CN117683888A

CN117683888A - Composition for detecting lung cancer and application thereof

Info

Publication number: CN117683888A
Application number: CN202311564281.9A
Authority: CN
Inventors: 聂海珍; 古双臻; 汪亚林; 吴宁宁; 王秀秀; 郭媛媛; 魏闯; 杨亚东; 吴振
Original assignee: Biochain Beijing Science and Technology Inc
Current assignee: Biochain Beijing Science and Technology Inc
Priority date: 2023-11-22
Filing date: 2023-11-22
Publication date: 2024-03-12

Abstract

The present application provides a composition for detecting lung cancer and uses thereof, the composition comprising: a nucleic acid for detecting methylation status of a target gene, wherein the target gene is selected from one or two or three of a SCUBE1 gene, a BCL2L11 gene, and a WDR11 gene. The application also provides a kit comprising the composition and application of the composition in preparing a kit for detecting lung cancer in vitro.

Description

Composition for detecting lung cancer and application thereof

Technical Field

The application belongs to the field of molecular biology, relates to gene detection, and in particular relates to a nucleic acid composition for detecting methylation of lung cancer related genes, and a corresponding kit and application thereof.

Background

The incidence and death rate of lung cancer far exceed those of other cancer diseases and are the first place; in recent years, the incidence and mortality of lung cancer continue to increase. In clinical practice, early lung cancer can be cured, but because early lung cancer symptoms are not obvious, when a patient visits a hospital due to clinical symptoms such as cough, chest pain and the like, most lung tumors reach middle and late stages, the treatment effect is not ideal, and the survival rate of 5 years after operation is less than 10%, so that the realization of early diagnosis and early treatment is a key for improving the survival rate of lung cancer patients.

The current technical means applied to early screening and diagnosis of lung cancer mainly comprise imaging examination, hematological examination, pathological examination and the like, but the means have certain limitations: if lung cancer tissue is obtained through operation or puncture to carry out pathological examination, the lung cancer tissue is the gold standard for lung cancer diagnosis, but the problems of high operation difficulty, high trauma to a patient, tissue detection heterogeneity and the like exist; at present, chest scanning is mainly carried out by using low-dose spiral CT (LDCT), the technology can reduce the overall lung cancer mortality rate by improving the detection rate of early lung cancer, but simultaneously, the higher false positive rate and possible radiation injury and the like are worried; clinical serological tumor markers such as lung cancer five items (CEA, CYFRA21-1, SCC, pro-GRP, NSE) are commonly used as auxiliary diagnostic means of lung cancer, but the traditional serological tumor markers have low detection sensitivity on early lung cancer and cannot meet the requirement of early screening.

In recent years, more and more researches indicate that DNA methylation is closely related to the occurrence and development of diseases such as lung cancer. As one of the important research points in the field of epigenetic science, DNA methylation refers to the process of converting 5 'cytosine in CpG dinucleotides on genomic DNA sequences to 5' methylcytosine under the catalysis of DNA methyltransferases. It has been demonstrated that abnormal hypermethylation of the promoter region of the cancer suppressor gene inhibits transcription of the corresponding cancer suppressor gene, which reduces or silences gene expression, resulting in reduced or absent cancer suppressing function of the gene, and thus promotes the occurrence and development of lung cancer. Abnormal methylation of DNA usually occurs in the ultra-early stage of cancer, is a seed factor for tumor growth, and the methylation state of DNA can also dynamically change along with the development of the course of cancer, so that the growth condition of tumor focus can be directly reflected, and therefore, the early screening and auxiliary diagnosis of lung cancer by using DNA methylation detection has great application potential.

One important way to achieve early screening of lung cancer is liquid biopsy based on genetic sequencing technology, where the samples used for detection are mostly circulating free DNA (cfDNA) in peripheral blood. Part of cfDNA is produced and released during apoptosis or necrosis of cancer cells, and is called circulating tumor DNA (Circulating tumor DNA, ctDNA), and methylation abnormality at specific sites on ctDNA characterizes the occurrence and development of cancer. Therefore, the early screening and auxiliary diagnosis of lung cancer can be realized by taking the blood plasma cfDNA as a detection sample and matching with a methylation gene marker with high sensitivity and high specificity for lung cancer detection.

Disclosure of Invention

The technology clinically applied to early lung cancer screening and diagnosis is mainly low-dose spiral CT (LDCT) of imaging detection technology, but large-scale clinical data analysis shows that LDCT has remarkable effect on reducing the death rate of lung cancer, but has higher false positive rate, so that the risk of overstock to cause overstock exists. In addition, imaging examinations have certain limitations in terms of equipment costs, operating techniques, result interpretation, and radiological hazards.

In addition, traditional serum tumor markers such as lung cancer five items (CEA, CYFRA21-1, SCC, pro-GRP, NSE) are detected, but traditional serum tumor markers such as lung cancer five items (CEA, CYFRA21-1, SCC, pro-GRP, NSE) have lower sensitivity to lung cancer detection, especially early lung cancer detection, and cannot fully meet the requirement of early lung cancer screening.

Therefore, based on the problems existing in the existing lung cancer detection, the purpose of the application is to provide a composition for detecting lung cancer in vitro, a kit and application thereof, and application for detecting lung cancer.

The specific technical scheme of the application is as follows:

1. a composition for detecting lung cancer in vitro, the composition comprising:

nucleic acid for detecting methylation status of a target gene,

wherein the methylation state of the target gene is characterized by methylation of a target sequence of the target gene,

wherein the target gene is selected from one or two or three of a SCUBE1 gene, a BCL2L11 gene and a WDR11 gene.

2. The composition of item 1, wherein the target sequence of the SCUBE1 gene is the sequence set forth in any one of SEQ ID NOs 1 to 4 or comprises the sequence set forth in any one of SEQ ID NOs 1 to 4.

3. The composition of item 1 or 2, wherein the target sequence of the BCL2L11 gene is as set forth in any one of SEQ ID NOs 5 to 8 or comprises a sequence set forth in any one of SEQ ID NOs 5 to 8.

4. The composition of any one of claims 1-3, wherein the target sequence of the WDR11 gene is as set forth in any one of SEQ ID NOs 9-12 or comprises a sequence set forth in any one of SEQ ID NOs 9-12.

5. The composition of any one of items 1 to 4, wherein the nucleic acid for detecting methylation status of a target gene comprises:

a primer that is a fragment of at least 9 nucleotides in a target sequence of the target gene, the fragment comprising at least one CpG dinucleotide sequence.

6. The composition of any one of items 1 to 5, wherein the nucleic acid for detecting methylation status of a target gene comprises:

a probe which is a fragment of at least 15 nucleotides hybridised to the target sequence of the target gene under moderately stringent or stringent conditions,

the fragment comprises at least one CpG dinucleotide sequence.

7. The composition of any one of items 1-6, further comprising:

an agent that converts an unmethylated cytosine base at position 5 of a target sequence of a target gene into uracil.

8. The composition of any one of items 1-7, wherein the nucleic acid for detecting the methylation state of a target gene further comprises:

a blocking agent that preferentially binds to a target sequence in an unmethylated state;

preferably, the sequence of the blocker is selected from the group comprising one or two or three of SEQ ID NO. 22, SEQ ID NO. 23 and SEQ ID NO. 24 or from one or two or three of SEQ ID NO. 22, SEQ ID NO. 23 and SEQ ID NO. 24.

9. The composition according to item 5, wherein,

the at least 9 nucleotide fragment is selected from one or two or three of the sequences shown in SEQ ID NO. 13 and SEQ ID NO. 14, the sequences shown in SEQ ID NO. 15 and SEQ ID NO. 16, and the sequences shown in SEQ ID NO. 17 and SEQ ID NO. 18, or from one or two or three of the sequences shown in SEQ ID NO. 13 and SEQ ID NO. 14, the sequences shown in SEQ ID NO. 15 and SEQ ID NO. 16, and the sequences shown in SEQ ID NO. 17 and SEQ ID NO. 18.

10. The composition of item 6, wherein the fragment of at least 15 nucleotides is selected from one or two or three comprising the sequence set forth in SEQ ID NO. 19, the sequence set forth in SEQ ID NO. 20 and the sequence set forth in SEQ ID NO. 21, or from one or two or three of the sequence set forth in SEQ ID NO. 19, the sequence set forth in SEQ ID NO. 20 and the sequence set forth in SEQ ID NO. 21.

11. An oligonucleotide for detecting lung cancer in vitro, comprising:

a fragment of at least 9 nucleotides of SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof comprising at least one CpG dinucleotide sequence; and/or

A fragment of at least 9 nucleotides of SEQ ID No. 5 or SEQ ID No. 6 or SEQ ID No. 7 or SEQ ID No. 8 or the complement thereof and comprising at least one CpG dinucleotide sequence; and/or

Fragments of at least 9 nucleotides of SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof and comprising at least one CpG dinucleotide sequence.

12. The oligonucleotide of item 11, further comprising:

a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of said SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or

A fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of said SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or

A fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of said SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof and which comprises at least one CpG dinucleotide sequence.

13. The oligonucleotide of item 11 or 12, further comprising:

the sequence of the blocking agent is selected from one or two or three of SEQ ID NO. 22, SEQ ID NO. 23 and SEQ ID NO. 24 or one or two or three of SEQ ID NO. 22, SEQ ID NO. 23 and SEQ ID NO. 24.

14. An oligonucleotide for detecting lung cancer in vitro, comprising:

SEQ ID NO. 13 and SEQ ID NO. 14.

15. The oligonucleotide of claim 14, further comprising:

the sequence of SEQ ID NO. 19;

preferably, it also comprises the sequence of SEQ ID NO. 22.

16. An oligonucleotide for detecting lung cancer in vitro, comprising:

SEQ ID NO. 15 and SEQ ID NO. 16.

17. The oligonucleotide of claim 16, further comprising:

the sequence of SEQ ID NO. 20;

preferably, it also comprises the sequence of SEQ ID NO. 23.

18. An oligonucleotide for detecting lung cancer in vitro, comprising:

SEQ ID NO. 17 and SEQ ID NO. 18.

19. The oligonucleotide of claim 18, further comprising:

the sequence of SEQ ID NO. 21;

preferably, it also comprises the sequence of SEQ ID NO. 24.

20. A kit comprising the composition of any one of claims 1-10 or comprising the oligonucleotide of any one of claims 11-19.

21. The kit of item 20, further comprising at least one additional component selected from the group consisting of:

nucleoside triphosphates, DNA polymerase and buffers required for the function of the DNA polymerase.

22. The kit of item 20 or 21, wherein the sample for detection of the kit comprises: cell lines, histological sections, tissue biopsies/paraffin-embedded tissues, body fluids, faeces, colonic exudates, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof.

23. The kit of any one of items 20-22, further comprising: and (3) a specification.

24. Use of the composition of any one of claims 1-10 or the oligonucleotide of any one of claims 11-19 in the preparation of a kit for detecting lung cancer in vitro.

25. The use of item 24, wherein the kit for in vitro detection of lung cancer detects lung cancer by a method comprising the steps of:

1) Isolating a DNA sample comprising a target sequence of a target gene or a fragment thereof from a biological sample to be tested;

2) Determining the methylation status of the target sequence of the target gene;

3) Judging the state of the biological sample according to the detection result of the methylation state of the target sequence of the target gene, thereby realizing the in vitro detection of lung cancer.

26. The use according to item 25, wherein the method comprises the steps of:

extracting genome DNA of a biological sample to be detected;

treating the extracted genomic DNA with a reagent to convert the unmethylated cytosine base at position 5 to uracil or other bases;

contacting the DNA sample treated by the reagent with a DNA polymerase and a primer of a target sequence of a target gene to perform DNA polymerization reaction;

detecting the amplified product with a probe; and

determining the methylation status of at least one CpG dinucleotide of the target sequence of the target gene based on the presence or absence of the amplification product.

27. The use according to item 26, wherein the reagent is a bisulphite reagent.

28. A method of detecting lung cancer comprising the steps of:

isolating a DNA sample comprising a target sequence of a target gene or a fragment thereof from a biological sample to be tested;

determining the methylation status of the target sequence of the target gene; and

judging the state of a biological sample according to the detection result of the methylation state of the target sequence of the target gene, thereby realizing in-vitro detection of lung cancer;

the target gene is selected from one or two or three of a SCUBE1 gene, a BCL2L11 gene and a WDR11 gene.

29. A method of detecting lung cancer comprising the steps of:

extracting genome DNA of a biological sample to be detected;

detecting the amplified product with a probe; and

determining the methylation status of at least one CpG dinucleotide of the target sequence of the target gene based on the presence or absence of the amplification product;

30. The method of claim 28 or 29, wherein the target sequence of the SCUBE1 gene is as set forth in any one of SEQ ID NOs 1 to 4 or comprises a sequence set forth in any one of SEQ ID NOs 1 to 4.

31. The method of any one of claims 28-30, wherein the target sequence of the BCL2L11 gene is as set forth in any one of SEQ ID NOs 5-8 or comprises a sequence set forth in any one of SEQ ID NOs 5-8.

32. The method of any one of claims 28-31, wherein the target sequence of the WDR11 gene is as set forth in any one of SEQ ID NOs 9-12 or comprises a sequence set forth in any one of SEQ ID NOs 9-12.

33. The method of item 29, wherein the reagent is a bisulphite reagent.

34. The method of item 29, wherein the primer is:

A fragment of at least 9 nucleotides of said SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof comprising at least one CpG dinucleotide sequence; and/or

The fragment of at least 9 nucleotides of SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof and comprising at least one CpG dinucleotide sequence.

35. The method of item 29, wherein the probe is:

36. The method according to item 34, wherein the primer has the sequence shown in SEQ ID NO. 13 and SEQ ID NO. 14, or has the sequence shown in SEQ ID NO. 15 and SEQ ID NO. 16, or has the sequence shown in SEQ ID NO. 17 and SEQ ID NO. 18.

37. The method of item 35, wherein the probe is the sequence set forth in SEQ ID NO. 19, or the sequence set forth in SEQ ID NO. 20, or the sequence set forth in SEQ ID NO. 21.

The application has the following beneficial effects:

the application screens out 3 related markers which can sensitively and specifically detect lung cancer, and determines the methylation region of the related markers. By detecting methylation of target sequences of the SCUBE1 gene, BCL2L11 gene and WDR11 gene, the methylation state of the genes can be sensitively and specifically detected, and thus can be used for detection of peripheral blood episomal DNA. The detection of peripheral blood samples of lung cancer patients and normal control individuals shows that: the composition and the detection method can sensitively and specifically detect lung cancer, thereby ensuring the correctness and reliability of detection results. Therefore, the application provides a composition, a kit and a detection method for detecting lung cancer in vitro, which can conveniently, rapidly and effectively detect lung cancer and have important clinical application value.

The method utilizes the epigenomic and bioinformatics technologies, finds a plurality of methylation genes related to lung cancer by analyzing genome methylation data of the lung cancer, determines a target sequence of methylation abnormality of the methylation genes of the lung cancer, and can sensitively and specifically detect the methylation state of the genes by the target sequence of the methylation genes, so that the method can be used for detecting free DNA of peripheral blood.

The composition is used for screening asymptomatic people in a non-invasive mode, harm caused by invasive detection is reduced, and the composition has higher sensitivity and accuracy and can realize real-time monitoring.

Drawings

FIGS. 1A-1B are schematic representations of amplification using different templates, wherein FIG. 1A is a schematic representation of amplification using BisDNA converted from a mixture of human genomic DNA methyltransferase treated product and normal human WBC cell line genomic DNA as a template and FIG. 1B is a schematic representation of amplification using BisDNA converted from normal human WBC cell line DNA as a template.

Detailed Description

The present application is described in detail below. While specific embodiments of the present application are shown, it should be understood that the present application may be embodied in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the disclosure to those skilled in the art.

Unless otherwise indicated, practice of the present application will employ conventional molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and genetics techniques, which are within the skill of the art. Such techniques are described in detail in the literature as Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al, 1989); oligonucleotide Synthesis (M.J.Gait, 1984); animal Cell Culture (R.I. Freshney, 1987); methods in Enzymology Cluster books (American academic Press Co., ltd.); current Protocols in Molecular Biology (F.M. Ausubel et al, 1987 edition, and periodic updates); PCR The Polymerase Chain Reaction (Mullis et al, 1994). Primers, probes, blockers and kits useful in the present application can be prepared using standard techniques well known in the art.

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

Definition of the definition

"precancerous" in this application means a cell that is at an early stage of, or is prone to be transformed into, a cancer cell. Such cells may exhibit one or more phenotypic traits characteristic of cancer cells.

"stringent hybridization conditions" and "high stringency" in this application refer to conditions under which a probe hybridizes to its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. For detailed guidance on nucleic acid hybridization, reference may be made to Tijssen, biochemical and molecular biological techniques-nucleic acid probe hybridization, "review of hybridization principles and nucleic acid assay strategies. Typically, stringent conditions are those about 5-10deg.C below the melting point (Tm) for a specific nucleic acid at a defined ionic strength pH. At Tm temperatures (at defined ionic strength, pH and nucleic acid concentration), 50% of the probes complementary to the target hybridize uniformly to the target sequence. Stringent conditions can also be achieved with the addition of destabilizing agents. For selective or specific hybridization, the positive signal is twice, preferably 10 times, that of the background hybridization. Exemplary stringent hybridization conditions are as follows: hybridization was performed at 42℃in a solution of 50% formamide, 5 XSSC and 1% SDS, or at 65℃in a solution of 5 XSSC and 1% SDS, followed by washing at 65℃in a solution of 0.2XSSC and 0.1% SDS.

Also, if the polypeptides encoded by the nucleic acids are substantially similar, the nucleic acids are substantially similar even if they are not capable of hybridizing under stringent conditions. In this case, the nucleic acid is typically hybridized under moderately stringent hybridization conditions. As an example, "moderately stringent hybridization conditions" include hybridization in a solution of 40% formamide, 1M sodium chloride and 1% SDS at 37 ℃ and washing in a solution of 1xSSC at 45 ℃. It will be apparent to one of ordinary skill in the art that guidance in achieving the conditions to achieve the same stringency is available in the prior art. For PCR, temperatures around 36℃are typically suitable for low stringency amplification, while annealing temperatures range between 32℃and 48℃based on the length of the primer. For highly stringent PCR amplification, it is typically at 62℃and the annealing temperature for highly stringent hybridization ranges between 50℃and 65℃based on the length and specificity of the primers. For cycling conditions of high stringency and low stringency amplification, typically, include: the denaturation phase is continued for 30 seconds to 2 minutes at 90-95 ℃, the annealing phase is continued for 30 seconds to 2 minutes, and the extension phase is continued for 1 to 2 minutes at about 72 ℃. Tools and guidelines for low and high stringency amplification reactions are available in the prior art.

"oligonucleotide" in this application refers to a molecule consisting of two or more nucleotides, preferably three or more nucleotides, the exact size of which may depend on a number of factors, which in turn are determined by the ultimate function and use of the oligonucleotide. In certain embodiments, the oligonucleotide may comprise a length of 10 nucleotides to 100 nucleotides. In certain embodiments, the oligonucleotides may comprise a length of 10 nucleotides to 30 nucleotides, or may have lengths of 20 and 25 nucleotides. In some particular embodiments, oligonucleotides shorter than these lengths are also suitable.

"primer" in this application means an oligonucleotide capable of acting as a point of initiation of synthesis, whether it is naturally occurring in a purified restriction digest or synthetically produced, when placed under conditions that induce synthesis of a primer extension product complementary to a nucleic acid strand, i.e., in the presence of a nucleotide and an inducer such as a DNA or RNA polymerase, and at a suitable temperature and pH. The primer may be single-stranded or double-stranded and must be long enough to prime the synthesis of the desired extension product in the presence of the primer. The exact length of the primer depends on a variety of factors, including temperature, primer source and method used. For example, for diagnostic and prognostic applications, an oligonucleotide primer will typically contain at least or more than about 9, 10, or 15, or 20, or 25 or more nucleotides, depending on the complexity of the target sequence, but it may contain fewer nucleotides or more nucleotides. Factors involved in determining the appropriate length of the primer are well known to those skilled in the art.

"primer pair" in this application means a primer pair that hybridizes to the opposite strand of a target DNA molecule or to a region of the target DNA flanked by nucleotide sequences to be amplified.

"primer site" in this application refers to a region of target DNA or other nucleic acid to which a primer hybridizes.

The term "probe" as used herein, when referring to a nucleic acid sequence, is used in its ordinary sense to refer to a selected nucleic acid sequence that hybridizes to a target sequence under defined conditions and can be used to detect the presence of the target sequence. Those skilled in the art will appreciate that in some cases, probes may also be used as primers, and primers may be used as probes.

"DNA methylation" in this application refers to the addition of a methyl group to the 5-position of cytosine (C), which is typically (but not necessarily) the case with CpG (cytosine followed by guanine) dinucleotides. As used herein, "increased degree of methylation" or "substantial degree of methylation" refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancerous cell or tissue sample or a DNA sample treated for methylation of DNA residues) is unmethylated, and in certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more C can be methylated, wherein the C at these positions in the control DNA sample is unmethylated.

In embodiments, a variety of different methods may be used to detect DNA methylation changes. Methods for detecting DNA methylation include, for example, methylation-sensitive restriction endonuclease (MSRE) assays using southern or Polymerase Chain Reaction (PCR) assays, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (MS-SnuPE), high Resolution Melting (HRM) assays, bisulfite sequencing, pyrosequencing, methylation-specific single strand conformation assays (MS-SSCA), combinatorial bisulfite restriction assays (COBRA), methylation-specific gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve assays (MS-MCA), methylation-specific high performance liquid chromatography (MS-DHPLC), methylation-specific Microarray (MSO). These assays may be PCR assays, quantitative assays using fluorescent markers or southern blot assays.

"methylation determination" in this application refers to any determination that determines the methylation state of one or more CpG dinucleotide sequences within a DNA sequence.

"detecting" in this application refers to any process of observing a marker or a change in a marker (e.g., a change in the methylation state of a marker or the expression level of a nucleic acid or protein sequence) in a biological sample, whether or not the marker or the change in the marker is actually detected. In other words, the act of detecting the marker or a change in the marker of the sample is "detecting" even if the marker is determined to be absent or below the sensitivity level. The detection may be quantitative, semi-quantitative, or non-quantitative observation, and may be based on comparison to one or more control samples. It is to be understood that detecting lung cancer as disclosed herein includes detecting pre-cancerous cells that begin to develop into, or are about to develop into, or have an increased propensity to develop into, lung cancer cells. Detecting lung cancer may also include detecting a possible probability of death or a possible prognosis of a disease condition.

"homology", "identity" and "similarity" in this application refer to sequence similarity between 2 nucleic acid molecules. The positions in each sequence can be compared to determine "homology", "identity" or "similarity", and the sequences can be aligned for comparison purposes. When an equivalent position in the compared sequences is occupied by the same base, the molecules are identical at that position; when an equivalent site is occupied by the same or a similar amino acid (e.g., similar in steric or charged properties) residue, the molecule may be said to be homologous (similar) at that position. Expression of homology/similarity or percent identity refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences. "unrelated" or "non-homologous" sequences share less than 40% identity, preferably less than 25% identity, with the sequences of the present application. The absence of residues (amino acids or nucleic acids) or the presence of redundant residues also reduces identity and homology/similarity when comparing 2 sequences. In particular embodiments, two or more sequences or subsequences are considered substantially or significantly homologous, similar or identical if their sequences are about 60% identical, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical over a defined region when compared and aligned for maximum correspondence over a comparison window or defined region, as determined using BLAST or BLAST 2.0 sequence comparison algorithms having default parameters described below, or as determined by manual alignment and visual inspection provided on-line by, for example, the national center for biotechnology information (National Center for Biotechnology Information (NCBI)). The definition also relates to or can be used to test the complement of a sequence. Thus, for example, if a nucleotide sequence can be predicted to occur naturally in a DNA duplex, or can occur naturally in the form of one or both of the complementary strands, the nucleotide sequence that is complementary to a specified target sequence or variant thereof is itself considered "similar" to the target sequence, and when reference is made to a "similar" nucleic acid sequence, includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing, to the extent permitted by the context herein. The circumstances in which similarity must be limited to analysis of a single nucleic acid strand sequence may include, for example, detection and quantification of expression of a particular RNA sequence or coding sequence in a cell. The definition also includes sequences with deletions and/or additions, as well as sequences with substitutions. In embodiments, identity or similarity may be over a region of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25 or more nucleotides in length, or over a region of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more than about 100 nucleotides in length.

"amplification" in this application refers to the process of obtaining multiple copies from a particular locus of a nucleic acid, such as genomic DNA or cDNA. Amplification may be accomplished using any of a variety of known means including, but not limited to, polymerase Chain Reaction (PCR), transcription-based amplification, and Strand Displacement Amplification (SDA).

The "fluorescence-based real-time PCR" of the present application means such a method: and adding a fluorescent group into the PCR reaction system, monitoring the whole PCR process in real time by utilizing fluorescent signal accumulation, and finally quantitatively analyzing the unknown template through a standard curve. In this PCR technique, there is a very important concept, the cycle threshold, also called Ct value. C represents Cycle, t represents threshold, and Ct has the meaning of: the number of cycles that the fluorescent signal within each reaction tube experiences when reaching a set threshold. For example, the fluorescence threshold (threshold) is set as follows: the fluorescent signal of the first 15 cycles of the PCR reaction served as the fluorescent background signal, and the default (default) setting of the fluorescent threshold was 10 times the standard deviation of the fluorescent signal of 3-15 cycles.

The "cut off value of real-time PCR" in the present application means a critical Ct value for a biomarker that determines whether a sample is negative or positive. According to some specific real-time aspects of the present application, the "critical Ct value (Cut Off value) is derived based on statistical processing from a certain number of sample data, and may be different depending on the desired sensitivity or specificity requirements.

The "sensitivity" of the present application means the proportion of cancers detected from a certain cancer sample, and the calculation formula is: sensitivity= (detected cancer/all cancers), whereas "specificity" indicates the normal proportion detected in a certain normal human sample, the formula is specificity= (detected negative/total negative).

A "label" or "detectable moiety" in this application is a component that is detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical or other physical means. For example, useful labels include 32P, fluorescent dyes, electron dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxin, or haptens, and proteins that can be prepared to be detectable, e.g., by incorporating a radiolabel into the peptide or for detecting antibodies that specifically react with the peptide.

Nucleic acid molecules can be detected using a variety of different methods. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., southern blot, northern blot, or in situ hybridization). In particular, oligonucleotides (e.g., oligonucleotide primers) capable of amplifying a target nucleic acid may be used in a PCR reaction. The PCR method generally comprises the steps of: obtaining a sample, isolating nucleic acids (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acids with one or more oligonucleotide primers that specifically hybridize to a template nucleic acid under conditions that enable amplification of the template nucleic acid to occur. In the presence of a template nucleic acid, amplification products are produced. Conditions for nucleic acid amplification and detection of amplification products are known to those skilled in the art. Various improvements to the basic PCR technique have been developed, including, but not limited to, anchored PCR, RACE PCR, RT-PCR, and Ligase Chain Reaction (LCR). The primer pairs in the amplification reaction must anneal to the opposite strand of the template nucleic acid and should be kept at a suitable distance from each other so that the polymerase can efficiently polymerize across the region and so that the amplified product can be easily detected, for example, using electrophoresis. For example, oligonucleotide primers may be designed using a computer program such as OLIGO (Molecular Biology Insights inc., cascades, colo.) to aid in designing primers with similar melting temperatures. Typically, the oligonucleotide primer is 9-30 or 40 or 50 nucleotides in length (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length), although the oligonucleotide primer may be longer or shorter as long as appropriate amplification conditions are used.

Detection of the amplification product or hybridization complex is typically accomplished using a detectable label. The term "label", when referring to a nucleic acid, is intended to include direct labeling of the nucleic acid by coupling (i.e., physically linking) a detectable substance to the nucleic acid, as well as indirect labeling of the nucleic acid by reaction with another reagent that directly labels the detectable substance. Detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable prosthetic groups include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; examples of luminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin and aequorin. Examples of indirect labeling include end-labeling a nucleic acid with biotin such that the nucleic acid can be detected with fluorescently labeled streptavidin.

SUMMARY

In one aspect, the present application provides a composition for detecting lung cancer in vitro, the composition comprising a nucleic acid for detecting methylation status within a target sequence of a target gene, wherein the methylation status of the target gene is characterized by methylation of the target sequence of the target gene, wherein the target gene is selected from one or two or three of a SCUBE1 gene, a BCL2L11 gene, and a WDR11 gene.

The application provides a target sequence of a target gene emitting abnormal methylation in lung cancer, which comprises one or two or three target sequences selected from a SCUBE1 gene, a BCL2L11 gene and a WDR11 gene, wherein the target sequence of the SCUBE1 gene is a sequence shown in any one of SEQ ID NOs 1-4 or a sequence shown in any one of SEQ ID NOs 1-4, the target sequence of the BCL2L11 gene is a sequence shown in any one of SEQ ID NOs 5-8 or a sequence shown in any one of SEQ ID NOs 5-8, and the target sequence of the WDR11 gene is a sequence shown in any one of SEQ ID NOs 9-12 or a sequence shown in any one of SEQ ID NOs 9-12.

It will also be appreciated by those skilled in the art that the target sequences of the SCUBE1 gene, BCL2L11 gene and WDR11 gene are not limited to the specific sequences listed above. The target sequence of the SCUBE1 gene should encompass sequences comprising one or two or more nucleotide mutations compared to the sequence set forth in any of SEQ ID NOs 1-4, but which are substantially functionally identical thereto, as well as sequences having 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence set forth in any of SEQ ID NOs 1-4. The target sequence of the BCL2L11 gene should encompass sequences comprising one or two or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs 5-8, but which are substantially functionally identical thereto, as well as sequences having 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs 5-8. The target sequence of the WDR11 gene should encompass sequences comprising one or two or more nucleotide mutations compared to the sequence set forth in any one of SEQ ID NOs 9-12, but which are substantially functionally identical thereto, as well as sequences having 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence set forth in any one of SEQ ID NOs 9-12.

The target sequence (5 '-3') of the SCUBE1 gene is as follows:

GTATGCAGCAACACAGAATAGATTTAAGAACACAAACACCCTGCTAGTTGTAATAAAGACAAAAACGTCTAAAGTTAAAAATCAAACAAACAAATGGAAATGAGGAAGCCTGCATTTTGCCCGGCACTGTAACTCCTGGTTTCACCTGATTTTGCGACTCATATTTCCTCACCTTGATTTTCTCACTAATCAATCAAATTGTTGGAATGACGCAGAGTCTAACTAAGCAACGAGTTAGCACGGAAAGCGCTTTCATGCTGCTGCCCTGCACAGAAGCTGCAAGTTCACACGGAAAGACCCTTTCCGCTGGCTCGATTCCAAAACAGCATCAGCGCCTGAGTCACACAGATAGTGGCGTGCGGTCAACGCTTAACAGCCGGCAGGGGTGGAGGCTGATTTGCAGTATTTACCAATTTACGTGGGATAAATACGCCAGCCACGGCTAATTTC(SEQ ID NO:1)

the sequence (5 '-3') of the target sequence of the SCUBE1 gene after bisulfite treatment is as follows:

GTATGTAGTAATATAGAATAGATTTAAGAATATAAATATTTTGTTAGTTGTAATAAAGATAAAAACGTTTAAAGTTAAAAATTAAATAAATAAATGGAAATGAGGAAGTTTGTATTTTGTTCGGTATTGTAATTTTTGGTTTTATTTGATTTTGCGATTTATATTTTTTTATTTTGATTTTTTTATTAATTAATTAAATTGTTGGAATGACGTAGAGTTTAATTAAGTAACGAGTTAGTACGGAAAGCGTTTTTATGTTGTTGTTTTGTATAGAAGTTGTAAGTTTATACGGAAAGATTTTTTTCGTTGGTTCGATTTTAAAATAGTATTAGCGTTTGAGTTATATAGATAGTGGCGTGCGGTTAACGTTTAATAGTCGGTAGGGGTGGAGGTTGATTTGTAGTATTTATTAATTTACGTGGGATAAATACGTTAGTTACGGTTAATTTT(SEQ ID NO:2)

the reverse complement (5 '-3') of the target sequence of the SCUBE1 gene is as follows:

GAAATTAGCCGTGGCTGGCGTATTTATCCCACGTAAATTGGTAAATACTGCAAATCAGCCTCCACCCCTGCCGGCTGTTAAGCGTTGACCGCACGCCACTATCTGTGTGACTCAGGCGCTGATGCTGTTTTGGAATCGAGCCAGCGGAAAGGGTCTTTCCGTGTGAACTTGCAGCTTCTGTGCAGGGCAGCAGCATGAAAGCGCTTTCCGTGCTAACTCGTTGCTTAGTTAGACTCTGCGTCATTCCAACAATTTGATTGATTAGTGAGAAAATCAAGGTGAGGAAATATGAGTCGCAAAATCAGGTGAAACCAGGAGTTACAGTGCCGGGCAAAATGCAGGCTTCCTCATTTCCATTTGTTTGTTTGATTTTTAACTTTAGACGTTTTTGTCTTTATTACAACTAGCAGGGTGTTTGTGTTCTTAAATCTATTCTGTGTTGCTGCATAC(SEQ ID NO:3)

the sequence (5 '-3') of the reverse complement of the target sequence of the SCUBE1 gene after bisulfite treatment is as follows:

GAAATTAGTCGTGGTTGGCGTATTTATTTTACGTAAATTGGTAAATATTGTAAATTAGTTTTTATTTTTGTCGGTTGTTAAGCGTTGATCGTACGTTATTATTTGTGTGATTTAGGCGTTGATGTTGTTTTGGAATCGAGTTAGCGGAAAGGGTTTTTTCGTGTGAATTTGTAGTTTTTGTGTAGGGTAGTAGTATGAAAGCGTTTTTCGTGTTAATTCGTTGTTTAGTTAGATTTTGCGTTATTTTAATAATTTGATTGATTAGTGAGAAAATTAAGGTGAGGAAATATGAGTCGTAAAATTAGGTGAAATTAGGAGTTATAGTGTCGGGTAAAATGTAGGTTTTTTTATTTTTATTTGTTTGTTTGATTTTTAATTTTAGACGTTTTTGTTTTTATTATAATTAGTAGGGTGTTTGTGTTTTTAAATTTATTTTGTGTTGTTGTATAT(SEQ ID NO:4)

the target sequence (5 '-3') of the BCL2L11 gene is as follows:

CTAGATGGCTGTAAGTGTGCCAACATCTGACCTGTCCCATTGTGTTGTGTTTTGCAGTTGCTGGATTTGTGCGACTCGGTGAAGGATGATGCCCGGAGGGTGATCTCGACCTTTAACATTCCACACACCTACCTCCACGCACCAATCGCCGGAATCTCCAACCCGCGGGCCGCGTGGGCTTTCTACCCTGCACCGCTGCAGCCGCGGCCACGGGAAGAGGCGCGCTCCCGGCGGCCCAAGCTGGGAGCCAAGCTCTAACGGGTGTGGCGGGAAGTGTGGTGGCCCGCCAGCAGCTGCCACGACGCTCGCTCCACCGACGCCCAGAGCTGTGGCCGAGGCCGGGGGCTGGCACCCGCTGGGCCGCCA(SEQ ID NO:5)

the target sequence of the BCL2L11 gene after bisulfite treatment (5 '-3') was as follows:

TTAGATGGTTGTAAGTGTGTTAATATTTGATTTGTTTTATTGTGTTGTGTTTTGTAGTTGTTGGATTTGTGCGATTCGGTGAAGGATGATGTTCGGAGGGTGATTTCGATTTTTAATATTTTATATATTTATTTTTACGTATTAATCGTCGGAATTTTTAATTCGCGGGTCGCGTGGGTTTTTTATTTTGTATCGTTGTAGTCGCGGTTACGGGAAGAGGCGCGTTTTCGGCGGTTTAAGTTGGGAGTTAAGTTTTAACGGGTGTGGCGGGAAGTGTGGTGGTTCGTTAGTAGTTGTTACGACGTTCGTTTTATCGACGTTTAGAGTTGTGGTCGAGGTCGGGGGTTGGTATTCGTTGGGTCGTTA(SEQ ID NO:6)

the reverse complement (5 '-3') of the target sequence of the BCL2L11 gene is as follows:

TGGCGGCCCAGCGGGTGCCAGCCCCCGGCCTCGGCCACAGCTCTGGGCGTCGGTGGAGCGAGCGTCGTGGCAGCTGCTGGCGGGCCACCACACTTCCCGCCACACCCGTTAGAGCTTGGCTCCCAGCTTGGGCCGCCGGGAGCGCGCCTCTTCCCGTGGCCGCGGCTGCAGCGGTGCAGGGTAGAAAGCCCACGCGGCCCGCGGGTTGGAGATTCCGGCGATTGGTGCGTGGAGGTAGGTGTGTGGAATGTTAAAGGTCGAGATCACCCTCCGGGCATCATCCTTCACCGAGTCGCACAAATCCAGCAACTGCAAAACACAACACAATGGGACAGGTCAGATGTTGGCACACTTACAGCCATCTAG(SEQ ID NO:7)

the sequence (5 '-3') of the reverse complement of the target sequence of the BCL2L11 gene after bisulfite treatment is as follows:

TGGCGGTTTAGCGGGTGTTAGTTTTCGGTTTCGGTTATAGTTTTGGGCGTCGGTGGAGCGAGCGTCGTGGTAGTTGTTGGCGGGTTATTATATTTTTCGTTATATTCGTTAGAGTTTGGTTTTTAGTTTGGGTCGTCGGGAGCGCGTTTTTTTTCGTGGTCGCGGTTGTAGCGGTGTAGGGTAGAAAGTTTACGCGGTTCGCGGGTTGGAGATTTCGGCGATTGGTGCGTGGAGGTAGGTGTGTGGAATGTTAAAGGTCGAGATTATTTTTCGGGTATTATTTTTTATCGAGTCGTATAAATTTAGTAATTGTAAAATATAATATAATGGGATAGGTTAGATGTTGGTATATTTATAGTTATTTAG(SEQ ID NO:8)

the target sequence (5 '-3') of WDR11 gene is as follows

GATTCTGGATATTAGCCCTTTGTCAGATGAGTAGGTTGCAAAAATTTTCTCCCATTCTGTAGGTTGACTGTTCACTCTGATGGTAGTTTCTTTTGCTGTGCAGCTCTTTAGTTTAATTAGATAAGGGGATGATCCTAAAGGGACGCAGTGGTCCCGCCCATCGCCGCCTCTACAGGGAGGGAGCCGCGGCCCCGAGCTGGCCACGCGATGGCGCTGTGCACCCGGCCGCGGAGCCCCTGCACGTCCGGCTCCCGCTCGCGCTCTCGGCTCGAGCTCCGGACTCCAGGCTCGGAGCAGGGGTTCGGGCTACGGTTCCCGGCTCCGAGGGACCGCGGGGCTCTCTGCCTGGGAAGGAAGCTTGCGGGCCTCCTCGGGCCTCGCTGCAG(SEQ ID NO:9)

The sequence (5 '-3') of the target sequence of the WDR11 gene after bisulfite treatment is as follows:

GATTTTGGATATTAGTTTTTTGTTAGATGAGTAGGTTGTAAAAATTTTTTTTTATTTTGTAGGTTGATTGTTTATTTTGATGGTAGTTTTTTTTGTTGTGTAGTTTTTTAGTTTAATTAGATAAGGGGATGATTTTAAAGGGACGTAGTGGTTTCGTTTATCGTCGTTTTTATAGGGAGGGAGTCGCGGTTTCGAGTTGGTTACGCGATGGCGTTGTGTATTCGGTCGCGGAGTTTTTGTACGTTCGGTTTTCGTTCGCGTTTTCGGTTCGAGTTTCGGATTTTAGGTTCGGAGTAGGGGTTCGGGTTACGGTTTTCGGTTTCGAGGGATCGCGGGGTTTTTTGTTTGGGAAGGAAGTTTGCGGGTTTTTTCGGGTTTCGTTGTAG(SEQ ID NO:10)

the reverse complement (5 '-3') of the target sequence of the WDR11 gene is as follows:

CTGCAGCGAGGCCCGAGGAGGCCCGCAAGCTTCCTTCCCAGGCAGAGAGCCCCGCGGTCCCTCGGAGCCGGGAACCGTAGCCCGAACCCCTGCTCCGAGCCTGGAGTCCGGAGCTCGAGCCGAGAGCGCGAGCGGGAGCCGGACGTGCAGGGGCTCCGCGGCCGGGTGCACAGCGCCATCGCGTGGCCAGCTCGGGGCCGCGGCTCCCTCCCTGTAGAGGCGGCGATGGGCGGGACCACTGCGTCCCTTTAGGATCATCCCCTTATCTAATTAAACTAAAGAGCTGCACAGCAAAAGAAACTACCATCAGAGTGAACAGTCAACCTACAGAATGGGAGAAAATTTTTGCAACCTACTCATCTGACAAAGGGCTAATATCCAGAATC(SEQ ID NO:11)

the sequence (5 '-3') of the reverse complement of the target sequence of the WDR11 gene after bisulfite treatment is as follows:

TTGTAGCGAGGTTCGAGGAGGTTCGTAAGTTTTTTTTTTAGGTAGAGAGTTTCGCGGTTTTTCGGAGTCGGGAATCGTAGTTCGAATTTTTGTTTCGAGTTTGGAGTTCGGAGTTCGAGTCGAGAGCGCGAGCGGGAGTCGGACGTGTAGGGGTTTCGCGGTCGGGTGTATAGCGTTATCGCGTGGTTAGTTCGGGGTCGCGGTTTTTTTTTTGTAGAGGCGGCGATGGGCGGGATTATTGCGTTTTTTTAGGATTATTTTTTTATTTAATTAAATTAAAGAGTTGTATAGTAAAAGAAATTATTATTAGAGTGAATAGTTAATTTATAGAATGGGAGAAAATTTTTGTAATTTATTTATTTGATAAAGGGTTAATATTTAGAATT(SEQ ID NO:12)

target sequences and related sequences of the SCUBE1 gene, BCL2L11 gene and WDR11 gene are shown in table 1:

table 1: target sequence and related sequence of each gene

Target sequence name	Sequence number
		Target sequence of SCUBE1 gene	SEQ ID NO:1
Sequence of target sequence of SCUBE1 gene after bisulfite treatment	SEQ ID NO:2
		Complementary sequence to target sequence of SCUBE1 gene	SEQ ID NO:3
Sequence complementary to target sequence of SCUBE1 Gene after bisulfite treatment	SEQ ID NO:4
		Target sequence of BCL2L11 gene	SEQ ID NO:5
Target sequence of BCL2L11 gene after bisulphite treatment	SEQ ID NO:6
		Complementary sequence of target sequence of BCL2L11 gene	SEQ ID NO:7
Sequence complementary to target sequence of BCL2L11 Gene after bisulfite treatment	SEQ ID NO:8
		Target sequence of WDR11 Gene	SEQ ID NO:9
Target sequence of WDR11 Gene in sulfurous acidSequence after hydrogen salt treatment	SEQ ID NO:10
		Complementary sequence to target sequence of WDR11 Gene	SEQ ID NO:11
Sequence of complementary sequence of target sequence of WDR11 Gene after bisulfite treatment	SEQ ID NO:12

Preferably, the nucleic acid for detecting methylation status of a gene of interest comprises a fragment of at least 9 nucleotides in a target sequence of the gene of interest, wherein the fragment comprises at least one CpG dinucleotide sequence. In certain preferred embodiments, the nucleic acid for detecting methylation status of a target gene comprises a fragment of at least 9 nucleotides, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides in a sequence that has been bisulfite converted from a target sequence of the target gene, such as by using bisulfite to convert a sample DNA to be tested, wherein the fragment of a nucleotide comprises at least one CpG dinucleotide sequence.

More preferably, the nucleic acid for detecting methylation status of a gene of interest comprises a fragment of at least 15 nucleotides that hybridizes under moderate stringency or stringent conditions to a target sequence of said gene of interest, wherein said fragment of nucleotides comprises at least one CpG dinucleotide sequence. In certain preferred embodiments, the nucleic acid for detecting the methylation state of a target gene, such as by converting a test sample DNA using bisulfite, comprises a fragment of at least 15 nucleotides, preferably a fragment of at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, in a sequence following bisulfite conversion of a target sequence hybridized to the target gene under moderately stringent or stringent conditions, wherein the fragment of nucleotides comprises at least one CpG dinucleotide sequence.

Preferably, the composition further comprises an agent that converts an unmethylated cytosine base at position 5 of the target sequence of the target gene to uracil. More preferably, the reagent is bisulphite.

The nucleic acid used to detect the methylation state of a gene of interest can also include a blocking agent that preferentially binds to DNA in the unmethylated state.

Preferably, the composition comprises one or more of the primers, probes as shown in table 2.

Preferably, the composition comprises one or more of the primers, probes and blocking agent as shown in table 2

TABLE 2 primer, probe and blocker sequences used in this application

Sequence numbering	Sequence name	Specific nucleotide sequence (5 '-3')
			SEQ ID NO:13	SCUBE1_F	TAATTAAATTGTTGGAATGACGTAG
SEQ ID NO:14	SCUBE1_R	CTATACAAAACAACAACATAAAAAC
			SEQ ID NO:19	SCUBE1_P	GTTTAATTAAGTAACGAGTTAGTACGGA
SEQ ID NO:22	SCUBE1_B	GAATGATGTAGAGTTTAATTAAGTAATGAGTTAGTATGG
			SEQ ID NO:15	BCL2L11_F	TTTGTATCGTTGTAGTCGC
SEQ ID NO:16	BCL2L11_R	CTTAACTCCCAACTTAAACC
			SEQ ID NO:20	BCL2L11_P	CGAAAACGCGCCTCTTCCC
SEQ ID NO:23	BCL2L11_B	TAGTTGTGGTTATGGGAAGAGGTGTGTTTTTGGTG
			SEQ ID NO:17	WDR11_F	TCGTTTTTATAGGGAGGG
SEQ ID NO:18	WDR11_R	GAATACACAACGCCATC
			SEQ ID NO:21	WDR11_P	GCGGTTTCGAGTTGGTTAC
SEQ ID NO:24	WDR11_B	GGGAGGGAGTTGTGGTTTTGAGTTGG

"F" in Table 2 represents a forward primer; "R" means the reverse primer; "P" means a probe and "B" means a blocker.

Preferably, the probes used herein and the fluorescent labeling of blocker sequences are as shown in Table 3.

TABLE 3 fluorescent labelling of probe sequences and blocker sequences as used herein

Sequence variation	Sequence name	5' tag	3' tag
				SEQ ID NO:19	SCUBE1_P	FAM	BHQ1
SEQ ID NO:20	BCL2L11_P	FAM	BHQ1
				SEQ ID NO:21	WDR11_P	FAM	BHQ1
SEQ ID NO:22	SCUBE1_B	/	C6
				SEQ ID NO:23	BCL2L11_B	/	C6
SEQ ID NO:24	WDR11_B	/	C6

In certain embodiments, the composition further comprises an agent that converts an unmethylated cytosine base at position 5 of the gene to uracil. Preferably, the agent is bisulphite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In eukaryotic DNA, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because 5-methylcytosine has the same base pairing behavior as cytosine. Furthermore, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification. The most commonly used method for analyzing DNA for the presence of 5-methylcytosine is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, unmethylated cytosines are converted to uracil which corresponds to thymine in pairing behavior; but under these conditions 5-methylcytosine remains unmodified. The original DNA is thus converted in such a way that the 5-methylcytosine, which was originally indistinguishable from cytosine in its hybridization behavior, can now be detected as the only cytosine remaining by conventional known molecular biological techniques, for example by amplification and hybridization. All of these techniques are now fully utilized based on different base pairing properties. Thus, typically, the present application provides for the use of bisulfite technology in combination with one or more methylation assays for determining the methylation status of CpG dinucleotide sequences within a target sequence of a gene of interest. Furthermore, the methods of the present application are suitable for analyzing heterogeneous biological samples, such as low concentrations of tumor cells in blood or stool. Thus, when analyzing the methylation status of CpG dinucleotide sequences in such samples, one skilled in the art can use quantitative assays to determine the methylation level (e.g., percentage, fraction, ratio, proportion or degree) of a particular CpG dinucleotide sequence, rather than the methylation status. Accordingly, the term methylation status or methylation status shall also be taken to mean a value reflecting the methylation status of a CpG dinucleotide sequence.

In another aspect, the present application provides an oligonucleotide for detecting lung cancer in vitro, comprising: a fragment of at least 9 nucleotides of SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof comprising at least one CpG dinucleotide sequence; and/or a fragment of at least 9 nucleotides of SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof comprising at least one CpG dinucleotide sequence; and/or a fragment of at least 9 nucleotides of SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof and comprising at least one CpG dinucleotide sequence.

Preferably the oligonucleotide for in vitro detection of lung cancer comprises: a fragment of at least 9 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof; and/or a fragment of at least 9 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof and comprising at least one CpG dinucleotide sequence; and/or a fragment of at least 9 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof and comprising at least one CpG dinucleotide sequence.

An oligonucleotide for in vitro detection of lung cancer of the present application, further comprising: a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof and which comprises at least one CpG dinucleotide sequence.

Preferably the oligonucleotide for in vitro detection of lung cancer comprises: a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 1 or SEQ ID NO. 2 or SEQ ID NO. 3 or SEQ ID NO. 4 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 5 or SEQ ID NO. 6 or SEQ ID NO. 7 or SEQ ID NO. 8 or the complement thereof and which comprises at least one CpG dinucleotide sequence; and/or a fragment which hybridizes under moderately stringent or stringent conditions to at least 15 nucleotides of the sequence after bisulfite conversion of SEQ ID NO. 9 or SEQ ID NO. 10 or SEQ ID NO. 11 or SEQ ID NO. 12 or the complement thereof and which comprises at least one CpG dinucleotide sequence.

The oligonucleotide for detecting lung cancer in vitro can further comprise: preferably, the sequence of the blocker is selected from the group consisting of one or two or three of SEQ ID NO. 22, SEQ ID NO. 23 and SEQ ID NO. 24 or one or two or three of SEQ ID NO. 22, SEQ ID NO. 23 and SEQ ID NO. 24.

In a specific embodiment, an oligonucleotide for detecting lung cancer in vitro, comprising: SEQ ID NO. 13 and SEQ ID NO. 14. It also includes: SEQ ID NO. 19. It comprises the following steps: SEQ ID NO. 22.

In another specific embodiment, an oligonucleotide for detecting lung cancer in vitro, comprising: SEQ ID NO. 15 and SEQ ID NO. 16. It also includes: SEQ ID NO. 20. It comprises the following steps: SEQ ID NO. 23.

In another specific embodiment, an oligonucleotide for detecting lung cancer in vitro, comprising: the sequences of SEQ ID NO. 17 and SEQ ID NO. 18, further comprising: SEQ ID NO. 21. It comprises the following steps: SEQ ID NO. 24.

In another aspect, the present application provides a kit comprising the composition. The kit further comprises at least one additional component selected from the group consisting of: nucleoside triphosphates, DNA polymerase and buffers required for the function of the DNA polymerase.

Typically, the kit further comprises a container for holding a biological sample of a patient. And, the kit also includes instructions for use and interpretation of the test results.

The application also relates to application of the composition and the oligonucleotide in preparation of a kit for detecting lung cancer in vitro.

The application also relates to the use of one or two or three of the SCUBE1 gene, the BCL2L11 gene and the WDR11 gene in preparing a kit for detecting lung cancer in vitro.

Wherein the SCUBE1 gene (EGF-like 1) is located in the q13.2 region of chromosome 22 of human genome, contains 22 exons, encodes a cell surface glycoprotein, is mainly expressed and secreted in platelet endothelial cells, and is abnormally expressed in various human tumors, such as small cell lung cancer, the high expression of SCUBE1 can inhibit the progress of tumor to a certain extent, and the cancer inhibiting function is exerted.

The BCL2L11 gene (BCL 2-like 11 (apoptosis facilitator)) maps to the q13 region of chromosome 2 of the human genome, encoding a BCL-2 family protein that functions as an apoptosis regulator in the form of a heterologous or homodimer. The protein coded by the BCL2L11 gene comprises Bcl-2homology domain 3 (BH 3) and can interact with other members of the same family to play a role of an apoptosis promoting factor. In addition, there are several studies showing that the methylation level of this gene is characteristically elevated in lung cancer tissues.

The WDR11 gene (WD repeat domain 11) is located in the q26.12 region of human chromosome 10, contains 29 exons, and the encoded protein belongs to WD repeat protein family and participates in a series of cell processes including cell cycle process regulation, signal transduction, apoptosis and the like. Research shows that the gene localization region is a very important cancer suppressor gene with deletion mutation frequently occurring in gliomas and some other tumors.

In yet another aspect, the present application provides a method of detecting lung cancer in vitro, the method comprising the steps of:

1) Isolating a target sequence of a target gene or a fragment thereof in a biological sample to be tested;

According to certain preferred embodiments, the method further comprises the steps of:

1) Extracting genome DNA of a biological sample to be detected;

2) Treating the DNA sample obtained in step 1) with a reagent to convert the 5-unmethylated cytosine base into uracil or another base, i.e., the 5-unmethylated cytosine base of the target sequence of the target gene into uracil or another base, the converted base being different from the 5-unmethylated cytosine base in hybridization performance and being detectable;

3) Contacting the DNA sample treated in step 2) with a DNA polymerase and primers for the target sequence of the target gene such that the target sequence of the treated target gene is amplified to produce amplified products or not; the target sequence of the treated target gene produces amplified products if DNA polymerization occurs; the target sequence of the treated target gene is not amplified if DNA polymerization does not occur;

4) Detecting the amplified product with a probe; and

5) Determining the methylation status of at least one CpG dinucleotide of the target sequence of the target gene based on the presence or absence of the amplification product.

Preferably, typical primers include fragments of the target sequence of the target gene comprising fragments of at least 9 nucleotides that are identical, complementary or hybridize under moderately stringent or stringent conditions to a sequence selected from any one of SEQ ID NOs 1-4, any one of SEQ ID NOs 5-8 or any one of SEQ ID NOs 9-12, respectively.

Preferably, a typical probe comprises a fragment of the target sequence of the target gene comprising a fragment of at least 15 nucleotides which is identical to, complementary to or hybridizes under moderately stringent or stringent conditions to a sequence selected from any one of SEQ ID NOs 1 to 4, any one of SEQ ID NOs 5 to 8 or any one of SEQ ID NOs 9 to 12, respectively.

Preferably, one or more of the primers, probes are as set forth in table 2 above.

And, the contacting or amplifying comprises using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using Polymerase Chain Reaction (PCR), producing an amplification product nucleic acid molecule with a detectable label.

Preferably, the methylation status is determined by means of PCR, such as "fluorescence-based real-time PCR technique", methylation sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation Specific PCR (MSP), and methylation CpG island amplification (MCA), etc., is used to determine the methylation status of at least one CpG dinucleotide of the target sequence of the gene of interest. Among these, the "fluorescence-based real-time PCR" assay is a high throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) techniques, requiring no further manipulation after the PCR step. Briefly, the "fluorescence-based real-time PCR" method starts with a mixed sample of genomic DNA that is converted into a mixed pool of methylation-dependent sequence differences in a sodium bisulfite reaction according to standard procedures. Fluorescence-based PCR was then performed in an "offset" (biased) reaction (using PCR primers overlapping known CpG dinucleotides). Sequence differences can be produced at the amplification level and at the fluorescence detection amplification level. The "fluorescence-based real-time PCR" assay can be used as a quantitative test for methylation status in genomic DNA samples, where sequence discrimination occurs at the level of probe hybridization. In this quantitative format, the PCR reaction provides methylation specific amplification in the presence of fluorescent probes that overlap specific CpG dinucleotides. An unbiased control for the amount of starting DNA is provided by the following reaction: wherein neither the primer nor the probe covers any CpG dinucleotide. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as "TaqMan", "Lightcycler", etc. The TaqMan probe is double labeled with a fluorescent reporter (RTSP ULT 5 rter) and a Quencher (Quencher) and is designed to be specific for a relatively high GC content region such that it melts at a temperature about 10℃higher than the forward or reverse primer during the PCR cycle. This allows the TaqMan probe to remain fully hybridized during the PCR annealing/extension step. When Taq polymerase enzymatically synthesizes a new strand in PCR, it eventually encounters an annealed TaqMan probe. Taq polymerase 5 'to 3' endonuclease activity will then displace the TaqMan probe by digesting it, thereby releasing the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescent detection system. Typical reagents for "fluorescence-based real-time PCR" analysis may include, but are not limited to: target sequence PCR primers for the target gene; a non-specific amplification blocker; taqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; taq polymerase, and the like.

In certain preferred embodiments, the methylation status of at least one CpG dinucleotide in the target sequence of the target gene is determined from the critical Ct value of the real-time PCR reaction. The method for analyzing DNA in the biological sample by utilizing the real-time PCR reaction can conveniently realize the detection of the methylation state of the target sequence of the target gene, and can rapidly and conveniently judge whether the detected sample is positive according to the critical Ct value of the PCR reaction, thereby providing a noninvasive and rapid lung cancer in-vitro detection method.

The biological sample is selected from the group consisting of a cell line, a histological section, a tissue biopsy/paraffin-embedded tissue, a body fluid, stool, a colonic outflow, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof. A preferred biological sample is plasma.

The inventors found that there was a significant difference between the methylation status of target sequences of the SCUBE1 gene, BCL2L11 gene and WDR11 gene in lung cancer tissue and the methylation status of target sequences of said genes of normal lung tissue: in lung cancer tissues, the target sequences of the SCUBE1 gene, BCL2L11 gene and WDR11 gene are methylated, whereas in normal lung tissues, the target sequences of the SCUBE1 gene, BCL2L11 gene and WDR11 gene are not methylated. Therefore, the application provides a method for detecting lung cancer in vitro by detecting methylation status of one or more gene target sequences of SCUBE1 gene, BCL2L11 gene and WDR11 gene in a sample, and the method provided by the application can detect lung cancer noninvasively and rapidly.

Examples

The materials used in the test and the test methods are generally and/or specifically described herein, and in the examples which follow,% represents wt%, i.e., weight percent, unless otherwise specified. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.

Example 1 primer and Probe test

First, screening methylation markers by WGBS sequencing analysis, sequencing and analyzing samples comprising 100 cases of lung cancer and healthy human control plasma samples, 50 cases of lung cancer and paracancerous tissues, and 300 cases of samples. First, a site with a lower methylation level is selected from sequencing information of 100 healthy human control plasma samples, and a threshold value is set as an average methylation level beta<0.055; secondly, lung cancer is carried out on the screened sites with lower methylation level in the control plasma of healthy peopleAnd (3) analyzing the blood plasma and the lung cancer tissues, screening out sites which are different in the lung cancer blood plasma and the healthy human control blood plasma and also different in the lung cancer tissues and the paracancerous tissues, wherein the set threshold value is as follows: beta _{Lung cancer blood plasma} -β _{Control plasma of healthy people} >0.05，β _{Lung cancer tissue} -β _{Tissue beside cancer} >0.05. Finally, carrying out functional annotation on the genes with different methylation levels, screening 20 candidate genes according to other related research reports, and determining 3 specific markers of the SCUBE1 gene, the BCL2L11 gene and the WDR11 gene through wet experiment verification based on a qPCR platform in the later stage.

Primers and probes were designed based on the target sequences of the 3 genes, and the designed primer and probe sequences are shown in Table 2.

The cell line DNA of normal human leukocytes is usually in a low/unmethylated state and can be used as a negative control, with the amount of DNA used in this embodiment being 20 ng/response; the human genome DNA methyltransferase processing product is usually in a high/full methylation state, in this embodiment, the human genome DNA methyltransferase processing product is mixed with the genome DNA of a normal human WBC cell line, the template input amount of each reaction is 350pg and 15.75ng respectively, and the template input amount can be used as a positive reference for detecting the methylation state of a target sequence of a target gene and can be used as a positive control. Firstly, bisulphite conversion is carried out on a DNA sample, and real-time fluorescence PCR amplification is carried out by using the converted BisDNA as a template and using the primer probe. The beta Actin (ACTB) gene is used as an internal reference, a beta actin gene amplicon is created by using a primer complementary to the beta actin gene sequence, and the beta actin gene amplicon is detected with a specific probe. Each sample is subjected to at least one real-time fluorescent PCR, and in some embodiments, two or three real-time PCR assays are performed. The PCR system for the primer probe test is shown in Table 4 below.

TABLE 4 PCR System for primer probe test

	Volume (mul)	Final concentration
			Taq DNA Polymerase(Biochain)	1.2
4.2×buffer(Biochain)	11.9	1×
			Forward primer F (10. Mu.M)	1	200nM
Reverse primer R (10. Mu.M)	1	200nM
			Probe P (10 mu M)	0.75	150nM
Blocking agent B (10. Mu.M)	1	200nM
			Reference gene ACTB forward primer F (10. Mu.M)	0.25	50nM
Reference gene ACTB reverse primer (10 mu M)	0.25	50nM
			Internal reference gene ACTB probe P (10. Mu.M)	0.25	50nM
Template BisDNA	25
			H ₂ O	7.4
Total	50

Note that: "F" represents a forward primer; "R" means the reverse primer; "P" means a probe and "B" means a blocker.

The PCR amplification procedure used was: 94 ℃ for 20min; (65 ℃,5s;62 ℃,30 s-read fluorescent signal; 93 ℃,30 s) 45 cycles; at 40℃for 10s, the results are shown in FIG. 1A when the bisDNA obtained by transforming the mixture of the human genomic DNA methyltransferase treated product and the genomic DNA of the normal human WBC cell line is used as a template, and the results are shown in FIG. 1B when the bisDNA obtained by transforming the genomic DNA of the normal human WBC cell line is used as a template.

As can be seen from FIGS. 1A and 1B, when the bisDNA obtained by transforming the genomic DNA methyltransferase treated product of human body with the genomic DNA of the normal human WBC cell line is used as a template, the SCUBE1 gene, the BCL2L11 gene and the WDR11 gene are all amplified efficiently, whereas when the bisDNA obtained by transforming the genomic DNA of the normal human WBC cell line is used as a template, none of the SCUBE1 gene, the BCL2L11 gene and the WDR11 gene is amplified except for the reference gene ACTB.

EXAMPLE 2 lung cancer tissue and Normal human WBC test

16 lung cancer tissue samples (8 lung adenocarcinoma and 8 lung squamous carcinoma) and 24 normal human WBC samples are selected, genome DNA is extracted, bisulphite is converted into BisDNA, template amounts of 500 pg/reaction of lung cancer tissue and 20 ng/reaction of normal human WBC are used for detecting methylation states of SCUBE1 genes, BCL2L11 genes and WDR11 genes according to a PCR reaction system in example 1 and a reaction program in example 1, ct values of real-time PCR (polymerase chain reaction) of 16 lung cancer tissues and 24 normal human WBC samples on target sequences of target genes are finally measured, ct is less than or equal to 40 according to the PCR result, and critical values of Ct values of three markers are all selected, and sensitivity and specificity are shown in the following table.

TABLE 5 sensitivity of lung cancer tissue and normal human WBC samples

As can be seen from the above table, the sensitivities of the SCUBE1, BCL2L11 and WDR11 genes for detecting lung cancer are respectively 100%, 93.75% and 100%; meanwhile, methylation of target sequences of target genes has good specificity of normal human WBC, and the specificity of detection of the normal human WBC is 100%. Because the markers have higher WBC specificity and lung cancer tissue sensitivity of normal people, and the combined detection of every two or three markers in the three markers can reach 100% of WBC specificity of normal people and 100% of lung cancer tissue sensitivity, the three markers are presumed to be applicable to early screening and real-time monitoring of lung cancer.

EXAMPLE 3 plasma from Lung cancer and normal human plasma testing

Plasma free DNA was extracted from 58 cases of lung cancer (stage 0-II) and 98 cases of normal human plasma samples (3.5 mL), converted to BisDNA by sulfite, and the methylation status of the SCUBE1, BCL2L11, WDR11 genes was examined according to the PCR reaction system and the reaction procedure in example 1. The results are shown in Table 6.

TABLE 6 sensitivity and specificity of single markers and combinations of multiple markers

As can be seen from the table, the sensitivity of detecting lung cancer by using the SCUBE1, BCL2L11 and WDR11 genes is 56.9%, 36.2% and 32.8%, respectively, and the sensitivity of combined detection of the three markers is 72.4%; meanwhile, methylation of target sequences of target genes has good specificity, the specificity of lung cancer detection is 94.9%, 94.9% and 96.9% respectively, and the specificity of combined detection of three markers is 92.8%. .

The above experimental results indicate that the 3 target genes (SCUBE 1, BCL2L11 and WDR 11) selected in the present application are markers for detecting lung cancer methylation. By detecting the target sequence methylated DNA of the target gene, the lung cancer can be detected in vitro in a noninvasive manner, and the detection rate of early lung cancer can be improved.

In summary, the composition, the nucleic acid sequence, the kit and the application thereof and the detection method realize in vitro detection of lung cancer by using the target sequence methylation biomarker of the target gene by detecting the target sequence of the target gene and the methylated nucleic acid sequence of the fragment thereof, thereby effectively improving the sensitivity and the specificity of in vitro detection of lung cancer.

The above description is only of the preferred embodiments of the present application and is not intended to limit the present application in any way, and any person skilled in the art may make modifications or alterations to the disclosed technical content to the equivalent embodiments. However, any simple modification, equivalent variation and variation of the above embodiments according to the technical substance of the present application still fall within the protection scope of the technical solution of the present application.

Claims

nucleic acid for detecting methylation status of a target gene,

2. The composition of claim 1, wherein the target sequence of the SCUBE1 gene is as set forth in SEQ ID NOs:1-4 or a sequence comprising any one of SEQ ID NOs: 1-4; and/or

The target sequence of the BCL2L11 gene is shown as SEQ ID NOs:5-8 or a sequence comprising any one of SEQ ID NOs: 5-8; and/or

The target sequence of the WDR11 gene is shown as SEQ ID NOs:9-12 or a sequence comprising any one of SEQ ID NOs: 9-12.

3. The composition of any one of claims 1-2, wherein the nucleic acid for detecting methylation status of a gene of interest comprises:

a primer which is a fragment of at least 9 nucleotides in a target sequence of the target gene,

the fragment comprises at least one CpG dinucleotide sequence;

preferably, the at least 9 nucleotide fragment is selected from the group consisting of a nucleotide sequence as set forth in SEQ ID NO:13 and SEQ ID NO:14, and the sequence shown in SEQ ID NO:15 and SEQ ID NO:16, and a sequence as set forth in SEQ ID NO:17 and SEQ ID NO:18, or is selected from one or two or three of the sequences set forth in SEQ ID NO:13 and SEQ ID NO:14, and the sequence shown in SEQ ID NO:15 and SEQ ID NO:16, and a sequence as set forth in SEQ ID NO:17 and SEQ ID NO:18, or two or three of the sequences shown in seq id no;

Preferably, the nucleic acid for detecting methylation status of a target gene comprises:

the fragment comprises at least one CpG dinucleotide sequence;

preferably, the at least 15 nucleotide fragment is selected from the group consisting of a fragment comprising the amino acid sequence as set forth in SEQ ID NO:19, the sequence set forth in SEQ ID NO:20 and the sequence shown as SEQ ID NO:21, or is selected from one or two or three of the sequences set forth in SEQ ID NO:19, the sequence set forth in SEQ ID NO:20 and the sequence shown as SEQ ID NO:21, or two or three of the sequences of seq id no;

preferably, it further comprises:

an agent that converts an unmethylated cytosine base at position 5 of a target sequence of a target gene into uracil;

preferably, the nucleic acid for detecting methylation status of a target gene further comprises:

preferably, the sequence of the blocker is selected from the group comprising the amino acid sequence as set forth in SEQ ID NO: 22. SEQ ID NO:23 and SEQ ID NO:24 or two or three or are selected from the group consisting of SEQ ID NOs: 22. SEQ ID NO:23 and SEQ ID NO:24, or two or three thereof.

4. An oligonucleotide for detecting lung cancer in vitro, comprising:

SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or a fragment of at least 9 nucleotides in its complement comprising at least one CpG dinucleotide sequence; and/or

SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8 or a fragment of at least 9 nucleotides in its complement comprising at least one CpG dinucleotide sequence; and/or

SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11 or SEQ ID NO:12 or a complementary sequence thereof and comprises at least one CpG dinucleotide sequence.

5. The oligonucleotide of claim 4, further comprising:

hybridization to the SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4 or a fragment of at least 15 nucleotides in its complement comprising at least one CpG dinucleotide sequence; and/or

Hybridization to the SEQ ID NO:5 or SEQ ID NO:6 or SEQ ID NO:7 or SEQ ID NO:8 or a fragment of at least 15 nucleotides in its complement comprising at least one CpG dinucleotide sequence; and/or

Hybridization to the SEQ ID NO:9 or SEQ ID NO:10 or SEQ ID NO:11 or SEQ ID NO:12 or a fragment of at least 15 nucleotides in a complementary sequence thereof and comprising at least one CpG dinucleotide sequence;

preferably, it further comprises:

6. An oligonucleotide for detecting lung cancer in vitro, comprising:

SEQ ID NO:13 and SEQ ID NO:14, preferably, it further comprises:

SEQ ID NO: 19;

preferably, it further comprises SEQ ID NO: 22.

7. An oligonucleotide for detecting lung cancer in vitro, comprising:

SEQ ID NO:15 and SEQ ID NO:16, preferably, it further comprises:

SEQ ID NO: 20;

preferably, it further comprises SEQ ID NO: 23.

8. An oligonucleotide for detecting lung cancer in vitro, comprising:

SEQ ID NO:17 and SEQ ID NO: 18; preferably, it further comprises:

SEQ ID NO:21, a sequence of seq id no;

preferably, it further comprises SEQ ID NO: 24.

9. A kit comprising the composition of any one of claims 1-3 or comprising the oligonucleotide of any one of claims 4-8;

preferably, it further comprises at least one other component selected from the group consisting of:

nucleoside triphosphates, DNA polymerase and buffers required for the function of the DNA polymerase;

preferably, the sample for detection of the kit comprises: cell lines, histological sections, tissue biopsies/paraffin-embedded tissues, body fluids, faeces, colonic exudates, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof;

preferably, it further comprises: and (3) a specification.

10. Use of a composition according to any one of claims 1-3 or an oligonucleotide according to any one of claims 4-8 in the preparation of a kit for detecting lung cancer in vitro;

preferably, the kit for in vitro detection of lung cancer detects lung cancer by a method comprising the steps of:

3) Judging the state of a biological sample according to the detection result of the methylation state of the target sequence of the target gene, thereby realizing in-vitro detection of lung cancer;

preferably, the method comprises the steps of:

extracting genome DNA of a biological sample to be detected;

detecting the amplified product with a probe; and

preferably, the reagent is a bisulphite reagent.