RU2717975C2 - Method for estimating cross-contamination of samples in ngs-data on analysis of high-polymorphic loci - Google Patents

Method for estimating cross-contamination of samples in ngs-data on analysis of high-polymorphic loci Download PDF

Info

Publication number
RU2717975C2
RU2717975C2 RU2018128649A RU2018128649A RU2717975C2 RU 2717975 C2 RU2717975 C2 RU 2717975C2 RU 2018128649 A RU2018128649 A RU 2018128649A RU 2018128649 A RU2018128649 A RU 2018128649A RU 2717975 C2 RU2717975 C2 RU 2717975C2
Authority
RU
Russia
Prior art keywords
contamination
samples
analysis
data
ngs
Prior art date
Application number
RU2018128649A
Other languages
Russian (ru)
Other versions
RU2018128649A (en
RU2018128649A3 (en
Inventor
Екатерина Феликсовна Рожавская
Original Assignee
Общество с ограниченной ответственностью "ОНКОДИАГНОСТИКА АТЛАС"
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Общество с ограниченной ответственностью "ОНКОДИАГНОСТИКА АТЛАС" filed Critical Общество с ограниченной ответственностью "ОНКОДИАГНОСТИКА АТЛАС"
Priority to RU2018128649A priority Critical patent/RU2717975C2/en
Publication of RU2018128649A publication Critical patent/RU2018128649A/en
Publication of RU2018128649A3 publication Critical patent/RU2018128649A3/ru
Application granted granted Critical
Publication of RU2717975C2 publication Critical patent/RU2717975C2/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

FIELD: medicine.
SUBSTANCE: invention relates to molecular biology and diagnostic medicine. Described is a method for determining contamination of samples with DNA admixture. Using 3 pairs of primers for analysis of polymorphisms with higher discriminating force: D1S1655, D12S381, D12S392. Primers have sequences:
D1S1655 GAGATTCAAGAATCACGGAACC
GTGTTTGCAGTGGGGTCAACT D12S381 AACAGGATCAATGGATGCAT
TGGCTTTGTTTCCTGGACTG D12S392 AACAGGTGCAATGGATGCAT
AGCCTCCATATGGACTGAGC
See table.
EFFECT: invention can be used to determine in data of high-efficiency sequencing of signs of cross contamination of samples and/or contamination of samples of extraneous human DNA.
1 cl

Description

Изобретение относится к области молекулярной биологии и диагностической медицины и может быть использовано для определения в данных высокопроизводительного секвенирования признаков перекрестной контаминации образцов и/или загрязнения образцов посторонней ДНК человека.The invention relates to the field of molecular biology and diagnostic medicine and can be used to determine in the data of high throughput sequencing signs of cross-contamination of samples and / or contamination of samples of extraneous human DNA.

Ближайшим аналогом (прототипом) является The Ion AmpliSeq™ Sample ID Panel-панель для определения генетических полиморфизмов человека, состоящая из 9 специально созданных пар праймеров, которые могут быть добавлены реакцию мультиплексной ПЦР при подготовки таргетной библиотеки ДНК, чтобы создать уникальный идентификатор образца. Этот идентификатор далее распознается на этапе анализа результатов секвенирования.The closest analogue (prototype) is The Ion AmpliSeq ™ Sample ID Panel for determining human genetic polymorphisms, consisting of 9 specially designed pairs of primers that can be added to the multiplex PCR reaction when preparing a targeted DNA library to create a unique sample identifier. This identifier is further recognized in the analysis step of the sequencing results.

Дискриминирующая сила прототипа рассчитана как 4641, в случае если все 9 пар праймеров сработали корректно.The discriminating power of the prototype is calculated as 4641, if all 9 pairs of primers worked correctly.

В отличие от прототипа изобретение включает не более 3 пар праймеров и направлено на анализ полиморфизмов с большей дискриминирующей силой: D1S1655, D12S381, D12S392.Unlike the prototype, the invention includes no more than 3 pairs of primers and is aimed at the analysis of polymorphisms with greater discriminatory power: D1S1655, D12S381, D12S392.

Их амплификация в составе мультиплексной панели осуществляется с помощью праймеров следующих последовательностей:Their amplification as part of the multiplex panel is carried out using primers of the following sequences:

Figure 00000001
Figure 00000001

Claims (1)

Способ определения контаминации образцов примесью ДНК другого (не исследуемого индивида) человека, включающий добавление специфических олигонуклеотидных праймеров для амплификации одного или нескольких локусов D1S1655, D12S381, D12S392 в реакцию таргетного обогащения ДНК-библиотек, с последующей идентификацией аллелей STR-локусов по длине секвенированных фрагментов; контаминация регистрируется, если по какому-либо из локусов наблюдается более 2 аллелей или доля любого аллеля конкретного локуса в прочтениях составляет менее 25%.A method for determining the contamination of samples with a DNA impurity of another (non-studied individual) person, comprising adding specific oligonucleotide primers to amplify one or more D1S1655, D12S381, D12S392 loci in the target enrichment reaction of DNA libraries, followed by identification of STR locus fragment alleles by length of sec; contamination is detected if at any locus more than 2 alleles are observed or the proportion of any allele of a particular locus in the readings is less than 25%.
RU2018128649A 2018-08-06 2018-08-06 Method for estimating cross-contamination of samples in ngs-data on analysis of high-polymorphic loci RU2717975C2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
RU2018128649A RU2717975C2 (en) 2018-08-06 2018-08-06 Method for estimating cross-contamination of samples in ngs-data on analysis of high-polymorphic loci

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
RU2018128649A RU2717975C2 (en) 2018-08-06 2018-08-06 Method for estimating cross-contamination of samples in ngs-data on analysis of high-polymorphic loci

Publications (3)

Publication Number Publication Date
RU2018128649A RU2018128649A (en) 2020-02-06
RU2018128649A3 RU2018128649A3 (en) 2020-02-06
RU2717975C2 true RU2717975C2 (en) 2020-03-27

Family

ID=69415785

Family Applications (1)

Application Number Title Priority Date Filing Date
RU2018128649A RU2717975C2 (en) 2018-08-06 2018-08-06 Method for estimating cross-contamination of samples in ngs-data on analysis of high-polymorphic loci

Country Status (1)

Country Link
RU (1) RU2717975C2 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2208645C1 (en) * 2002-08-28 2003-07-20 Черкасов Евгений Геннадьевич Method of detection of bacterial blood contamination
RU2307167C2 (en) * 2005-02-21 2007-09-27 Рамиль Ришадович Вафин Method for protection of rt-pcr from contamination by amplification products based on destructive action of uracyl dna glycosylase
EP2098599A1 (en) * 2008-03-05 2009-09-09 Deutsches Krebsforschungszentrum, Stiftung des öffentlichen Rechts Composition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2208645C1 (en) * 2002-08-28 2003-07-20 Черкасов Евгений Геннадьевич Method of detection of bacterial blood contamination
RU2307167C2 (en) * 2005-02-21 2007-09-27 Рамиль Ришадович Вафин Method for protection of rt-pcr from contamination by amplification products based on destructive action of uracyl dna glycosylase
EP2098599A1 (en) * 2008-03-05 2009-09-09 Deutsches Krebsforschungszentrum, Stiftung des öffentlichen Rechts Composition comprising an oligonucleotide mixture for the detection of contaminations in cell cultures

Also Published As

Publication number Publication date
RU2018128649A (en) 2020-02-06
RU2018128649A3 (en) 2020-02-06

Similar Documents

Publication Publication Date Title
Wang et al. Developmental validation of the GlobalFiler® Express PCR Amplification Kit: a 6-dye multiplex assay for the direct amplification of reference samples
EP2660331B1 (en) Method for single cell genome analysis and kit therefor
CN105339508B (en) Multiple DNA typing method and kit for HLA gene
EP2735617A1 (en) Method and kit for dna typing of hla gene
JP2009502137A (en) Method for rapid identification and quantification of nucleic acid variants
JP2005504508A5 (en)
US20160208240A1 (en) Ngs workflow
Pun et al. Species identification in mammals from mixed biological samples based on mitochondrial DNA control region length polymorphism
Belokon et al. Development of microsatellite genetic markers in Siberian stone pine (Pinus sibirica Du Tour) based on the de novo whole genome sequencing
CN109486964B (en) Microsatellite rapid detection method for individual identification and paternity test of donkeys
US20170137807A1 (en) Improved ngs workflow
RU2717975C2 (en) Method for estimating cross-contamination of samples in ngs-data on analysis of high-polymorphic loci
JP2007202552A (en) Method and composition for assaying point mutation and/or large-scale alteration in nucleic acid and use thereof in diagnosis of genetic disease and cancer
WO2005075678A1 (en) Determination of genetic variants in a population using dna pools
Krüger et al. Genetic fingerprinting using microsatellite markers in a multiplex PCR reaction: a compilation of methodological approaches from primer design to detection systems
Stoeckle et al. Identification of 18 polymorphic microsatellite loci in the spruce bark beetle Ips typographus (Coleoptera: Scolytidae) using high-throughput sequence data
Tahir et al. A panel of microsatellite markers for genetic diversity and parentage analysis of dog breeds in Pakistan.
Mellet et al. HLA typing: Conventional techniques v. next-generation sequencing
Bakar et al. Optimisation of polymerase chain reaction conditions to amplify D-loop region in the Malaysian mousedeer genomic DNA
KR20090028894A (en) Method for identification korean cattle using multiplex pcr
Chen et al. Development of microsatellite markers for Suriana maritima (Surianaceae) using next-generation sequencing technology
Dubey et al. A pilot study of DNA yield from bloodstains on various surfaces using Phenol chloroform isoamyl alcohol (PCIA) and Chelex DNA extraction methods
KR101557407B1 (en) Method and Kit for identification of Korean cattle
RU2709174C1 (en) Method for differentiating legionella pneumophila strains by molecular-genetic typing
US11028442B2 (en) Simultaneous detection of multiple nucleic acid templates using modified primers