucleotides in length.

"amplification" in this application refers to the process of obtaining multiple copies from a particular locus of a nucleic acid, such as genomic DNA or cDNA. Amplification may be accomplished using any of a variety of known means including, but not limited to, polymerase Chain Reaction (PCR), transcription-based amplification, and Strand Displacement Amplification (SDA).

The "fluorescence-based real-time PCR" of the present application means such a method: and adding a fluorescent group into the PCR reaction system, monitoring the whole PCR process in real time by utilizing fluorescent signal accumulation, and finally quantitatively analyzing the unknown template through a standard curve. In this PCR technique, there is a very important concept, the cycle threshold, also called Ct value. C represents Cycle, t represents threshold, and Ct has the meaning of: the number of cycles that the fluorescent signal within each reaction tube experiences when reaching a set threshold. For example, the fluorescence threshold (threshold) is set as follows: the fluorescent signal of the first 15 cycles of the PCR reaction served as the fluorescent background signal, and the default (default) setting of the fluorescent threshold was 10 times the standard deviation of the fluorescent signal of 3-15 cycles.

The "cut off value of real-time PCR" in the present application means a critical Ct value for a biomarker that determines whether a sample is negative or positive. According to some specific real-time aspects of the present application, the "critical Ct value (Cut Off value) is derived based on statistical processing from a certain number of sample data, and may be different depending on the desired sensitivity or specificity requirements.

The "sensitivity" of the present application means the proportion of cancers detected from a certain cancer sample, and the calculation formula is: sensitivity= (detected cancer/all cancers), whereas "specificity" indicates the normal proportion detected in a certain normal human sample, the formula is specificity= (detected negative/total negative).

A "label" or "detectable moiety" in this application is a component that is detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical or other physical means. For example, useful labels include 32P, fluorescent dyes, electron dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxin, or haptens, and proteins that can be prepared to be detectable, e.g., by incorporating a radiolabel into the peptide or for detecting antibodies that specifically react with the peptide.

Nucleic acid molecules can be detected using a variety of different methods. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., southern blot, northern blot, or in situ hybridization). In particular, oligonucleotides (e.g., oligonucleotide primers) capable of amplifying a target nucleic acid may be used in a PCR reaction. The PCR method generally comprises the steps of: obtaining a sample, isolating nucleic acids (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acids with one or more oligonucleotide primers that specifically hybridize to a template nucleic acid under conditions that enable amplification of the template nucleic acid to occur. In the presence of a template nucleic acid, amplification products are produced. Conditions for nucleic acid amplification and detection of amplification products are known to those skilled in the art. Various improvements to the basic PCR technique have been developed, including, but not limited to, anchored PCR, RACE PCR, RT-PCR, and Ligase Chain Reaction (LCR). The primer pairs in the amplification reaction must anneal to the opposite strand of the template nucleic acid and should be kept at a suitable distance from each other so that the polymerase can efficiently polymerize across the region and so that the amplified product can be easily detected, for example, using electrophoresis. For example, oligonucleotide primers may be designed using a computer program such as OLIGO (Molecular Biology Insights inc., cascades, colo.) to aid in designing primers with similar melting temperatures. Typically, the oligonucleotide primer is 9-30 or 40 or 50 nucleotides in length (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length), although the oligonucleotide primer may be longer or shorter as long as appropriate amplification conditions are used.

Detection of the amplification product or hybridization complex is typically accomplished using a detectable label. The term "label", when referring to a nucleic acid, is intended to include direct labeling of the nucleic acid by coupling (i.e., physically linking) a detectable substance to the nucleic acid, as well as indirect labeling of the nucleic acid by reaction with another reagent that directly labels the detectable substance. Detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable prosthetic groups include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; examples of luminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin and aequorin. Examples of indirect labeling include end-labeling a nucleic acid with biotin such that the nucleic acid can be detected with fluorescently labeled streptavidin.

SUMMARY

In one aspect, the present application provides a composition for detecting urothelial cancer in vitro, the composition comprising a nucleic acid for detecting methylation status within a target sequence of a target gene, wherein the methylation status of the target gene is characterized by methylation of the target sequence of the target gene, wherein the target gene is one or more of a VIM gene, a KCNA3 gene, a TMEM220 gene, and a PPM1N gene.

The present application provides a set of target sequences of a target gene which emits abnormal methylation in urothelial cancer, comprising target sequences of one or more of a VIM gene, a KCNA3 gene, a TMEM220 gene and a PPM1N gene, wherein the target sequences of the VIM gene are shown as any one of SEQ ID nos. 1 to 4 or comprise sequences shown as any one of SEQ ID nos. 1 to 4, the target sequences of the KCNA3 gene are shown as any one of SEQ ID nos. 5 to 8 or comprise sequences shown as any one of SEQ ID nos. 5 to 8, the target sequences of the TMEM220 gene are shown as any one of SEQ ID nos. 9 to 12 or comprise sequences shown as any one of SEQ ID nos. 9 to 12, and the target sequences of the PPM1N gene are shown as any one of SEQ ID nos. 13 to 16 or comprise sequences shown as any one of SEQ ID nos. 13 to 16.

It will also be appreciated by those skilled in the art that the target sequences of the VIM gene, KCNA3 gene, TMEM220 gene and PPM1N gene are not limited to the specific sequences listed above. The target sequence of the VIM gene should encompass sequences comprising one or two or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs 1-4, but which are substantially still functionally identical thereto; also included are sequences having 95%, 96%, 97%, 98% or 99% sequence identity to the sequences set forth in any one of SEQ ID NOs 1-4; also included are sequences that delete one or more nucleotides, add one or more nucleotides, or replace one or more nucleotides on the basis of the nucleotide sequence set forth in any one of SEQ ID NOs 1-4, but which are 90%, 91%, 92%, 93%, 94%, 95% or 96% or 97% or 98% or 99% identical to the nucleotide sequence set forth in any one of SEQ ID NOs 1-4. The target sequence of the KCNA3 gene should encompass a sequence comprising one or two or more nucleotide mutations compared to the sequence shown in any of SEQ ID NOS 5-8, but substantially still functionally identical thereto; also included are sequences having 95%, 96%, 97%, 98% or 99% sequence identity to the sequences set forth in any one of SEQ ID NOs 5-8; also included are sequences that delete one or more nucleotides, add one or more nucleotides, or replace one or more nucleotides on the basis of the nucleotide sequence set forth in any one of SEQ ID NOs 5-8, but which are 90%, 91%, 92%, 93%, 94%, 95% or 96% or 97% or 98% or 99% identical to the nucleotide sequence set forth in any one of SEQ ID NOs 5-8. The target sequence of the TMEM220 gene should encompass sequences comprising one or two or more nucleotide mutations compared to the sequence shown in any of SEQ ID NOs 9-12, but which are substantially still functionally identical thereto; also included are sequences having 95%, 96%, 97%, 98% or 99% sequence identity to the sequences set forth in any one of SEQ ID NOs 9-12; also included are sequences that delete one or more nucleotides, add one or more nucleotides, or replace one or more nucleotides on the basis of the nucleotide sequence set forth in any one of SEQ ID NOs 9-12, but have 90%, 91%, 92%, 93%, 94%, 95% or 96% or 97% or 98% or 99% identity to the nucleotide sequence set forth in any one of SEQ ID NOs 9-12. The target sequence of the PPM1N gene should encompass sequences comprising one or two or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOS: 13-16, but which are substantially functionally identical thereto; also included are sequences having 95%, 96%, 97%, 98% or 99% sequence identity to the sequences set forth in any one of SEQ ID NOs 13-16; also included are sequences that delete one or more nucleotides, add one or more nucleotides, or replace one or more nucleotides on the basis of the nucleotide sequence set forth in any one of SEQ ID NOs 13-16, but which are 90%, 91%, 92%, 93%, 94%, 95% or 96% or 97% or 98% or 99% identical to the nucleotide sequence set forth in any one of SEQ ID NOs 13-16.

The target sequence (5 '-3') of the VIM gene is as follows:

the sequence (5 '-3') of the target sequence of the VIM gene after bisulfite treatment is as follows:

the complementary sequences (5 '-3') of the target sequence of the VIM gene are as follows:

the sequence (5 '-3') of the complementary sequence of the target sequence of the VIM gene after bisulfite treatment is as follows:

the target sequence (5 '-3') of the KCNA3 gene is as follows:

the sequence (5 '-3') of the target sequence of the KCNA3 gene after bisulphite treatment is as follows:

the complementary sequence (5 '-3') of the target sequence of the KCNA3 gene is as follows:

the sequence (5 '-3') of the complementary sequence of the target sequence of the KCNA3 gene after bisulfite treatment is as follows:

the target sequence (5 '-3') of TMEM220 gene is as follows

/>

The sequence (5 '-3') of the target sequence of TMEM220 gene after bisulfite treatment is as follows:

the complementary sequences (5 '-3') of the target sequence of the TMEM220 gene are as follows:

the sequence (5 '-3') of the complementary sequence of the target sequence of TMEM220 gene after bisulfite treatment is as follows:

the target sequence (5 '-3') of the PPM1N gene is as follows:

the sequence (5 '-3') of the target sequence of the PPM1N gene after bisulfite treatment is as follows:

the complementary sequences (5 '-3') of the target sequence of the PPM1N gene are as follows:

/>

the sequence (5 '-3') of the complementary sequence of the target sequence of the PPM1N gene after bisulfite treatment is as follows:

The target sequences and related sequences of the VIM gene, KCNA3 gene, TMEM220 gene and PPM1N gene are shown in table 1:

table 1: target sequence and related sequence of each gene

Target sequence name	Sequence number
		Target sequence of VIM gene	SEQ ID NO:1
Sequence of the target sequence of the VIM Gene after bisulfite treatment	SEQ ID NO:2
		Complementary sequence of target sequence of VIM gene	SEQ ID NO:3
Sequence complementary to target sequence of VIM Gene after bisulfite treatment	SEQ ID NO:4
		Target sequence of KCNA3 gene	SEQ ID NO:5
Sequence of target sequence of KCNA3 gene after bisulphite treatment	SEQ ID NO:6
		Complementary sequence of target sequence of KCNA3 gene	SEQ ID NO:7
Sequence complementary to target sequence of KCNA3 Gene after bisulfite treatment	SEQ ID NO:8
		Target sequence of TMEM220 gene	SEQ ID NO:9
Sequence of TMEM220 Gene target sequence after bisulfite treatment	SEQ ID NO:10
		Complementary sequence of target sequence of TMEM220 gene	SEQ ID NO:11
Sequence complementary to target sequence of TMEM220 Gene after bisulfite treatment	SEQ ID NO:12
		Target sequence of PPM1N gene	SEQ ID NO:13
Sequence of target sequence of PPM1N gene after bisulfite treatment	SEQ ID NO:14
		Complementary sequence of target sequence of PPM1N gene	SEQ ID NO:15
Sequence of complementary sequence of target sequence of PPM1N Gene after bisulfite treatment	SEQ ID NO:16

Preferably, the nucleic acid for detecting methylation status of a gene of interest comprises a fragment of at least 9 nucleotides in a target sequence of the gene of interest, wherein the fragment comprises at least one CpG dinucleotide sequence. In certain preferred embodiments, the nucleic acid for detecting methylation status of a target gene comprises a fragment of at least 9 nucleotides, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides in a sequence that has been bisulfite converted from a target sequence of the target gene, such as by using bisulfite to convert a sample DNA to be tested, wherein the fragment of a nucleotide comprises at least one CpG dinucleotide sequence.

More preferably, the nucleic acid for detecting methylation status of a gene of interest comprises a fragment of at least 15 nucleotides that hybridizes under moderate stringency or stringent conditions to a target sequence of said gene of interest, wherein said fragment of nucleotides comprises at least one CpG dinucleotide sequence. In certain preferred embodiments, the nucleic acid for detecting the methylation state of a target gene, such as by converting a test sample DNA using bisulfite, comprises a fragment of at least 15 nucleotides, preferably a fragment of at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, in a sequence following bisulfite conversion of a target sequence hybridized to the target gene under moderately stringent or stringent conditions, wherein the fragment of nucleotides comprises at least one CpG dinucleotide sequence.

Preferably, the composition further comprises an agent that converts an unmethylated cytosine base at position 5 of the target sequence of the target gene to uracil. More preferably, the reagent is bisulphite.

Preferably, the composition comprises one or more of the primers, probes as shown in table 2.

TABLE 2 primer and probe sequences used herein

Sequence numbering	Sequence name	Specific nucleotide sequence (5 '-3')
			SEQ ID NO:17	VIM_F	TAAAGTTATATAATTTGCGACG
SEQ ID NO:18	VIM_R	AATCGCCGAACTAAAACC
			SEQ ID NO:19	VIM_P	TTCGTTTTTATTTTTCGGTCGTTT
SEQ ID NO:20	KCNA3_F	TTCGGAGATGTTGATGATTACGC
			SEQ ID NO:21	KCNA3_R	CCGTAATACCCGAAAACCACC
SEQ ID NO:22	KCNA3_P	AAAACCCCGCCTCAAAACGAC
			SEQ ID NO:23	TMEM220_F	ATTAATTGTGCGTTTTTGCGAT
SEQ ID NO:24	TMEM220_R	TACAAATCAAACGACCGCGAT
			SEQ ID NO:25	TMEM220_P	CCGCCCGACTCCCAACTC
SEQ ID NO:26	PPM1N_F	GGCGGTTTTGGTTCGTTAGTTGT
			SEQ ID NO:27	PPM1N_R	CCAAACGCCTCGACACCC
SEQ ID NO:28	PPM1N_P	AAACCCTACGCCCCGCCTC

"F" in Table 2 represents a forward primer; "R" means the reverse primer; "P" means a probe.

Preferably, the fluorescent labeling patterns of the probe sequences used in the present application are shown in Table 3.

TABLE 3 fluorescent labelling of probe sequences for use herein

In certain embodiments, the composition further comprises an agent that converts an unmethylated cytosine base at position 5 of the gene to uracil. Preferably, the agent is bisulphite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In eukaryotic DNA, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because 5-methylcytosine has the same base pairing behavior as cytosine. Furthermore, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification. The most commonly used method for analyzing DNA for the presence of 5-methylcytosine is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, unmethylated cytosines are converted to uracil which corresponds to thymine in pairing behavior; but under these conditions 5-methylcytosine remains unmodified. The original DNA is thus converted in such a way that the 5-methylcytosine, which was originally indistinguishable from cytosine in its hybridization behavior, can now be detected as the only cytosine remaining by conventional known molecular biological techniques, for example by amplification and hybridization. All of these techniques are now fully utilized based on different base pairing properties. Thus, typically, the present application provides for the use of bisulfite technology in combination with one or more methylation assays for determining the methylation status of CpG dinucleotide sequences within a target sequence of a gene of interest. Furthermore, the methods of the present application are suitable for analyzing heterogeneous biological samples, such as low concentrations of tumor cells in urine. Thus, when analyzing the methylation status of CpG dinucleotide sequences in such samples, one skilled in the art can use quantitative assays to determine the methylation level (e.g., percentage, fraction, ratio, proportion or degree) of a particular CpG dinucleotide sequence, rather than the methylation status. Accordingly, the term methylation status or methylation status shall also be taken to mean a value reflecting the methylation status of a CpG dinucleotide sequence.

In another aspect, the present application provides an oligonucleotide for detecting urothelial cancer in vitro comprising: a fragment of at least 9 nucleotides of SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof comprising at least one CpG dinucleotide sequence; and/or a fragment of at least 9 nucleotides of SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof comprising at least one CpG dinucleotide sequence; and/or a fragment of at least 9 nucleotides of SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof comprising at least one CpG dinucleotide sequence; and/or a fragment of at least 9 nucleotides of SEQ ID NO. 13 or SEQ ID NO. 14 or SEQ ID NO. 15 or SEQ ID NO. 16 or the complement thereof and comprising at least one CpG dinucleotide sequence.

Preferably the oligonucleotide for in vitro detection of urothelial cancer comprises: a fragment of at least 9 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof; and/or a fragment of at least 9 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof and comprising at least one CpG dinucleotide sequence; and/or a fragment of at least 9 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof and comprising at least one CpG dinucleotide sequence; and/or a fragment of at least 9 nucleotides of the sequence after bisulphite conversion of SEQ ID NO. 13 or SEQ ID NO. 14 or SEQ ID NO. 15 or SEQ ID NO. 16 or the complement thereof.

An oligonucleotide for in vitro detection of urothelial cancer of the present application, further comprising: a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of SEQ ID NO. 13 or SEQ ID NO. 14 or SEQ ID NO. 15 or SEQ ID NO. 16 or the complement thereof and which comprises at least one CpG dinucleotide sequence.

Preferably the oligonucleotide for in vitro detection of urothelial cancer comprises: a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 13 or SEQ ID NO. 14 or SEQ ID NO. 15 or SEQ ID NO. 16 or the complement thereof and which comprises at least one CpG dinucleotide sequence.

In a specific embodiment, an oligonucleotide for in vitro detection of urothelial cancer comprising: SEQ ID NO. 17 and SEQ ID NO. 18. It also includes: SEQ ID NO. 19.

In another specific embodiment, an oligonucleotide for detecting urothelial cancer in vitro, comprising: SEQ ID NO. 20 and SEQ ID NO. 21. It also includes: SEQ ID NO. 22.

In another specific embodiment, an oligonucleotide for detecting urothelial cancer in vitro, comprising: the sequences of SEQ ID NO. 23 and SEQ ID NO. 24, further comprising: SEQ ID NO. 25.

In another specific embodiment, an oligonucleotide for detecting urothelial cancer in vitro, comprising: the sequences of SEQ ID NO. 26 and SEQ ID NO. 27, further comprising: SEQ ID NO. 28.

In another aspect, the present application provides a kit comprising the composition. The kit further comprises at least one additional component selected from the group consisting of: nucleoside triphosphates, DNA polymerase and buffers required for the function of the DNA polymerase.

Typically, the kit further comprises a container for holding a biological sample of a patient. And, the kit also includes instructions for use and interpretation of the test results.

The application also relates to the use of the above composition and oligonucleotide for preparing a kit for detecting urothelial cancer in vitro.

The application also relates to application of one or more than two of VIM gene, KCNA3 gene, TMEM220 gene and PPM1N gene in preparation of a kit for in vitro detection of urothelial cancer.

Wherein the VIM gene encodes a type III intermediate filament protein. The intermediate filaments together with microtubules and actin filaments constitute the cytoskeleton. The encoded protein is responsible for maintaining the integrity of the cell shape and cytoplasm and stabilizing cytoskeletal interactions. This protein is involved in neuritic genesis and cholesterol transport and functions as a organizer of many other key proteins involved in cell attachment, migration and signaling.

The KCNA3 gene encodes a member of the potassium channel, voltage-gated, oscillator-related subfamily. From a functional and structural standpoint, potassium channels represent the most complex class of voltage-gated ion channels. Their multiple functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction and cell volume.

The TMEM220 gene expression product is predicted to be a component of a cell membrane.

The PPM1N gene predicts that metal ion binding activity and protein serine/threonine phosphatase activity can be achieved. Predicted to be involved in negative regulation of I- κB kinase/NF- κB signaling and positive regulation of canonical Wnt signaling pathways. Activity in the cytosol and nucleus is predicted.

In yet another aspect, the present application provides a method of detecting urothelial cancer in vitro, the method comprising the steps of:

1) Isolating a target sequence of a target gene or a fragment thereof in a biological sample to be tested;

According to certain preferred embodiments, the method further comprises the steps of:

1) Extracting genome DNA of a biological sample to be detected;

2) Treating the DNA sample obtained in step 1) with a reagent to convert the 5-unmethylated cytosine base into uracil or another base, i.e., the 5-unmethylated cytosine base of the target sequence of the target gene into uracil or another base, the converted base being different from the 5-unmethylated cytosine base in hybridization performance and being detectable;

3) Contacting the DNA sample treated in step 2) with a DNA polymerase and primers for the target sequence of the target gene such that the target sequence of the treated target gene is amplified to produce amplified products or not; the target sequence of the treated target gene produces amplified products if DNA polymerization occurs; the target sequence of the treated target gene is not amplified if DNA polymerization does not occur;

4) Detecting the amplified product with a probe; and

5) Determining the methylation status of at least one CpG dinucleotide of the target sequence of the target gene based on the presence or absence of the amplification product.

Preferably, typical primers comprise fragments of the target sequence of the target gene comprising fragments of at least 9 nucleotides which are identical, complementary or hybridise under moderately stringent or stringent conditions to a sequence selected from any one of SEQ ID NOS: 1 to 4, any one of SEQ ID NOS: 5 to 8, any one of SEQ ID NOS: 9 to 12, any one of SEQ ID NOS: 13 to 16, respectively.

Preferably, a typical probe comprises a fragment of the target sequence of the target gene comprising a fragment of at least 15 nucleotides which is identical to, complementary to or hybridizes under moderately stringent or stringent conditions, respectively, to a fragment selected from any one of SEQ ID NOS: 1-4, any one of SEQ ID NOS: 5-8, any one of SEQ ID NOS: 9-12, any one of SEQ ID NOS: 13-16.

Preferably, one or more of the primers, probes are as set forth in table 2 above.

And, the contacting or amplifying comprises using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using Polymerase Chain Reaction (PCR), producing an amplification product nucleic acid molecule with a detectable label.

Preferably, the methylation status is determined by means of PCR, such as "fluorescence-based real-time PCR technique", methylation sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation Specific PCR (MSP), and methylation CpG island amplification (MCA), etc., is used to determine the methylation status of at least one CpG dinucleotide of the target sequence of the gene of interest. Among these, the "fluorescence-based real-time PCR" assay is a high throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) techniques, requiring no further manipulation after the PCR step. Briefly, the "fluorescence-based real-time PCR" method starts with a mixed sample of genomic DNA that is converted into a mixed pool of methylation-dependent sequence differences in a sodium bisulfite reaction according to standard procedures. Fluorescence-based PCR was then performed in an "offset" (biased) reaction (using PCR primers overlapping known CpG dinucleotides). Sequence differences can be produced at the amplification level and at the fluorescence detection amplification level. The "fluorescence-based real-time PCR" assay can be used as a quantitative test for methylation status in genomic DNA samples, where sequence discrimination occurs at the level of probe hybridization. In this quantitative format, the PCR reaction provides methylation specific amplification in the presence of fluorescent probes that overlap specific CpG dinucleotides. An unbiased control for the amount of starting DNA is provided by the following reaction: wherein neither the primer nor the probe covers any CpG dinucleotide. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as "TaqMan", "Lightcycler", etc. The TaqMan probe is double labeled with a fluorescent reporter (RTSP ULT 5 rter) and a Quencher (Quencher) and is designed to be specific for a relatively high GC content region such that it melts at a temperature about 10℃higher than the forward or reverse primer during the PCR cycle. This allows the TaqMan probe to remain fully hybridized during the PCR annealing/extension step. When Taq polymerase enzymatically synthesizes a new strand in PCR, it eventually encounters an annealed TaqMan probe. Taq polymerase 5 'to 3' endonuclease activity will then displace the TaqMan probe by digesting it, thereby releasing the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescent detection system. Typical reagents for "fluorescence-based real-time PCR" analysis may include, but are not limited to: target sequence PCR primers for the target gene; taqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; taq polymerase, and the like.

In certain preferred embodiments, the methylation status of at least one CpG dinucleotide in the target sequence of the target gene is determined from the critical Ct value of the real-time PCR reaction. The method for analyzing DNA in the biological sample by utilizing the real-time PCR reaction can conveniently realize the detection of the methylation state of the target sequence of the target gene, and can rapidly and conveniently judge whether the detected sample is positive according to the critical Ct value of the PCR reaction, thereby providing a noninvasive and rapid in-vitro detection method for urothelial cancer.

The biological sample is selected from the group consisting of a cell line, a histological section, a tissue biopsy/paraffin-embedded tissue, a body fluid, stool, a colonic outflow, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof. According to previous studies, a preferred biological sample for detection of urothelial cancer is urine. For example: emil Christensen, elta [ Cell-Free Urine and Plasma DNA Mutational Analysis Predicts Neoadjuvant Chemotherapy Response and Outcome in Patients with Muscle-Invasive Bladder Cancer ] compared plasma and urine samples simultaneously in 2017. The results show that: tumor DNA levels were higher in urine supernatant and urine pellet (P < 0.001) compared to plasma samples.

The present inventors found that there is a significant difference between the methylation status of the target sequences of VIM gene, KCNA3 gene, TMEM220 gene and PPM1N gene in urothelial cancer tissue and the methylation status of the target sequences of the genes of normal liver tissue: in urothelial cancer tissues, the target sequences of the VIM gene, KCNA3 gene, TMEM220 gene, and PPM1N gene are methylated, whereas in normal liver tissues, the target sequences of the VIM gene, KCNA3 gene, TMEM220 gene, and PPM1N gene are not methylated. The application provides a method for in vitro detection of urothelial cancer by detecting methylation status of one or more gene target sequences of VIM gene, KCNA3 gene, TMEM220 gene and PPM1N gene in a sample, and the method can be used for noninvasively and rapidly detecting urothelial cancer.

Examples

The materials used in the test and the test methods are generally and/or specifically described herein, and in the examples which follow,% represents wt%, i.e., weight percent, unless otherwise specified. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.

Example 1: marker screening route

1) Sample collection: the 450k methylation chip cancer tissue data in TCGA was downloaded, involving a total of 7769 cancer tissue samples from 26 tumors. For healthy people, urine from 38 healthy people was collected and whole genome methylation sequencing was performed (Whole Genome Bisulfite Sequencing, WGBS).

2) Candidate marker screening: for healthy urine samples, the third quartile (Q3), also known as the "greater quartile", of the probe beta corresponding to the 450k region of WGBS was calculated, and the site with Q3<0.02 was screened, resulting in List1. For 450K chip organization data, calculating a first quartile (Q1) of beta value of each probe corresponding to the 450K corresponding region, wherein Q1 is also called as smaller quartile, screening sites of Q1>0.1, and obtaining a result as List2. Taking the intersection of List1 and List2 yields 65739 differentially methylated regions.

3) And (3) marker selection: among the above markers, markers specific to urothelial cancer were selected to obtain 123 markers. Meanwhile, the difference between methylation levels of 450k chip urothelial carcinoma (412) and paracancerous tissue (21) in TCGA was required to be greater than 0.2, resulting in 79 different methylation regions.

4) And (3) marker verification: probe capture was designed for the 79 differential methylation regions described above, and verification was performed using bohr's urine sample data (urothelial carcinoma sample number=40, healthy person sample number=38), and finally the differential regions of VIM, KCNA3, TMEM220, and PPM1N genes were verified. Based on the resulting target sequence region, the PCR probe composition is tailored. The PCR system for the primer probe test is shown in Table 4 below.

TABLE 4 PCR System for primer probe test

	Volume (mu L)	Final concentration
			Taq DNA Polymerase(Biochain)	1.0	/
4.2×buffer(Biochain)	12.0	1×
			Forward primer F (10. Mu.M)	1.0	200nM
Reverse primer R (10. Mu.M)	1.0	200nM
			Probe P (10 mu M)	1.0	200nM
BisDNA	4.0	/
			H ₂ O	30.0	/
Total	50.0	/

Note that: "F" represents a forward primer; "R" means the reverse primer; "P" means a probe.

The PCR amplification procedure used is shown in Table 5:

TABLE 5

Example 2: urothelial cancer tissue and normal human urine sample test

40 cases of urothelial cancer urine samples (40 mL) and 80 cases of control samples (40 mL) (30 healthy persons, 30 cases of benign diseases (kidney stones, prostatic hyperplasia, cystitis, etc.), 20 cases of other cancers (kidney cancer, prostate cancer, endometrial cancer, prostate cancer, etc.), were selected, genomic DNA was extracted, and after conversion to bisDNA by bisulfite, methylation detection was performed on VIM, KCNA3, TMEM220 and PPM1N genes according to the PCR reaction system in example 1. Finally, ct values of real-time PCR of 40 urine samples of the urothelial cancer and 80 urine samples of the control urine to target sequences of the target genes are measured. According to the PCR result (table 6), the critical values of Ct values of all four genes were selected to be ct=41, and as shown in tables 7 to 10, the methylation level of VIM gene was detected with urine with sensitivity and specificity of 90% and 91.25%, respectively. The methylation level of KCNA3 gene, sensitivity and specificity thereof were 92% and 90%, respectively, the methylation level of TMEM220 gene, sensitivity and specificity thereof were 88% and 93.75%, respectively, and the methylation level of PPM1N gene was detected by urine, sensitivity and specificity thereof were 82% and 98.75%, respectively.

Table 6: CT value detection results of VIM, KCNA3, TMEM220 and PPM1N genes in urothelial cancer urine sample and control urine sample

/>

Table 7: detection results of VIM Gene in urothelial cancer sample and control sample

Table 8: detection results of KCNA3 Gene in urothelial cancer sample and control sample

Table 9: detection results of TMEM220 gene in urothelial cancer sample and control sample

Table 10: detection results of genes in urothelial cancer samples and control samples

The above experimental results show that the methylated DNA of the target sequence of the target gene is a marker of urothelial cancer. The detection of the target sequence methylation DNA of the target gene can realize the in-vitro noninvasive detection of the urothelial cancer and can improve the detection rate of the urothelial cancer.

In summary, the composition, the nucleic acid sequence, the kit and the application thereof and the detection method realize in vitro detection of urothelial cancer by using the target sequence methylation biomarker of the target gene by detecting the target sequence of the target gene and the methylated nucleic acid sequence of the fragment thereof, thereby effectively improving the sensitivity and the specificity of in vitro detection of the urothelial cancer.

The above description is only of the preferred embodiments of the present application and is not intended to limit the present application in any way, and any person skilled in the art may make modifications or alterations to the disclosed technical content to the equivalent embodiments. However, any simple modification, equivalent variation and variation of the above embodiments according to the technical substance of the present application still fall within the protection scope of the technical solution of the present application.

Claims

nucleic acid for detecting methylation status of a target gene,

2. The composition of claim 1, wherein the target sequence of the VIM gene is as shown in SEQ ID No. 1 or SEQ ID No. 2 or SEQ ID No. 3 or SEQ ID No. 4 or the target sequence of the VIM gene comprises a sequence as shown in SEQ ID No. 1 or SEQ ID No. 2 or SEQ ID No. 3 or SEQ ID No. 4.

3. The composition of claim 1, wherein the target sequence of the KCNA3 gene is shown as SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8, or the target sequence of the KCNA3 gene comprises a sequence shown as SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8.

4. The composition of claim 1, wherein the target sequence of TMEM220 is as shown in SEQ ID No. 9 or SEQ ID No. 10 or SEQ ID No. 11 or SEQ ID No. 12 or the target sequence of TMEM220 comprises a sequence as shown in SEQ ID No. 9 or SEQ ID No. 10 or SEQ ID No. 11 or SEQ ID No. 12.

5. The composition of claim 1, wherein the target sequence of the PPM1N gene is as shown in SEQ ID No. 13 or SEQ ID No. 14 or SEQ ID No. 15 or SEQ ID No. 16 or the target sequence of the PPM1N gene comprises a sequence as shown in SEQ ID No. 13 or SEQ ID No. 14 or SEQ ID No. 15 or SEQ ID No. 16.

6. The composition of any one of claims 1-5, wherein the nucleic acid for detecting methylation status of a target gene comprises:

a primer which is a fragment of at least 9 nucleotides in a target sequence of the target gene,

the fragment comprises at least one CpG dinucleotide sequence.

7. The composition of any one of claims 1 to 6, wherein the nucleic acid for detecting methylation status of a target gene comprises:

the fragment comprises at least one CpG dinucleotide sequence.

8. The composition of any one of claims 1-7, further comprising:

9. The composition of claim 8, wherein,

10. An oligonucleotide for detecting urothelial cancer in vitro, comprising: