RU2628504C2 - Methods of increasing yield of agricultural crops resistant to 2,4-d - Google Patents

Abstract

FIELD: agriculture.

SUBSTANCE: to increase the yield of soybean plants resistant to 2.4-D, they are treated with 2.4-D at the growth stage of V3 and R2 with the application rate from 1000 to 2000 g ke/ha. To increase the yield of a soybean plant resistant to 2.4-D: (a) soybean cells are transformed with the molecule of a nucleic acid comprising a nucleotide sequence encoding aryloxyalkanoate dioxygenase (AAD); (b) transformed cells undergo the selection; (c) soybean plants are regenerated from the transformed cells; and (d) 2.4-Dis applied at the growth stage of V3 and R2 of a 2.4-D-resistant soybean plant which is treated with 2.4-D at the application rate from 1000 to 2000 g ke/ha.

EFFECT: invention allows to increase the soybean crop capacity.

18 cl, 3 dwg, 44 tbl, 24 ex

Description

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims priority on provisional application US No. 61/656546, registered June 7, 2012, a description of which, therefore, is expressly incorporated by reference in full.

INCLUSION OF MATERIAL SUBMITTED ELECTRONICALLY AS A LINK

Included in its entirety as a reference is a machine-readable list of sequences filed simultaneously with the application and defined as follows: one 11342 byte ASCII file (text file) called "72747_ST25.txt" created on May 13, 2013.

BACKGROUND OF THE INVENTION

Weeds can quickly deplete soil nutrients needed for crops and other desired plants. There are many types of herbicides currently used for weed control. One of the extremely popular herbicides is glyphosate.

Crops such as corn, soy, canola, cotton, sugar beets, wheat, lawn grass and glyphosate resistant rice have been developed. Thus, fields with actively growing glyphosate resistant corn, for example, can be sprayed to control weeds without significant damage to the corn plants.

With the introduction of genetically engineered glyphosate-resistant crops (GTC) in the mid-1990s, farmers received a simple, convenient, flexible, and inexpensive tool to control a wide range of broad-leaved and grassy weeds, unparalleled in agriculture. Thus, the producers quickly adopted the GTC and in many cases abandoned many of the best generally accepted agronomic methods, such as crop rotation, crop rotation combined with the action of herbicides, the use of a tank mixture, the introduction of mechanical control along with the chemical and cultural control of weeds. Glyphosate tolerant soybeans, cotton, corn, and canola are commercially available in the United States and other areas of the Western Hemisphere. More and more GTCs (such as wheat, rice, sugar beets, lawn grass, etc.) are ready for implementation, pending adoption in the global market. Many other glyphosate-resistant species are in the stage from experiment to development (e.g. alfalfa, sugarcane, sunflower, beets, peas, carrots, cucumbers, lettuce, onions, strawberries, tomatoes and tobacco; forestry species such as poplar and liquidambar; and horticultural species such as marigolds, petunia and begonia; see website "isb.vt.edu/cfdocs/fieldtestsl.cfm, 2005"). In addition, the cost of glyphosate in recent years has dropped significantly to the point that several common weed control programs can effectively compete in price and performance with glyphosate-GTC systems.

Glyphosate has been used successfully for weed control in other non-agricultural areas for total weed control for over 15 years. In many cases, as with GTC, glyphosate is used 1-3 times a year for 3, 5, 10, up to 15 years in a row. These circumstances have led to excessive trust in glyphosate and GTC technology and heavy selection pressure for local weed species in favor of plants that are naturally more resistant to glyphosate or have developed a mechanism of resistance to glyphosate herbicidal activity.

Extensive use of weed control programs only with glyphosate results in the selection of glyphosate-resistant weeds and is selective for propagation of weed species that are naturally more resistant to glyphosate than most target species (i.e. shifts in weed populations). (Ng et al., 2003; Simarmata et al, 2003; Lorraine-Colwill et al, 2003; Sfiligoj, 2004; Miller et al, 2003; Heap, 2005; Murphy et al., 2002; Martin et al., 2002) . Although glyphosate has been widely used around the world for more than 15 years, it is reported that only a small number of weeds have developed resistance to glyphosate (Heap, 2005); however, most of them have been identified in the last 3-5 years. Resistant weeds include grassy and broad-leaved species - Lolium rigidum, Lolium multiflorum, Eleusine indica, Ambrosia artemisiifolia, Conyza canadensis, Conyza bonariensis and Plantago lanceolata. In addition, weeds, previously not an agronomic problem before the widespread use of GTCs, are now becoming more common and difficult to control for GTCs, which occupy> 80% acres of cotton and soy in the USA and> 20% acres of corn in the USA (Gianessi, 2005) . These shifts in weed populations predominantly (but not exclusively) occur in hard-to-control broadleaf weeds. Some examples include the species Ipomoea, Amaranthus, Chenopodium, Taraxacum and Commelina.

In areas where farmers are confronted with glyphosate-resistant weeds or shifts towards more difficult-to-control weed species, farmers can compensate for the inadequate action of glyphosate by using it in a tank mix or by replacing other herbicides with which to control lost weeds. One of the most popular and effective agents for use in tank mixtures for controlling broad-leaved wild plants in many cases is 2,4-dichlorophenoxyacetic acid (2,4-D). 2,4-D has been used in agronomy and non-agricultural conditions for a wide range of applications to control broadleaf weeds for over 60 years. Certain cases of resistant species have been reported, but 2,4-D remains one of the most widely used herbicides worldwide. A limitation on the further use of 2,4-D is that its selectivity in the case of dicotyledonous crops such as soybean or cotton is very poor, and thus, 2,4-D is generally not used on (and, usually not near) sensitive dicotyledonous crops. In addition, the use of 2,4-D in the case of herbaceous crops is to some extent limited by the nature of the damage to crops that can occur. 2,4-D in combination with glyphosate is used to provide a more reliable burndown treatment before planting soybean and cotton with zero tillage; however, due to the sensitivity of these dicotyledonous species to 2,4-D, this burndown treatment must be carried out at least 14-30 days before planting (Agriliance, 2003).

2,4-D belongs to the phenoxyacid class of herbicides, as does MCPA. 2,4-D is used in the case of many monocotyledonous crops (such as corn, wheat and rice) for the selective control of broadleaf weeds without significant damage to the desired crops. 2,4-D is a synthetic auxin derivative that acts by disrupting the regulation of normal cell-hormonal homeostasis and inhibiting balanced, controlled growth; however, the exact mechanism of action is still unknown. Triclopyr and fluroxypyr are pyridyloxyacetic acid herbicides, the mechanism of action of which is also the same as that of synthetic auxin.

These herbicides have different levels of selectivity for specific plants (for example, dicotyledonous plants are more sensitive than herbaceous plants). Differences in metabolism in different plants are one of the explanations for different levels of selectivity. Basically, plants metabolize 2,4-D slowly, so the different responses of plants to 2,4-D are more likely to be explained by the different activity at the target sites (WSSA, 2002). 2,4-D metabolism in plants typically occurs through a two-phase mechanism, usually hydroxylation, followed by conjugation with amino acids or glucose (WSSA, 2002).

Over time, an alternative and effective way of degradation of this particular xenobiotic has appeared in the populations of microorganisms, leading to the complete mineralization of 2,4-D. Subsequent application of the herbicide results in the selection of microorganisms that can use the herbicide as a carbon source for growth, providing them with a competitive advantage in the soil. For this reason, the currently compiled 2,4-D has a relatively short half-life in the soil, and no significant transient effects were observed with respect to subsequent crops. This increases the applicability of 2,4-D as a herbicide.

One of the organisms subjected to extensive research into its ability to degrade 2,4-D is Ralstonia eutropha (Streber et al., 1987). The coding gene at the first enzymatic stage of the mineralization cycle is tfdA. See US Patent No. 6153401 and GENBANK Reg. No. M16730. TfdA catalyzes the conversion of 2,4-D acid to dichlorophenol (DCP) through the reaction of α-ketoglutarate-dependent dioxygenase (Smejkal et al., 2001). DCP has a low herbicidal activity compared to 2,4-D. TfdA is used in transgenic plants to confer resistance to 2,4-D dicotyledonous plants (e.g. cotton and tobacco), normally sensitive to 2,4-D (Streber et al. (1989), Lyon et al. (1989), Lyon (1993) and U.S. Patent No. 5,608,147).

A large number of tfdA-type genes encoding proteins capable of degrading 2,4-D are identified in the environment and deposited in the Genbank database. Many homologues are similar to tfdA (> 85% amino acid identity) and have enzymatic properties similar to tfdA. However, there are a number of homologs that have significantly less identity with tfdA (25–50%), but have characteristic residues associated with α-ketoglutarate-dependent Fe ^{+ 2} -dioxigenases. Thus, the substrate specificities of these divergent dioxygenases are not clear.

One unique example of low homology with respect to tfdA (31% amino acid identity) is sdpA from Delftia acidovorans (Kohler et al., 1999, Westendorf et al., 2002, Westendorf et al., 2003). It has been shown that this enzyme catalyzes the first stage in the mineralization of (S) -dichloroprop (and other (S) -phenoxypropionic acids), as well as 2,4-D (phenoxyacetic acid) (Westendorf et al., 2003). To date, no use of this gene in plant transformation has been reported.

The development of new technology for herbicide-resistant crops (HTC) has limited success, mainly because of the efficiency, low cost and convenience of GTC. Thus, among manufacturers there is a very high level of implementation of GTC. This leads to low motivation for developing new HTC technologies.

Aryloxyalkanoate chemical substructures are common in many commercial herbicides, including phenoxyacetate auxins (such as 2,4-D and dichloroprop), pyridyloxyacetate auxins (such as fluroxypyr and triclopyr), aryloxyphenoxypropionate (AOPP) acetylase carboxy inhibitors (acetylase inhibitors) haloxifop, quisalofop, and diclofop) and 5-substituted phenoxyacetate protoporphyrinogen oxidase IX inhibitors (such as piraflufen and flumiclorac). However, these classes of herbicides are completely different, and in the modern literature there is no evidence of common degradation routes among these classes of chemicals. A multifunctional enzyme for the degradation of herbicides covering many types of action has recently been described (PCT US / 2005/014737; registered May 2, 2005).

SUMMARY OF THE INVENTION

The present invention relates to methods for increasing plant height and / or yield of crops resistant to the 2,4-D herbicide by treating 2,4-D plants at application rates that are not harmful to the plants. In particular, the invention relates to a method using 2,4-D treatment to increase the yield of crops expressing the AAD-12 gene for resistance to 2,4-D. This invention further relates to the use of 2,4-D to improve the productivity of 2,4-D resistant crops. The provided method is of particular interest for the processing of agricultural plants, including corn, soy, winter and spring rape, (canola), sugar beets, wheat, sunflower, barley and rice.

In some embodiments, 2,4-D resistant crops are transgenic crops transformed with aryloxy alkanoate dioxygenase (AAD). In a further embodiment, the aryloxyalkanoate dioxygenase (AAD) is AAD-1 or AAD-12. AAD-1 was previously described in US patent 2009/0093366, and AAD-12 was previously described in WO 2007/053482, the entire contents of which are incorporated herein by reference.

The yield-enhancing effect of 2,4-D treatment can be observed at application rates from 25 g ke / ha to 5000 g ke / ha, or from 100 g ke / ha to 2500 g ke / ha, or, in particular, from 1000 g ke / ha up to 2000 g ke / ha. In one embodiment, between 1000 g ke / ha and 1,500 g ke / ha 2,4-D are used. In another embodiment, from 2000 g ke / ha to 2500 g ke / ha are used. In addition, this yield-enhancing effect of 2,4-D treatment is particularly pronounced when 2,4-D is applied in a phase of 2 to 8 crop leaves before flowering. However, the required application rate and / or the growth phase of the crop varies depending on the plants, their growth and climatic conditions.

The term "increase" in yield means that the yield of a plant is increased by 50% or more. In one embodiment, the yield increase is at least 10%. In another embodiment, the yield increase is at least 20%. In another embodiment, the yield increase is from 10% to 60%. In another embodiment, the yield increase is from 20% to 50%. In another embodiment, the increase in yield is statistically significant. Growth enhancing 2,4-D activity against 2,4-D resistant crops can be measured in field trials or in growing experiments. As a rule, it is known about a herbicide with a different mechanism of action, whether it has an adverse effect on yield or does not affect yield.

One aspect relates to a method for increasing the yield of 2,4-D-resistant crops, comprising treating the plants with a stimulating amount of a herbicide containing an aryloxy alkanoate residue.

In one embodiment, 2,4-D resistant crops are transgenic plants transformed using aryloxyalkanoate dioxygenase (AAD). In a further embodiment, the aryloxyalkanoate dioxygenase (AAD) is AAD-1 or AAD-12. In another embodiment, the herbicide containing the aryloxyalkanoate residue is a phenoxy herbicide or phenoxyacetic herbicide. In a further embodiment, the herbicide containing the aryloxy alkanoate residue is 2,4-D. In a further embodiment, 2,4-D contains 2,4-D-choline or 2,4-D-dimethylamine (DMA).

In one embodiment, transgenic plants transformed using aryloxyalkanoate dioxygenase (AAD) are selected from cotton, soy, and canola. In another embodiment, the treatment is carried out at least once at a rate of application of 2,4-D, also used to control weeds. In another embodiment, the treatment is carried out twice at a rate of application of 2,4-D, also used to control weeds. In a further embodiment, 2,4-D is applied to soybean growth phases V3 and R2 with resistance to 2,4-D. In another embodiment, the treatment is carried out at least three times at a rate of application of 2,4-D, also used to control weeds. In another embodiment, a herbicide containing an aryloxy alkanoate residue reaches 2,4-D resistant crops by root uptake.

In another embodiment, for controlling weeds, 2,4-D resistant crops are also treated with a herbicide other than 2,4-D. In a further embodiment, the herbicide other than 2,4-D is a phosphoric herbicide or an aryloxyphenoxypropionic herbicide. In a further embodiment, the phosphoric herbicide includes glyphosate, glufosinate, derivatives thereof, or combinations thereof. In a further embodiment, the phosphoric herbicide is in the form of an ammonium salt, an isopropylammonium salt, an isopropylamine salt or a potassium salt. In another embodiment, the phosphorus herbicide reaches 2,4-D resistant crops through root uptake. In another embodiment, the aryloxyphenoxypropionic herbicide includes chlorazifop, fenoxaprop, fluazifop, haloxifop, quisalofop, derivatives thereof, or combinations thereof. In a further embodiment, the aryloxyphenoxypropionic herbicide reaches 2,4-D resistant crops through root uptake.

In one embodiment, 2,4-D resistant crops are treated at least once at a dose of 25 g ke / ha to 5,000 g ke / ha 2,4-D. In another embodiment, 2,4-D resistant crops are treated at least once at a dose of 100 g ke / ha to 2000 g ke / ha 2,4-D. In another embodiment, 2,4-D resistant crops are treated at least once at a dose of 100 g ke / ha to 2,500 g ke / ha 2,4-D. In another embodiment, 2,4-D resistant crops are treated at least once at a dose of 1,000 g ke / ha to 2,000 g ke / ha 2,4-D. In a further embodiment, 2,4-D includes 2,4-D-choline or 2,4-D-dimethylamine (DMA).

One embodiment relates to a method for increasing the yield of 2,4-D resistant crops. The method includes

(a) transforming plant cells using a nucleic acid molecule containing a nucleotide sequence encoding an aryloxyalkanoate dioxygenase (AAD);

(b) selection of transformed cells;

(c) plant regeneration from transformed cells; and

(d) treating the plants with a stimulating amount of a herbicide containing an aryloxy alkanoate residue.

In one embodiment, the implementation of aryloxyalkanoate dioxygenase (AAD) is AAD-1 or AAD-12. In another embodiment, the nucleic acid molecule contains a non-aryloxyalkanoate dioxygenase (AAD) selectable marker. In a further embodiment or alternative embodiment, the selectable marker is a phosphinotricin acetyltransferase (pat) gene or a bialaphos resistance gene (bar). In another embodiment, the nucleic acid molecule is optimized for plants.

Another aspect relates to the use of a herbicide containing an aryloxyalkanoate residue in the production of transgenic plants with resistance to 2,4-D with increased yield compared to their non-transgenic parent plants. In one embodiment, the herbicide containing the aryloxyalkanoate residue is 2,4-D. In a further embodiment, 2,4-D is applied at least once at a dose of 25 g ke / ha to 5,000 g ke / ha 2,4-D. In another embodiment, 2,4-D is applied at least once at a dose of from 100 g ke / ha to 2000 g ke / ha of 2,4-D. In another embodiment, 2,4-D is applied at least once at a dose of from 100 g ke / ha to 2500 g ke / ha of 2,4-D. In another embodiment, 2,4-D is applied at least once at a dose of from 1000 g ke / ha to 2000 g ke / ha of 2,4-D. In a further embodiment, 2,4-D includes 2,4-D-choline or 2,4-D-dimethylamine (DMA). In a further embodiment, 2,4-D resistant crops are treated with 2,4-D at least twice before flowering. In another embodiment, 2,4-D resistant crops are transgenic plants transformed using aryloxyalkanoate dioxygenase (AAD). In a further embodiment, the aryloxyalkanoate dioxygenase (AAD) is AAD-1 or AAD-12.

BRIEF DESCRIPTION OF THE DRAWINGS AND SEQUENCES

In FIG. 1 shows a general chemical reaction catalyzed by the AAD-12 enzymes of the present invention. In FIG. 2 shows a typical map of plasmid pDAB4468. In FIG. 3 shows a typical map of plasmid pDAS1740.

SEQ ID NO: 1 is the nucleotide sequence of AAD-12 from Delftia acidovorans.

SEQ ID NO: 2 is the translated protein sequence encoded by SEQ ID NO: 1.

SEQ ID NO: 3 is the plant-optimized nucleotide sequence of AAD-12 (v1).

SEQ ID NO: 4 is the translated protein sequence encoded by SEQ ID NO: 3.

SEQ ID NO: 5 is the AAD-12 (v2) nucleotide sequence optimized for E. coli.

SEQ ID NO: 6 is the sequence of the forward primer M13.

SEQ ID NO: 7 represents the sequence of the reverse primer M13.

SEQ ID NO: 8 represents the sequence of the forward primer PTU AAD-12 (v1).

SEQ ID NO: 9 is the reverse primer sequence of PTU AAD-12 (v1).

SEQ ID NO: 10 is a forward primer sequence for the PCR coding region of AAD-12 (v1).

SEQ ID NO: 11 is the reverse primer sequence for the PCR coding region of AAD-12 (v1).

SEQ ID NO: 12 is the sequence of the primer "sdpacodF" AAD-12 (v1).

SEQ ID NO: 13 represents the sequence of the primer "sdpacodR" AAD-12 (v1).

SEQ ID NO: 14 represents the sequence of the primer "Nco1 of Brady".

SEQ ID NO: 15 is a Sac1 of Brady primer sequence.

DETAILED DESCRIPTION OF THE INVENTION

As used herein, the phrase “transformed” or “transformation” refers to the incorporation of DNA into a cell. The phrases “transformant” or “transgenic” refer to plant cells, plants, and the like transformed or transformed. Embedded DNA is typically in the form of a vector containing a DNA insert.

As used herein, the phrase “selective marker” or “gene for selective marker” refers to a gene optionally used in plant transformation, for example, to protect plant cells from a selective agent or to provide resistance / resistance to the selective agent. Only those cells or plants that have received a functional selective marker are capable of dividing or growing under conditions of the presence of a selective agent. Examples of selective agents may include, for example, antibiotics, including spectinomycin, neomycin, kanamycin, paromomycin, gentamicin and hygromycin. These selective markers include the neomycin phosphotransferase (npt II) gene expressing an enzyme conferring antibiotic resistance to kanamycin, and genes for related antibiotics neomycin, paromomycin, gentamicin and G418, or the hygromycin phosphotransferase (hpt) gene expressing enzyme resistance. Other selectable marker genes may include genes encoding herbicide resistance, including Bar (resistance to BASTA® (ammonium glufosinate) or phosphinotricin (PPT)), acetolactate synthase (ALS, resistance to inhibitors such as sulfonyl carbamides (SU), imidazolinones , triazolopyrimidines (TP), pyrimidinyl oxybenzoates (POB) and sulfonylaminocarbonyltriazolinones preventing the first step in the synthesis of branched chain amino acids, glyphosate, 2,4-D and metal resistance or sensitivity. The phrase “marker-positive” refers to Asthenia transformed with the inclusion of a selectable marker gene.

Various selectable or detectable markers can be inserted into the selected expression vector, making it possible to identify and select transformed plants, or transformants. Many methods are available for confirming the expression of selective markers in transformed plants, including, for example, DNA sequencing and PCR (polymerase chain reaction), Southern blotting, RNA blotting, immunological methods for determining the protein expressed from a vector, for example, precipitated protein, protein reporter genes - phosphinotricin, or other proteins such as β-glucuronidase (GUS), luciferase, green fluorescent protein (GFP), DsRed, β-galactosidase, chloramphenicol acetyltransferase (CAT), alkaline phosphatase and etc. (See Sambrook, et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, N.Y., 2001, the entire contents of which are incorporated herein by reference).

Genes for selective markers are used to select transformed cells or tissues. Genes for selective markers include genes encoding antibiotic resistance, such as genes encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds. Herbicide resistance genes typically encode a modified target protein that is insensitive to the herbicide, or an enzyme that degrades or detoxifies the herbicide in the plant before it can act. See DeBlock et al. (1987) EMBO J., 6: 2513-2518; DeBlock et al. (1989) Plant Physiol., 91: 691-704; Fromm et al. (1990) 8: 833-839; Gordon-Kamm et al. (1990) 2: 603-618). For example, resistance to glyphosate or sulfonyl carbamide herbicides was achieved using genes encoding the mutant target enzymes 5-enolpyruvil-shikimate-3-phosphate synthetase (EPSPS) and acetolactate synthase (ALS). Resistance to ammonium glufosinate, bromoxynil and 2,4-dichlorophenoxyacetate (2,4-D) was achieved using bacterial genes encoding phosphinotricin acetyltransferase, nitrilase or 2,4-dichlorophenoxyacetate monooxygenase, which detoxify the corresponding herbicides. The 2,4-D resistance enzymes / genes were previously described in US Pat. No. 2009/0093366 and WO 2007/053482, the contents of which are hereby incorporated by reference in their entirety.

Other herbicides may inhibit the growth cone or meristem, including imidazolinone or sulfonylurea. Examples of genes in this category encode mutant ALS and AHAS enzymes, as described, for example, in Lee et al., EMBO J. 7: 1241 (1988); and Miki et al., Theon. Appl. Genet. 80: 449 (1990), respectively.

Glyphosate resistance genes include mutant 5-enolpyruvyl-shikimate-3-phosphate synthetase (EPSP) genes (by incorporation of recombinant nucleic acids and / or various forms of in vivo native EPSP genes), aroA genes and glyphosate acetyltransferase genes, respectively. Resistance genes to other phosphonic compounds include glufosinate genes (phosphinotricin acetyl transferase (PAT) genes from Streptomyces species, including Streptomyces hygroscopicus and Streptomyces viridichromogenes) and pyridinoxy or phenoxyproionic acids and cyclohexones (AC genes encoding an inhibitor). See, for example, US Patent No. 4,940,835 to Shah, et al. and US patent No. 6248876 Barry et al., which describe the nucleotide sequences of the forms of EPSP, which can give the plant resistance to glyphosate. The DNA molecule encoding the aroA mutant gene can be obtained at ATCC under registration number 39256, and the nucleotide sequence of the mutant gene is described in US Pat. No. 4,769,061 to Comai, European Patent Application No. 0 333,033 to Kumada et al. and U.S. Patent No. 4,975,374 to Goodman et al., which describes the nucleotide sequences of glutamine synthetase genes conferring resistance to herbicides such as L-phosphinotricin. The nucleotide sequence of the PAT gene is presented in European patent application No. 0 242 246 Leemans et al. In addition, DeGreef et al., Bio / Technology 7:61 (1989) describe the preparation of transgenic plants expressing chimeric bar genes encoding PAT activity. Examples of genes that confer resistance to phenoxypropionic acids and cyclohexones, including setoxydim and haloxifop, are the genes Acc1-S1, Acc1-S2 and Acc1-S3 described in Marshall et al., Theon. Appl. Genet. 83: 435 (1992). GAT genes capable of conferring glyphosate resistance are described in WO 2005012515 Castle et al. Genes conferring resistance to 2,4-D herbicides, fop and pyridyloxyiaxin are described in WO 2005107437 and US Patent Application Serial No. 11/587893.

Other herbicides can inhibit photosynthesis, including triazine (psbA and 1s + genes) or benzonitrile (nitrilase gene). In Przibila et al., Plant Cell 3: 169 (1991) describe the transformation of Chlamydomonas using plasmids encoding mutant psbA genes. The nucleotide sequences of nitrilase genes are described in US Pat. No. 4,810,648 to Stalker, and DNA molecules containing these genes are available from ATCC under Registration Nos. 53435, 67441 and 67442. Cloning and expression of DNA encoding glutathione S-transferase is described in Hayes et al. ., Biochem. J. 285: 173 (1992).

For the purposes of the present invention, selectable marker genes include, but are not limited to, genes encoding: neomycin phosphotransferase II (Fraley et al. (1986) CRC Critical Reviews in Plant Science, 4: 1-25); cyanamide hydratase (Maier-Greiner et al. (1991) Proc. Natl. Acad. Sci. USA, 88: 4250-4264); aspartate kinase; dihydrodipicolinate synthetase (Perl et al. (1993) Bio / Technology, 11: 715-718); tryptofandecarboxylase (Goddijn et al. (1993) Plant Mol. Bio., 22: 907-912); dihydrodipicolinate synthetase and desensitized aspartate kinase (Perl et al. (1993) Bio / Technology, 11: 715-718); the bar gene (Toki et al. (1992) Plant Physiol., 100: 1503-1507 and Meagher et al. (1996) and Crop Sci., 36: 1367); tryptofandecarboxylase (Goddijn et al. (1993) Plant Mol. Biol., 22: 907-912); neomycin phosphotransferase (NEO) (Southern et al. (1982) J. Mol. Appl. Gen., 1: 327; hygromycin phosphotransferase (HPT or HYG) (Shimizu et al. (1986) Mol. Cell Biol., 6: 1074); dihydrofolate reductase (DHFR) (Kwok et al. (1986) PNAS USA 4552); phosphinotricin acetyltransferase (DeBlock et al. (1987) EMBO J., 6: 2513); 2,2-dichloropropionic acid dehalogenase (Buchanan-Wollatron et al. ( 1989) J. Cell. Biochem. 13D: 330); acetohydroxyacid synthetase (Anderson et al., U.S. Pat. (Comai et al. (1985) Nature 317: 741); haloaryl nitrile (Stalker et al., Published PCT application WO87 / 04181); acetyl coenzyme A carboxylase (Par ker et al. (1990) Plant Physiol. 92: 1220); dihydropteroatesynthetase (sul I) (Guerineau et al. (1990) Plant Mol. Biol. 15: 127); and photosystem II polypeptide weighing 32 kDa (psbA) (Hirschberg et al. (1983) Science, 222: 1346).

Also included are genes encoding resistance to: chloramphenicol (Herrera-Estrella et al. (1983) EMBO J., 2: 987-992); methotrexate (Herrera-Estrella et al. (1983) Nature, 303: 209-213; Meijer et al. (1991) Plant Mol Bio., 16: 807-820 (1991); hygromycin (Waldron et al. (1985) Plant Mol. Biol., 5: 103-108; Zhijian et al. (1995) Plant Science, 108: 219-227 and Meijer et al. (1991) Plant Mol. Bio. 16: 807-820); streptomycin (Jones et al. (1987) Mol. Gen. Genet., 210: 86-91); spectinomycin (Bretagne-Sagnard et al. (1996) Transgenic Res., 5: 131-137); bleomycin (Hille et al. (1986) Plant Mol. Biol., 7: 171-176); sulfonamide (Guerineau et al. (1990) Plant Mol. Bio., 15: 127-136); bromoxynil (Stalker et al. (1988) Science, 242: 419- 423); 2,4-D (Streber et al. (1989) Bio / Technology, 7: 811-816); glyphosate (Shaw et al. (1986) Science, 233: 478-481); and phosphinotricin (DeBlock et al. (1987) EMBO J., 6: 2513-2518) All references cited in the description, thus , Incorporated herein by reference in its entirety, unless otherwise specified.

The above list of selectable marker and reporter gene genes is not limiting. Any reporter or selective marker gene is within the scope of the present invention. If necessary, such genes can be sequenced by methods known in the art.

Reporter and selective marker genes are synthesized for optimal expression in plants. Those. the coding sequence of the gene is modified to increase expression in plants. A synthetic marker gene is designed for expression in plants at a high level, resulting in higher transformation efficiency. Synthetic gene optimization techniques are available in this area. In fact, several genes are optimized to increase expression of a gene product in plants.

The marker gene sequence can be optimized for expression in a particular plant form or, alternatively, it can be modified for optimal expression in plant families. Preferred plant codons can be determined from codons occurring with the greatest frequency in proteins expressed in the greatest amounts in a particular plant species of interest. See, for example, EPA 0359472; EPA 0385962; WO 91/16432; Perlak et al. (1991) Proc. Natl. Acad. Sci. USA 88: 3324-3328; and Murray et al. (1989) Nucleic Acids Research, 17: 477-498; U.S. Patent No. 5,380,831; and US Patent No. 5,436,391, incorporated herein by reference. Thus, nucleotide sequences can be optimized for expression in any plant. It has been found that it is possible to optimize or synthesize the entire gene sequence or any part of it. That is, it is also possible to use fully optimized or partially optimized sequences.

In addition, several transformation strategies have been developed using the Agrobacterium-mediated transformation system. For example, a binary vector strategy is based on a two-plasmid system, where T-DNA is in a different plasmid than plasmid Ti. In a cointegration strategy, a small portion of T-DNA is placed in the same vector as the foreign gene, which then recombines with the plasmid Ti.

As used herein, the phrase “plant” includes dicotyledonous plants and monocotyledonous plants. Examples of dicotyledonous plants include tobacco, arabidopsis, soy, tomato, papaya, canola, sunflower, cotton, alfalfa, potatoes, grapes, pigeon peas, peas, ornamental cabbage, chickpeas, sugar beets, canola, watermelon, melon, pepper, peanuts, pumpkin , radishes, spinach, giant pumpkin, broccoli, cabbage, carrots, cauliflower, celery, Chinese cabbage, cucumber, eggplant and lettuce. Examples of monocotyledonous plants include corn, rice, wheat, sugarcane, barley, rye, sorghum, orchid, bamboo, banana, cattail, lily, oats, onions, millet and triticale.

Subject development of the 2,4-D resistance gene and subsequent resistant crops provides exceptional means of controlling broadleaf, glyphosate-resistant (or highly resistant and sheared) weed species for use in crops. 2,4-D is a relatively inexpensive and reliable broad-spectrum herbicide against broad-leaved plants, which will be of exceptional benefit to agricultural producers if it is possible to provide higher crop resistance equally for dicotyledonous and monocotyledonous crops. 2,4-D-resistant transgenic dicotyledonous crops will also have greater flexibility in terms of timing and rate of application. An additional benefit of this sign of resistance to 2,4-D herbicide is the prevention of normal susceptible crops due to 2,4-D drift, evaporation, transformation (or other phenomenon of moving outside the territory), improper use, vandalism, etc. An additional advantage of the AAD-12 gene is that, unlike all the tfdA homologs characterized so far, AAD-12 is able to degrade pyridyloxyacetate auxins (e.g. triclopyr, fluroxypyr) in addition to achiral phenoxy-auxins (e.g. 2,4-D , MCPA, 4-chlorophenoxyacetic acid). See table 1. A general picture of the chemical reactions catalyzed by the indicated AAD-12 enzyme is shown in FIG. 1. (Addition of O.sub.2 is stereospecific; the decomposition of the intermediate into phenol and glyoxylate is spontaneous.) It should be understood that using the chemical structures in FIG. 1 illustrate molecular backbones, and that various R groups and the like. (such as those presented in table 1) are included, but not necessarily specifically illustrated in FIG. 1. Many mixtures of various combinations of phenoxy-auxins are used to affect specific weed spectra and environmental conditions in various fields throughout the world. The use of the AAD-12 gene in plants provides protection against a much wider range of auxin herbicides, thereby increasing the flexibility and spectra of weeds that can be controlled.

To date, a single gene (AAD-12) has been identified that, when genetically engineered for expression in plants, has properties that allow phenoxy-auxin herbicides to be used on plants that have never had hereditary resistance, or were not high enough to be able to use these herbicides . In addition, AAD-12 can provide protection against pyridyloxyacetate herbicides in the field, increasing the potential benefits of these herbicides, the natural resistance to which is also insufficient to make selectivity possible. Plants containing AAD-12 alone can now be treated sequentially or using a tank mix with one, two, or a combination of several phenoxy-auxin herbicides. The application rate of each phenoxy-auxin herbicide can range from 25 to 4000 g ke / ha, and more often from 100 to 2000 g ke / ha to control a wide range of dicotyledonous weeds. Similarly, one, two, or a mixture of several pyridyloxyacetate auxin compounds can be applied to plants expressing AAD-12 with a reduced risk of damage from said herbicides. The application rate for the pyridyloxyacetate herbicide may be in the range of 25 to 2000 g ke / ha, and more often 35-840 g ke / ha for additional control of dicotyledonous weeds.

Glyphosate is widely used because it helps control a very wide range of broadleaf and herbaceous weed species. However, the reuse of glyphosate in GTC and in non-agricultural applications leads and will continue to lead to weed breeding with shifts towards naturally more resistant species or glyphosate resistant biotypes. The use of tank mixtures of herbicides used in effective application rates that provide control of the same species, but with different mechanisms of action, is prescribed in most strategies to combat herbicide resistance as a way to delay the emergence of resistant weeds. AAD-12 stacking with signs of glyphosate resistance (and / or signs of resistance to other herbicides) may be a mechanism to control glyphosate-resistant dicotyledonous weeds in GTC, making glyphosate, phenoxy-auxins (e.g. 2,4-D) and pyridyloxyacetate auxin herbicides (e.g., triclopyr) selectively in the same crop. Application of these herbicides may be simultaneous application in a tank mixture containing two or more herbicides with different mechanisms of action; separate application of one composition of herbicides with successive applications in pre-sowing, pre-emergence or post-emergence and separate application in the range from about 2 hours to about 3 months; or, alternatively, any combination of any number of herbicides representing each chemical class can be applied in any mode ranging from about 7 months from planting the crop to harvesting the crop (or pre-harvest interval for an individual herbicide, depending on which of them is the shortest).

It is important to have the flexibility to control a wide range of grassy and broad-leaved weeds with regard to the application regimen, application rates of individual herbicides and the ability to control difficult or resistant weeds. The rate of glyphosate application to the crop with a glyphosate / AAD-12 resistance gene stack may be in the range of about 250-2500 g ke / ha; phenoxy-auxin herbicides (one or more) can be applied at a spread rate of approximately 25-4000 g ke / ha; and pyridyloxyacetate auxin herbicides (one or more) can be applied at a rate of application of 25-2000 g ke / ha. The optimal combinations and the mode of these applications will depend on the specific situation, type and environment, and they will be best determined by a specialist in the field of weed control, benefiting from the present invention.

Seedlings are usually resistant throughout the growth cycle. Transformed plants will typically be resistant to the application of a new herbicide at any time during gene expression. In the present description, resistance to 2,4-D is presented throughout the life cycle using constitutive promoters that have been tested to date (mainly CsVMV and AtUbi10). This, as a rule, is expected, but represents an improvement over other non-metabolizable active agents, where resistance can be significantly affected, for example, by reduced expression of the site of application of the resistance mechanism. One example is Roundup Ready cotton, where plants are resistant to early spraying, but if they are sprayed too late, glyphosate is concentrated in the meristem (as it is not metabolized and moves); used Monsanto viral promoters are poorly expressed in colors. In this regard, the claimed invention is an improvement.

Herbicide formulations (e.g., esters, acids or salts; or soluble concentrate, emulsifiable concentrate or soluble liquid) and additives for tank mixtures (e.g. excipients, surfactants, drift inhibitors or compatibility agents) can significantly affect control weeds using the specified herbicide or a combination of one or more herbicides. Any combination thereof with any of the above herbicidal chemicals is within the scope of the present invention.

One skilled in the art will also see the benefit of combining two or more mechanisms of action to increase the spectrum of controlled weeds and / or to control naturally more resistant or resistant weed species. This may also apply to chemicals in which resistance to herbicides in crops has become possible under the influence of humans (transgenic or non-transgenic) in addition to GTC. In fact, signs of glyphosate resistance (e.g., EPSPS resistant plant or bacterium, glyphosate oxidoreductase (GOX), GAT), glufosinate resistance (e.g. Pat, bar), acetolactate synthase (ALS) inhibitory resistance to herbicides (e.g. imidazulfonolonu, , triazolopyrimidine sulfonanilide, pyrimidinylthiobenzoates and other chemicals - AHAS, Csrl, SurA, etc.), resistance to bromoxynil (e.g. Bxn), resistance to HPPD enzyme inhibitors (4-hydroxyphenylpyruvate dioxygenase), resistant phytoendesaturase (PDS) inhibitors, photosystem II inhibiting herbicide resistance (e.g., psbA), photosystem I inhibiting herbicide resistance, protoporphyrinogen oxidase IX (PPO) inhibiting herbicides (e.g., PPO-1), herb resistance phenylurea bases (e.g., CYP76B1), dicamba-degrading enzymes (see, e.g., US 20030135879) and others can be isolated or in multiple combinations to provide the ability to effectively control or prevent weed shifts and / or stentnost to any herbicide of the aforementioned classes. In some preferred embodiments, in vivo modified EPSPS as well as glyphosate resistance genes of class I, class II, and class III can be used.

Regarding additional herbicides, some additional preferred ALS inhibitors include, but are not limited to, sulfonylcarbamides (such as chlorosulfuron, halosulfuron, nicosulfuron, sulfomethuron, sulfosulfuron, trifloxisulfuron), imidazolinones (such as imazamox, imazetapiri disulfonazole, azazonopyridazole -methyl, diclosulam, florasulam, flumetsulam, metosulam and penoxulam), pyrimidinylthiobenzoates (such as bispiribac and pyritiobac) and flucarbazone. Some preferred HPPD inhibitors include, but are not limited to, mesotrione, isoxaflutol, and sulcotrione. Some preferred PPO inhibitors include, but are not limited to, flumiclorac, flumioxazine, flufenpir, piraflufen flutiacet, butafenacil, carfentrazone, sulfentrazone and diphenyl ethers (such as acifluorfen, fomesafen, lactofen) and.

In addition, AAD-12 alone or stacked with one or more additional HTC features can be stacked with one or more additional inputs (e.g., insect resistance, fungus resistance or stress resistance, etc.) or weekends (e.g. increased productivity harvest, improved oil profile, improved fiber quality, etc.) signs. Thus, the present invention can be used to provide a complete agronomic package of improved crop quality with the ability to flexibly and cost-effectively control any number of agricultural pests.

The present invention partially relates to the identification of an enzyme that is not only capable of degrading 2,4-D, but also, unexpectedly, has new properties, which distinguishes the enzyme of the present invention, for example, from previously known tfdA proteins. Despite the fact that this enzyme has very low homology with tfdA, the genes of the present invention can still, as a rule, be classified into the same general family of α-ketoglutarate-dependent oxygenases. This protein family is characterized by three conserved histidine residues in the motif "HX (D / E) X23-26 (T / S) X114-183HX10-13R" containing the active center. Histidines coordinate in the active center the Fe ^{2+ ion} , which is important for catalytic activity (Hogan et al., 2000). The preliminary in vitro expression experiments discussed herein have been adapted to facilitate the selection of new properties. These experiments also show that the AAD-12 enzyme is unique with respect to another, radically different, enzyme of the same class described in the previously registered patent application (PCT US / 2005/014737; registered May 2, 2005). The AAD-1 enzyme of this application has only about 25% sequence identity with respect to the AAD-12 protein of the present invention.

More specifically, the present invention relates in part to the use of an enzyme capable of degrading not only 2,4-D, but also pyridyloxyacetate herbicides. Earlier, no α-ketoglutarate-dependent enzyme dioxygenase was reported to have the ability to degrade herbicides of various chemical classes and mechanisms of action. Preferred enzymes and genes for use in the present invention are referred to herein as genes and proteins of AAD-12 (aryloxyalkanoate dioxygenase).

The proteins of the present invention were tested positive for the conversion of 2,4-D to 2,4-dichlorophenol ("DCP"; herbicide inactive). The partially purified proteins of the present invention can rapidly convert 2,4-D to in vitro DCP. An additional advantage of the AAD-12 transformed plants provided is that the parent herbicides are metabolized to inactive forms, thereby reducing the collection potential of the herbicidal residues along with grain or straw.

The present invention also includes methods for controlling weeds, where these methods include applying a pyridyloxyacetate and / or phenoxyiaxin herbicide to plants containing the AAD-12 gene.

In light of these results, new plants are now provided containing a polynucleotide encoding this type of enzyme. Up to this point, there was no motivation to obtain such plants, and it was not expected that such plants would be able to efficiently produce this enzyme, making the plants resistant not only to phenoxy acid herbicides (such as 2,4-D), but also to pyridyloxyacetate herbicides. Thus, the present invention provides many advantages, which until now in this area were not considered possible.

Publicly available strains (deposited in culture collections such as ATCC or DSMZ) can be acquired and screened for new genes using the methods described herein. The sequences provided herein can be used to amplify and clone homologous genes into a recombinant expression system for additional screening and testing of the present invention.

As indicated in the Background section above, one of the organisms intensively tested for the ability to degrade 2,4-D was Ralstonia eutropha (Streber et al., 1987). The gene encoding the first enzyme in the degradation pathway is tfdA. See US Patent No. 6153401 and GENBANK Reg. No. M16730. TfdA catalyzes the conversion of 2,4-D acid to a herbicidally inactive DCP through the reaction of α-ketoglutarate-dependent oxygenase (Smejkal et al., 2001). TfdA is used in transgenic plants to confer resistance to 2,4-D dicotyledonous plants (e.g. cotton and tobacco) that are normally susceptible to 2,4-D (Streber et al., 1989; Lyon et al., 1989; Lyon et al., 1993). A large number of tfdA-type genes encoding proteins capable of degrading 2,4-D were identified from the environment and deposited in the Genbank database. Many homologs are very similar to tfdA (> 85% amino acid identity) and have similar tfdA enzymatic properties. However, to date, a small collection of homologues of α-ketoglutarate-dependent oxygenase having a low level of homology with tfdA has been identified.

The present invention partially relates to unexpected data on new uses and functions of the distantly related sdpA enzyme from Delftia acidivorans (Westendorf et al., 2002, 2003) with low homology to tfdA (31% amino acid identity). It was previously shown that this enzyme, α-ketoglutarate-dependent dioxigenase, purified in its native form, degrades 2,4-D and S-dichloroprop (Westendorf et al., 2002 and 2003). However, the enzyme α-ketoglutarate-dependent oxygenase having the ability to degrade the chemical class herbicides of pyridyloxyacetates was not previously reported. SdpA was never expressed in plants, and there was no motivation for this, partly because the development of new HTC technologies was limited mainly by the efficiency, low cost and convenience of GTC (Devine, 2005).

Given the new activity, the proteins and genes of the present invention are referred to herein as AAD-12 proteins and genes. To date, it has been confirmed that AAD-12 degrades a variety of in vitro phenoxyacetate auxin herbicides. However, as first reported in the present description, it was unexpectedly discovered that this enzyme is also able to degrade additional substrates of the class of aryloxyalkanoate molecules. Substrates of significant agronomic importance include pyridyloxyacetate auxin herbicides. This new discovery is the basis for significant opportunities for herbicide-resistant crops (HTC) and signs of selective markers. This enzyme is unique in its ability to exhibit its herbicide-destructive activity against broad-leaved broad-spectrum herbicides (phenoxyacetate and pyridyloxyacetateuxins).

Thus, the present invention partially relates to the degradation of 2,4-dichlorophenoxyacetic acid, other phenoxyacetate auxin herbicides and pyridyloxyacetate herbicides with the aid of the recombinantly expressed enzyme aryloxyalkanoate dioxygenase (AAD-12). The present invention also relates in part to the identification and use of genes encoding the aryloxyalkanoate dioxygenase (AAD-12) degrading enzyme capable of degrading phenoxy and / or pyridyloxy-auxin herbicides.

The enzyme of the present invention allows transgenic expression, leading to resistance to combinations of herbicides with which almost all broad-leaved weeds will be controlled. AAD-12 can serve as an exceptional feature of a herbicide-resistant crop (HTC) for stacking with other HTC traits [eg, glyphosate resistance, glufosinate resistance, resistance to ALS inhibitors (eg imidazolinone, sulfonyl carbamide, triazolopyrimidine sulfon, resistance to bromoxynil, resistance to HPPD inhibitors, resistance to PPO inhibitors, etc.] and, for example, signs of resistance to insects (Cry1F, Cry1Ab, Cry 34/45, other Bt. proteins or insecticidal b LKI, not derived from Bacillis, et al.). Additionally, AAD-12 can serve as a selective marker to facilitate the selection of primary plant transformants genetically engineered with a second gene or group of genes.

In addition, the microorganism gene of the present invention was redesigned in such a way that the protein is encoded by codons shifted towards their use by monocotyledonous and dicotyledonous plants (hemicot). Arabidopsis, corn, tobacco, cotton, soy, canola and rice were transformed using constructs containing AAD-12, and they showed high levels of resistance to phenoxy- and pyridyloxy-auxin herbicides. Thus, the present invention also relates to genes "optimized for plants" encoding the proteins of the present invention.

Oxyalkanoate groups are useful for incorporating a stable acid functional group into the herbicides. An acid group through an “acid trap” can give the desired characteristic feature of the action of the herbicide is mobility in the phloem, and thus it can be incorporated into new herbicides in order to increase mobility. Aspects of the present invention also relate to the HTC production mechanism. There are many potential commercial and experimental herbicides that can serve as substrates for AAD-12. Thus, the use of the genes of the present invention can also lead to herbicide resistance also in relation to other herbicides.

The HTC features of the present invention can be used in new combinations with other HTC features (including, but not limited to, glyphosate resistance). These combinations of traits give rise to new ways of controlling weed species (etc.) due to newly acquired resistance or hereditary resistance to herbicides (e.g. glyphosate). Thus, in addition to the characteristics of HTC, the scope of the invention includes new methods for controlling weeds using herbicides, which resistance in transgenic crops was achieved using this enzyme.

The present invention can be applied to commercialize the stacked 2,4-D resistance trait, for example, with currently existing signs of glyphosate resistance in soybeans. Thus, the present invention relates to a tool for controlling shifts in populations of broadleaf weed species and / or selection of herbicide-resistant broadleaf weeds, which have become widespread due to the extremely high confidence of farmers regarding glyphosate for controlling weeds in various crops.

The transgenic expression of the AAD-12 genes of the present invention is presented as an example in Arabidopsis, tobacco, soy, cotton, rice, corn and canola. Soy is a preferred crop for transformation of the present invention. However, the present invention can be used in many other monocotyledons (such as grazing grass or lawn grass) and dicotyledonous crops such as alfalfa, clover, tree species, etc. Similarly, 2,4-D (or other AAD-12 substrates) can be more successfully used in the case of herbaceous crops in which the resistance is moderate, and the resistance increased with this feature will provide agricultural producers with the opportunity to use these herbicides in a more effective x rates of application and with a broader application mode without the risk of damage to crops.

In addition, the present invention relates to a single gene that can provide herbicide resistance by which broad-leaved weeds can be controlled. This gene can be used in many crops to make it possible to use a combination of broad spectrum herbicides. Using the present invention, weeds that are resistant to currently existing chemicals can also be controlled, and it can help control weed population shifts resulting from currently existing agronomic technologies. The AAD-12 of the present invention can also be used in attempts to effectively detoxify additional herbicidal substrates into non-herbicidal forms. Thus, the present invention relates to the development of additional features of HTC and / or selective marker technology.

Alone or in addition to using the genes of the present invention to obtain HTC, the genes of the present invention can also be used as selective markers for the successful selection of transformants in cell cultures, greenhouses and in the field. The genes of the present invention are extremely important simply as a selective marker for biotechnological projects. The undifferentiated effect of AAD-12 on other aryloxyalkanoate auxin herbicides offers many possibilities for using this gene to produce HTC and / or a selectable marker.

One cannot simply describe the term “resistance” and not use the verb “have stability” or the adjective “stable”. In this area, countless hours have been spent debating the terms “herbicide-resistant crops” (HTC) and “herbicide-resistant crops” (HRC). HTC is the preferred term in this area. However, the official definition of "resistance" according to the Weed Science Society of America is the "innate ability of a plant to survive and reproduce after exposure to a dose of a herbicide that is normally lethal to a wild-type plant. In plants, resistance can be natural or induced using technologies such as genetic engineering or selection of variants carried out using tissue culture or mutagenesis. " As used in the present description, unless otherwise indicated, the "resistance" to the herbicide is hereditary and allows the plant to grow and multiply in the presence of a typical herbicide-effective treatment with the herbicide for the specified plant, as proposed in the latter, at the time of filing of this application, edition Herbicide Handbook. According to experts in this field, the plant can still be considered "resistant", even if some degree of damage to the plant as a result of treatment with the herbicide is obvious. As used herein, the term "resistance" is broader than the term "resistance" and includes "resistance" as defined herein, as well as the improved ability of a particular plant to resist various degrees of herbicide-induced damage, which is typically occurs in wild-type plants of the same genotype at the same dose of herbicide.

The transfer of functional activity to plant or bacterial systems may include a nucleic acid sequence encoding the amino acid sequence of the protein of the present invention, integrated into a vector expressing a protein suitable for the host in which the vector will reside. One way to obtain a nucleic acid sequence encoding a protein with functional activity is to isolate native genetic material from bacterial species producing the protein of interest using information predicted from the amino acid sequence of the protein as described herein. Native sequences can be optimized for expression in plants, for example, as described in more detail below. An optimized polynucleotide can also be constructed based on a protein sequence.

There are a number of methods for producing proteins for use in the present invention. For example, antibodies against the proteins described herein can be used to identify and isolate such proteins from a mixture of proteins. In particular, it is possible to induce antibodies against portions of proteins that are the most conserved or the most diverse compared to other related proteins. These antibodies can then be used to specifically identify equivalent proteins with characteristic activity by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or immunoblotting. Antibodies against the proteins described herein, or against equivalent proteins, or against fragments of these proteins can be easily obtained using standard methods. Such antibodies are an aspect of the present invention. Antibodies of the present invention include monoclonal and polyclonal antibodies, preferably produced in response to an exemplary or putative protein.

One skilled in the art will recognize that the proteins (and genes) of the present invention can be obtained from a variety of sources. Since it is known that the complete operons of degradation of herbicides are encoded by mobile genetic elements, such as plasmids, as well as elements integrable into the genome, the proteins of the present invention can be obtained from a wide range of microorganisms, for example, including recombinant and / or wild-type bacteria.

Mutant forms of bacterial isolates can be obtained by methods well known in the art. For example, asporogenous mutants can be obtained by subjecting the isolate to mutagenesis using ethyl methanesulfonate (EMS). Mutant strains can also be obtained using ultraviolet radiation and nitrosoguanidine by methods well known in the art.

The protein "from" or "obtained from" any of the isolates of the present invention mentioned or proposed in the present description means that the protein (or a similar protein) can be obtained from an isolate or some other source, such as another bacterial strain or plant. “Derived from” also has this meaning and includes proteins derived from the indicated type of bacteria, for example, modified for expression in a plant. One skilled in the art will understand that, given the description of the bacterial gene and protein, a plant can be constructed to produce protein. Antibody preparations, nucleic acid probes (e.g. DNA, RNA or PNA), etc. can be obtained using polynucleotide and / or amino acid sequences presented in the present description, and use them for screening and isolation of other related genes from other (natural) sources.

For cloning and sequencing of the proteins and genes presented in the present description, you can use standard methods of molecular biology. Further information can be found in Sambrook et al., 1989, incorporated herein by reference.

Polynucleotides and probes: The present invention further relates to nucleic acid sequences encoding proteins for use in the present invention. The present invention further relates to methods for identifying and characterizing genes encoding proteins having the desired herbicidal activity. In one embodiment, the present invention relates to unique nucleotide sequences useful as probes for hybridization and / or primers for PCR methods. Using primers, characteristic fragments of genes are obtained that can be used in the identification, determination of properties and / or isolation of specific genes of interest. The nucleotide sequences of the present invention encode proteins that are different from the previously described proteins.

The polynucleotides of the present invention can be used to obtain complete "genes" encoding proteins or peptides in a desired host cell. For example, as will be appreciated by those skilled in the art, the polynucleotides of the present invention can be appropriately placed under the control of a promoter in a host of interest, as is known in the art. The level of gene expression and transient / tissue-specific expression can significantly affect the applicability of the invention. As a rule, higher levels of expression of the protein of the destructive gene will lead to faster and more complete degradation of the substrate (in this case, the target herbicide). It is desirable that the promoters control the expression of the target gene at high levels if high expression does not have a subsequent negative effect on plant health. As a rule, it is desirable to have the AAD-12 gene, constitutively expressed in all tissues to fully protect the plant at all phases of growth. However, alternatively, you can use the resistance gene, expressed depending on the phase of the vegetative cycle; this will allow the target herbicide to be used in the fruiting phase to control weeds and then control the sexual reproduction of the target crop by application during the flowering phase. In addition, the desired levels and periods of expression may also depend on the type of plant and the desired level of resistance. In some preferred embodiments, strong constitutive promoters are used in combination with transcription enhancers and the like. to increase expression levels and resistance to desired levels. Some such embodiments are described in more detail below before the Examples section.

As is known to those skilled in the art, DNA typically exists in double-stranded form. In such a structure, one chain is complementary to another, and vice versa. Because DNA is replicated (for example) in the plant, additional complementary DNA chains are produced. The term "coding chain" is often used in this area to mean a chain that binds to an antisense chain. mRNA is transcribed from the "antisense" DNA strand. A “sense” or “coding” chain has a series of codons (a codon is three nucleotides that can be read as a unit of three residues to denote a specific amino acid), which can be read as an open reading frame (ORF) to form the protein or peptide of interest. In the case of in vivo production of a protein, a DNA strand is typically transcribed into a complementary mRNA strand used as a template for the protein. Thus, the present invention includes the use of examples of polynucleotides shown in the attached list of sequences and / or equivalents, including complementary chains. The present invention includes RNA and PNA (peptide nucleic acids), which are functionally equivalent to examples of DNA molecules.

Proteins and genes for use in the present invention can be identified and obtained, for example, using oligonucleotide probes. These probes are detectable nucleotide sequences that can be determined using the appropriate label, or which can be obtained essentially fluorescent, as described in international patent application No. WO 93/16094. The probes (and polynucleotides of the present invention) can be DNA, RNA, or PNA. In addition to adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U; in the case of RNA molecules), the synthetic probes (and polynucleotides) of the present invention may also contain inosine (neutral base, capable of mating with all four bases; sometimes used instead of a mixture of all four bases in synthetic probes) and / or other synthetic (unnatural) bases. Thus, when a synthetic, degenerate oligonucleotide is mentioned in the present description and, in general, “N” or “n” is used, “N” or “n” may be G, A, T, C or inosine. As used in the present description, undefined codes correspond to standard IUPAC nomenclature agreements at the time of filing this application (for example, R means A or G, Y means C or T, etc.).

As is well known in this field, if a probe molecule is hybridized with a nucleic acid sample, it can be reasonably assumed that the probe and sample have significant homology / similarity / identity. Preferably, the polynucleotide is first hybridized, followed by washing under conditions of reduced stringency, moderate stringency, or stringent conditions by methods well known in the art, as described, for example, in Keller, GH, MM Manak (1987) DNA Probes, Stockton Press, New York, NY, pp. 169-170. For example, as indicated there, conditions of reduced stringency can be achieved first by washing with 2x SSC (standard citrate-salt buffer) / 0.1% SDS (sodium dodecyl sulfate) for 15 minutes at room temperature. As a rule, carry out two washes. More rigor can then be achieved by lowering the salt concentration and / or raising the temperature. For example, after the above washings, two washes with 0.1-fold SSC / 0.1% SDS for 15 minutes, each at room temperature, followed by a wash with 0.1-fold SSC / 0.1% SDS for 30 minutes each at 55 ° C. These temperatures can be used with other hybridization and washing protocols described in the present description and known to the person skilled in the art (for example, SSPE can be used as a salt instead of SSC). A 2-fold SSC / 0.1% SDS can be obtained by adding 50 ml of a 20-fold SSC and 5 ml of 10% SDS in 445 ml of water. A 20-fold SSC can be obtained by combining NaCl (175.3 g / 0.150 M), sodium citrate (88.2 g / 0.015 M) and water, adjusting the pH to 7.0 with 10 N NaOH, and then adjusting the volume to 1 liter 10% SDS can be obtained by dissolving 10 g of SDS in 50 ml of autoclaved water, and then diluting to 100 ml.

Probe detection provides means for determining in a known manner whether hybridization is supported. Such probe analysis provides a quick way to identify the genes of the present invention. The nucleotide segments used as probes of the invention can be synthesized using a DNA synthesizer and standard methods. These nucleotide sequences can also be used as primers for PCR for amplification of the genes of the present invention.

Hybridization characteristics of the molecule can be used to determine the polynucleotides of the present invention. Thus, the present invention includes polynucleotides (and / or their complementary polynucleotides, preferably completely complementary to them polynucleotides), hybridizing with the polynucleotide given as an example in the present description. That is, one way of determining a gene (and the protein encoded by it), for example, is to determine its ability to hybridize (under any conditions specifically described in the present description) with a known or specifically exemplified gene.

As used in the present description, the term "stringent" hybridization conditions refers to conditions by which the same or approximately the same degree of specificity of hybridization is achieved as in the conditions used by the authors of the present invention. In particular, hybridization of immobilized DNA by Southern blotting with ³² P labeled gene-specific probes can be carried out by standard methods (see, for example, Maniatis et al. 1982). In general, hybridization and subsequent washing can be carried out under conditions that allow the determination of target sequences. In the case of double-stranded DNA probes to the gene, hybridization can be performed overnight at a temperature of 20-25 ° C below the melting temperature (Tm) of the DNA hybrid in 6-fold SSPE, 5-fold Denhardt's solution, 0.1% SDS, 0, 1 mg / ml denatured DNA.

Typically, washing can be carried out as follows: (1) twice at room temperature for 15 minutes in 1-fold SSPE, 0.1% SDS (washing under conditions of reduced stringency); and (2) once at Tm-20 ° C for 15 minutes in 0.2-fold SSPE, 0.1% SDS (washings under moderate stringency).

In the case of oligonucleotide probes, hybridization can be performed overnight at a temperature of 10-20 ° C below the melting temperature (Tm) of the hybrid in 6-fold SSPE, 5-fold Denhardt's solution, 0.1% SDS, 0.1 mg / ml denatured DNA

Typically, washing can be carried out as follows: (1) twice at room temperature for 15 minutes in 1-fold SSPE, 0.1% SDS (washing under conditions of reduced stringency); and (2) once at hybridization temperature for 15 minutes in 1-fold SSPE, 0.1% SDS (washing under moderate stringency conditions).

Basically, to change the severity, you can change the salt and / or temperature. In the case of a labeled DNA fragment with a length of> 70 bases or so, the following conditions can be used: (1) reduced stringency: 1- or 2-fold SSPE, room temperature; (2) reduced severity: 1- or 2-fold SSPE, 42 ° C; (3) moderate severity: 0.2-fold or 1-fold SSPE, 65 ° C, or (4) stringent conditions: 0.1-fold SSPE, 65 ° C

The formation and stability of the duplex depends on the actual complementarity between the two chains of the hybrid and, as indicated above, some degree of mismatch can be allowed. Thus, the probe sequences of the present invention include mutations (single and multiple), deletions, insertions in the described sequences, and combinations thereof, where these mutations, insertions, and deletions enable the formation of stable hybrids with the target polynucleotide of interest. Mutations, insertions, and deletions can be obtained in the indicated polynucleotide sequence in a variety of ways, and these methods are generally known to those skilled in the art. Other methods may become known in the future.

PCR technology: Polymerase chain reaction (PCR) is a repetitive, enzymatic, primed synthesis of a nucleic acid sequence. This method is well known and commonly used by those skilled in the art (see Mullis, US Patent Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki et al., 1985). PCR is based on the enzymatic amplification of a DNA fragment of interest flanked by two oligonucleotide primers that hybridize on opposite chains of the target sequence. Preferably, the primers are oriented at the 3'-ends directed against each other. Repeated cycles of thermal denaturation of the template, annealing of the primers on their complementary sequences, and elongation of the annealed primers using DNA polymerase lead to amplification of the segment determined by the 5'-ends of the PCR primers. The elongation product of each primer can serve as a template for the other primers, thus, in each cycle, the amount of DNA fragment formed in the previous cycle is doubled. This leads to an exponential accumulation of a specific target fragment several million times in a few hours. Using thermostable DNA polymerase such as Taq polymerase isolated from the thermophilic bacterium Thermus aquaticus, the amplification can be completely automated. Other enzymes that can be used are known to those skilled in the art.

Examples of DNA sequences or their segments can be used as primers for PCR amplification. When performing PCR amplification, a certain degree of mismatch between the primers and the matrix can be allowed. Thus, mutations, deletions, and insertions (especially the addition of nucleotides at the 5'-end) of the primer examples are included in the scope of the present invention. In this primer, mutations, insertions and deletions can be carried out by methods generally known to those skilled in the art.

Modification of genes and proteins: The genes and proteins of the present invention can be fused with other genes and proteins to produce chimeric or fusion proteins. The genes and proteins useful in the present invention include not only the full-length sequences specifically exemplified, but also parts, segments and / or fragments (including adjacent fragments and variants with internal and / or terminal deletions compared to full-sized molecules) of these sequences , their variants, mutant, chimeric and fused forms. The proteins of the present invention may contain amino acid substitutions, provided that they retain the desired functional activity. "Variants" of genes have nucleotide sequences encoding the same proteins or equivalent proteins having activity equivalent to or similar to the protein given as an example.

The two best BLAST searches using the native aad-12 nucleotide sequence show a sufficient level of homology (approximately 85%) for 120 base pairs in the sequence. Hybridization under specific conditions can be expected to include these two sequences. See GENBANK reg. No. DQ406818.1 (89329742; Rhodoferax) and AJ6288601.1 (44903451; Sphingomonas). Rhodoferax is very similar to Delftia, but Sphingomonas phylogenetically represents a completely different class.

The terms “protein variants” and “equivalent proteins” refer to proteins having the same or substantially the same biological / functional activity against target substrates and equivalent sequences with respect to the exemplary proteins. As used herein, a reference to an “equivalent” sequence refers to sequences containing amino acid substitutions, deletions, additions or insertions that improve or do not affect activity to a large extent unfavorably. Activity-retaining fragments are also included in this definition. Fragments and other equivalents that retain the same or similar function or activity as the corresponding protein fragment, given as an example, are included in the scope of the present invention. Changes, such as amino acid substitutions or additions, can be made for various purposes, such as increasing (or decreasing) the protease stability of a protein (without significantly / significantly decreasing the functional activity of a protein), removing or adding a restriction site, and the like. Gene variants can be easily constructed, for example, using standard methods for generating point mutations.

In addition, for example, US Pat. No. 5,605,793 describes methods for producing additional molecular diversity using DNA reassembly after random or directed fragmentation. This can be referred to as “shuffling” the genes, usually involving mixing fragments (of the desired size) of two or more different DNA molecules with subsequent repeated rounds of renaturation. This can improve the activity of the protein encoded by the original gene. The result is a chimeric protein having improved activity, altered substrate specificity, increased enzymatic stability, altered stereospecificity, or other characteristics.

"Shuffling" can be planned and directed after obtaining and studying atomic 3D (three-dimensional) coordinates and the crystal structure of the protein of interest. Thus, “directional shuffling” can be directed to specific segments of the protein, ideal for modification, such as segments exposed on the surface, and preferably non-internal segments involved in protein folding and important for 3D structural integrity.

Specific changes in the "active center" of the enzyme can be made to affect its inherent functionality with respect to activity or stereospecificity. Muller et. al. (2006). The known crystal structure of tauD was used as a model of dioxigenase to determine the residues of the active center, while it was associated with its characteristic substrate, taurine. Elkins et al. (2002) “X-ray crystal structure of Escerichia coli taurine / alpha-ketoglutarate dioxygenase complexed to ferrous iron and substrates,” Biochemistry 41 (16): 5185-5192. For sequence optimization and construction of active sites of the enzyme, see Chakrabarti et al., PNAS, (Aug. 23, 2005), 102 (34): 12035-12040.

Fragments of full-sized genes can be obtained by standard methods using commercially available exonucleases or endonucleases. For example, enzymes such as Bal31 or site-specific mutagenesis can be used to systematically cleave nucleotides from the ends of these genes. In addition, genes encoding active fragments can be obtained using various restriction enzymes. To directly obtain active fragments of these proteins, proteases can be used.

As presented in the present description, the scope of the invention includes the fact that proteins can be shortened and still maintain functional activity. The term “truncated protein” means that part of the protein can be cleaved off, while the rest of the truncated protein retains and exhibits the desired activity after cleavage. Cleavage can be carried out using various proteases. In addition, efficiently cleaved proteins can be obtained by molecular biology methods, where the bases of the DNA encoding the protein are removed by treatment with restriction endonucleases, or by other methods available to those skilled in the art. After trimming, these proteins can be expressed in heterologous systems such as E. coli, baculoviruses, plant virus systems, yeast, and the like, and then placed in insect cell analysis systems as described herein to determine activity. It is well known in this field that truncated proteins can be successfully obtained in such a way that they retain functional activity with a smaller sequence than a full-sized sequence. For example, B.t. proteins can be used in shortened form (core protein) (see, for example, Hofte et al. (1989), and Adang et al. (1985)). As used herein, the term “protein” may include functionally active truncated forms.

As used herein, unless otherwise indicated, the percent identity and / or sequence similarity of the two nucleic acids is determined using the algorithm of Karlin and Altschul, 1990, modified as described in Karlin and Altschul, 1993. Such an algorithm is included in the NBLAST and XBLAST programs Altschul et al., 1990. Nucleotide searches in BLAST are performed using the NBLAST program, match weight = 100, word length = 12. Gapped BLAST can be used as described in Altschul et al., 1997. When using the BLAST and Gapped programs BLAST use the parameters of the corresponding programs m by default (NBLAST and XBLAST). See the NCBI / NIH website. For comparison purposes, AlignX Vector NTI Suite 8 (InforMax, Inc., North Bethesda, Md., U.S.A.) with the default settings was used to obtain alignment with gaps. They were the following: a fine for opening a pass - 15, a penalty for lengthening a pass - 6.66, and a penalty for sharing a pass - 8.

Table 1 Amino acid class Amino Acid Examples Non-polar Ala, Val, Leu, Ile, Pro, Met, Phe, Trp Uncharged polar Gly, Ser, Thr, Cys, Tyr, Asn, Gln Sour Asp, Glu The main Lys, Arg, His

You can also change the various properties and three-dimensional features of the protein without adversely affecting its activity / functionality. Conservative amino acid substitutions can be allowed / included so as not to adversely affect the activity and / or three-dimensional configuration of the molecule. Amino acids can be divided into the following classes: non-polar, uncharged polar, basic and acidic. Conservative substitutions in which an amino acid of one class is replaced by another amino acid of the same type fall within the scope of the present invention, provided that the substitution does not adversely affect the biological activity of the compound. Table 1 provides a list of examples of amino acids belonging to each class. In some cases, non-conservative substitutions can also be made. However, preferred substitutions do not significantly alter the functional / biological activity of the protein.

As used herein, a reference to "isolated polynucleotides and / or" purified "proteins refers to these molecules when they are not associated with other molecules with which they are found in nature. Thus, a reference to" isolated "and / or" purified "means the participation of" human hands "as described herein. For example, the bacterial" gene "of the present invention, placed in a plant for expression, is an" isolated polynucleotide. "Similarly, a protein derived from a bacterial protein and produced by a plant, is an "isolated protein".

Due to the degeneracy / redundancy of the genetic code, the amino acid sequences provided herein can be encoded by many different DNA sequences. One of skill in the art can obtain alternative DNA sequences encoding the same or essentially the same proteins. These variants of DNA sequences are included in the scope of the present invention. This is described in more detail below in the section entitled "Optimization of the sequence for expression in plants."

Sequence optimization for expression in plants: To achieve a high level of expression of heterologous genes in plants, it is generally preferable to reconstruct genes so that they are more efficiently expressed in plant cells (cytoplasm). Corn is one such plant in which reconstruction of heterologous genes prior to transformation may be preferred to increase their expression level in said plant. Thus, an additional step in the construction of genes encoding a bacterial protein is the reconstruction of a heterologous gene for optimal expression using a deviation in the frequency of use of codons more appropriate to the target sequence of a plant belonging to dicotyledonous or monocotyledonous species. The sequences can also be optimized for expression in any of the more specific types of plants discussed elsewhere in the present description.

Transgenic hosts: The genes of the present invention, encoding proteins, can be integrated into a wide range of microorganisms or host plants. The present invention includes transgenic plant cells and transgenic plants. Preferred plants (and plant cells) are corn, arabidopsis, tobacco, soy, cotton, canola, rice, wheat, lawn grass, legumes and cereals (e.g. alfalfa and clover), pasture grains, and the like. Other types of transgenic plants, such as fruit plants, vegetables, ornamental plants, and trees, can also be prepared according to the present invention. In general, dicotyledonous and / or monocotyledonous plants may be used in various aspects of the present invention.

In preferred embodiments, gene expression, directly or indirectly, results in intracellular production (and retention) of the proteins of interest. Thus, plants can be made resistant to herbicides. Such hosts can be referred to as transgenic, recombinant, transformed and / or transfected hosts and / or cells. In some aspects of the present invention (for example, by cloning and obtaining the gene of interest), cells of microorganisms (preferably bacteria) can be obtained and used by standard methods to the advantage of the disclosure of the subject invention.

Plant cells transfected using the polynucleotide of the present invention can be regenerated into whole plants. The present invention includes cell cultures, including tissue cell cultures, liquid cultures, and solid culture. Seeds produced and / or used to produce plants of the present invention are also included in the scope of the present invention. Other plant tissues and parts are also included in the present invention. The present invention likewise includes methods for producing plants or cells containing a polynucleotide of the present invention. One of the preferred methods for producing such plants is the planting of seeds of the present invention.

Although plants may be preferred, the present invention also includes the production of highly active recombinant AAD-12, for example, in the Pseudomonas fluorescens (Pf) acceptor strain. The present invention includes preferred growth temperatures for maintaining soluble active AAD-12 in this host; fermentation conditions in which AAD-12 is produced as more than 40% of the total protein of the cell or at least 10 g / l; a purification method leading to efficient isolation of active recombinant AAD-12 from the Pf host; purification scheme, the yield of which is at least 10 g of active AAD-12 per kg of cells; purification scheme, the yield of which may be 20 g of active AAD-12 per kg of cells; a preparation method in which AAD-12 can be stored and restored in solution; and a lyophilization method in which AAD-12 activity can be maintained for long-term storage and shelf life.

Insertion of genes to obtain transgenic hosts: One aspect of the present invention is the transformation / transfection of plants, plant cells and other host cells using the polynucleotides of the present invention, from which the proteins of the present invention are expressed. Plants transformed in this way can be made resistant to various herbicides with different mechanisms of action.

A wide range of methods are available for embedding a gene encoding a desired protein in a target host under conditions that make it possible to stably preserve and express the gene. These methods are well known to specialists in this field and are described, for example, in US patent No. 5135867.

Vectors containing AAD-12 polynucleotide are included in the scope of the present invention. For example, a large number of cloning vectors containing a replication system in E. coli and a marker that allows selection of transformed cells are available to prepare for the incorporation of foreign genes into higher plants. Vectors include, for example, pBR322, pUC series, M13 mp series, pACYC184, etc. Thus, a protein coding sequence can be inserted into a vector at a suitable restriction site. The resulting plasmid is used to transform E. coli. E. coli cells are cultured in a suitable culture medium, then harvested and lysed. The plasmid is isolated by purification from genomic DNA. As methods of analysis, as a rule, carry out sequence analysis, restriction analysis, electrophoresis and other methods of biochemistry and molecular biology. After each manipulation, the DNA sequence used can be restricted and linked to the next DNA sequence. The sequence of each plasmid can be cloned into the same or different plasmids. Depending on the method of embedding the desired genes in the plant, other DNA sequences may be necessary. For example, if a Ti or Ri plasmid is used to transform a plant cell, at least the right edge, but often the right edge, and the left edge of the T-DNA of the Ti or Ri plasmid must be connected in the form of flanking regions of the genes to be inserted. The use of T-DNA for the transformation of plant cells is actively investigated and described in EP 120 516; Hoekema (1985); Fraley et al. (1986); and An et al. (1985).

A large number of methods are available for embedding DNA in a plant host cell. These methods include T-DNA transformation using Agrobacterium tumefaciens or Agrobacterium rhizogenes as transformation objects, fusion, injection, biolystics (microparticle bombardment), use of silicon carbide whiskers, aerosol treatment, PEG or electroporation, and other possible methods. When using Agrobacteria for transformation, the DNA to be inserted must be cloned into special plasmids, namely an intermediate vector or a binary vector. Intermediate vectors can be inserted into the plasmid Ti or Ri through homologous recombination due to sequences homologous to sequences in T-DNA. Plasmid Ti or Ri also contains the vir region necessary for T-DNA transfer. Intermediate vectors cannot replicate independently in Agrobacteria. The intermediate vector can be transferred to Agrobacterium tumefaciens via helper plasmids (conjugation). Binary vectors can replicate independently in both E. coli and Agrobacteria. They contain a selectable marker gene and a linker or polylinker flanked by the right and left edge regions of T-DNA. Using them, Agrobacteria can be directly transformed (Holsters, 1978). Agrobacterium used as the host cell must contain a plasmid carrying the vir region. The Vir region is necessary for the transfer of T-DNA into the plant cell. Additional T-DNA may be included. The bacterium transformed in this way is used to transform plant cells. To transfer DNA into a plant cell, plant explants can be cultured predominantly with Agrobacterium tumefaciens or Agrobacterium rhizogenes. Then, in a suitable medium, which may contain antibiotics or biocides for breeding, from the infected plant material (for example, pieces of leaves, segments of the stem, roots, as well as protoplasts or cells cultured in suspension), whole plants can be regenerated. The plants thus obtained can then be tested for the presence of integrated DNA. In the case of injection and electroporation for plasmids, there are no special requirements. Conventional plasmids can be used, such as, for example, pUC derivatives.

Transformed cells grow inside plants in the usual way. They can form germ cells and transmit the transformed traits to the offspring of plants. Such plants can be grown in a generally accepted manner and crossed with plants having the same transformed hereditary factors or other hereditary factors. The resulting hybrid individuals have corresponding phenotypic properties. In some preferred embodiments, genes encoding a bacterial protein are expressed from transcriptional units integrated into the plant genome. Preferably, said transcriptional units are recombinant vectors capable of stable integration into the plant genome and enabling selection of lines of transformed plants expressing mRNA encoding proteins.

When inserted, DNA integrates into the genome and is relatively stable in it (and does not come back). Normally, it contains a selective marker that confers resistance to the biocide or antibiotic, such as, but not limited to, kanamycin, G418, bleomycin, hygromycin, or chloramphenicol. Selective plant markers, as a rule, can also confer resistance to various herbicides, such as glufosinate (e.g. PAT / bar), glyphosate (EPSPS), ALS inhibitors (e.g. imidazolinone, sulfonylcarbamide, triazolopyrimidine sulfonanilide, etc.), bromoxiniline, to HPPD inhibitors, PPO inhibitors, ACC-ase inhibitors and many others. Thus, the individually used marker should allow selection of transformed cells, and not cells that do not contain embedded DNA. Preferably, the genes of interest are expressed in a plant cell using constitutive or inducible promoters. When expressed, mRNA is translated into proteins, thus, amino acids of interest are integrated into the protein. Genes encoding a protein expressed in plant cells can be controlled by a constitutive promoter, a tissue-specific promoter, or an inducible promoter.

There are several ways to incorporate foreign recombinant vectors into plant cells and obtain plants that stably preserve and express the integrated gene. Such methods include embedding the genetic material that is coated with the microparticles directly into the cells (US Pat. Nos. 4,945,050 to Cornell and 5,141,131 to DowElanco, currently Dow AgroSciences, LLC). In addition, plants can be transformed using technology using Agrobacterium, see US Pat. Nos. 5,177,010 to the University of Toledo; 5,104,310 Texas A&M; European Patent Application No. 0131624B1; European patent applications Nos. 120516, 159418B1 and 176112 Schilperoot; U.S. Patent Nos. 5149645, 5469976, 5464763, 4940838 and 4693976 Schilperoot; European Patent Applications No. 116718, 290799, 320500 Max Planck; European patent applications Nos. 604662 and 627752 and US Patent No. 5591616 Japan Tobacco; European patent applications Nos. 2,027,159 and 0292435 and US Pat. No. 5,231,019 to Ciba Geigy, currently Syngenta; U.S. Patent Nos. 5,463,174 and 4,762,785 to Calgene; and U.S. Patent Nos. 5,048,663 and 5,159,135 to Agracetus. Another transformation technology includes whisker technology. See U.S. Patent Nos. 5,302,523 and 5,464,765 to Zeneca, currently Syngenta. Another direct DNA delivery transformation technology includes aerosol beam technology. See US Patent No. 6809232. Electroporation technology is also used to transform plants. See WO 87/06614 Boyce Thompson Institute; U.S. Patent Nos. 5,472,869 and 5,384,253 to Dekalb; and WO 92/09696 and WO 93/21335 Plant Genetic Systems. In addition, viral vectors can also be used to produce transgenic plants expressing a protein of interest. For example, monocotyledonous plants can be transformed using a viral vector using the methods described in US Pat. No. 5,596,597 to Mycogen Plant Science and Ciba-Geigy (currently Syngenta), as well as US Pat. Nos. 5,589,367 and 5,316,931 to Biosource, currently Large Scale Biology.

As indicated above, the method by which a DNA construct is inserted into a host plant is not critical to the present invention. You can use any method that provides effective transformation. For example, various methods for transforming plant cells are provided herein and include the use of Ti or Ri plasmids and the like. for mediation of Agrobacterium transformation. In many cases, it is desirable to have a construct used for transformation flanked on one or both sides by the edge regions of T-DNA, more specifically, the right edge region. It is especially useful when a transformation mediated by Agrobacterium tumefaciens or Agrobacterium rhizogenes is used as a transformation method for the construct, although the edge regions of T-DNA can be used in other transformation methods. When using Agrobacterium to transform plant cells, a vector can be used that can be inserted into the host for homologous recombination with T-DNA or the plasmid Ti or Ri present in the host. The incorporation of the vector can be accomplished by electroporation, three parent breeding and other methods of transformation of gram-negative bacteria, known to specialists in this field. A method for transforming an Agrobacterium host using a vector is not critical to the present invention. Plasmid Ti or Ri containing T-DNA for recombination may or may not cause galling and is not critical to the invention provided that vir genes are present in the host.

In some cases, when using Agrobacterium for transformation, the expression construct within the edge regions of T-DNAs will be inserted into a wide variety of vectors, such as pRK2 or its derivatives, as described in Ditta et al. (1980) and EPO 0 120 515. One or more markers, as described herein, will enable selection of transformed Agrobacterium and transformed plant cells in the expression construct and T-DNA. The particular marker used is not essential to the present invention, with the preferred marker being dependent on the host used and design.

To transform plant cells using Agrobacterium, explants can be combined and incubated with transformed Agrobacterium for a period of time sufficient to allow transformation. After transformation, Agrobacteria is destroyed by selection using the appropriate antibiotic and plant cells are cultured with the appropriate selective medium. After the formation of calluses, shoot formation can be stimulated using appropriate plant hormones by methods well known in the field of plant tissue cultivation and plant regeneration. However, the intermediate stage of callus is not always mandatory. After the formation of a shoot, these plant cells can be transferred to a medium stimulating root formation, thereby completing plant regeneration. Then the plants can be grown to produce seeds, and these seeds can be used to obtain future generations. Regardless of the method of transformation, the gene encoding the bacterial protein is preferably inserted into a gene transfer vector adapted for expression of the specified gene in a plant cell by incorporating plant promoter regulatory element as well as 3 ′ untranslated transcription termination regions such as Nos etc.

In addition to numerous plant transformation technologies, the type of tissue brought into contact with foreign genes can also be varied. Such tissue will include, but are not limited to, embryogenic tissue, callus tissue of types I, II, and III, hypocotyl, meristem, root tissue, tissue for expression in the phloem, and the like. Almost all plant tissues can be transformed by dedifferentiation using the appropriate methods described herein.

As indicated above, a variety of selective markers can be used if desired. The preference for a particular marker remains at the discretion of a person skilled in the art, but any of the following selective markers may be used together with any other gene not specified in the present description that may function as a selective marker. Such selective markers include, but are not limited to, the transposon aminoglycoside phosphotransferase gene Tn5 (Aph II) encoding the antibiotic resistance of kanamycin, neomycin, and G41; hygromycin resistance; resistance to methotrexate, as well as genes encoding resistance or resistance to glyphosate; phosphinotricin (bialafos or glufosinate); ALS-inhibiting herbicides (imidazolinones, sulfonylcarbamides and triazolopyrimidine herbicides), ACC-ase inhibitors (e.g., aryloxypropionates or cyclohexanedions), etc., such as bromoxynil, and HPPD inhibitors (e.g., mesotrione)

In addition to the selective marker, the use of a reporter gene may be desirable. In some cases, the reporter gene can be used with or without a selective marker. Reporter genes are genes that are generally not present in the body or tissue of the recipient and, as a rule, are coding proteins that lead to some phenotypic changes or an enzymatic property. Examples of such genes are presented in Weising et al., 1988. Preferred reporter genes include beta-glucuronidase (GUS) gene of E. coli uidA locus, E. coli Tn9 chloramphenicolacetyltransferase gene, Aequorea victoria green fluorescent jellyfish protein gene, and fluorescent genes pyralis. An analysis can then be carried out to determine the expression of the reporter gene at an appropriate time after the incorporation of the gene into the recipient cells. Such a preferred analysis involves the use of a gene encoding beta-glucuronidase (GUS), the E. coli uidA locus, as described in Jefferson et al., (1987), to identify transformed cells.

In addition to the promoter regulatory elements of plants in plant cells, promoter regulatory elements from a variety of sources can be effectively used to express foreign genes. For example, promoter regulatory elements of bacterial origin can be used, such as the octopinsynthase promoter, the nopalin synthase promoter, the mannopinsynthase promoter; promoters of viral origin, such as the cauliflower mosaic virus promoter (35S and 19S), 35T (which is a remodeled 35S promoter, see US Patent No. 6166302, especially Example 7E), and the like. Plant promoter regulatory elements include, but are not limited to, the ribulose 1,6-bisphosphate (RUBP) carboxylase (ssu) small subunit promoter, beta-conglycinin promoter, beta-phaseolin promoter, ADH promoter, heat shock protein promoters, and tissue-specific promoters . Other elements may be present, such as matrix attachment sequences, nuclear matrix binding sequences, introns, enhancers, polyadenylation sequences and the like, and thus can improve transcription efficiency or DNA integration. Such elements may or may not be necessary for the functioning of DNA, although they may provide better expression or functioning of DNA, affecting transcription, stability of mRNA, and the like. Such elements, if desired, can be incorporated into DNA to achieve optimal functioning of the transformed DNA in the plant. Typical elements include, but are not limited to, Adh-intron 1, Adh-intron 6, alfalfa mosaic virus coat protein leader sequence, osmotin UTR sequences, maize streak virus cover protein leader, and others available to those skilled in the art. It is also possible to use constitutive promoter regulatory elements, thereby regulating continuous gene expression in all types of cells and at any time (for example, actin, ubiquitin, CaMV 35S, etc.). Tissue-specific promoter regulatory elements are responsible for gene expression in specific types of cells or tissues, such as leaves or seeds (e.g., zein, oleosin, napin, ACP, globulin, etc.), and can also be used.

Promoter regulatory elements can also be active (or inactive) during a particular phase of plant growth, as well as active in the tissues and organs of a plant. Examples thereof include, but are not limited to, pollen specific, embryospecific, corn stigma specific, cotton fiber specific, root specific, seed endosperm specific, and the like. In specific circumstances, it may be desirable to use an inducible promoter regulatory element responsible for gene expression in response to a specific signal, such as: physical stimulus (heat shock protein genes), light (RUBP-carboxylase), hormone (Em), metabolites, chemicals (tetracycline sensitive) and stress. Other desirable transcriptional and translational elements that function in plants may be used. Many plant specific vectors for gene transfer are known in the art.

Plant bacterial RNA systems can also be used to express bacterial protein. Moreover, the gene encoding the protein can be inserted into the promoter region of the coat protein gene of a suitable plant virus, which infects the host plant of interest. The protein can then be expressed, thus protecting the plant from damage to the herbicides. Plant RNA virus-based systems are described in US Pat. No. 5,500,360 to Mycogen Plant Sciences, Inc. and U.S. Patent Nos. 5,316,931 and 5,589,367 to Biosource, currently Large Scale Biology.

Means of further increasing levels of stability or resistance. In the present description it is shown that the plants of the present invention can be given new signs of resistance to herbicides without the observed adverse effects on the phenotype, including yield. Such plants are included in the scope of the present invention. The plants shown as examples and proposed in the present description, can withstand 2-, 3-, 4- and 5-fold typical application rates, for example, at least one herbicide of the present invention. Improvements to these stability levels are included in the scope of the present invention. For example, various methods are known in the art and can be predictably optimized and further developed to enhance expression of the gene.

One such method involves increasing the copy number of the AAD-12 genes of the present invention (in expression cassettes, etc.). Transformed objects can also be selected in favor of multiple copies of genes.

Strong promoters and enhancers can be used to force expression. Examples of such promoters include the preferred 35T promoter in which 35S enhancers are used. For such purposes, the 35S, ubiquitin corn, ubiquitin arabidopsis, actin A.t. promoters are included. and CSMV. Other potent viral promoters are also preferred. Enhancers include dual OCS and 35S dual enhancer. Matrix attachment sequences (MARs) can also be used to increase the efficiency of transformation and transgene expression.

Shuffling (directed development) and transcription factors can also be used for embodiments of the present invention.

It is also possible to construct protein variants that differ at the sequence level, but retain the same or similar overall necessary three-dimensional structure, surface charge distribution, etc. See, for example, US patent No. 7058515; Larson et al., Protein Sci. 2002 11: 2804-2813, “Thoroughly sampling sequence space: Large-scale protein design of structural ensembles”; Crameri et al., Nature Biotechnology 15, 436-438 (1997), “Molecular evolution of an arsenate detoxification pathway by DNA shuffling”; Stemmer, W. P. C. 1994. “DNA shuffling by random fragmentation and reassembly: in vitro recombination for molecular evolution” Proc. Natl. Acad. Sci. USA 91: 10747-10751; Stemmer, W. P. C. 1994. “Rapid evolution of a protein in vitro by DNA shuffling” Nature 370: 389-391; Stemmer, W. P. C. 1995. Searching sequence space. Bio / Technology 13: 549-553; Crameri, A., et al. 1996. “Construction and evolution of antibody-phage libraries by DNA shuffling” Nature Medicine 2: 100-103; and Crameri, A., et al. 1996. “Improved green fluorescent protein by molecular evolution using DNA shuffling” Nature Biotechnology 14: 315-319.

The activity of recombinant polynucleotides embedded in plant cells may depend on the influence of endogenous plant DNA adjacent to the insert. Thus, another option is to take advantage of objects that are known to be excellent sites for insertions in the plant genome. See for example WO 2005/103266 A1 relating to cotton objects crylF and crylAc; the AAD-12 genome of the present invention can be replaced at the loci of the crylF and / or crylAc insertion genome. Thus, according to the present invention, for example, directed homologous recombination can be used. This type of technology is the subject of, for example, WO 03/080809 A2 and the corresponding published US patent application No. 20030232410 relating to the use of zinc fingers for directional recombination. The use of recombinase (e.g. cre-10x and flp-frt) is also known.

AAD-12 detoxification is believed to occur in the cytoplasm. Thus, aspects of the present invention include means for further stabilizing this protein and mRNA (including blocking mRNA degradation), and thus, methods known in the art can be used. Proteins that are resistant to degradation by proteases and the like can be constructed. (protease cleavage sites can be effectively removed by reconstructing the amino acid sequence of the protein). Such embodiments include the use of a 5'- and 3'-stem-loop structure, such as UTR from osmotin, and per5 (AU-rich 5'-untranslated sequences). You can also use 5'-caps, such as 7-methyl - or 2'-O-methyl groups, for example, the remainder of 7-methylguanilic acid. See, for example: Proc. Natl. Acad. Sci. USA Vol. 74, No. 7, pp. 2734-2738 (July 1977) Importance of 5'-terminal blocking structure to stabilize mRNA in eucaryotic protein synthesis. You can also use protein complexes or ligand-blocking groups.

Within the scope of the present invention, it is also possible to carry out computer design of the 5'- or 3'-UTR most suitable for AAD-12 (synthetic studs). Computer modeling in general, as well as gene shuffling and directed development, are described elsewhere in the present description. More specifically, with respect to computer simulation and UTR, computer simulation methods for use in predicting / evaluating the 5'- and 3'-UTR derivatives of the present invention include, but are not limited to: MFold version 3.1, available from Genetics Corporation Group, Madison, Wis. (see Zucker et al., Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide. In RNA Biochemistry and Biotechnology, 11-43, J. Barciszewski & BFC Clark, eds., NATO ASI Series, Kluwer Academic Publishers, Dordrecht , NL, (1999); Zucker et al., Expanded Sequence Dependence of Thermodynamic Parameters Improves Prediction of RNA Secondary Structure. J. Mol. Biol. 288, 911-940 (1999); Zucker et al., RNA Secondary Structure Prediction. In Current Protocols in Nucleic Acid Chemistry S. Beaucage, DE Bergstrom, GD Glick, and RA Jones eds., John Wiley & Sons, New York, 11.2.1-11.2.10, (2000)), COVE (RNA structure analysis with using covariance models (stochastic contextless grammatical methods)) v. 2.4.2 (Eddy & Durbin, Nucl. Acids Res. 1994, 22: 2079-2088) freely distributed as a source program and which can be downloaded by accessing the website genetics.wustl.edu/eddy/software/, and FOLDALIGN also freely available and available for download at bioinf.au.dk.FOLDALIGN / (see Finding the most significant common sequence and structure motifs in a set of RNA sequences. J. Gorodkin, LJ Heyer and GD Stormo. Nucleic Acids Research, Vol. 25, no. 18 pp 3724-3732, 1997; Finding Common Sequence and Structure Motifs in a set of RNA Sequences. J. Gorodkin, LJ Heyer, and GD Stormo. ISMB 5; 120-123, 1997) .

Embodiments of the present invention can be used in combination with naturally-developed or chemically induced mutants (mutants can be selected using screening methods and then transformed using AAD-12 and, possibly, other genes). You can combine plants of the present invention with resistance to ALS and / or developed resistance to glyphosate. Aminopyralid resistance, for example, can also be combined or "stacked" with the AAD-12 gene.

Conventional cross-breeding methods can also be combined with the present invention to obtain a strong combination, introgression, and improvement of desired traits.

Additional improvements also include the use of, together with appropriate antidotes, to further protect plants and / or to impart cross-resistance to more herbicides. Antidotes typically act to enhance the plant’s immune system through activation / expression of cP450. Antidotes are chemical agents that reduce the phytotoxicity of herbicides against crops using a physiological or molecular mechanism, without compromising the effectiveness of weed control.

Herbicide antidotes include benoxacor, clocvintocet, cyometrinyl, dichloride, dicyclonone, dietholate, fenchlorazole, fenclorim, flurazole, fluxophenim, furylazole, isoxadifen, mefenpyr, mefenate, naphtha anhydride and oxabetri. Plant activators (a new class of compounds protecting plants by activating their protection mechanisms) can also be used in embodiments of the present invention. These include acibenzolar and probenazole.

Commercially available antidotes can be used to protect large seed grassy crops such as maize, sorghum and rice crops when applying seedlings or seedlings of the thiocarbamate and chloroacetanilide families. Antidotes are also being developed to protect winter cereals, such as wheat, in the post-emergence application of aryloxyphenoxypropionate and sulfonyl carbamide herbicides. It is also well known to use antidotes to protect corn and rice from the herbicides of sulfonyl carbamide, imidazolinone, cyclohexanedione, isoxazole and tricetone. The antidote-induced increase in herbicide detoxification in protected plants is widely recognized as the main mechanism of action of the antidote. Antidotes induce cofactors such as glutathione and herbicide detoxifying enzymes such as glutathione S transferases, cytochrome P450 monooxygenases and glucosyl transferases. Hatzios K K, Burgos N (2004) "Metabolism-based herbicide resistance: regulation by safeners," Weed Science: Vol. 52, No. 3 pp. 454-467.

The use of the cytochrome p450 monooxygenase gene stacked with AAD-12 is one of the preferred embodiments. There are P450 involved in the metabolism of herbicides; cP450 may be, for example, of mammalian or plant origin. In higher plants, cytochrome-P450-monooxygenase (P450) is known to carry out secondary metabolism. It also plays an important role in the oxidative metabolism of xenobiotics in interaction with NADPH-cytochrome-P450-oxidoreductase (reductase). Resistance to certain herbicides is reported to result from metabolism using P450, as well as glutathione S-transferase. Using molecular cloning, a number of microsomal P450 species involved in the metabolism of xenobiotics in mammals were characterized. Some of them are reported to metabolize several herbicides efficiently. Thus, transgenic plants with P450 plants or mammals can exhibit resistance to several herbicides.

One of the preferred embodiments of the foregoing is the use of cP450 for resistance to acetochlor (acetochlor products based on the herbicides Surpass®, Keystone®, Keystone LA, FulTime® and TopNotch®) and / or trifluralin (such as Treflan®). Some preferred embodiments include such resistance in soy and / or corn. For further instructions regarding such embodiments, see, for example, Inui et al., "A selectable marker using cytochrome P450 monooxygenases for Arabidopsis transformation," Plant Biotechnology 22, 281-286 (2005) (relating to the selection system for Arabidopsis transformation thaliana by means of Agrobacterium tumefaciens, which uses human cytochrome-P450 monooxygenases metabolizing herbicides; herbicide-resistant seedlings were transformed and selected using the herbicides acetochlor, amiprofos-methyl, chlorprofam, chlorosulfuron, norflurazone p; Siminszky et al., "Expression of a soybean cytochrome P450 monooxygenase cDNA in yeast and tobacco enhances the metabolism of phenylurea herbicides," PNAS Vol. 96, Issue 4, 1750-1755, Feb. 16, 1999; Sheldon et al, Weed Science: Vol. 48, No. 3, pp. 291-295, "A cytochrome P450 monooxygenase cDNA (CYP71A10) confers resistance to linuron in transgenic Nicotiana tabacum"; and "Phytoremediation of the herbicides atrazine and metolachlor by transgenic rice plants expressing human CYP1A1, CYP2B6, and CYP2C19," J Agric Food Chem. 2006 Apr. 19; 54 (8): 2985-91 (related to testing human cytochrome p450 monooxygenase in rice, where rice plants reportedly showed high resistance to chloroacetamides (acetochlor, alachlor, methochlor, pretilachlor and tenylchlor), oxyacetamide (mefenacet) pyridazinones (norflurazone), 2,6-dinitroanalines (trifluralin and pendimethalin), phosphamidates (amiprofos-methyl, thiocarbamates (piributicarbum) and urea (chlorotoluron)).

Various 2,4-D chemical formulations can also be modified or used to make the AAD-12 genes of the present invention more effective. Such possible changes include obtaining better substrates and better leaving groups (greater electronegativity). In addition to 2,4-D, auxin transport inhibitors (e.g., diflufenzopyr) can also be used to increase the herbicidal activity.

Unless specifically indicated or obviously otherwise, the singular terms mean “at least one,” as used herein. All patents, patent applications, provisional applications and publications referenced or cited in the present description, are incorporated into this description by reference in full until they contradict what is presented in the present description.

The following are examples illustrating methods for practicing the invention.

These examples should not be construed as limiting. All percentages are fractions by weight, and all proportions in solvent mixtures are proportions by volume, unless otherwise indicated.

EXAMPLES

EXAMPLE 1

Method for the identification of genes conferring resistance to 2,4-D in the field

As a way to identify genes that have the properties of degradation of herbicides in the field, you can search the currently available publicly available databases, such as the NCBI (National Center for Biotechnology Information). First you need to have an already identified sequence of a functional gene encoding a protein with the desired properties (i.e., the activity of α-ketoglutarate dioxygenase). This protein sequence is then used as input to the BLAST (Basic Local Alignment Search Tool) algorithm (Altschul et al., 1997) for comparison with available protein sequences stored in the NCBI. Using the default settings, this search yields approximately 100 homologous protein sequences at various levels. They range from highly identical (85-98%) to low identical (23-32%) at the amino acid level. As a rule, it is expected that only sequences with high homology will retain properties similar to those of the introductory sequence. In this case, only sequences with ≥50% homology will be selected. As exemplified herein, cloning of recombinantly expressed homologues with as little as 31% conservative amino acids (relative to tfdA from Ralstonia eutropha) can be used to confer commercial resistance levels not only to the intended herbicide, but also to substrates never tested before with these enzymes.

Using the NCBI database (see website ncbi.nlm.nih.gov; Account No. AF516752), a single gene (sdpA) was identified as a homologue with only 31% amino acid identity with respect to tfdA. The percent identity was determined by first converting the sdpA and tfdA DNA sequences stored in the database to proteins, then using ClustalW in the VectorNTI software package to perform multiple sequence alignment.

EXAMPLE 2

Sequence optimization for expression in plants and bacteria

To achieve higher levels of expression of heterologous genes in plants, it may be preferable to reconstruct the protein coding sequence of the genes so that they are more efficiently expressed in plant cells. Corn is one such plant where it may be preferable to reconstruct the heterologous region encoding the protein before transformation to increase the level of gene expression and the level of encoded protein in the plant. Thus, an additional step in the construction of genes encoding a bacterial protein is the reconstruction of a heterologous gene for optimal expression.

table 2
Generalization of data on the content of G + C in the regions of maize genes encoding protein Protein class Range% G + C Average% G + C ^b Metabolic Enzymes (76) 44.4-75.3 59.0 (. + -. 8.0) Structural Proteins (18) 48.6-70.5 63.6 (. + -. 6.7) Regulatory Proteins (5) 57.2-68.8 62.0 (. + -. 4.9) Uncharacterized proteins (9) 41.5-70.3 64.3 (. + -. 7.2) All Proteins (108) 44.4-75.3 60.8 (. + -. 5.2) ^{s a The} number of genes in a class is given in parentheses ^b Standard deviation in parentheses ^{c The} mean for the combined groups is ignored in the mean calculations

One of the reasons for reconstructing the bacterial protein for expression in corn is the non-optimal content of G + C in the native gene. For example, the very low G + C content in many native bacterial genes (and the subsequent shift towards a high A + T content) leads to the formation of sequences that mimic or duplicate the plant gene control sequences, which are known to be significantly rich in A + T. The presence of some A + T-rich sequences in the DNA of genes that are inserted into plants (for example, the TATA box regions normally found in promoters of genes) can lead to abnormal gene transcription. On the other hand, the presence of other regulatory sequences in the transcribed mRNA (for example, polyadenylation signal sequences (AAUAAA) or sequences complementary to small nuclear RNA involved in pre-mRNA splicing) can lead to RNA instability. Thus, one of the goals in constructing genes encoding a bacterial protein for expression in maize, more preferably referred to as genes optimized for plants, is to obtain a DNA sequence having a higher G + C content, and preferably close to that in corn genes encoding metabolic enzymes. Another goal in constructing genes optimized for plants and encoding a bacterial protein is to obtain a DNA sequence in which sequence modifications do not interfere with translation.

Table 2 shows how high the G + C content in corn is. As for the data in Table 2, gene coding regions were obtained from GenBank entries (Issue 71), and base compositions were calculated using MacVector ™ software (Accelerys, San Diego, Calif.). In the calculations, sequences of introns were ignored.

Due to the plasticity provided by the redundancy / degeneracy of the genetic code (i.e., some amino acids are determined by several codons), the evolution of genomes in different organisms or classes of organisms has led to different uses of excess codons. This “codon usage frequency deviation” is reflected in the average base composition in the protein coding regions. For example, organisms with a relatively low G + C content use codons containing A or T in the third position of the excess codons, while organisms with a high G + C content use codons containing G or C in the third position. It is believed that the presence of "minor" codons in mRNA can reduce the absolute translation rate of this mRNA, especially when the relative excess of loaded tRNA corresponding to the minor codon is low. A continuation of this is that a decrease in translation speed through individual minor codons will be at least additive for multiple minor codons. Thus, mRNA having a high relative content of minor codons will have a correspondingly low translation rate. This rate will be reflected in subsequent low levels of the encoded protein.

Table 3
Preferred codons for amino acids in proteins expressed in corn Amino acid Codon * Alanine Gcc / gcg Cysteine TGC / TGT Aspartic acid Gac / gat Glutamic acid GAG / GAA Phenylalanine TTC / TTT Glycine GGC / GGG Histidine CAC / CAT Isoleucine ATC / ATT Lysine AAG / AAA Leucine CTG / CTC Methionine ATG Asparagine AAC / AAT Proline CCG / CCA Glutamine CAG / CAA Arginine AGG / CGC Serine AGC / TCC Threonine ACC / ACG Valine GTG / GTC Tryptophan Tgg

Tyrosine Tac / tat Stop codon TGA / TAG

When constructing genes encoding a bacterial protein for expression in corn (or another plant, such as cotton or soy), the deviation in the frequency of codon use in the plant is determined. The deviation in codon usage in corn is the statistical distribution of codons that the plant uses to encode its proteins, and the preferred use of codons is shown in Table 3. After determining the deviation, determine the percentage codon frequency in the genes of interest. It is necessary to determine the preferred primary codons in the plant, as well as the preferred codons of the second, third and fourth choice, if there is the possibility of multiple selection. You can then construct a new DNA sequence encoding the amino acid sequence in the bacterial protein, but the new DNA sequence differs from the native bacterial DNA sequence (encoding the protein) by substituting plant codons (first preferred, second preferred, third preferred or fourth preferred) to determine the amino acids in each position in the amino acid sequence of the protein. The new sequence is then analyzed for restriction enzyme recognition sites that can be obtained by modification. The identified regions are further modified by replacing the codons with the preferred codons of the first, second, third or fourth choice. Other parts of the sequence that may affect the transcription or translation of the gene of interest are exon-intron junctions (5 ′ or 3 ′), polyadenylation signals, or termination signals for RNA polymerase. The sequence is further analyzed and modified to reduce the frequency of TA or GC doublets. In addition to doublets, G or C blocks in a sequence containing approximately more than four identical residues can influence the transcription of the sequence. Thus, these blocks are also modified by replacing the codons of the first or second choice, etc. preferred codons of the next choice.

Preferably, plant-optimized genes encoding a bacterial protein contain about 63% of the first choice codons, from about 22% to about 37% of the second choice codons, and from about 15% to about 0% of the third or fourth choice codons, where the total percentage is 100%. Most preferably, plant-optimized genes comprise about 63% of the first selection codons, at least about 22% of the second selection codons, about 7.5% of the third selection codons, and about 7.5% of the fourth selection codons, where the total percentage is one hundred%. The method described above allows one skilled in the art to modify genes that are foreign to a particular plant so that genes are optimally expressed in plants. The method is further illustrated in PCT application WO 97/13402.

Thus, to construct genes that are optimized for plants and encoding a bacterial protein, a DNA sequence is constructed that encodes the amino acid sequence of a specified protein using an excess genetic code set in the codon usage frequency deviation table composed of gene sequences of a particular plant or plants. The resulting DNA sequence has a higher degree of codon diversity, the desired base composition, may contain strategically located restriction enzyme recognition sites and does not contain sequences that may interfere with gene transcription or translation of the mRNA product. Thus, for the transformation of hosts, including plants, synthetic genes that are functionally equivalent to the proteins / genes of the present invention can be used. Additional instructions regarding the preparation of synthetic genes can be found, for example, in US patent No. 5380831.

Analysis of rearrangements in plant AAD-12: Extensive analysis of 876 base pairs (bp) of the DNA sequence encoding the native AAD-12 region (SEQ ID NO: 1) revealed the presence of several sequence motifs that are considered to be unfavorable for optimal expression in the plant, as well as non-optimal codon composition. The protein encoded by SEQ ID NO: 1 (AAD-12) is presented as SEQ ID NO: 2. To improve the production of the recombinant protein in monocotyledonous as well as dicotyledonous plants, an AAD-12 (v1) DNA sequence optimized for plants was developed ( SEQ ID NO: 3) encoding a protein (SEQ ID NO: 4), which is the same as native SEQ ID NO: 2, except for the addition of an alanine residue in the second position (underlined in SEQ ID NO: 4). An additional alanine codon (GCT; underlined in SEQ ID NO: 3) encodes a portion of the NcoI restriction enzyme recognition site (CCATGG) overlapping with the translation-triggering ATG codon. Thus, it serves the dual purpose of facilitating subsequent cloning activities while improving the context of the sequence surrounding the ATG initiation codon to optimize translation initiation. Proteins encoded by native and plant-optimized (v1) coding regions are 99.3% identical, differing only in amino acid at position 2. In contrast, native and plant-optimized (v1) plant DNA sequences of coding regions are only on 79.7% identical.

Table 4 shows the differences between the native codon compositions (columns A and D) and plant-optimized sequences (columns B and E), and a comparison with the theoretical plant-optimized sequence (columns C and F) is given.

When considering table 4 it is seen that the native and optimized for plants coding regions, although they encode approximately identical proteins, are significantly different from each other. The plant-optimized version (v1) accurately mimics the composition of the codons in a theoretical plant-optimized coding region encoding the AAD-12 protein.

"Amino acid" - "Amino acid", "Native #" - "Amount in the native sequence", "Plant Opt v1 #" - "Amount in the plant-optimized version (v1)", "Theor. Plant Opt. #" - " Number in theoretical version optimized for plants, "" Totals "-" Total "]

Table 4
Comparison of the composition of codons of coding regions of native AAD-12, optimized for plants version (v1) and theoretical optimized for plants version A B C D E F Amino acid Codon The number in the native sequence Quantity in plant-optimized version (v1) Quantity in Theoretical Plant Optimized Version Amino acid Codon The number in the native sequence Quantity in plant-optimized version (v1) Quantity in a theoretical version optimized for plants ALA (A) Gca one 10 eleven LEU (L) Cta 0 0 0 Gcc 35 16 fifteen CTC one 8 8 Gcg 7 0 0 CTG 23 0 0 Gct 0 eighteen 17 CTT 0 8 8 ARG (R) AGA 0 four 5 Tta 0 0 0 AGG 0 four 6 TTG 0 8 8 Cga 0 0 0 LYS (K) AAA one one 2 Cgc fifteen 6 four Aag 5 5 four Cgg 3 0 0 MET (M) ATG 10 10 10 Cgt 0 four 3 PHE (F) Ttc 7 5 5 ASN (N) Aac 3 2 2 TTT one 3 3 At one 2 2 PRO (P) CCA 0 5 6 ASP (D) Gac fifteen 9 9 CCC 9 four four

Gat 2 8 8 CCG 5 0 0 CYS (C) Tgc 3 2 2 CCT 0 5 5 TGT 0 one one SER (S) AGC 5 four 3 End TAA one 0 one AGT 0 0 0 TAG 0 0 TCA 0 3 3 TGA 0 one Tcc 2 3 3 GLN (Q) CAA one 8 7 TCG 6 0 0 Cag 13 6 7 TCT 0 3 3 GLU (E) GAA 3 four four THR (T) ACA one four 5 Gag 8 7 7 ACC eleven 7 7 GLY (G) Gga 0 8 7 ACG 5 0 0 Ggc 24 7 7 ACT one 7 6 Ggg one 3 four TRP (W) Tgg 8 8 8 Ggt 0 7 7 TYR (Y) Tac four 3 3 HIS (H) CAC 8 9 9 Tat one 2 2 CAT 8 7 7 VAL (V) GTA 0 0 0 ILE (I) ATA 0 2 2 GTC 6 8 7 ATC 10 four 5 GTG eighteen 8 9 ATT one 5 four GTT 0 8 8 Total 163 164 163 Total 130 130 130

Perestroika for expression in E. coli: Specially designed Escherichia coli strains and corresponding vector systems are often used to produce relatively large amounts of proteins for biochemical and analytical studies. It is sometimes found that the native gene encoding the desired protein is poorly suited for high-level expression in E. coli, even if a different genus of bacteria may be the source organism of the gene. In such cases, it is possible and desirable to reconstruct the protein coding region of the gene to make it more suitable for expression in E. coli. Genes of E. coli class II are defined as those that are at a high level and are continuously expressed during the exponential phase of growth of E. coli cells. (Henaut, A. and Danchin, A. (1996) in Escherichia coli and Salmonella typhimurium cellular and molecular biology, vol. 2, pp. 2047-2066. Neidhardt, F., Curtiss III, R., Ingraham, J., Lin, E., Low, B., Magasanik, B., Reznikoff, W., Riley, M., Schaechter, M. and Umbarger, H. (eds. American Society for Microbiology, Washington, DC). By examining the codon compositions of the coding regions of the E. coli class II genes, it is possible to develop an average codon composition for these coding regions of the E. coli class II genes.

It is believed that a protein coding region having an average codon composition that mimics that of class II genes will be suitable for expression during the exponential growth phase of E. coli. Using these guidelines, a new DNA sequence encoding an AAD-12 protein (SEQ ID NO: 4), including additional alanine in the second position, as described above, was constructed in accordance with the average codon composition of the coding regions of class II E. coli genes. The original sequence, the construction of which was based solely on codon composition, was further reconstructed to include specific sequences of restriction enzyme recognition sites suitable for cloning into vectors expressed in E. coli. Adverse sequence features such as stem-loop structures with high stability, as well as intragenic sequences homologous to the 3'-end of the 16S ribosomal RNA (i.e., the Shine-Dalgarno sequence) were avoided. The E. coli-optimized sequence (v2) is described as SEQ ID NO: 5, and it encodes a protein described as SEQ ID NO: 4.

Native and E. coli-optimized (v2) DNA sequences are 84.0% identical, while plant-optimized (v1) and E. coli-optimized (v2) DNA sequences are 76.0% identical. Table 5 presents the codon compositions of the native AAD-12 coding region (columns A and D), the coding region of AAD-12 optimized for expression in E. coli (v2; columns B and E), and the codon composition of the theoretical coding region for the AAD protein -12, having an optimal composition of codons of class II E. coli genes (columns C and F).

When considering table 6 it is seen that the native and E. coli-optimized coding regions, although they encode approximately identical proteins, are significantly different from each other. The E. coli-optimized version (v2) accurately mimics the codon composition in the theoretical E. coli-optimized coding region encoding the AAD-12 protein.

Table 5
Comparison of codon composition of coding regions of native AAD-12, E. coli-optimized version (v2) and theoretical version optimized for E. coli class II genes A B C D E F Amino acid Codon The number in the native sequence Amount in E. coli-optimized version (v2) Amount in the theoretical version optimized for E. coli # class II genes Amino acid Codon The number in the native sequence Amount in E. coli-optimized version (v2) Amount in the theoretical version optimized for E. coli class II genes ALA (A) Gca one 13 13 LEU (L) Cta 0 0 0 Gcc 35 0 0 CTC one 2 0 Gcg 7 eighteen 17 CTG 23 twenty 24 Gct 0 13 fourteen CTT 0 one 0 ARG (R) AGA 0 0 0 Tta 0 one 0 AGG 0 0 0 TTG 0 0 0 Cga 0 0 0 LYS (K) AAA one four 5 Cgc fifteen 6 6 Aag 5 2 one Cgg 3 0 0 MET (M) ATG 10 10 10 Cgt 0 12 12 PHE (F) Ttc 7 6 6 ASN (N) Aac 3 four four TTT one 2 2 At one 0 0 PRO (P) CCA 0 3 2

ASP (D) Gac fifteen 10 9 CCC 9 0 0 Gat 2 7 8 CCG 5 eleven 12 CYS (C) Tgc 3 2 2 CCT 0 0 0 TGT 0 one one SER (S) AGC 5 four four End TAA one one one AGT 0 0 0 TAG 0 0 0 TCA 0 0 0 TGA 0 0 0 Tcc 2 5 four GLN (Q) CAA one 3 3 TCG 6 0 0 Cag 13 eleven eleven TCT 0 four 5 GLU (E) GAA 3 8 8 THR (T) ACA one 0 0 Gag 8 3 3 ACC eleven 12 12 GLY (G) Gga 0 0 0 ACG 5 0 0 Ggc 24 12 eleven ACT one 6 6 Ggg one 0 0 TRP (W) Tgg 8 8 8 Ggt 0 13 fourteen TYR (Y) Tac four 3 3 HIS (H) CAC 8 eleven eleven Tat one 2 2 CAT 8 5 5 VAL (V) GTA 0 6 6 ILE (I) ATA 0 0 0 GTC 6 0 0 ATC 10 7 7 GTG eighteen 8 7 ATT one four four GTT 0 10 eleven Total 163 164 164 Total 130 130 130

Construction of a DNA sequence with a deviation in the use of soybean codons encoding soybean EPSPS having mutations conferring glyphosate resistance. This example describes the construction of a new DNA sequence encoding soybean mutant 5-enolpyruvilshikimate-3-phosphate synthetase (EPSPS), but optimized for expression in soy cells. The amino acid sequence of soybean EPSPS with three mutations is described as SEQ ID NO: 5 in WO 2004/009761. The mutant amino acids in the sequence described in this way are located at position 183 (threonine of the native protein replaced by isoleucine), position 186 (arginine of the native protein replaced by lysine) and position 187 (proline of the native protein replaced by serine). Thus, the amino acid sequence of the native soybean EPSPS protein can be obtained by replacing the substituted amino acids SEQ ID NO: 5 in WO 2004/009761 with the native amino acids at the corresponding positions. Such a native protein sequence is described as SEQ ID NO: 20 in PCT / US2005 / 014737 (registered May 2, 2005). The two-mutation soybean EPSPS protein sequence containing the mutation at position 183 (native protein threonine replaced by isoleucine) and position 187 (native serine replaced proline protein) is described as SEQ ID NO: 21 in PCT / US2005 / 014737.

A table of codon usage in soy protein coding sequences (with maximum glycine content) calculated using 362096 codons (approximately 870 coding sequences) was obtained on the website "kazusa.or.jp / codon". These data were transformed, as shown in Table 6. Columns D and H of Table 6 show the distributions (in% utilization of all codons for this amino acid) of synonymous codons for each amino acid, as found in protein coding regions of soy genes. Obviously, some synonymous codons for certain amino acids (1, 2, 3, 4 or 6 codons can determine the amino acid) are relatively rarely represented in protein-coding regions of soybeans (for example, the comparative use of GCG and GCT codons that define alanine).

The table of deviations of the use of codons in soybeans was calculated using the data from table 6.

Ignored the codons found in soy genes in less than about 10% of the total frequency of a particular amino acid. To balance the distribution of the remaining codons for amino acids, the weighted average frequency for each codon was calculated using the formula:

Weighted average% C1 = 1 / (% C1 +% C2 +% C3 + etc.) ×% C1 × 100

where C1 is the codon in question, C2, C3, etc. represent the remaining synonymous codons, and the% values for the corresponding codons are taken from columns D and H of table 6 (ignoring the values for the rare codons in bold).

The weighted average% of the value for each codon is presented in columns C and G of table 6. TGA was conditionally selected as a translation terminator. Then, codon usage frequency deviations were included in a dedicated genetic code table for use in OptGene ™ gene design software (Ocimum Biosolutions LLC, Indianapolis, Ind.).

Table 6
Frequency of synonymous codons in soy protein coding sequences and calculation of deviation of codon frequency for constructing a synthetic gene optimized for soy A B C D E F G H Amino acid Codon Weighted average% % in soy Amino acid Codon Weighted average% % in soy ALA (A) Gca 33.1 30.3 LEU (L) Cta DNU 9.1 Gcc 24.5 22.5 CTC 22.4 18.1 Gcg DNU * 8.5 CTG 16.3 13,2 Gct 42.3 38.7 CTT 31.5 25.5 ARG (R) AGA 36.0 30.9 Tta DNU 9.8 AGG 32,2 27.6 TTG 29.9 24.2 Cga DNU 8.2 LYS (K) AAA 42.5 42.5

Cgc 14.8 12.7 Aag 57.5 57.5 Cgg DNU 6.0 MET (M) ATG 100.0 one hundred Cgt 16.9 14.5 PHE (F) Ttc 49.2 49.2 ASN (N) Aac 50,0 50,0 TTT 50.8 50.8 At 50,0 50,0 PRO (P) CCA 39.8 36.5 ASP (D) Gac 38.1 38.1 CCC 20.9 19,2 Gat 61.9 61.9 CCG DNU 8.3 CYS (C) Tgc 50,0 50,0 CCT 39.3 36.0 TGT 50,0 50,0 SER (S) AGC 16,0 15.1 End TAA DNU 40.7 AGT 18.2 17.1 TAG DNU 22.7 TCA 21.9 20.6 TGA 100.0 36.6 Tcc 18.0 16.9 GLN (Q) CAA 55.5 55.5 TCG DNU 6.1 Cag 44.5 44.5 TCT 25.8 24.2 GLU (E) GAA 50,5 50,5 THR (T) ACA 32,4 29.7 Gag 49.5 49.5 ACC 30,2 27.7 GLY (G) Gga 31.9 31.9 ACG DNU 8.3 Ggc 19.3 19.3 ACT 37,4 34.3 Ggg 18,4 18,4 TRP (W) Tgg 100.0 one hundred Ggt 30,4 30,4 TYR (Y) Tac 48,2 48,2 HIS (H) CAC 44.8 44.8 Tat 51.8 51.8 CAT 55.2 55.2 VAL (V) GTA 11.5 11.5 ILE (I) ATA 23,4 23,4 GTC 17.8 17.8 ATC 29.9 29.9 GTG 32,0 32,0 ATT 46.7 46.7 GTT 38.7 38.7

To obtain a soybean-optimized DNA sequence encoding an EPSPS protein with two mutations, the protein sequence of SEQ ID NO: 21 from PCT / US2005 / 014737 was back-translated using the OptGene ™ program using the genetic code presented above with a deviation in soybean codon frequencies. Then, the initial DNA sequence obtained in this way was modified to compensate for codon changes (while maintaining the total weighted average codon frequencies) to reduce the number of CG and TA duplets between adjacent codons, increase the number of CT and TG doublets between adjacent codons, and remove intracellular secondary structures with high stability, deletion or addition of restriction enzyme recognition sites and deletion of other sequences that may be unfavorable for expression or activity Wii by cloning the constructed gene. Additional sequence improvements were made to eliminate potential plant sites of intron splicing, long sections of A / T or C / G residues, and other motifs that could interfere with RNA stability, transcription, or translation of the coding region in plant cells. Other changes were made to eliminate long internal open reading frames (frames other than +1). All these changes were carried out within the limits of preserving the codon composition with deviation of soybean codon usage frequencies, as described above, while maintaining the amino acid sequence described as SEQ ID NO: 21 in PCT / US2005 / 014737.

The soybean codon frequency deviation DNA sequence encoding the EPSPS protein SEQ ID NO: 21 is described as bases 1-1575 of SEQ ID NO: 22 in PCT / US2005 / 014737. The synthesis of the DNA fragment containing SEQ ID NO: 22 from PCT / US2005 / 014737 was carried out by a commercial supplier (PicoScript, Houston Tex.).

EXAMPLE 3

Cloning expression vectors and transformation vectors

Construction of E. coli expressing the pET vector: Using restriction enzymes corresponding to the sites added with the additional cloning linkers, (Xba 1, Xho 1) AAD-12 (v2) was excised from the Picoscript vector and ligated into pET280 vector with streptomycin resistance spectinomycin. Then, E. coli TOP10F 'was transformed using the ligation products and placed on agar plates with Luria broth + 50 μg / ml streptomycin and spectinomycin (LB S / S).

To distinguish between the ligation products of AAD-12 (v2): pET280 and pCR2.1: pET280, approximately 20 isolated colonies were placed in 6 ml of LB-S / S and grown at 37 ° C for 4 hours with shaking. Each culture was then applied to LB plates + 50 μg / ml kanamycin, which were incubated at 37 ° C. overnight. Colonies grown on LB-K were considered to contain the ligated vector pCR2.1 and were discarded. Plasmids were isolated from the remaining cultures as described above and checked for compliance by XbaI / XhoI digestion. The final expression construct was designated pDAB3222.

Construction of an Expression Vector for Pseudomonas: An AAD-12 (v2) open reading frame was first cloned into a modified pET expression vector (Novagen), "pET280 S / S", as an XbaI-XhoI fragment. The resulting plasmid pDAB725 was confirmed by restriction enzyme digestion and sequencing reactions. The open reading frame of AAD-12 (v2) from pDAB725 was transferred to an expression vector for Pseudomonas, pMYC1803, as an XbaI-XhoI fragment. Positive colonies were confirmed by restriction enzyme digestion. Using the completed construct, pDAB739 transformed Pseudomonas MB217 and MB324 expression strains.

Finalization of the construction of binary vectors: The plant-optimized AAD-12 gene (v1) was obtained from Picoscript (the reconstruction of the gene was completed (see above) and Picoscript was used for construction) and the sequence was confirmed internally (SEQ ID NO: 3) to ensure no changes in the expected sequence. Sequencing reactions were performed with the forward (SEQ ID NO: 6) and reverse (SEQ ID NO: 7) M13 primers using the Beckman Coulter Dye Terminator Cycle Sequencing with Quick Start Kit reagents as described above. Sequence data was analyzed and the results indicated no anomalies in the plant-optimized AAD-12 (v1) DNA sequence. The AAD-12 (v1) gene was cloned into pDAB726 as a fragment of NcoI-SacI. The resulting construct was designated as pDAB723 containing: [AtUbi10 promoter: Nt OSM 5'UTR: AAD-12 (v1): Nt OSM3 'UTR: ORF1 polyA 3'UTR] (verified by restriction of PvuII and NotI). Then, the NotI-NotI fragment containing the described cassette was cloned into the NotI region of the binary vector pDAB3038. The resulting binary vector pDAB724 containing the following cassette [AtUbi10 promoter: Nt OSM 5'UTR: AAD-12 (v1): Nt OSM 3'UTR: ORF1 polyA 3'UTR: CsVMV promoter: PAT: ORF25 / 26 3'UTR] was subjected restriction (using BamHI, NcoI, NotI, SacI and XmnI) to verify the correct orientation. The proven complete construct (pDAB724) was used to transform Agrobacterium.

Cloning additional constructs for transformation: All other constructs obtained for transforming the respective plant species were constructed using similar methods as described above and other standard molecular cloning methods (Maniatis et al., 1982).

EXAMPLE 4

Arabidopsis transformation and selection

Growing conditions for Arabidopsis thaliana: Wild-type Arabidopsis seeds were suspended in a 0.1% agarose solution (Sigma Chemical Co., St. Louis, Mo.). Suspended seeds were stored at 4 ° C for 2 days to meet dormancy requirements and ensure simultaneous seed germination (stratification).

Sunshine Mix LP5 (Sun Gro Horticulture, Bellevue, Wash.) Was coated with fine-grained vermiculite and subsoil irrigation was performed with Hoagland solution until moist. The soil mixture was allowed to drain for 24 hours. Stratified seeds were sown on vermiculite and covered with humidifier domes (KORD Products, Bramalea, Ontario, Canada) for 7 days.

The seeds sprouted and plants were grown in Conviron (models CMP4030 and CMP3244, Controlled Environments Limited, Winnipeg, Manitoba, Canada) under long day conditions (16 hours of light / 8 hours of darkness) at a light intensity of 120-150 μmol / m ² ⋅ s at a constant temperature (22 ° C) and humidity (40-50%). Plants were irrigated first with a solution of Hoagland, and then with deionized water to keep the soil moist but not wet.

Agrobacterium Transformation: A LB + agar with erythromycin (Sigma Chemical Co., St. Louis, Mo.) (200 mg / l) or spectinomycin (100 mg) was used to obtain a 4 ml preparative culture inoculation colony. / l) containing the dashed colony DH5α. The cultures were incubated overnight at 37 ° C with constant shaking. For plasmid DNA purification, Qiagen (Valencia, Calif.) Spin Mini Preps was used, purifying according to the manufacturer's instructions.

Agrobacterium tumefaciens electrocompetent cells (strains Z707s, EHA101s and LBA4404s) were obtained using the protocol from Weigel and Glazebrook (2002). Agrobacterium competent cells were transformed using an electroporation method adapted from Weigel and Glazebrook (2002). 50 μl of competent Agrobacterium cells were thawed on ice and 10-25 ng of the desired plasmid was added to the cells. A mixture of DNA and cells was added to pre-chilled electroporation cuvettes (2 mm). For the transformation, Eppendorf Electroporator 2510 was used with the following parameters: voltage: 2.4 kV, pulse duration: 5 ms.

After electroporation, 1 ml of YEP broth was added to the cuvette (per liter: 10 g of yeast extract, 10 g of bacto-peptone, 5 g of NaCl), and the suspension of YEP cells was transferred to a 15 ml culture tube. Cells were incubated at 28 ° C in a water bath with constant shaking for 4 hours. After incubation, the culture was placed in YEP + agar plates with erythromycin (200 mg / L) or spectinomycin (100 mg / L) and streptomycin (Sigma Chemical Co., St. Louis, Mo.) (250 mg / L). The plates were incubated for 2-4 days at 28 ° C.

Colonies were selected, streaked onto fresh plates with YEP + agar with erythromycin (200 mg / L) or spectinomycin (100 mg / L) and streptomycin (250 mg / L) and incubated at 28 ° C for 1-3 days. To check for the presence of an inserted gene, colonies were selected for PCR analysis using vector specific primers. To isolate plasmid DNA from selected Agrobacterium colonies, Qiagen Spin Mini Preps was used, isolating according to the manufacturer's instructions with the following exception: 4 ml aliquots of 15 ml of overnight preparative culture (liquid YEP + erythromycin (200 mg / l) or spectinomycin were used for DNA purification (100 mg / l)) and streptomycin (250 mg / l)). An alternative to using Qiagen Spin Mini Prep DNA was the lysis of transformed Agrobacterium cells suspended in 10 μl of water at 100 ° C for 5 minutes. Plasmid DNA from a binary vector used in Agrobacterium transformation was included as a control. PCR reaction was performed using Taq DNA polymerase from Takara Minis Bio Inc. (Madison, Wis.) According to the manufacturer's instructions in 0.5-fold concentrations. PCR reactions were carried out in an MJ Research Peltier thermal cycler programmed to the following conditions; 1) 94 ° C for 3 minutes, 2) 94 ° C for 45 seconds, 3) 55 ° C for 30 seconds, 4) 72 ° C for 1 minute, for 29 cycles, then 1 cycle at 72 ° C for 10 minutes. After completion of the cycles, the reaction mixture was stored at 4 ° C. Amplification products were analyzed by electrophoresis on a 1% agarose gel and visualized by ethidium bromide staining. Colonies were selected whose PCR product was identical to the control plasmid.

Arabidopsis Transformation: Arabidopsis was transformed using the flower bud immersion method. The selected colony was used to inoculate one or more 15-30 ml of precultures in YEP broth containing erythromycin (200 mg / l) or spectinomycin (100 mg / l) and streptomycin (250 mg / l). The cultures were incubated overnight at 28 ° C with constant shaking at 220 rpm. Each preculture was used to inoculate two 500 ml cultures in YEP broth containing erythromycin (200 mg / L) or spectinomycin (100 mg / L) and streptomycin (250 mg / L), and cultures were incubated overnight at 28 ° C with constant shaking. Then the cells were besieged at approximately 8700 × g for 10 minutes at room temperature and the resulting supernatant was discarded. The cell pellet was carefully resuspended in 500 ml of infiltration media containing: ½ × Murashige and Skoog / Vitamin B5 salts according to Hamburg, 10% (w / v) sucrose, 0.044 μM benzylaminopurine (10 μl / liter stock solution 1 mg / ml in DMSO) and 300 μl / liter Silwet L-77. Plants about 1 month old were immersed in the medium for 15 seconds, being confident in the immersion of the newest inflorescences. Then the plants were laid on their side and covered (with a transparent or opaque material) for 24 hours, then washed with water and placed vertically. Plants were grown at 22 ° C with a photoperiod of 16 hours of light / 8 hours of darkness. About 4 weeks after immersion, seeds were harvested.

Selection of Transformed Plants: Freshly harvested T1 seeds [AAD-12 (v1) gene] were allowed to dry for 7 days at room temperature. T1 seeds were sown in germination trays of 26.5 × 51 cm (TO Plastics Inc., Clearwater, Minn.), Each of which was aliquoted in 200 mg of stratified T1 seeds (approximately 10,000 seeds), previously suspended in 40 ml 0 , 1% agarose solution and stored at 4 ° C for 2 days to meet dormancy requirements and ensure simultaneous seed germination.

Sunshine Mix LP5 (Sun Gro Horticulture Inc., Bellevue, Wash.) Was coated with fine-grained vermiculite and groundwater was irrigated with Hoagland solution until it was moistened, then allowing it to drain by gravity. Each aliquot of 40 ml of stratified seeds was evenly sown on vermiculite using a pipette and covered with humidifier domes (KORD Products, Bramalea, Ontario, Canada) for 4-5 days. Domes were removed 1 day before the initial selection of transformants using post-emergence spraying with glufosinate (selection for the cotransformed PAT gene).

Seven days after planting (DAP) and again through 11 DAP, T1 plants (cotyledon and 2-4 leaf phases, respectively) were sprayed with a 0.2% Liberty herbicide solution (200 g of the active ingredient glufosinate / L, Bayer Crop Sciences, Kansas City , Mo.) at a spray volume of 10 ml / tray (703 l / ha) using a DeVilbiss pneumatic sprayer to deliver an effective amount of 280 g of the active ingredient glufosinate / ha for application. Surviving plants (actively growing plants) were determined 4-7 days after the last spray and transferred individually to 3-inch pots with prepared potted media (Metro Mix 360). Transferred plants were covered with humidifier domes for 3-4 days and placed in a growing chamber with a temperature of 22 ° C before being placed in the greenhouse or directly in the greenhouse. Then the domes were removed and the plants were grown in a greenhouse (22 + 5 ° C, 50 + 30% RH, 14 hours of lighting: 10 hours of darkness, at least 500 me / m ² ⋅ s ¹ natural + additional lighting) at least 1 day before testing on the ability of AAD-12 (v1) (a gene optimized for plants) to provide resistance to phenoxy-auxin herbicides.

T1 plants were then randomly assigned various amounts of 2,4-D. In the case of arabidopsis, 50 g ke / ha 2,4-D is an effective dose to distinguish between susceptible plants and plants with significant levels of resistance. Also, increasing amounts (50, 200, 800, or 3200 g ke / ha) were applied to determine relative levels of resistance.

All application of the auxin herbicide was carried out using a DeVilbiss sprayer, as described above, to apply a volume of spray solution of 703 l / ha (0.4 ml solution / 3-inch pot) or apply using an automatic spray device with a spray volume of 187 l / ha. Used 2,4-D was 2,4-D technical category (Sigma, St. Louis, Mo.), dissolved in DMSO and diluted in water (final concentration of DMSO <1%), or commercial composition of dimethylamine salt (456 g ke / l, NuFarm, St Joseph, Mo.). The dichloroprop used was commercial grade dichlorprop formulated as the potassium salt of R-dichloroprop (600 g of active ingredient / L, AH Marks). With increasing herbicides above 800 g ke / ha, the pH of the sprayed solution becomes extremely acidic, resulting in burns of the leaves of young vulnerable Arabidopsis plants and making it difficult to assess the primary effects of the herbicides. It has become common practice to apply these large quantities of herbicides in 200 mM HEPES buffer, pH 7.5.

Some individual T1 plants were exposed to alternative commercial herbicides instead of phenoxyiaxin. One of the points of interest was the determination of whether pyridyloxyacetate auxinous herbicides, triclopyr and fluroxypyr can be effectively degraded in the field. Herbicides were applied to T1 plants using an automatic spraying device with a spray volume of 187 l / ha. T1 plants exhibiting resistance to 2,4-D DMA were further evaluated in the T2 generation.

Selection Results for Transformed Plants: The first transformations of arabidopsis were performed using AAD-12 (v1) (a gene optimized for plants). First, T1 transformants were selected from data on non-transformed seeds using a selection scheme using glufosinate. More than 300,000 T1 seeds were screened and 316 glufosinate-resistant plants (PAT gene) were identified, equating to a transformation / selection rate of 0.10% falling within the normal range of construct selection frequency, where PAT + Liberty was used for selection. Then, the T1 plants subjected to selection, as described above, were transferred to separate pots and sprayed with various amounts of commercial aryloxyalkanoate herbicides.

Table 7
The response of Arabidopsis T1 plants transformed using AAD-12 v1 (optimized for plants) to the range of amounts of 2,4-D applied during the post-emergence period compared to a population of resistant plants (T ₄ ) homozygous for AAD-1 v3, plants transformed using Pat-Cry1F, auxin-susceptible control Transformants T ₁ for the gene AAD-12 v1
Medium % damage % damage <20% 20-40% > 40% Average Standard deviation Raw Control - Buffer 6 0 0 0 0 50 g ke / ha 2,4-D 6 0 2 16 24 200 g ke / ha 2,4-D 6 one one eleven eighteen 800 g ke / ha 2,4-D 5 2 one fifteen twenty 3200 g ke / ha 2,4-D 8 0 0 6 6 PAT / Cry1F (Transformed Control)
Medium % damage % damage <20% 20-40% > 40% Average Standard deviation Raw Control - Buffer 10 0 0 0 0 50 g ke / ha 2,4-D four one 5 31 16 200 g ke / ha 2,4-D 0 0 10 70 2 800 g ke / ha 2,4-D 0 0 10 81 8 3200 g ke / ha 2,4-D 0 0 10 91 2 Transformants T ₁ for the gene AAD-12 v1
Medium % damage % damage <20% 20-40% > 40% Average Standard deviation Raw Control - Buffer 10 0 0 0 0 50 g ke / ha 2,4-D 10 0 0 0 0 200 g ke / ha 2,4-D 10 0 0 0 0 800 g ke / ha 2,4-D 10 0 0 0 0 3200 g ke / ha 2,4-D 9 one 0 2 6

Table 7 compares the response of AAD-12 (v1) and control genes to confer resistance to 2,4-D Arabidopsis T1 transformants. The answer is presented in terms of% visible damage through 2 WAT. Data are presented as a histogram of individual plants showing little or no damage (<20%), moderate damage (20-40%) or severe damage (> 40%). Since each T1 plant is an independent transform, a significant variation in the individual responses of T1 plants can be expected within a specified amount. Arithmetic mean and standard deviation are presented for each treatment. The last column also indicates the range of individual response for each quantity and transformation. PAT / Cry1F-transformed Arabidopsis served as an auxin-susceptible transformed control. The AAD-12 (v1) gene conferred herbicide resistance to individual T1 Arabidopsis plants. Within the limits of this treatment, the response level of plants varied significantly, and this can be attributed to the fact that each plant is an independent transformant.

Table 8
The response of T ₁ Arabidopsis plants to the range of post-emergence R-dichloroprop amounts AAD-12 v1 Gene
Medium % damage % damage <20% 20-40% > 40% Average Standard deviation Raw control 6 0 0 0 0 50 g ke / ha of R-dichloroprop 0 0 8 63 7 200 g ke / ha of R-dichloroprop 0 0 8 85 10 800 g ke / ha of R-dichloroprop 0 0 8 96 four

3200 g ke / ha of R-dichloroprop 0 0 8 98 2 PAT / Cry1F
Medium % damage % damage <20% 20-40% > 40% Average Standard deviation Raw control 10 0 0 0 0 50 g ke / ha of R-dichloroprop 0 10 0 27 2 200 g ke / ha of R-dichloroprop 0 0 10 69 3 800 g ke / ha of R-dichloroprop 0 0 10 83 6 3200 g ke / ha of R-dichloroprop 0 0 10 90 2 T ₄ plants homozygous for the AAD-1 (v3) gene %
damage % damage <20% 20-40% > 40% Average Standard deviation Raw control 10 0 0 0 0 50 g ke / ha of R-dichloroprop 10 0 0 0 0 200 g ke / ha of R-dichloroprop 10 0 0 0 0 800 g ke / ha of R-dichloroprop 10 0 0 0 0 3200 g ke / ha of R-dichloroprop 10 0 0 0 0

It is important to note that for each test amount of 2,4-D, individual plants remained intact, while some plants were severely damaged. The average value of damage in the whole population at the application rate is presented in Table 7 solely to demonstrate a significant difference between plants transformed using AAD-12 (v1) and wild-type plants or PAT / Cry1F-transformed controls. Damage levels tended to increase, and the proportion of intact plants was lower with an increase in application rates to 3200 g ke / ha (or ~ 6-fold application rate in the field). Also, at these high application rates, the spray solution became strongly acidic if it was not buffered. Arabidopsis, grown mainly in the growing chamber, has a very thin cuticle, and severe burn effects can make testing difficult at these elevated application rates. However, many individual plants survived at 3200 g ke / ha 2,4-D with little or no damage.

Table 8 presents a similar analysis of the dose-dependent response of T1 Arabidopsis plants to phenoxypropionic acid, dichloroprop. The data indicate that the herbicidally active (R-) dichloroprop isomer is not a suitable substrate for AAD-12 (v1). The fact that AAD-1 will metabolize R-dichloroprop well enough to confer commercially acceptable stability is one of the distinguishing features that separate the two genes (Table 8). AAD-1 and AAD-12 are considered R- and S-specific α-ketoglutarate dioxygenases, respectively.

AAD-12 (v1) as a selective marker: Initially, the possibility of using AAD-12 (v1) as a selective marker when using 2,4-D as a selective agent was analyzed using Arabidopsis transformed as described above. Approximately 50 seeds of T4 generation Arabidopsis (AAD-12 homozygous (v1)) were added to approximately 5000 wild-type (susceptible) seeds. Several treatments were compared, for each of the trays with plants one or two application times of 2,4-D were used according to one of the following treatment schemes: through 7 DAP, through 11 DAP or through 7, then 11 DAP. Because all individual plants also contained the PAT gene in the same vector for transformation, AAD-12 subjected to selection with 2,4-D can be directly compared with PAT subjected to selection with glufosinate.

Treatments were performed using a DeVilbiss nebulizer as described above. Plants were identified as resistant or susceptible through 17 DAPs. The optimal treatment was 75 g ke / ha 2,4-D, applied 7 and 11 days after planting (DAP), was equally effective in the frequency of selection and led to less damage to the herbicides of individual transformed plants than in the selection scheme with using Liberty. These results suggest that AAD-12 (v1) can be effectively used as an alternative selective marker for the transformed Arabidopsis population.

Inheritance: Many T1 objects self-pollinate to form T2 seeds. These seeds were offspring tested by applying 2,4-D (200 g ke / ha) to 100 random T2 siblings. Each individual T2 plant was transferred to 7.5 cm square pots before spraying (automatic sprayer with a spray volume of 187 l / ha). Seventy-five percent of the T1 families (T2 plants) were split according to the proposed model of 3 resistant: 1 susceptible plant for a dominantly inherited single locus with Mendelian inheritance, as determined by analysis using the chi-square test (P> 0.05).

Seeds from 12 to 20 individual T2 plants (T3 seeds) were harvested. Twenty-five T3 siblings from each of the eight randomly selected T2 families were offspring tested as described above. In each line, approximately one third of the T2 families were identified, which are believed to be homozygotes (non-fissile populations). These data indicate that AAD-12 (v1) is stably integrated and inherited according to the Mendelian type in at least three generations.

Table 9
Comparison of the response of T ₂ plants with AAD-12 (v1) and transformed Arabidopsis control plants to foliar application of various auxin herbicides Pyridyloxyacetic auxins Herbicide treatment Average% damage after 14 DAT Cleaved plants T ₂ with AAD-12 (v1) (pDAB724.01.120) Pat / Cry1f - Control 280 g ke / ha Triklopira 0 52 560 g ke / ha Triklopira 3 58 1120 g ke / ha Triklopira 0 75 * 2240 g ke / ha Triklopira 3 75 * 280 g ke / ha of Fluroxypyr 0 75 * 560 g ke / ha of Fluroxypyr 2 75 * 1120 g ke / ha of Fluroxypyr 3 75 * 2240 g ke / ha of Fluroxypyr 5 75 * Inactive metabolite DCP 280 g ke / ha 2,4-DCP 0 0 560 g ke / ha 2,4-DCP 0 0 1120 g ke / ha 2,4-DCP 0 0 2240 g ke / ha 2,4-DCP 0 0

Additional analysis of herbicide resistance in AAD-12 Arabidopsis by foliar application: The ability of AAD-12 (v1) to provide resistance to other aryloxyalkanoate auxin herbicides in transgenic arabidopsis was determined by foliar application of various substrates. Seeds of generation T2 Arabidopsis were stratified and plated in selection trays in the same manner as in Arabidopsis. Similarly, a transformed control line containing PAT and the Cry1F insect resistance gene was planted. Seedlings were transferred to separate 3-inch pots in a greenhouse. All plants were sprayed using an automatic spraying device set at 187 l / ha. Plants were sprayed using a range of pyridyloxyacetate herbicides: 280-2240 g ke / ha of triclopyr (Garlon 3A, Dow AgroSciences) and 280-2240 g ke / ha of fluroxypyr (Starane, Dow AgroSciences); and the 2,4-D metabolite resulting from the activity of AAD-12, 2,4-dichlorophenol (DCP, Sigma) (in a molar equivalent of 280-2240 g ke / ha 2,4-D, DCP of the technical category was used). All solutions for application were in water. Each treatment was repeated 3-4 times. Plants were evaluated 3 and 14 days after treatment.

No effect of the metabolite of 2,4-D, 2,4-dichlorophenol (DCP) was observed with respect to the transgenic control Arabidopsis (Pat / Cry1F) without AAD-12. AAD-12-transformed plants were also specifically protected from the damage by the herbicides triclopyr and fluroxypyr observed in transformed non-resistant controls (see table 9). These results confirm that Arabidopsis AAD-12 (v1) provides resistance to test pyridyloxyacetic auxins. This is the first report of an enzyme with significant activity against pyridyloxyacetic acid herbicides. No other 2,4-D degrading enzyme with similar activity was reported.

Molecular analysis of Arabidopsis with AAD-12 (v1): Invader analysis (methods of the Third Wave Agbio kit procedures) for analyzing the copy number of the PAT gene was performed using total DNA obtained using the Qiagen DNeasy kit on multiple lines homozygous for AAD-12 ( v1), to determine the stable integration of a plant transformation unit containing PAT and AAD-12 (v1). The analysis evaluated the direct physical linkage of these genes, as they are contained in one plasmid.

The results showed that all of the analyzed 2,4-D-resistant plants analyzed contained PAT (and thus, as implied, AAD-12 (v1)). The analysis of copying showed that the total number of inserts is in the range from 1 to 5 copies. This also correlates with AAD-12 (v1) protein expression data, indicating that the presence of the enzyme leads to significantly high levels of resistance to all commercially available phenoxyacetic and pyridyloxyacetic acids.

Arabidopsis transformed using AAD-12 (v1) molecular stacking and a glyphosate resistance gene: Arabidopsis T1 seeds were prepared as described above containing the plasmid pDAB3759 (AAD-12 (v1) + EPSPS) encoding the putative sign of glyphosate resistance. T1 transformants were selected using AAD-12 (v1) as a selective marker, as described above. T1 plants (objects individually transformed) were obtained in the first selection experiment and transferred to three-inch pots in a greenhouse, as described above. Three different Arabidopsis control lines were also tested: wild-type Columbia-0, AAD-12 (v1) + PAT T4 homozygous lines (transformed using pDAB724), and PAT + Cry1F homozygous line (transformed control). Plants transformed using pDAB3759 and pDAB724 were preselected for resistance to 2,4-D at the seedling stage. Four days after transplanting, the plants were evenly divided for foliar treatment using an automatic spraying device, as described above, with 0, 26.25, 105, 420 or 1680 g ke / ha glyphosate (Glyphomax Plus, Dow AgroSciences) in water. All treatments were repeated 5 to 20 times. Plants were evaluated 7 and 14 days after treatment.

"AAD-12 v1 gene" - "AAD-12 v1 gene", "Averages" - "Medium", "% Injury" - "% damage", "Ave" - "Average", "Std Dev" - "Standard deviation "," Untreated control "-" Raw control, "g ae / ha" - "g ke / ha glyphosate", "Wild type" - "Wild type"]

Table 10
Arabidopsis response to the range of post-emergence glyphosate amounts (via 14 DAT) AAD-12 v1 + EPSPS + HptII gene (pDAB3759)
(Medium) %
damage % damage <20% 20-40
% > 40% Average Standard deviation Raw control 5 0 0 0 0 26.25 g ke / ha glyphosate 13 2 one eleven 16 105 g ke / ha glyphosate 10 one 5 34 38 420 g ke / ha glyphosate 5 6 5 44 37 1680 g ke / ha glyphosate 0 0 16 85 9 PAT / Cry1F
Medium % damage % damage <20% 20-40
% > 40% Average Standard deviation Raw control 5 0 0 0 0 26.25 g ke / ha glyphosate 0 0 5 67 7 105 g ke / ha glyphosate 0 0 5 one hundred 0 420 g ke / ha glyphosate 0 0 5 one hundred 0 1680 g ke / ha glyphosate 0 0 5 one hundred 0

Wild Type (Col-0)
Medium % damage % damage <20% 20-40% > 40% Average Standard deviation Raw control 5 0 0 0 0 26.25 g ke / ha glyphosate 0 0 5 75 13 105 g ke / ha glyphosate 0 0 5 one hundred 0 420 g ke / ha glyphosate 0 0 5 one hundred 0 1680 g ke / ha glyphosate 0 0 5 one hundred 0 pDAB724 T4 (PAT + AAD-12) Medium % damage % damage <20% 20-40
% > 40% Average Standard deviation Raw control 5 0 0 0 0 26.25 g ke / ha glyphosate 0 0 5 66 8 105 g ke / ha glyphosate 0 0 5 one hundred 0 420 g ke / ha glyphosate 0 0 5 one hundred 0 1680 g ke / ha glyphosate 0 0 5 one hundred 0

Plants identified in the initial assessment of resistance as 2,4-D resistant were subsequently determined to be glyphosate resistant when compared with the response of the three control lines. These results indicate that plants can be given resistance to two herbicides with different mechanisms of action, including resistance to 2,4-D and glyphosate, which allows both herbicides to be used in the post-emergence period. In addition, AAD-12 + 2,4-D was effectively used as a selective marker for accurate selection of resistance.

Arabidopsis with AAD-12 genetically stacked with AAD-1 to achieve a wider range of herbicide resistance: Plants with AAD-12 (v1) (pDAB724) and AAD-1 (v3) (pDAB721) were reciprocated and F1 seeds collected . Eight F1 seeds were planted and allowed to grow to produce seeds. From eight F1 plants, tissue samples were obtained and subjected to Western blot analysis to confirm the presence of both genes. It was concluded that all 8 test plants expressed AAD-1 and AAD-12 proteins. Seeds were harvested and allowed to dry for a week before planting.

One hundred F2 seeds were sown and 280 g of active ingredient / ha of glufosinate was applied. Ninety-six F2 plants survived after selection using glufosinate, which corresponds to the expected cleavage ratio for two independently selected glufosinate resistance loci (15 R: 1 S). Then, glufosinate-resistant plants were treated with 560 g ke / ha of R-dichloroprop +560 g ke / ha of triclopyr applied to the plants using the same spraying pattern used for other tests. Plants were classified at 3 and 14 DAT. Sixty-three of the 96 plants that survived after selection using glufosinate also survived after application of the herbicides. These data correspond to the expected cleavage profile (9R: 6S) of two independently selected dominant traits, where each confers resistance to only one of the auxin herbicides (R-dichloroprop or triclopyr). The results indicate that AAD-12 (pDAB724) can be successfully stacked with AAD-1 (pDAB721), thus increasing the range of herbicides that can be applied to the crop of interest [(2,4-D + R-dichloroprop) and (2,4-D + fluroxypyr + triclopyr), respectively]. This can be used to confer highly susceptible species resistance to 2,4-D by conventionally stacking two separate 2,4-D resistance genes. Additionally, if a gene is used as a selectable marker for the third and fourth genes of interest through independent transformations, then each pair of genes can be combined using conventional cross-breeding methods, and then selected in generation F1 by pair spraying with herbicides that are exclusive between AAD-1 and AAD-12 (as shown using R-dichloroprop and triclopyr for AAD-1 and AAD-12, respectively).

Other stacks with AAD are also included in the scope of the present invention. The TfdA protein described elsewhere in the present specification (Streber et al.), For example, can be used in conjunction with the AAD-12 genes of the present invention to impart herbicide resistance spectra to the transgenic plants of the present invention.

EXAMPLE 5

Whisker-mediated transformation of maize using imazetapyr selection

Cloning of AAD-12 (v1): The AAD-12 (v1) gene was excised from the intermediate vector pDAB3283 as an NcoI / SacI fragment. It was ligated directly into the similarly restricted vector pDAB3403 containing the ZmUbi1 promoter for monocotyledonous plants. Two fragments were ligated using T4 DNA ligase, and DH5α cells were transformed using them. Minimum growths of the obtained colonies were obtained using the Qiagen QIA Spin mini prep kit and the colonies were digested with enzymes to check orientation. This first intermediate construction (pDAB4100) contains a ZmUbi1 cassette: AAD-12 (v1). This construct was digested with NotI and PvuI to isolate the genetic cassette and cleave the unwanted skeleton. It was ligated into restricted NotI pDAB2212 containing AHAS as a selective marker, triggered by the rice actin promoter OsAct1. The final construct was designated as pDAB4101 or pDAS1863, and it contained ZmUbi1 / AAD-12 (v1) / ZmPer5 :: OsAct1 / AHAS / LZmLip.

Initiation of a callus suspension culture: To obtain immature embryos for initiating a callus culture, F1 crosses were performed between parents A and B grown in the Hi-II greenhouse (Armstrong et al. 1991). When the embryos reached a size of 1.0-1.2 mm (approximately 9-10 days after pollination), cobs were collected and their surface was sterilized by cleaning with Liqui-Nox® soap, immersed in 70% ethanol for 2-3 minutes, then immersed in 20 % commercial bleach (0.1% sodium hypochlorite) for 30 minutes.

The ears were washed in sterile distilled water, immature zygotic embryos were aseptically separated and cultured in 15Ag10 medium (medium N6 (Chu et al., 1975), 1.0 mg / L 2,4-D, 20 g / L sucrose, 100 mg / l of casein hydrolyzate (enzymatically cleaved), 25 mM L-proline, 10 mg / l AgNO ₃ , 2.5 g / l Gelrite, pH 5.8) for 2–3 weeks with removal of the flaps from the medium. The tissue showing the correct morphology (Welter et al., 1995) was selectively transferred at two-week intervals to fresh 15Ag10 medium for approximately 6 weeks, then at two-week intervals it was transferred to medium 4 (medium N6, 1.0 mg / L 2.4 -D, 20 g / L sucrose, 100 mg / L casein hydrolyzate (enzymatically digested), 6 mM L-Proline, 2.5 g / L Gelrite, pH 5.8) for approximately 2 months.

To initiate embryogenic suspension culture, approximately 3 ml of cell volume (PCV) of callus tissue obtained from a single embryo was added to approximately 30 ml of H9CP + liquid medium (basic MS salt mixture (Murashige and Skoog, 1962), modified MS vitamins containing 10 times less nicotinic acid and 5 times more thiamine chloride, 2.0 mg / l 2,4-D, 2.0 mg / l α-naphthylacetic acid (NAA), 30 g / l sucrose, 200 mg / l casein hydrolyzate ( acid extract), 100 mg / l myoinositol, 6 mM L-proline, 5% v / v coconut milk (added immediately before the subculture tion), pH 6,0). Suspension cultures were maintained under dark conditions in 125 ml Erlenmeyer conical flasks in a thermal shaker set at 125 rpm. at 28 ° C. Cell lines tend to become stable within 2 to 3 months after initiation. During the stabilization period, suspensions were subcultured every 3.5 days by adding 3 ml of PCV cells and 7 ml of conditioned medium to 20 ml of fresh H9CP + liquid using a wide-open pipette. When the doubling of tissue growth began, the suspensions were enlarged and maintained in 500 ml vials, while 12 ml of PCV cells and 28 ml of conditioned medium were transferred to 80 ml of H9CP + medium. When the suspensions were fully stabilized, they were cryopreserved for further use.

Cryopreservation and thawing of suspensions: Two days after subculturing, 4 ml of PCV suspension cells and 4 ml of conditioned medium were added to 8 ml of cryoprotectant (dissolved in H9CP + without coconut milk, with 1 M glycerol, 1 M DMSO, 2 M sucrose, sterilized by filtration) and allowed to shake at 125 rpm. and 4 ° C for 1 hour in a 125 ml bottle. After 1 hour, 4.5 ml was added to a cooled 5.0 ml Corning cryopreservation vessel. After filling, individual vessels were stored for 15 minutes at 4 ° C in a programmable cryo-freezer, then allowed to freeze at a rate of -0.5 ° C / min until a final temperature of -40 ° C was reached. After reaching the final temperature, the vessels were transferred to boxes in racks inside the Cryoplus 4 cryostorage (Form a Scientific) filled with liquid nitrogen vapors.

For thawing, the vessels were removed from the cryogenic storage and placed in a closed container with dry ice, then immersed in a water bath maintained at 40-45 ° C until the boiling was reduced. During thawing, the contents were poured onto a stack of ~ 8 sterile pieces of Whatman filter paper 70 mm thick (No. 4) in closed Petri dishes 100 × 25 mm. For several minutes, the fluids were allowed to soak into the filters, then the top filter containing the cells was transferred to GN6 medium (N6 medium, 2.0 mg / L 2,4-D, 30 g / L sucrose, 2.5 g / L Gelrite , pH 5.8) for 1 week. After 1 week, only tissue with morphology of interest was transferred directly from the filter paper onto fresh GN6 medium. This tissue was subcultured every 7-14 days until 1 to 3 grams was obtained to initiate a suspension culture in approximately 30 ml of H9CP + medium in 125 ml Erlenmeyer conical flasks. Three milliliters of PCV was subcultured in fresh H9CP + medium every 3.5 days until a total of 12 ml of PCV was obtained, after which subculture was performed as described above.

Stable transformation: Approximately 24 hours before the transformation, 12 ml of PCV of the previously cryopreserved suspension of corn embryogenic cells and 28 ml of conditioned medium were subcultured in 80 ml of GN6 liquid medium (GN6 without Gelrite) in a 500 ml Erlenmeyer conical flask and placed on a shaker at 125 rpm and 28 ° C. This was repeated 2 times using the same cell line so that a total of 36 ml of PCV was distributed in 3 vials. After 24 hours, GN6 liquid media was removed and replaced with 72 ml of GN6 S / M osmotic medium (N6 medium, 2.0 mg / L 2,4-D, 30 g / L sucrose, 45.5 g / L Sorbitol, 45, 5 g / l mannitol, 100 mg / l myoinositol, pH 6.0) per vial for plasmolysis of cells. Vials were placed on a shaker at 125 rpm. in the dark for 30-35 minutes at 28 ° C, and during this time a suspension of 50 mg / ml of silicon carbide whiskers was prepared by adding an appropriate volume of 8.1 ml of GN6 S / M liquid medium to ~ 405 mg of pre-autoclaved sterile whiskers from silicon carbide (Advanced Composite Materials, Inc.).

After incubation in GN6 S / M, the contents of each vial were combined in a 250 ml centrifugation flask. When all cells were sedimented, the entire GN6 S / M liquid medium was collected, except ~ 44 ml, and collected in a 1 L sterile vial for further use. A pre-wetted suspension of whiskers was centrifuged on a vortex for 60 seconds at maximum speed, and then 8.1 ml was added to the bottle into which 170 μg of DNA was added as the last step. The bottle was immediately placed in a modified commercial Red Devil 5400 paint mixer and mixed for 10 seconds. After mixing, a mixture of cells, media, whiskers and DNA was added to the contents of a 1 L vial along with 125 ml of fresh GN6 liquid to reconstitute the osmotic gradient solution. Cells were allowed to recover on a shaker at 125 rpm. for 2 hours at 28 ° C before filtering through Whatman No. 4 filter paper (5.5 cm) using a glass cell collector connected to a vacuum pipe.

Approximately 2 ml of the dispersed suspension was pipetted onto the surface of the filter simultaneously with exposure to vacuum. Filters were placed on plates 60 × 20 mm in size from GN6 medium. The cups were cultured for 1 week at 28 ° C in a closed box.

After 1 week, filter paper was transferred to 60 × 20 mm plates with GN6 (3P) medium (N6 medium, 2.0 mg / L 2,4-D, 30 g / L sucrose, 100 mg / L myoinositol, 3 μM imazetapyr from Pursuit ^® DG, 2,5 g / l Gelrite, pH 5,8). The cups were placed in boxes and cultured for an additional week.

Two weeks after transformation, the tissue was poured by scraping all cells on a plate in 3.0 ml of molten GN6 medium with agarose (medium N6, 2.0 mg / L 2,4-D, 30 g / L sucrose, 100 mg / L myoinositol , 7 g / l low-melting agarose, pH 5.8, autoclaved for only 10 minutes at 121 ° C) containing 3 μM imazetapyr from Pursuit ^® DG. The tissue was destroyed and 3 ml of agarose and the tissue was evenly poured onto the surface of a 100 × 15 mm plate with GN6 (3P). This was repeated for all other cups. After pouring cups individually sealed with Nescofilm ^® or Parafilm M ^®, and then cultured until putative isolates.

The method of isolates and regeneration: Expected isolated from transformed objects containing Pursuit ^® sealed cups approximately 9 weeks after transformation by transferring to fresh selection medium of the same concentration in the cup 60 × 20 mm. If steady growth was evident after approximately 2–3 weeks, the object was considered resistant and selected for molecular analysis.

"Event" - "Object", "Spray treatment" - "Spraying", "% Injury" - "% damage", "AAD-12 ELISA" - "ELISA on AAD-12", "AAD-12 PCR" - " PCR on AAD-12, "cloning region" - "cloning region", "AHAS Copy #" - "Copy number of AHAS", "g ae / ha" - "g ke / ha imazetapira", "Band smaller than expected" - "Band less than expected"]

Table 11
Characterization of T0 maize plants transformed using AAD-12 An object Spraying % Damage (14 DAT) ELISA on AAD-12
(ppm TSP) PCR on AAD-12 (cloning region) PCR on AAD-12 (PTU) Copy AHAS (Invader) 4101 (0) 003.001 2240 g ke / ha 2,4-D 0 146.9 + + one 4101 (0) 003.003 2240 g ke / ha 2,4-D 0 153.5 + + one 4101 (0) 005.001 2240 g ke / ha 2,4-D 0 539.7 + + 9 4101 (0) 005.0012 0 g ke / ha 2,4-D 0 562.9 + + 7 4101 (0) 001.001 70 g ke / ha imazetapira 5 170.7 + + 6 4101 (0) 002.001 0 g ke / ha imazetapira 0 105.6 + - 2 4101 (0) 002.002 70 g ke / ha imazetapira 0 105.3 + - 2 4101 (0) 003.002 70 g ke / ha imazetapira 0 0 + Less than expected band fifteen

Regeneration was initiated by transferring callus tissue into induction medium with cytokinins 28 (3P) containing 3 μM imazetapyr from Pursuit.RTM. DG, MS salts and vitamins, 30.0 g / L sucrose, 5 mg / L BAP, 0.25 mg / L 2,4-D, 2.5 g / L Gelrite; pH 5.7. Cells were allowed to grow at low light (13 μΕm ^-2 s ^-1 ) for one week, then at higher light (40 μΕm ^-2 s ^-1 ) for another week before transferring to regenerative medium 36 (3P), identical to 28 (3P), except for the absence of plant growth regulators. Small (3-5 cm) seedlings were removed and placed in 150 × 25 mm culture tubes containing non-selection SHGA medium (base salts and vitamins of Shenk and Hildebrandt, 1972; 1 g / l myoinositol, 10 g / l sucrose, 2, 0 g / l Gelrite, pH 5.8). When the seedlings developed a sufficient root system and shoot system, they were transplanted into the soil in a greenhouse.

In 4 experiments, complete seedlings, consisting of shoots and roots, were formed in vitro on flooded selection dishes in the dark without passing the generally accepted callus phase. Leaf tissues of nine of these "early regenerators" were subjected to PCR coding region and plant transcriptional PCR (PTU) to determine the AAD-12 gene and the genetic cassette, respectively. All contained the intact AAD-12 coding region, while 3 did not have a full-length PTU (Table 11). These "early regenerators" were identified as objects 4101, in order to distinguish them from objects obtained in a conventional manner, identified as objects "1283". Plants from 19 additional objects obtained by standard selection and regeneration were sent to the greenhouse, grown to maturity and cross-pollinated with a patented inbred line to obtain T1 seeds. Some of the objects, apparently, are clones of each other due to the similar character of the formation of stripes during Southern blotting, thus, only 14 unique objects were received. Object T0 plants were resistant to 70 g / ha of imazetapyr. An Invader assay (AHAS gene) revealed the copy number of the insert in the range from 1 to> 10 copies. Thirteen objects contained the complete coding region of AAD-12; however, a subsequent analysis revealed that in the case of nine objects, the complete transcriptional unit of plants was not integrated. None of the anomalous objects of 1863 passed further than stage T1, and objects 4101 were used to further determine the characteristics.

Molecular Analysis - Corn, materials and methods: Tissue collection, DNA isolation and quantitative analysis. Fresh tissue was placed in test tubes and lyophilized at 4 ° C for 2 days. After the fabric was completely dried, a tungsten granule (Valenite) was placed in a test tube and the samples were subjected to dry grinding for 1 minute using a Kelco ball mill. Then, a standard DNA isolation method was performed using DNeasy (Qiagen, DNeasy 69109). An aliquot of the extracted DNA was then stained with Pico Green (Molecular Probes P7589) and analyzed using a fluorimeter (BioTek) with known standards to obtain a concentration in ng / μl.

Invader analysis: DNA samples were diluted to 20 ng / μl, then denatured by incubation in a thermal cycler at 95 ° C for 10 minutes. A Signal Probe mix was then prepared using the provided mixture of oligonucleotides and MgCl ₂ (Third Wave Technologies). An aliquot of 7.5 μl was placed in each well of the Invader assay plate, then an aliquot of 7.5 μl of controls, standards and 20 ng / μl of diluted unknown samples. Each well was covered with 15 μl of mineral oil (Sigma). Then the plates were incubated at 63 ° C for 1 hour and analyzed using a fluorimeter (Biotek).

By calculating the% signal above the background for the target probe, divided by the% signal above the background for the internal control probe, a ratio was obtained. The ratio for known copy standards, obtained and validated by Southern blot analysis, was used to determine the approximate copy number for unknown objects.

Polymerase chain reaction: Only 100 ng of total DNA was used as template. 20 mM of each primer was used with the Takara Ex Taq PCR Polimerase kit (Minis TAKRR001A). Primers for PTU AAD-12 (v1) were direct GAACAGTTAGACATGGTCTAAAGG (SEQ ID NO: 8) and reverse GCTGCAACACTGATAAATGCCAACTGG (SEQ ID NO: 9). The PCR reaction was carried out in a 9700 Geneamp thermal cycler (Applied Biosystems), exposing the samples to 94 ° C for 3 minutes and 35 cycles of exposure to 94 ° C for 30 seconds, 63 ° C for 30 seconds and 72 ° C for 1 minute and 45 seconds, then 72 ° C for 10 minutes.

Primers for the PCR coding region of AAD-12 (v1) were direct ATGGCTCAGACCACTCTCCAAA (SEQ ID NO: 10) and reverse AGCTGCATCCATGCCAGGGA (SEQ ID NO: 11). The PCR reaction was carried out in a 9700 Geneamp thermal cycler (Applied Biosystems), exposing the samples to 94 ° C for 3 minutes and 35 cycles of exposure to 94 ° C for 30 seconds, 65 ° C for 30 seconds, and 72 ° C for 1 minute and 45 seconds, then 72 ° C for 10 minutes. PCR products were analyzed by electrophoresis on a 1% agarose gel stained with EtBr.

Southern Blotting Analysis: Southern blotting analysis was performed using genomic DNA obtained using the Qiagen DNeasy kit. Only 2 μg of genomic DNA from leaves or 10 μg of genomic DNA from callus was digested with BsmI and SwaI restriction enzymes overnight to obtain PTU data.

After digestion overnight, an aliquot of ~ 100 ng was analyzed using a 1% gel to ensure complete digestion. After this verification, samples were analyzed using a large 0.85% agarose gel overnight at 40 Volts. The gel was then denatured in 0.2 M NaOH, 0.6 M NaCl for 30 minutes. The gel was then neutralized in 0.5 M Tris-HCl, 1.5 M NaCl, pH 7.5, for 30 minutes. A blotter device containing a 20-fold SSC was then used to transfer the gel to a nylon membrane (Millipore INYC00010) by gravity overnight. After overnight transfer, the membrane was exposed to UV radiation using a crosslinker (Stratagene UV stratalinker 1800) at 1200 × 100 microjoules. The membrane was then washed in 0.1% SDS, 0.1 SSC for 45 minutes. After washing for 45 minutes, the membrane was dried for 3 hours at 80 ° C, and then stored at 4 ° C until hybridization. A fragment of the matrix for hybridization was obtained using the above PCR coding region using plasmid DNA. The product was subjected to electrophoresis on a 1% agarose gel and excised, and then extracted from the gel using a Qiagen gel extraction method (28706). The membrane was then subjected to prehybridization at 60 ° C for 1 hour in Perfect Hyb buffer (Sigma H7033). The Prime it RmT method dCTP-labeling rxn (Stratagene 300392) was used to prepare a p32-based probe (Perkin Elmer). The probe was purified using Probe Quant columns. G50 (Amersham 27-5335-01). Two million CPMs were used to hybridize Southern blots overnight. After hybridization overnight, the blots were subjected to two washes of 20 minutes at 65 ° C. in 0.1% SDS, 0.1% SSC. Then the blots were exposed to the film overnight, incubating at -80 ° C.

Post-emergence herbicide resistance in T0 maize transformed using AAD-12: Four T0 objects were allowed to acclimatize in the greenhouse and grown until 2-4 new, normal looking leaves from the whorl appeared (i.e., plants switched from tissue culture to growing conditions in greenhouse). Plants were grown at 27 ° C in a greenhouse under 16 hours of light: 8 hours of darkness. The plants were then treated with commercial formulations Pursuit ^® (imazethapyr) or 2,4-D-amine 4. Pursuit ^® sprayed to demonstrate the functioning of the selectable marker gene present in the test objects. The application of the herbicides was carried out using an automatic spraying device with a spray solution volume of 187 l / ha, spray height 50 cm. Plants were sprayed with a lethal dose of imazetapir (70 g ke / ha) or an amount of 2,4-D DMA salt, which could significantly damage untransformed corn lines (2240 g ke / ha). The lethal dose was defined as the amount causing> 95% damage in inbred Hi-II. Hi-II is the genetic background for transformants of the present invention.

Several individual plants were unharmed after treatment with herbicides, the resistance to which they were given the corresponding genes. However, a separate clone '001' of the object '' 001 '' (the so-called 4101 (0) -001-001) received minor damage, but recovered to 14 DAT. Three of the four objects were used later; individual plants were crossed with 5XH751 and received the next generation. Each herbicide resistant plant was positive for the presence of the AAD-12 coding region (PCR analysis) or the presence of the AHAS gene (Invader analysis) in the case of plants resistant to 2,4-D and imazetapyr, respectively. AAD-12 protein was determined in all 2,4-D resistant T0 plants containing the intact coding region. The transgene copy number (AHAS and, as implied, AAD-12) varied significantly from 1 to 15 copies. Individual T0 plants were grown to maturity and cross-pollinated with a patented inbred line to produce T1 seeds.

Verification of high resistance to 2,4-D in T1 maize: T1 seeds with AAD-12 (v1) were sown in 3-inch pots containing Metro Mix media, and 70 g ke / ha imazetapira was sprayed on plants in phase 2 of the leaves to eliminate the plants not containing an insert. Surviving plants were transplanted into 1 gallon pots containing Metro Mix media and placed under the same growing conditions as described above. In phase V3-V4, the plants were sprayed in an automatic spraying device set to 187 l / ha at 560 or 2240 g ke / ha 2,4-D DMA. Plants were classified in 3 and 14 DAT and compared with control plants 5XH751 x Hi-II. A rating scale of 0-10 (from no damage to critical damage by auxins) was developed to distinguish between damage to the supporting root. The reference root was evaluated at 14 DAT to demonstrate resistance to 2,4-D. 2,4-D causes deformation of the supporting root, which is an appropriate indicator of damage to auxin herbicides in corn. The estimates of the reference root (as can be seen from the table below) indicate that 2 of the 3 tested objects were stably resistant to 2240 g ke / ha of 2,4-D DMA. Object "pDAB4101 (0) 001.001" was apparently unstable; however, two other objects were stably resistant to 2,4-D and 2,4-D + imazetapyr or 2,4-D + glyphosate (see table 12).

"Herbicide" - "Herbicide", "Untransformed control" - "Non-transformed control", "g ae / ha" - "g ke / ha", "A scale of 0-10, 10 being the highest, was used for grading the 2,4-D DMA injury. Results are a visual average of four replications per tratment "-" A scale of 0 to 10, where 10 is the highest score, was used to classify damage from 2,4-D DMA. The results are the average for visual assessment for four repetitions per processing "]

Table 12
Damage to the supporting root of T1 plants transformed using AAD-12 (v1) and non-transformed control maize plants: medium damage to the supporting root
(scale 0-10) Herbicide Untransformed control AAD-12 (v1) pDAB4101 (0) 003.003 AAD-12 (v1) pDAB4101 (0) 001.001 AAD-12 (v1) pDAB4101 (0) 005.001 0 g ke / ha 2,4-D DMA 0 0 0 0 2240 g ke / ha 2,4-D DMA 9 one 8 0 A scale from 0 to 10, where 10 is the highest score, was used to classify damage from 2,4-D DMA. The results are the average of the visual assessment for four repetitions per treatment

Inheritance of AAD-12 (v1) in maize: The offspring of seven T1 families with AAD-12 (v1) crossed with 5XH751 were also tested. Seeds were planted in three inch pots as described above. In the three-leaf phase, all plants were sprayed with 70 g ke / ha of imazetapir in an automatic spraying device as described above. After 14 DAT, resistant and susceptible plants were counted. Four of the six test lines were split according to a single locus, the dominant trait with Mendelian inheritance (1R: 1S), as determined by chi-square analysis. Then, the surviving plants were sprayed with 2,4-D and all plants were considered resistant to 2,4-D (amounts> 560 g ke / ha). AAD-12 is inherited as a resistant gene for resistance to aryloxyalkanoate auxins in many species when reciprocated with a commercial hybrid.

Stacking AAD-12 (v1) to increase the spectrum of herbicides: AAD-12 (v1) (pDAB4101) and the elite inbred line Roundup Ready (BE1146RR) were reciprocally crossed and F1 seeds were collected. Seeds were planted from two F1 lines and treated with 70 g ke / ha of imazetapyr in phase V2 to eliminate plants without an insert. Of the surviving plants, the repeating ones were separated and treated with 1120 g ke / ha 2,4-D DMA + 70 g ke / ha imazetapyr (to confirm the presence of the AHAS gene) or 1120 g ke / ha 2,4-D DMA + 1680 g ke / ha glyphosate (to confirm the presence of the Round Up Ready gene) in an automatic sprayer calibrated at 187 l / ha. Plants were classified at 3 and 16 DAT. Spraying data showed that AAD-12 (v1) can be stacked in the conventional manner with a glyphosate resistance gene (such as the Roundup CP4-EPSPS gene) or other herbicide resistance genes to produce an increased spectrum of herbicides that can be safely applied to corn. Similarly, in plants F1, resistance to imidazolinone + 2,4-D + glyphosate was observed and no negative phenotype was observed with molecular or breeding stack combinations of these numerous transgenes.

Table 13
Data showing an increase in the spectrum of resistance to herbicides as a result of AAD-12 (v1) and BE1146RR (elite resistant inbred line, shortened as AF) in F1: average% damage after 16 DAT Herbicide Untransformed control 2P782 (Roundup Ready Control) AAD-12 (v1) pDAB4101 (0) 003.R003.AF AAD-12 (v1) pDAB4101 (0) 005.R001.AF 0 g ke / ha 2,4-D DMA 0 0 0 0 1120 g ke / ha 2,4-D DMA 21 19 0 0 1120 g ke / ha 2,4-D DMA + 70 g ke / ha imazetapira one hundred one hundred 5 one 1120 g ke / ha 2,4-D DMA + 1680 g ke / ha glyphosate one hundred 71 2 5

Resistance of transformed maize plants pDAB4101 to 2,4-D herbicides, triclopyr and fluroxypyr in the field: Field tests of the resistance level were carried out at two sites with AAD-12 (v1) pDAB4101 (4101 (0) 003.R.003.AF and 4101 (0) 005.R001.AF) and one Roundup Ready (RR) control hybrid (2P782) in Fowler, Ind. and Wayside, Miss. Seeds were planted using a 40-inch row spacing seeder at Wayside and 30 inches at Fowler. The design of the experiment was a randomized full block plan with 3 repetitions. The experimental options were 2,4-D (dimethylamine salt) at 1120, 2240 and 4480 g ke / ha, triclopyr at 840 g ke / ha, fluroxypyr at 280 g ke / ha and untreated control. Objects with AAD-12 (v1) contained the AHAS gene as a selective marker. F2 maize objects were split, so plants with AAD-12 (v1) were treated with imazetapyr at 70 g ke / ha to remove plants that did not contain the insert. When the corn reached phase V6, herbicide treatments were carried out using a pneumatic knapsack sprayer that released a volume of spray solution of 187 l / ha under a pressure of 130-200 kPa. Visual assessment of damage was carried out at 7, 14 and 21 days after treatment. Damage of the support root was assessed on 28 DAT on a scale of 0-10, where 0-1 represents the fusion of the support root, 1-3 - moderate thickening of the support root / deviation and proliferation of the root, 3-5 - moderate fusion of the support root, 5-9 - severe fusion of the supporting root and deformation, and 10 represents complete inhibition of the supporting roots.

The response of the object from AAD-12 (v1) to 2,4-D, triclopyr and fluroxypyr 14 days after treatment is presented in Table 14. The damage to the crop was the most severe after 14 DAT. Control corn RR (2P782) was severely damaged (44% after 14 DAT) 2,4-D at 4480 g ke / ha, which is an 8-fold (8 x) field application rate. All objects with AAD-12 (v1) showed exceptional resistance to 2,4-D through 14 DAT at 0% damage at 1-, 2- and 4-fold application rates, respectively. Control corn (2P782) was severely damaged (31% after 14 DAT) at a 2-fold application rate of triclopyr (840 g ke / ha). Objects with AAD-12 (v1) demonstrated stability at a 2-fold application rate of triclopyr with an average of 3% damage through 14 DAT for two objects. Fluroxypyr at 280 g ke / ha caused 11% visible damage to wild-type maize after 14 DAT. Objects with AAD-12 (v1) showed increased resistance with an average of 8% damage after 5 DAT.

Table 14
Visible damage to objects with AAD-12 and wild-type corn after foliar treatments of 2,4-D, triclopyr and fluoxypyr in the field:% of visible damage after 14 DAT Treatment Application rate
(g ke / ha) AAD-12 4101 (0) 003.R.003.AF AAD-12 4101 (0) 005.001.AF 2P782 control Untreated 0 0 0 0 2,4-D 1120 0 0 9 2,4-D 2240 0 one twenty 2,4-D 4480 0 one 34 Fluoxypyr 280 one 5 eleven Triclopyr 840 3 four 31 Dicamba 840 8 8 eleven

Treatment with maize auxin herbicides in the V6 growth phase may cause deformation of the supporting roots. Table 15 presents the severity of damage to the supporting root caused by 2,4-D, triclopyr and fluroxypyr. Triclopyr at 840 g ke / ha caused the most severe fusion of the supporting root and deformation, leading to an average score of 7 points for the control of the root of the root of the wild-type control corn 2P782.

"Treatment" - "Processing", "Rate (g ae / ha)" - "Application rate (g ke / ha)", "control" - "control", "Untreated" - "Untreated", "Fluoxypyr" - " Fluoxypyr "," Triclopyr "-" Triclopyr "," Dicamba "-" Dicamba "]

Table 15
Assessment of support root damage in AAD-12 and wild-type maize plants in response to 2,4-D, triclopyr and fluoxypyr in the field: Assessment of support root damage (on a scale of 0-10) through 28 DAT Treatment Application rate (g ke / ha) AAD-12 4101 (0) 003.R.003.AF AAD-12 4101 (0) 005.001.AF 2P782 control Untreated 0 0 0 0

2,4-D 1120 0 0 3 2,4-D 2240 0 0 5 2,4-D 4480 0 0 6 Fluoxypyr 280 0 0 2 Triclopyr 840 0 0 7 Dicamba 840 one one one

Both corn objects with AAD-12 (v1) showed no damage to the supporting root after treatment with triclopyr. Damage to the supporting root in corn 2P782 increased with increasing rates of application of 2,4-D. At 4480 g ke / ha 2,4-D, objects with AAD-12 showed no damage to the support root; while the 2P782 hybrid observed severe fusion of the support root and deformation. Fluroxypyr caused only a moderate thickening and deflection of the support root in wild-type corn, while no damage to the support root was observed in objects with AAD-12 (v1).

These data clearly indicate that AAD-12 (v1) gives maize a high level of resistance to 2,4-D, triclopyr and fluroxypyr at application rates that are much higher than those commercially used and cause heavy visible maize without AAD-12 (v1) damage and damage to the supporting root.

EXAMPLE 6

Tobacco transformation

The transformation of tobacco using Agrobacterium tumefaciens was carried out by a method similar, but identical, published methods (Horsch et al., 1988). To obtain a source of tissue for transformation, tobacco seeds (Nicotiana tabacum cv. KY160) were surface sterilized and plated on the surface of TOB medium, which is a hormone-free Murashige-Skoog medium (Murashige and Skoog, 1962), agar cured. Plants were grown for 6-8 weeks in a lighted incubator room at 28-30 ° C and leaves were sterile collected for use in transformation. Fragments of approximately one square centimeter in size excluding the middle vein were sterilely cut from these leaves. Cultures of Agrobacterium strains (EHA101S containing pDAB3278, also referred to as pDAS1580, AAD-12 (v1) + PAT), grown overnight in a bottle on a shaker set at 250 rpm, at 28 ° C, were precipitated by centrifugation, resuspended in sterile Murashige-Skoog salts and adjusted to a final optical density of 0.5 at 600 nm. Leaf fragments were immersed in this bacterial suspension for approximately 30 seconds, then dried on sterile paper towels, placed right-side up on TOB + medium (Murashige-Skoog medium containing 1 mg / l indolyl-3-acetic acid and 2.5 mg / l benzyladenine) and incubated in the dark at 28 ° C. Two days later, leaf fragments were transferred to TOB + medium containing 250 mg / L cefotaxime (Agri-Bio, North Miami, Fla.) And 5 mg / L ammonium glufosinate (active ingredient in Basta, Bayer Crop Sciences), and incubated at 28- 30 ° C under lighting. Leaf fragments were transferred to fresh TOB + medium with cefotaxime and Basta twice a week for the first two weeks and once a week thereafter. 4-6 weeks after processing leaf fragments using bacteria, small plants that developed from the transformed foci were removed from this preparation and planted in TOB medium containing 250 mg / L cefotaxime and 10 mg / L Basta in Phytatray ™ II vessels ( Sigma). These seedlings were grown in a lighted incubator room. After 3 weeks, stem fragments were obtained and re-rooted in the same media. Plants were ready for shipment to the greenhouse after another 2-3 weeks.

Plants were transferred to the greenhouse, washing the agar from the roots, transplanting into the soil into 13.75 cm square pots, placing the pot in a Ziploc ^® bag (SC Johnson & Son, Inc.), placing tap water at the bottom of the bag, and placing it under indirect lighting in a greenhouse at 30 ° C for one week. After 3-7 bags were opened; the plants were fertilized and allowed to grow in an open bag until the plants were acclimatized in the greenhouse when the bag was removed. Plants were grown under generally accepted warm conditions in a greenhouse (30 ° C, 16 hours of illumination, 8 hours of darkness, minimum natural + additional light = 500 me / m ² s ¹ ).

Before propagation from plants, T0 samples were taken for DNA analysis to determine the copy number of the insert. For convenience, the PAT gene, molecularly coupled to AAD-12 (v1), was analyzed. Fresh tissue was placed in test tubes and lyophilized at 4 ° C for 2 days. After the fabric was completely dried, a tungsten granule (Valenite) was placed in a test tube and the samples were subjected to dry grinding for 1 minute using a Kelco ball mill. Then, standard DNA isolation was performed using DNeasy (Qiagen, DNeasy 69109). An aliquot of the extracted DNA was then stained with Pico Green (Molecular Probes P7589) and analyzed using a fluorimeter (BioTek) with known standards to obtain a concentration in ng / μl.

DNA samples were diluted to 9 ng / μl and then denatured by incubation in a thermal cycler at 95 ° C for 10 minutes. A Signal Probe mix was then prepared using the provided mixture of oligonucleotides and MgCl ₂ (Third Wave Technologies). An aliquot of 7.5 μl was placed in each well of the Invader assay plate, then an aliquot of 7.5 μl of controls, standards and 20 ng / μl of diluted unknown samples. Each well was covered with 15 μl of mineral oil (Sigma). Then the plates were incubated at 63 ° C for 1.5 hours and analyzed using a fluorimeter (Biotek).

When calculating the% signal above the background for the target probe, divided by the% signal above the background for the internal control probe, a ratio was obtained. The ratio for known copy standards, obtained and validated by Southern blot analysis, was used to identify the approximate copy number for unknown objects.

All objects were also analyzed for the presence of the AAD-12 (v1) gene by PCR using the same isolated DNA samples. A total of 100 ng of total DNA was used as the template. Used 20 mm of each primer with a set of Takara Ex Taq PCR Polimerase. The primers for the PCR transcriptional unit of plants (PTU) of AAD-12 were (SdpacodF: ATGGCTCATGCTGCCCTCAGCC) (SEQ ID NO: 12) and (SdpacodR: CGGGCAGGCCTAACTCCCCCACAA) (SEQ ID NO: 13). The PCR reaction was carried out in a 9700 Geneamp thermal cycler (Applied Biosystems), exposing the samples to 94 ° C for 3 minutes and 35 cycles of exposure to 94 ° C for 30 seconds, 64 ° C for 30 seconds and 72 ° C for 1 minute and 45 seconds, then 72 ° C for 10 minutes. PCR products were analyzed by electrophoresis on a 1% agarose gel stained with EtBr. 4-12 clonal lines from each of 18 PCR-positive objects with 1-3 copies of the PAT gene (and, obviously, AAD-12 (v1), because these genes are physically connected) were regenerated and transferred to the greenhouse.

Table 16
T0 tobacco objects transformed using pDAS1580 (AAD-12 (v1) + PAT) Tube number Plant ID Copy PAT PCR for PTU AAD-12 Full PTU and less than 2 Full PTU and 1 copy Relative herbicide tolerance one 1580 [1] -001 6 + Not tested 2 1580 [1] -002 8 + Not tested 3 1580 [1] -003 10 + Not tested four 1580 [1] -004 one + * * High 5 1580 [1] -005 2 + * Variable 6 1580 [1] -006 6 + Not tested 7 1580 [1] -007 four + Not tested 8 1580 [1] -008 3 + Variable

9 1580 [1] -009 four + Not tested 10 1580 [1] -010 8 + Not tested eleven 1580 [1] -011 3 + High 12 1580 [1] -012 12 + Not tested 13 1580 [1] -013 13 + Not tested fourteen 1580 [1] -014 four + Not tested fifteen 1580 [1] -015 2 + * High 16 1580 [1] -016 one ? + * * High 17 1580 [1] -017 3 + High eighteen 1580 [1] -018 one + * * Variable 19 1580 [1] -019 one + * * Variable twenty 1580 [1] -020 one + * * Not tested 21 1580 [1] -021 one + * * Not tested 22 1580 [1] -022 3 + Variable 23 1580 [1] -023 one + * * Variable 24 1580 [1] -024 one + * * Variable 25 1580 [1] -025 5 + Not tested

26 1580 [1] -026 3 + Variable 27 1580 [1] -027 3 + Low 28 1580 [1] -028 four + Not tested 29th 1580 [1] -029 3 + Variable thirty 1580 [1] -030 one + * * High 31 1580 [1] -031 one + * * High 32 1580 [1] -032 2 + * High To distinguish between herbicide resistance indices, an assessment of relative stability was necessary when processing 560 g ke / ha of fluoxypyr, where resistance varied among objects

Post-emergence herbicide resistance in transformed T0 tobacco plants with AAD-12 (v1): T0 plants from each of 19 objects were tested using a wide range of 2,4-D, triclopyr or fluroxypyr sprayed onto tall plants

3-4 inches. Spraying was carried out as described above using an automatic spraying device with a spray volume of 187 l / ha. The corresponding clones from each object were coated with 2,4-D dimethylamine salt (Riverside Corp) mixed with deionized water in an amount of 0, 140, 560 or 2240 g ke / ha. Fluroxypyr was applied similarly in an amount of 35, 140 or 560 g ke / ha. Triclopyr was applied in an amount of 70, 280, or 1120 g ke / ha. Each treatment was repeated 1-3 times. Damage assessments were performed at 3 and 14 DAT. Each test object was more resistant to 2,4-D than the non-transformed KY160 control line. Several objects experienced some initial epinasty associated with auxin herbicides at doses of 560 g ke / ha 2,4-D or less. Some objects were intact when 2,4-D was applied in an amount of 2240 g ke / ha (equivalent to a 4-fold application rate). In general, objects with AAD-12 (v1) were more susceptible to fluroxypyr, then triclopyr, and 2,4-D was least damaged. The quality of the objects in relation to the resistance value was determined using the responses of T0 plants to 560 g ke / ha of fluroxypyr. Resistance of the objects was classified as “low” (> 40% of damage after 14 DAT), “medium” (20-40% of damage), “high” (<20% of damage). Some objects had a fickle response among duplicate plants, and were considered "variables."

Confirmation of the high resistance to 2,4-D in tobacco T1: Two to four separate T0 plants that survived after exposure to high doses of 2,4-D and fluroxypyr were stored from each object and allowed them to self-pollinate in a greenhouse to obtain T1 seeds. T1 seeds were stratified and sown in selection trays, as in the case of Arabidopsis, followed by the selective removal of non-transformed plants without inserts in this split population using 560 g of active ingredient / ha of glufosinate (PAT gene selection). Surviving plants were transferred to separate 3-inch pots in a greenhouse. These lines provided high levels of resistance to 2,4-D in the T0 generation. In T1 plants obtained not directly from tissue culture, improved constancy of response was suggested. These plants were compared with wild-type tobacco KY160. All plants were sprayed using an automatic spraying device set at 187 l / ha. Plants were sprayed with amounts of 2,4-D dimethylamine salt (DMA) in the range of 140-2240 g ke / ha, triclopyr in the range of 70-1120 g ke / ha, or fluroxypyr in the range of 35-560 g ke / ha. All spray solutions were in water. Each treatment was repeated 2-4 times. Plants were evaluated 3 and 14 days after treatment. Plants were assigned a degree of damage with respect to stunted growth, chlorosis, and necrosis. The T1 generation was split, so some variable response was expected due to differences in zygosity.

Table 17
The response of fissionable tobacco plants T ₁ with AAD-12 to phenoxy- and pyridyloxy-auxin herbicides Herbicide KY160 - Wild Type 1580 (1) -004 (high stability in generation T ₀ ) 1580 (1) -018 (high stability in generation T ₀ ) The average% damage in duplicate plants after 14 DAT 140 g ke / ha 2,4-D DMA 45 0 0 560 g ke / ha 2,4-D DMA 60 0 0 2240 g ke / ha 2,4-D DMA 73 0 0 70 g ke / ha of triclopyr 40 0 5 280 g ke / ha triclopyr 65 0 5 1120 g ke / ha triclopyr 80 0 8 35 g ke / ha of fluroxypyr 85 0 8 140 g ke / ha of fluroxypyr 93 0 10 560 g ke / ha of fluroxypyr one hundred 3 eighteen

In the case of 2,4-D, no damage was observed at a 4-fold application rate (2240 g ke / ha) or lower. Some injuries were observed when treating with triclopyr in the same line of objects, but the greatest damage was observed when processing with fluroxypyr. Damage to fluroxypyr was short-term, and growth at one site was almost indistinguishable from the untreated control at 14 DAT (table 17). It is important to note that untransformed tobacco is extremely susceptible to fluroxypyr. These results suggest that using AAD-12 (v1), you can get a commercial level of resistance to 2,4-D, even in auxin-susceptible dicotyledonous crops such as tobacco. These results also showed that resistance to pyridyloxyacetic acid herbicides, triclopyr and fluroxypyr can be conferred. Having the ability to prescribe treatment with a herbicide-resistant crop protected by AAD-12 using various active ingredients having different weed control spectra is highly applicable to farmers.

Inheritance of AAD-12 (v1) in tobacco: 100 descendant plants were also tested in seven T1 lines from lines with AAD-12 (v1). Seeds were stratified, sown and transplanted in accordance with the method described above, except that plants that did not contain the insert were not removed by selection using Liberty. Then all plants were sprayed with 560 g ke / ha 2,4-D DMA, as described above. After 14 DAT, resistant and susceptible plants were counted. Five of the seven test lines were split according to one locus, the dominant trait with Mendelian inheritance (3R: 1S), as determined by chi-square analysis. AAD-12 is inherited as a resistant gene for resistance to aryloxyalkanoate auxins in many species.

Resistance of tobacco plants with pDAS1580 to 2,4-D herbicides, dichloroprop, triclopyr and fluroxypyr in the field: Field tests of the resistance level were carried out on three lines with AAD-12 (v1) (objects pDAS1580- [1] -018.001, pDAS1580- [ 1] -004.001 and pDAS1580- [1] -020.016) and one wild-type line (KY160) at field stations in Indiana and Miss. Tobacco seedlings were grown in a greenhouse by planting T1 seeds in 72-well seedling trays (Hummert International) containing Metro 360 media according to the above growing conditions. Plants without insertion were selectively removed by selection using Liberty, as described above. Seedlings were transferred to field stations and planted at intervals of 14 or 24 inches using industrial transplanters. To maintain intensive plant growth, drip irrigation was used at the Mississippi station, and sprinkler irrigation was used at the Indiana station.

The design of the experiment was a plan with split plots with 4 repetitions. Herbicide treatment was the main plot, and the tobacco line was fake. The experimental options were 2,4-D (dimethylamine salt) in an amount of 280, 560, 1120, 2240 and 4480 g ke / ha, triclopyr in an amount of 840 g ke / ha, fluroxypyr in an amount of 280 g ke / ha and an untreated control. The test plots contained one row of 25-30 feet. Herbicide treatments were carried out 3-4 weeks after transplantation using a pneumatic knapsack sprayer, releasing a volume of solution for spraying 187 l / ha under a pressure of 130-200 kPa. Visual assessment of damage, growth inhibition and epinastia was performed on 7, 14 and 21 days after treatment.

Table 18
The response of tobacco plants from AAD-12 to 2,4-D, triclopyr and fluroxypyr in the field Herbicide treatment Average% damage on site after 14 DAT Active ingredient amount Wild type PDAS1580- [1] -004.001 PDAS1580- [1] -020.016 PDAS1580- [1] -018.001 2,4-D 280 g ke / ha 48 0 0 0 2,4-D 560 g ke / ha 63 0 0 2 2,4-D 1120 g ke / ha 78 one one 2 2,4-D 2240 g ke / ha 87 four four four 2,4-D 4480 g ke / ha 92 four four four Triclopyr 840 g ke / ha 53 5 5 four Fluroxypyr 280 g ke / ha 99 eleven eleven 12

The response from AAD-12 (v1) to 2,4-D, triclopyr and fluroxypyr is shown in Table 18. The untransformed tobacco line was severely damaged (63% through 14 DAT) 2,4-D at 560 g ke / ha, considered as a 1-fold application rate. All AAD-12 (v1) lines showed exceptional resistance to 2,4-D through 14 DAT with average damage of 1, 4 and 4% damage observed at 2-, 4- and 8-fold application rates, respectively. The non-transformed tobacco line was severely damaged (53% after 14 DAT) with a 2-fold application rate of triclopyr (840 g ke / ha); while lines with AAD-12 (v1) showed resistance with an average of 5% damage through 14 DAT among the three lines. Fluroxypyr at 280 g ke / ha caused severe damage (99%) in the untransformed line through 14 DAT. Lines with AAD-12 (v1) showed increased resistance with an average of 11% damage after 14 DAT.

These results indicate that lines of transformed objects with AAD-12 (v1) exhibit a high level of resistance to 2,4-D, triclopyr and fluroxypyr with a multiple increase in commercially available application rates, which are lethal or cause severe epinastic deformations in untransformed tobacco in typical field conditions.

Protection using AAD-12 (v1) against increased amounts of 2,4-D: Results showing protection using AAD-12 (v1) against increased amounts of 2,4-D DMA in a greenhouse are shown in Table 19. T1 plants with AAD-12 (v1) from the object was cleaved as 3R: 1S by selection using 560 g of active ingredient / ha Liberty using the same method as described above. T1 seeds with AAD-1 (v3) were also planted as transformed tobacco controls (see PCT / US2005 / 014737). Non-transformed KY160 served as susceptible control. Plants were sprayed using an automatic spraying device set at 187 l / ha at 140, 560, 2240, 8960 and 35840 g ke / ha of 2,4-D DMA, and evaluated at 3 and 14 DAT.

AAD-12 (v1) and AAD-1 (v3) effectively protected tobacco from 2,4-D damage at doses up to 4 times the commercial application rate. However, plants with AAD-12 (v1) clearly demonstrated a significant advantage over AAD-1 (v3), protecting against 64-fold standard application rates.

"Treatment" - "Processing", "control" - "control", "Average% Injury of Replicates 14 DAT" - "Average% damage to duplicate plants after 14 DAT", "g ae / ha" - "g ke / ha "]

Table 19
Results demonstrating protection against increased amounts of 2,4-D provided by AAD-12 (v1) and AAD-1 (v3) Treatment KY160 control AAD-1 (v3) AAD-12 (v1) The average% damage in duplicate plants after 14 DAT 2240 g ke / ha 2,4-D 95 four 0 8960 g ke / ha 2,4-D 99 9 0 35840 g ke / ha 2,4-D one hundred 32 four

Stacking AAD-12 for increasing the herbicidal spectrum: Plants reciprocally crossed homozygous for AAD-12 (v1) (pDAS1580) and AAD-1 (v3) (pDAB721) (see PCT / US2005 / 014737 for the latter), and collected seeds F1. F1 seeds from two reciprocally crossed plants with each gene were stratified and 4 duplicate plants from each crossing were treated according to the same spraying scheme that was used for other tests with one of the following treatments: 70, 140, 280 g ke / ha of fluroxypyr (gene selection AAD-12 (v1)); 280, 560, 1120 g ke / ha of R-dichloroprop (selection by AAD-1 (v3) gene); or 560, 1120, 2240 g ke / ha 2,4-D DMA (to confirm resistance to 2,4-D). Homozygous T2 plants were also planted with each gene for use as controls. Plants were classified after 3 and 14 DAT. The spraying results are presented in table 20.

The results confirm that AAD-12 (v1) can be successfully stacked with AAD-1 (v3), thus increasing the range of herbicides that can be applied to the crop of interest (phenoxyacetic acids + phenoxypropionic acids vs. phenoxyacetic acids + pyridyloxyacetic acids for AAD-1 and AAD-12, respectively). The complementary nature of herbicide cross-resistance patterns makes it possible to conveniently use these two genes as complementary and stackable selective markers in the field. In the case of crops in which resistance when using one gene may be insignificant, one skilled in the art will understand that it is possible to increase resistance by stacking with a second resistance gene to the same herbicide. This can be done using the same gene with the same or different promoters; however, as observed in this case, the stacking and tracking of two complementary features can be facilitated by differing cross-protection from phenoxypropionic acids [using AAD-1 (v3)] or pyridyloxy acetic acids [using AAD-12 (v1)].

Table 20
Comparison of cross resistance to auxin herbicides in T2 plants with AAD-12 (v1) (pDAS1580) and AAD-1 (v3) (pDAB721) with F1 hybrid AAD-12 x AAD-1 and wild type Treatment Average% damage after 14 DAT KY160 wild-type control AAD-12 (v1) (pDAS1580) AAD-1 (v3) (pDAB721) AAD-12 (v1) x AAD (v3) F1 560 g ke / ha 2,4-D 63 0 0 0 1120 g ke / ha 2,4-D 80 0 four 0 2240 g ke / ha 2,4-D 90 0 9 0 280 g ke / ha of R-dichloroprop 25 fifteen 0 0 560 g ke / ha of R-dichloroprop 60 fifty 0 0 1120 g ke / ha of R-dichloroprop 80 70 3 0 70 g ke / ha of fluroxypyr 40 0 40 0 140 g ke / ha of fluroxypyr g ke / ha of fluroxypyr 65 0 60 0 280 g ke / ha of fluroxypyr 75 3 75 3

EXAMPLE 7

Soybean transformation

Soya is improved by gene transfer methods for traits such as herbicide resistance (Padgette et al., 1995), amino acid modification (Falco et al., 1995), and insect resistance (Parrott et al., 1994). To introduce foreign traits into the crop, methods are needed that will make it possible to routinely produce transgenic lines using selectable marker sequences containing simple inserts. To simplify breeding, transgenes should be inherited as a single functional locus. The delivery of foreign genes into cultured soybean is reported by microparticle bombardment of the rib of a zygotic embryo (McCabe et al., 1988) or somatic embryogenic cultures (Finer and McMullen, 1991) and Agrobacterium-mediated transformation of cotyledon explants (Hinchee et al., 1988) or (Chee et al., 1989).

Transformants obtained through Agrobacterium-mediated transformation typically contain simple inserts with low copy number (Birch, 1991). There are advantages and disadvantages associated with each of the three target tissues studied for gene transfer to soybeans, scarring of zygotic embryos (Chee et al., 1989; McCabe et al., 1988), cotyledons (Hinchee et al., 1988) and somatic embryogenic cultures (Finer and McMullen, 1991). The latter ones are intensively investigated as target tissue for direct gene transfer. Embryogenic cultures, as a rule, proliferate well and can be maintained for a long period. However, the shelf life of embryogenic suspensions is associated with sterility and chromosomal aberrations of primary transformants (Singh et al., 1998), and thus, for the soybean transformation systems using this tissue, continuous initiation of new cultures seems to be necessary. This system requires a high level of 2,4-D, a concentration of 40 mg / l, to initiate embryogenic callus, and this represents a fundamental problem in the use of the AAD-12 (v1) gene, because the transformed locus cannot develop further with 2,4-D in the medium. Thus, transformation using a meristem is ideal for developing 2,4-D resistant plants using AAD-12 (v1).

Gateway-cloning of binary constructs: The AAD-12 (v1) coding sequence was cloned into five different Gateway donor vectors containing various plant promoters. Then, the resulting AAD-12 (v1) expression cassettes for plants were cloned into the final Gateway binary vector using the LR clonase reaction (Invitrogen Corporation, Carlsbad Calif., Cat. No. 11791-019).

The NcoI-SacI fragment containing the AAD-12 (v1) coding sequence was excised from DASPICO12 and ligated at the corresponding NcoI-SacI restriction sites into the following Gateway donor vectors: pDAB3912 (attL1 // CsVMV promoter // AtuORF23 3'UTR // attL2) ; pDAB3916 (attL1 // AtUbi10 promoter // AtuORF23 3'UTR // attL2); pDAB4458 (attL1 // AtUbi3 promoter // AtuORF23 3'UTR // attL2); pDAB4459 (attL1 // promoter ZmUbi1 // AtuORF23 3'UTR // attL2) and pDAB4460 (attL1 // promoter AtAct2 // AtuORF23 3'UTR // attL2). The resulting constructs containing the following expression cassettes for plants were designated as: pDAB4463 (attL1 // CsVMV promoter // AAD-12 (v1) // AtuORF23 3'UTR // attL2); pDAB4467 (attL1 // AtUbi10 promoter // AAD-12 (v1) // AtuORF23 3'UTR // attL2); pDAB4471 (attL1 // AtUbi3 promoter // AAD-12 (v1) // AtuORF23 3'UTR // attL2); pDAB4475 (attL1 // promoter ZmUbi1 // AAD-12 (v1) // AtuORF23 3'UTR // attL2) and pDAB4479 (attL1 // promoter AtAct2 // AAD-12 (v1) // AtuORF23 3'UTR // attL2 ) These constructs were verified by restriction enzyme digestion and sequencing.

The plant expression cassettes were recombined into the final Gateway binary vector pDAB4484 (RB7 MARv3 // attR1-ccdB resistance to chloramphenicol-attR2 // promoter CsVMV // PATv6 // AtuORF1 3'UTR) using the LR Gateway clonase reaction. Gateway technology uses lambda phage site-specific recombination instead of using a restriction endonuclease and ligase to insert the gene of interest into the expression vector. Invitrogen Corporation, Gateway Technology: A Universal Technology to Clone DNA Sequences for Functional Analysis and Expression in multiple Systems, Technical Manual, Catalog # 's 12535-019 and 12535-027, Gateway Technology Version E, Sep. 22, 2003, # 25-022. DNA recombination sequences (attL, and attR,) and a mixture of LR clonase enzymes allow transfer of any DNA fragment flanked by the recombination site to any vector containing the corresponding site. Plot attL1 of the donor vector corresponds to attR1 of the binary vector. Similarly, the attL2 region of the donor vector corresponds to the attR2 of the binary vector. Using Gateway technology, an expression cassette for plants (from a donor vector) flanked by attL regions can be recombined into attR regions of a binary vector. The resulting constructs containing the following plant expression cassettes were labeled as: pDAB4464 (RB7 MARv3 // CsVMV promoter // AAD-12 (v1) // AtuORF23 3'UTR // CsVMV promoter // PATv6 AtuORF1 3'UTR); pDAB4468 (RB7 MARv3 // AtUbi10 promoter // AAD-12 (v1) // AtuORF23 3'UTR // CsVMV promoter // PATv6 // AtuORF1 3'UTR); pDAB4472 (RB7 MARv3 // AtUbi3 promoter // AAD-12 (v1) // AtuORF23 3'UTR // CsVMV promoter // PATv6 // AtuORF1 3'UTR); pDAB4476 (RB7 MARv3 // ZmUbi1 promoter // AAD-12 (v1) // AtuORF23 3'UTR // CsVMV promoter // PATv6 AtuORF1 3'UTR); and pDAB4480 (RB7 MARv3 // AtAct2 promoter // AAD-12 (v1) // AtuORF23 3'UTR // CsVMV promoter // PATv6 // AtuORF1 3'UTR). These constructs were verified by restriction enzyme digestion and sequencing.

Transformation Method 1 - Agrobacterium-mediated Transformation: In the first reports of soybean transformation, meristem cells were used in the cotyledonous region (Hinchee et al., 1988) and propagation of shoots from the apical meristem (McCabe et al., 1988). In the method using A. tumefciciens and the cotyledon node, an explant was obtained and, using the composition of the culture media, stimulated proliferation of the auxillary meristem in the node (Hinchee et al., 1988). It remains unclear whether the culture of differentiated, but totipotent, callus is actually initiated using these treatments. The isolation of numerous clones of the transformation object from one explant and the rare isolation of chimeric plants (Clemente et al., 2000; Olhoft et al., 2003) indicate the origin of a single cell followed by the multiplication of transgenic cells to obtain a culture of proliferating transgenic meristem or uniformly transformed shoot, further propagated shoots. The original method for propagating soybean shoots is based on microparticle bombardment (McCabe et al., 1988), but it has recently been adapted for Agrobacterium-mediated transformation (Martinell et al., 2002), which obviously does not reach the same level or type of differentiation as in the method using cotyledon node, because the system is based on the successful identification of germline chimeras. In addition, this method is not based on the use of 2,4-D, which would be ideal for a selection system with 2,4-D. Thus, a method using a cotyledonous node may be the method of choice for the development of 2,4-D resistant soybean cultivars.

Obtaining stable phenotypes with AAD-12 (v1) using plant transformation. To obtain transgenic plants with AAD-12 (v1), Maverick seed explants and a method of Agrobacterium-mediated cotyledon node transformation were used.

Agrobacterium preparation and inoculation: Agrobacterium EHA101 strain (Hood et al. 1986) carrying each of the five binary pDAB vectors was used to initiate the transformation (Table 8). Each binary vector contains an AAD-12 (v1) gene cassette and a plant selection gene (PAT) in the T-DNA region. Plasmids were introduced into the Agrobacterium EHA101 strain by electroporation. Then, the selected colonies were analyzed for insertion of genes before the treatment of Agrobacterium soy explants. Maverick seeds were used in all transformation experiments and were obtained from the University of Missouri, Columbia, Mo.

Agrobacterium-mediated soybean transformation (Glycine max) was carried out using the PAT gene as a selectable marker along with the herbicide glufosinate as a selective agent. Seeds were germinated on B5 minimal medium (Gamborg et al. 1968), cured with 3 g / L phytagel (Sigma-Aldrich, St. Louis, Mo.). Then, the selected shoots were transferred to the rooting medium. The optimal selection scheme was the use of glufosinate at a concentration of 8 mg / l in the medium during the appearance phases of the first and second shoots and at a concentration of 3-4 mg / l in the medium during shoot growth in length.

Before transferring the longer shoots (3-5 cm) to the rooting medium, the cut end of the internodes was immersed in 1 mg / L of indolyl-3-butyric acid for 1-3 minutes to stimulate rooting (Khan et al. 1994). The shoots were sprouted roots in 25 × 100 mm glass culture tubes containing rooting medium, and then they were transferred to the soil mixture for acclimatization of seedlings in Metro-mix 200 (Hummert International, Earth City, Mo.) in open Magenta boxes in Conviron. When a shoot emerged and grew in length, glufosinate, the active ingredient of the Liberty herbicide (Bayer Crop Science), was used for selection. Rooted seedlings were acclimatized in open Magenta boxes for several weeks before being screened and transferred to the greenhouse for further acclimatization and evaluation.

Analysis of putatively transformed seedlings and analyzes to evaluate T0 plants in a greenhouse: For screening for putative transformants, 50 mg / L of glufosinate was applied twice to the leaflet from the selected leaves of these seedlings twice with a weekly interval to observe the results. Then, the seedlings subjected to screening were transferred to the greenhouse and, after acclimatization, glufosinate was again applied to the leaves to confirm the stability of these seedlings in GH and considered them as putative transformants.

In the future, plants transferred to the greenhouse can be analyzed for the presence of the active PAT gene in a non-destructive way by applying a solution of glufosinate [0.05-2% vol./about. To the leaf part of the primary transformant T0 or its descendant. Liberty herbicide, preferably 0.25-1.0% (v / v) = 500-2000 ppm glufosinate, Bayer Crop Science]. Depending on the concentration used, damage assessment with glufosinate can be done 1-7 days after treatment. Plants can also be tested for resistance to 2,4-D in a non-destructive way by selectively applying a solution of 2,4-D in water (0.25-1% v / v of the commercial composition of 2,4-D dimethylamine salt, preferably 0 , 5% vol./about. = 2280 ppm 2,4-D ke) on the leaflet of the new blossoming three-leaf nodes, one or two, preferably two, below the last three-leaf node appeared. This analysis allows you to evaluate susceptible to 2,4-D plants from 6 hours to several days after application by evaluating the reorientation or rotation of the sheet> 90 degrees relative to the plane of adjacent leaves. 2,4-D resistant plants will not respond to 2,4-D. T0 plants were allowed to self-pollinate in a greenhouse to produce T1 seeds. T1 plants (and to the extent sufficient to obtain T0 plant clones) will be sprayed using the dose range of the herbicides to determine the level of herbicide protection provided by the AAD-12 (v1) and PAT genes in the transgenic soybean. The 2.4-D application rates used for T0 plants will typically contain one or two selective application rates in the range of 100-1120 g ke / ha applied using an automatic spraying device as described above. T1 plants will be treated with a wider dose range of 50-3200 g ke / ha 2,4-D. Similarly, plants T0 and T1 can be screened for glufosinate resistance by post-emergence treatment of 200-800 and 50-3200 g ke / ha of glufosinate, respectively. The glyphosate resistance gene (in plants transformed using constructs containing EPSPS) or other glyphosate resistance can be evaluated in the T1 generation by post-emergence glyphosate applications in a dose range of 280-2240 g ke / ha glyphosate. Individual T0 plants were evaluated for the coding region of the gene of interest (AAD-12 (v1) or PAT v6) and copy number. The determination of inheritance of AAD-12 (v1) will be carried out using the cleavage of offspring T1 and T2 with respect to herbicide resistance, as described in the examples above.

A subpopulation of the initial transformants was evaluated in the T0 generation by the above methods. Any plant for which the presence of the AAD-12 (v1) coding region was confirmed, regardless of the promoter initiating the transcription of the gene, did not respond to the application of 2,4-D to the leaves, in contrast to the wild type Maverick soybeans. Plants transformed exclusively using PAT responded to the application of 2,4-D to the leaves in the same way as wild-type plants.

A subpopulation of plants having a size similar to the size of control wild-type plants was treated with 2,4-D using 560 or 1120 g ke 2,4-D. All plants containing AAD-12 (v1) were obviously resistant to herbicide treatment compared to wild-type Maverick soybeans. Two plants with AAD-12 (v1) showed a slight level of damage (at 2 DAT), however, the damage was temporary and no damage was observed at 7 DAT. Wild type control plants were severely damaged after 7-14 DAT at 560 g ke / ha 2,4-D and died at 1120 g ke / ha. These data are consistent with the fact that AAD-12 (v1) can confer high tolerance (> 2 times the application rate) to susceptible crops such as soybeans. Then, samples of screened plants were taken for molecular and biochemical analyzes to confirm the insertion of AAD-12 (v1) genes, copy number and gene expression levels.

Molecular Tests - Soya: Tissue collection, DNA isolation and quantitative analysis. Fresh tissue was placed in test tubes and lyophilized at 4 ° C for 2 days. After the fabric was completely dried, a tungsten granule (Valenite) was placed in a test tube and the samples were subjected to dry grinding using a Kelco ball mill for 1 minute. Then, standard DNA isolation was performed using DNeasy (Qiagen, DNeasy 69109). An aliquot of the extracted DNA was then stained with Pico Green (Molecular Probes P7589) and analyzed using a fluorimeter (BioTek) with known standards to obtain a concentration in ng / μl.

Polymerase chain reaction: only 100 ng of total DNA was used as template. Used 20 mm of each primer with a set of Takara Ex Taq PCR Polimerase (Minis TAKRR001A). The primers for the AAD-12 PTU (v1) were (direct ATAATGCCAGCCTGTTAAACGCC) (SEQ ID NO: 8) and (reverse CTCAAGCATATGAATGACCTCGA) (SEQ ID NO: 9). The PCR reaction was carried out in a 9700 Geneamp thermal cycler (Applied Biosystems), exposing the samples to 94 ° C for 3 minutes and 35 cycles of exposure to 94 ° C for 30 seconds, 63 ° C for 30 seconds, and 72 ° C for 1 minute and 45 seconds, then 72 ° C for 10 minutes. Primers for the PCR coding region of AAD-12 (v1) were (direct ATGGCTCATGCTGCCCTCAGCC) (SEQ ID NO: 10) and (reverse CGGGCAGGCCTAACTCCACCAA) (SEQ ID NO: 11). The PCR reaction was carried out in a 9700 Geneamp thermal cycler (Applied Biosystems), exposing the samples to 94 ° C for 3 minutes and 35 cycles of exposure to 94 ° C for 30 seconds, 65 ° C for 30 seconds, and 72 ° C for 1 minute and 45 seconds, then 72 ° C for 10 minutes. PCR products were analyzed by electrophoresis on a 1% agarose gel stained with EtBr.

Southern Blot Analysis: Southern blot analysis was performed using total DNA obtained using the Qiagen DNeasy kit. Only 10 μg of genomic DNA was digested overnight to obtain embedding data. After digestion overnight, an aliquot of ~ 100 ng was analyzed with a 1% gel to ensure complete digestion. After this verification, samples were analyzed using a large 0.85% agarose gel overnight at 40 Volts. The gel was then denatured in 0.2 M NaOH, 0.6 M NaCl for 30 minutes. The gel was then neutralized in 0.5 M Tris-HCl, 1.5 M NaCl, pH 7.5, for 30 minutes. A blotter device containing a 20-fold SSC was then used to transfer the gel to a nylon membrane (Millipore INYC00010) by gravity overnight. After overnight transfer, the membrane was exposed to UV radiation using a crosslinker (Stratagene UV stratalinker 1800) at 1200 × 100 microjoules. The membrane was then washed in 0.1% SDS, 0.1 SSC for 45 minutes. After washing for 45 minutes, the membrane was dried for 3 hours at 80 ° C, and then stored at 4 ° C until hybridization. A fragment of the matrix for hybridization was obtained using the above PCR coding region using plasmid DNA. The product was subjected to electrophoresis on a 1% agarose gel and excised, and then extracted from the gel using a Qiagen gel extraction method (28706). The membrane was then subjected to prehybridization at 60 ° C for 1 hour in Perfect Hyb buffer (Sigma H7033). The Prime it RmT method dCTP-labeling rxn (Stratagene 300392) was used to prepare a p32-based probe (Perkin Elmer). The probe was purified using Probe Quant columns. G50 (Amersham 27-5335-01). Two million CPMs were used to hybridize Southern blots overnight. After hybridization overnight, the blots were subjected to two washes of 20 minutes at 65 ° C. in 0.1% SDS, 0.1% SSC. Then the blots were exposed to the film overnight, incubating at -80 ° C.

Biochemical Assays - Soybean: Collecting tissue samples and isolating AAD-12 (v1) protein from soybean leaves. Approximately 50 to 100 mg of leaf tissue was collected from N-2 leaves subjected to 2,4-D, but after 1 DAT. The terminal leaflet N-2 was removed, cut into small fragments or 2 discs from leaves from a separate locus (~ 0.5 cm in diameter) and immediately frozen on dry ice. Thus, protein analysis (ELISA and Western blot analysis) was performed.

T1 offspring assessment: T0 plants were allowed to self-pollinate to produce T1 families. Testing offspring (cleavage analysis) was performed using glufosinate at a concentration of 560 g of active ingredient / ha as a selective agent applied to the growth phase V1-V2. The surviving plants were then analyzed for resistance to 2,4-D in one or more of the growth phases of V2-V6. Seeds were obtained by self-pollination to enable wider testing of herbicides on transgenic soybeans.

Maverick soybean plants transgenic for AAD-12 (v1) were obtained using an Agrobacterium-mediated transformation system. The resulting T0 plants were resistant to a 2-fold application rate of 2,4-D and yielded fertile seeds. The frequency of fertile transgenic soybean plants was up to 5.9%. The incorporation of the AAD1-12 (v1) gene into the soybean genome was confirmed by Southern blot analysis. This analysis showed that most transgenic plants contained a low number of copies. Plants screened using antibodies against AAD-12 (v1) showed a positive ELISA and the corresponding band for Western blot analysis.

Transformation Method 2 - Aerosol-Beam-mediated transformation of soybean callus tissue embryogenic tissue: Cultivation of soybean callus tissue embryogenic tissue and subsequent beaming can be performed as described in US Pat. No. 6809232 (Held et al.) To obtain transformants using the constructs described herein. .

Transformation Method 3 — Soybean Biological Bombardment: This method can be carried out using a mature scar meristem obtained from seeds (McCabe et al. (1988)). After the implementation of biolistic bombardment methods, recovery of transformed soybean plants can be expected.

Transformation Method 4 — Whisker-mediated Transformation: Production of whiskers and transformation using whiskers can be carried out by methods previously described by Terakawa et al. (2005)). After the implementation of biolistic bombardment methods, recovery of transformed soybean plants can be expected.

Maverick seeds were surface sterilized in 70% ethanol for 1 minute, followed by immersion in 1% sodium hypochlorite for 20 minutes, and then washing three times in sterile distilled water. Seeds were soaked in distilled water for 18-20 hours. Embryonic scars were cut from the seeds and the apical meristem was exposed, removing the primary leaves. Embryonic scars with the apical region up were placed in a bombardment medium [BM: MS (Murashige and Skoog 1962) basic salt medium, 3% sucrose and 0.8% Sigma phytagel, pH 5.7] in 5 cm culture dishes containing 12 ml of culture medium.

Transformation Method 5 — Transformation of callus embryogenic tissue mediated by microparticle bombardment can be optimized by methods previously described (Khalafalla et al., 2005; El-Shemy et al., 2004, 2006).

EXAMPLE 8

AAD-12 (v1) in cotton

Method of transforming cotton: Cotton seeds (genotype Co310) were surface sterilized in 95% ethanol for 1 minute, washed, sterilized with 50% commercial bleach for twenty minutes, and then washed 3 times with sterile distilled water before germination on G-media (table 21) in Magenta GA-7 vessels and storage at high light intensities of 40-60 μΕ / m ² with a photoperiod set for 16 hours of illumination and 8 hours of darkness, at 28 ° C.

Square segments of the cotyledon (~ 5 mm) were obtained from seedlings aged 7-10 days and placed in liquid M media (table 21) in Petri dishes (Nunc, cat. No. 0875728). The cut segments were treated with a solution containing Agrobacterium (for 30 minutes), then transferred to a semi-solid medium M (table 21) and subjected to co-cultivation for 2-3 days. After co-cultivation, the segments were transferred onto MG medium (Table 21). Carbenicillin is an antibiotic used to kill Agrobacterium, and ammonium glufosinate is a selective agent that only allows cells containing the transferred gene to grow.

Obtaining Agrobacterium: 35 ml of medium Y (table 21) (containing streptomycin (stock solution 100 mg / ml) and erythromycin (stock solution 100 mg / ml)) were inoculated using one loop of bacteria for growing overnight in the dark at 28 ° C with shaking at 150 rpm. The next day, the Agrobacterium-containing solution was poured into a sterile Oak Ridge tube (Nalge-Nunc, 3139-0050) and centrifuged in Beckman J2-21 at 8000 rpm. within 5 minutes. The supernatant was poured, the pellet was resuspended in 25 ml of liquid M (Table 21) and centrifuged on a vortex. An aliquot was placed in a glass culture tube (Fisher, 14-961-27) for reading using Klett (Klett-Summerson, model 800-3). Dilute the new suspension using M liquid readouts using a Klett colorimeter at 10 colony forming units per ml with a total volume of 40 ml.

Three weeks later, callus was isolated from the cotyledon segments and transferred to fresh MG medium. Callus was transferred to MG medium for another 3 weeks. In a direct comparison, the MG medium can be supplemented with dichloroprop (added to the medium at concentrations of 0.01 and 0.05 mg / l) to complement the degradation of 2,4-D, because Dichloroprop is not a substrate of the AAD-12 enzyme, but dichloroprop is more active with respect to cotton than 2,4-D. In a separate comparison, the segments were placed on MG medium that did not contain growth regulators compared to standard MG medium; they showed reduced callus formation, but callus still grew. Callus was then transferred to CG medium (Table 21) and, after three weeks, transferred again to fresh selection medium. After another three weeks, callus tissue was transferred to medium D (table 21) without plant growth regulators for the induction of embryogenic callus. After 4-8 weeks, embryogenic callus formed on this medium, and it can be distinguished from non-embryogenic callus by its yellowish-white color and granular cells. Soon after, embryo regeneration began, and they became discernible green in color. The regeneration and formation of cotton embryos can take time, one of the ways to accelerate this process is to expose the tissue to stress. A common way to accomplish this is through desiccation through changes in the microenvironment of the tissue and cup using fewer culture media and / or various methods of enclosing the cup (tape wrapping compared to parafilm).

Table 21
Cotton Transformation Media Ingredients per 1 liter G M liquid M MG Cg D Dk Y LS salts (5X) 200 ml 200 ml 200 ml 200 ml 200 ml Glucose 30 g 30 g 30 g 30 g 20 g Modified d B5 vit (1000x) 1 ml 1 ml 1 ml 1 ml 1 ml 10 ml 1 ml kinetin
(1 mm) 1 ml 1 ml 1 ml 4.6 ml 0.5ml 2,4-D
(1 mm) 1 ml 1 ml 1 ml agar 8 g 8 g 8 g 8 g 8 g 8 g DKW salts (D190) 1 pack 1 pack myoinositol (100 ×) 1 ml 10 ml Sucrose 3% 30 g 30 g 10 g NAA Carbenicillin (250 mg / ml) 2 ml 0.4 ml GLA (10 mg / ml) 0.5 ml 0.3 ml Peptone 10 g Yeast extract 10 g NaCl 5 g

Well-developed larger embryos were isolated and transferred to DK media (Table 21) for embryo development. After 3 weeks (or when the embryos develop), the germinated embryos were transferred to fresh media to germinate the shoot and root. After 4-8 weeks, any well-developed plants were transferred to the soil and grown to maturity. After a few months, the plants grew to such an extent that they can be sprayed to determine if they have resistance to 2,4-D.

Cell Transformation: Several experiments were started in which cotyledon segments were treated with Agrobacterium containing pDAB724. More than 2000 segments obtained were processed using various auxin variants for the proliferation of cotton callus with pDAB724: 0.1 or 0.5 mg / L of R-dichloroprop, 2,4-D at standard concentration and without treatment with auxins. Callus was subjected to selection with ammonium glufosinate due to the inclusion of the PAT gene in the construct. Analysis of the callus line in the form of PCR and Invader will be used to determine and verify the presence of the gene at the callus stage; then callus lines, which are embryogenic, will be sent for Western blot analysis. Embryogenic cotton callus was stressed using desiccation methods to improve the quality and quantity of excreted tissue. Nearly 200 callus objects were screened for intact PTU and expression using Western blot analysis for the AAD-12 (v1) gene.

Plant regeneration: Cotton lines with AAD-12 (v1), with which the plants were obtained according to the above method, will be sent to the greenhouse. To demonstrate that the AAD-12 (v1) gene provides resistance to cotton to 2,4-D, cotton plants with AAD-12 (v1) and wild-type cotton plants were sprayed using an automatic spraying device releasing 560 g ke / ha 2,4-D with a spray volume of 187 l / ha. Plants will be evaluated 3 and 14 days after treatment. Plants surviving at a selective 2,4-D application rate will self-pollute to produce T1 seeds or outcross with an elite cotton line to produce F1 seeds. The seeds obtained then will be grown and evaluated for herbicide resistance, as described above. Objects with AAD-12 (v1) can be combined with other desired features of HT or IR.

EXAMPLE 9

Transformation of other crops using Agrobacterium

In light of the present description of the present invention, additional crops can be transformed using methods known in the art. Agrobacterium-mediated rye transformation see, for example, Popelka and Altpeter (2003). Agrobacterium-mediated soybean transformation, see, for example, Hinchee et al., 1988. Agrobacterium-mediated sorghum transformation, see, for example, Zhao et al., 2000. Agrobacterium-mediated soybean transformation, see, for example, Tingay et al., 1997 For Agrobacterium-mediated transformation of wheat, see, for example, Cheng et al., 1997. For Agrobacterium-mediated transformation of rice, see, for example, Hiei et al., 1997.

The Latin names of these and other plants are presented below. It should be understood that these and other (without Agrobacterium) transformation methods can be used for transformation using AAD-12 (v1), for example, these and other plants, including, but not limited to, corn (Zea mays), wheat (Triticum spp .), rice (Oryza spp. and Zizania spp.), barley (Hordeum spp.), cotton (Abroma augusta and Gossypium spp.), soy (Glycine max), sugar and table beets (Beta spp.), sugarcane ( Arenga pinnata), tomato (Lycopersicon esculentum and other spp., Physalis ixocarpa, Solanum incanum and other spp., And Cyphomandra betacea), potatoes (Solanum tubersoum), sweet potato (Ipomoea betatas), rye (Secale sppic.), Pepper ( annuum, sinense and frutescens), la yuk (Lactuca sativa, perennis and pulchella), cabbage (Brassica spp), celery (Apium graveolens), eggplant (Solanum melongena), peanuts (Arachis hypogea), sorghum (all types of sorghum), alfalfa (Medicago sativua), carrots (Daucus carota), beans (Phaseolus spp. and other genera), oats (Avena sativa and strigosa), peas (Pisum, Vigna and Tetragonolobus spp.), sunflower (Helianthus annuus), giant pumpkin (Cucurbita spp.), cucumber (Cucumis sativa ), tobacco (Nicotiana spp.), Arabidopsis (Arabidopsis thaliana), lawn grass (Lolium, Agrostis, Poa, Cynadon and other genera), clover (Tifolium), peas (Vicia). Such plants, for example, with AAD-12 (v1) genes, are included in the present invention.

AAD-12 (v1) has the potential to increase the applicability of key auxin herbicides for seasonal use in many deciduous and coniferous forestry systems. Tree species resistant to triclopyr, 2,4-D, and / or fluroxypyr will increase the flexibility of overuse of these herbicides without fear of damage. These species will include, but are not limited to: alder (Alnus spp.), Ash (Fraxinus spp.), Aspen and poplar species (Populus spp.), Beech (Fagus spp.), Birch (Betula spp.), Cherry ( Prunus spp.), Eucalyptus (Eucalyptus spp.), Hickory (Carya spp.), Maple (Acer spp.), Oak (Quercus spp) and pine (Pinus spp). The use of auxin resistance for the selective control of weeds in ornamental and fruit bearing species is also included in the scope of the present invention. Examples may include, but are not limited to, a rose (Rosa spp.), Euonymus (Euonymus spp.), Petunia (Petunia spp.), Begonia (Begonia spp.), Rhododendron (Rhododendron spp), wild apple or apple tree (Malus spp. ), pear (Pyrus spp.), peach (Prunus spp.) and marigolds (Tagetes spp.).

EXAMPLE 10

Additional evidence of unexpected results: AAD-12 compared to AAD-2

Initial cloning of AAD-2 (v1): Another gene from the NCBI database (see website ncbi.nlm.nih.gov; reg. No. AP005940) identified as a homologue with identity to only 44% amino acids with respect to tfdA. For convenience, this gene is referred to herein as AAD-2 (v1). The percent identity was determined by first converting the AAD-2 and tfdA DNA sequences (SEQ ID NO: 12 from PCT / US2005 / 014737 and GenBank registration number M16730, respectively) into proteins (SEQ ID NO: 13 from PCT / US2005 / 014737 and registration number GenBank M16730, respectively), then using ClustalW in the VectorNTI software package to perform multiple sequence alignment.

A strain of Bradyrhizobium japonicum containing the AAD-2 (v1) gene (NRRL, strain No. B4450) was obtained from the Northern Regional Research Laboratory. The lyophilized strain was restored according to the NRRL protocol and stored at -80 ° C in 20% glycerol for internal use as a bacterial strain Dow DB 663. Then, a plate with tryptic soy agar was seeded with a loop of cells from this frozen stock for isolation and incubated at 28 ° C in within 3 days. A separate colony was used to inoculate 100 ml of tryptic soy broth in a flask with 500 ml chippers, which were incubated overnight at 28 ° C in an outdoor shaker at 150 rpm. Total DNA was isolated from it using a gram-negative protocol for Qiagen's DNeasy kit (Qiagen, cat. No. 69504). For amplification of the target gene from genomic DNA, the following primers were designed, straight: 5'-ACTAGTAACAAAGAAGGAGATATACCATGACGAT-3 '[(brjap 5' (speI) SEQ ID NO: 14 from PCT / US2005 / 014737 (with the added Spe I restriction site and binding site ribosomes (RBS))], and reverse: 5'-TTCTCGAGCTATCACTCCGCCGCCTGCTGCTGC-3 '[(brjap 3' (xhoI) SEQ ID NO: 15 from PCT / US2005 / 014737 (with added XhoI restriction site)].

Fifty microliter reaction mixtures were as follows: Fail Safe Buffer 25 μl, ea. primer - 1 μl (50 ng / μl), genomic DNA - 1 μl (200 ng / μl), H.sub.2O - 21 μl, Taq polymerase - 1 μl (2.5 Units / μl). Three Fail Safe Buffers-A, B, and C were used in three separate reactions. Then, PCR was carried out under the following conditions: thermal denaturation cycle at 95 ° C for 3.0 minutes; 95 ° C - 1.0 minute, 50 ° C - 1.0 minute, 72 ° C - 1.5 minutes for 30 cycles; followed by a final cycle at 72 ° C for 5 minutes using the FailSafe PCR System (Epicenter, Cat. No F599100). To confirm the nucleotide sequence of the obtained PCR product of size ~ 1 TPN cloned into pCR 2.1 (Invitrogen, cat. No. K4550-40), following the protocol included, using chemically competent TOP10F 'E. coli as an acceptor strain.

Ten of the obtained white colonies were inoculated with 3 μl of Luria broth + 1000 μg / ml ampicillin (LB Amp) and grown overnight at 37 ° C with shaking. Plasmids were isolated from each culture using the Nucleospin Plus Plasmide Miniprep Kit (BD Biosciences, Cat. No. K3063-2) and following the protocol included. A restriction of the isolated DNA was performed to confirm the presence of a PCR product in the pCR2.1 vector. Plasmid DNA was digested using the restriction enzyme EcoRI (New England Biolabs, cat. No. R0101S). Sequencing was performed using the Beckman CEQ Quick Start Kit (Beckman Coulter, Cat. No. 608120) using M13 primers, direct [5'-GTAAAACGACGGCCAG-3 '] (SEQ ID NO: 6) and reverse [5'-CAGGAAACAGCTATGAC-3 '] (SEQ ID NO: 7), according to the manufacturer's instructions. This gene sequence and its corresponding protein was given a new general designation AAD-2 (v1) for internal consistency.

Obtaining binary vector AAD-2 (v1): The AAD-2 (v1) gene was amplified by PCR from pDAB3202. In the PCR reaction, changes were made in the primers to insert the restriction sites AflIII and SacI into the 5'-primer and 3'-primer, respectively. See PCT / US2005 / 014737. Primers "NcoI of Brady" [5'-TATACCACATGTCGATCGCCATCCGGCAGCTT-3 '] (SEQ ID NO: 14) and "SacI of Brady" [5'-GAGCTCCTATCACTCCGCCGCCTGCTGCTGCAC-3'] (SEQ ID NO: 15) using the Fail Safe PCR System (Epicentre). The PCR product was cloned into the pCR2.1 TOPO TA cloning vector (Invitrogen) and the sequence was confirmed using M13 forward and reverse primers using Beckman Coulter "Dye Terminator Cycle Sequencing with Quick Start Kit" sequencing reagents. Using the sequence data, a clone with the correct sequence (pDAB716) was identified. Then, the AflIII / SacI AAD-2 (v1) gene fragment was cloned into the NcoI / SacI vector pDAB726. The resulting construct (pDAB717); AtUbi10 promoter: Nt OSM 5'UTR: AAD-2 (v1): Nt OSM 3'UTR: ORF1 polyA 3'UTR was confirmed by restriction (using NcoI / SacI). This construct was cloned into the binary vector pDAB3038 as a NotI-NotI DNA fragment. The resulting construct (pDAB767); AtUbi10 promoter: Nt OSM5'UTR: AAD-2 (v1): Nt OSM 3'UTR: ORF1 polyA 3'UTR: CsVMV promoter: PAT: ORF25 / 26 3'UTR was subjected to restriction (using Nod, EcoRI, HinDIII, NcoI , PvuII and SalI) to confirm the correct orientation. Then, the completed construct (pDAB767) was used to transform Agrobacterium.

Assessment of Transformed Arabidopsis: Freshly harvested T1 seeds transformed using the plant-optimized AAD-12 (v1) gene or native AAD-2 (v1) gene were grown and selected for glufosinate resistance as described above. Then the plants were randomly assigned different application rates of 2,4-D (50-3200 g ke / ha). The application of the herbicide was carried out using an automatic device for spraying with a volume of solution for spraying 187 l / ha. Used 2,4-D was the commercial composition of dimethylamine salt (456 g ke / l, NuFarm, St Joseph, Mo.), mixed in 200 mm Tris buffer (pH 9.0) or 200 mm HEPES buffer (pH 7.5).

AAD-12 (v1) and AAD-2 (v1) provided detectable resistance to 2,4-D compared to transformed and non-transformed control lines; however, individual constructs were widely variable in their ability to confer resistance to 2,4-D to individual T1 arabidopsis plants. Unexpectedly, transformants with AAD-2 (v1) and AAD-2 (v2) were much less resistant to 2,4-D than with the AAD-12 (v1) gene, in terms of the proportion of highly resistant plants, as well as the overall average damage. Plants transformed using AAD-2 (v1) did not survive at 200 g ke / ha 2,4-D relatively intact (<20% visible damage), and the total damage in the population was approximately 83% (see PCT / US2005 / 014737). In contrast, AAD-12 (v1) had average damage in the population of approximately 6% when treated with 3200 g ke / ha 2,4-D. Resistance improved slightly in the case of plant-optimized AAD-2 (v2) compared to the native gene; however, a comparison of both AAD-12 and AAD-2 genes optimized for plants indicates a significant advantage of AAD-12 (v1) in the field.

These results are surprising given that when comparing AAD-2 (v1) (see PCT / US2005 / 014737) and AAD-12 (v2) in vitro, both were highly effective in 2,4-D degradation and both had S-type specificity for chiral aryloxyalkanoate substrates. AAD-2 (v1) is expressed in individual T1 plants at various levels; however, this expressed protein confers little protection against 2,4-D damage. No significant differences were observed in the level of protein expression (in the field) for native and plant-optimized AAD-2 genes (see PCT / US2005 / 014737). These data confirm the previously obtained results, which make unexpected functional expression of AAD-12 (v1) in the field and the resulting resistance to 2,4-D herbicides and pyridyloxyacetate herbicides.

EXAMPLE 11

The use of phenoxy-auxin herbicides for soybean, cotton and other dicotyledonous crops, transformed using only AAD-12 (v1)

AAD-12 (v1) may make it possible to use phenoxy-auxin herbicides (e.g., 2,4-D and MCPA) and pyridyloxy-auxins (triclopyr and fluroxypyr) to control a wide range of broad-leaved weeds directly in the case of crops that are normally susceptible to 2,4- D. By applying 2,4-D in an amount of 280 to 2240 g ke / ha, most types of broad-leaved weeds present under agronomic conditions can be controlled. Often use 560-1120 g ke / ha. In the case of triclopyr, application rates will usually be in the range of 70–1120 g ke / ha, more often 140–420 g ke / ha. In the case of fluroxypyr, application rates will usually be in the range of 35-560 g ke / ha, more often 70-280 ke / ha.

The advantage of this additional tool is the extremely low cost of the herbicidal component for broad-leaved plants and the potential short-term post-exposure control of weeds provided by higher quantities of 2,4-D, triclopyr and fluroxypyr when used, while a non-resulting herbicide, such as glyphosate, will not provide control of weeds germinated in the future. This tool also provides a mechanism for combining herbicide action mechanisms with HTC convenience as an integrated strategy for herbicide resistance and shift control in weed populations.

An additional advantage provided by this tool is the ability to produce a tank mix of herbicides for controlling a wide range of broadleaf weeds (e.g., 2,4-D, triclopyr and fluroxypyr) with commonly used subsequent herbicides for controlling weeds. These herbicides are typically applied before or during planting, but they are often less effective against sprouted, rooted weeds that may exist on the field before planting. Increasing the applicability of these aryloxy-auxin herbicides before planting, pre-emergence or pre-sowing treatments are included, they increase the flexibility of subsequent weed control programs. One skilled in the art will understand that the programs using the subsequent herbicides will vary according to the crop of interest, but typical programs will include herbicides from the groups of chloroacetamide and dinitroaniline herbicides, as well as herbicides such as clomazone, sulfentrazone and many ALS-inhibiting, PPO -inhibiting and HPPD-inhibiting herbicides.

Additional benefits may include resistance to 2,4-D, triclopyr, or fluroxypyr, required before planting after application of aryloxy acetic acid auxin herbicides (see example above); and fewer problems with contaminated damage to dicotyledonous crops resulting from incomplete cleaning of tank cars containing 2,4-D, triclopyr or fluroxypyr. Dicambu (and many other herbicides) can still be used for subsequent control of AAD-12 (v1) -transformed dicotyledonous self-sowing crops.

It will also be clear to those skilled in the art that the above example can be applied to any 2,4-D (or other aryloxy-auxin herbicide) susceptible crop that will be protected by the AAD-12 (v1) gene in the event of a stable transformation. Therefore, the specialist in the field of weed control will understand that the use of various commercial phenoxy- or pyridyloxy-auxin herbicides individually or in combination with the herbicide is made possible by transformation using AAD-12 (v1). The specific amounts of other herbicides specific to these chemicals can be determined using the herbicide labeling compiled in the CPR book (Crop Protection Reference), or a similar collection, or any commercial or academic crop protection source such as the Agriliance Crop Protection Guide ( 2005). Each alternative herbicide that can be used on HTC thanks to AAD-12 (v1), used alone, in a tank mix or sequentially, is considered to be included in the scope of the present invention.

EXAMPLE 12

The use of phenoxy-auxin and pyridyloxy-auxin herbicides for crops of corn, rice and other monocotyledonous species transformed only using AAD-12 (v1)

Similarly, the transformation of grass species (as non-limiting examples, such as corn, rice, wheat, barley or lawn grass and grassland) using AAD-12 (v1) will make it possible to use highly effective phenoxy- and pyridyloxy-auxins in the case of crops, where normal selectivity is uncertain. Most grass species have natural resistance to auxin herbicides such as phenoxy auxins (i.e., 2,4-D). However, the relatively low level of crop selectivity leads to reduced applicability in the case of these crops due to a shortened application window or an unacceptable risk of damage. Thus, monocotyledonous crops transformed using AAD-12 (v1) will make it possible to use a similar combination of treatments described for dicotyledonous crops, such as applying 2,4-D at a spread rate of 280 to 2240 g ke / ha to control most types of broadleaf weeds. Often use 560-1120 g ke / ha. In the case of triclopyr, application rates will usually be in the range of 70–1120 g ke / ha, more often 140–420 g ke / ha. In the case of fluroxypyr, application rates will usually be in the range of 35-560 g ke / ha, more often 70-280 ke / ha.

The advantage of this additional tool is the extremely low cost of the herbicidal component for broad-leaved plants and the potential short-term follow-up weed control provided by higher amounts of 2,4-D, triclopyr or fluroxypyr. In contrast, an inconsistent herbicide, such as glyphosate, will not provide control of weeds that have germinated later. This tool will also provide a mechanism for alternating the mechanisms of action of herbicides with the convenience of HTC as an integrated strategy for herbicide resistance and controlling shifts in weed populations in the strategy of combining glyphosate-resistant crops / HTC AAD-12 (v1) with or without crop rotation .

An additional advantage provided by this tool is the ability to produce a tank mix of herbicides for controlling a wide range of broadleaf weeds (e.g., 2,4-D, triclopyr and fluroxypyr) with commonly used subsequent herbicides for controlling weeds. These herbicides are typically applied before or during planting, but they are often less effective against sprouted, rooted weeds that may exist on the field before planting. Increasing the applicability of these aryloxy-auxin herbicides before planting, pre-emergence or pre-sowing treatments are included, they increase the flexibility of subsequent weed control programs. One skilled in the art will understand that the programs using the subsequent herbicides will vary according to the crop of interest, but typical programs will include herbicides from the groups of chloroacetamide and dinitroaniline herbicides, as well as herbicides such as clomazone, sulfentrazone and many ALS-inhibiting, PPO -inhibiting and HPPD-inhibiting herbicides.

The increased resistance of maize, rice and other monocotyledonous plants to phenoxy- or pyridyloxyiaxins should allow the use of these herbicides for crops without restrictions related to the growth phases or potential inclination of crops, the development of phenomena such as the “rat tail”, the inclination of crops induced by regulators growth fragility of the stem in corn or deformation of supporting roots. Each alternative herbicide that can be used on HTC thanks to AAD-12 (v1), used alone, in a tank mix or sequentially, is considered to be included in the scope of the present invention.

EXAMPLE 13

AAD-12 (v1) in rice

Description of the media: The culture media used were adjusted to pH 5.8 with 1 M KOH and cured with 2.5 g / L phytagel (Sigma). Embryogenic calli were cultured in 100 × 20 mm Petri dishes containing 40 ml of semi-solid medium. Rice seedlings were grown on 50 ml of medium in Magenta boxes. Cell suspensions were maintained in 125 ml conical flasks containing 35 ml of liquid medium and rotated at 125 rpm. Induction and maintenance of embryogenic cultures was carried out in the dark at 25-26 ° C, and plant regeneration and cultivation of whole plants was carried out during a photoperiod of 16 hours (Zhang et al. 1996).

The induction and maintenance of embryogenic callus was carried out on the minimal NB medium described previously (Li et al. 1993), but adapted for the content of 500 mg / l glutamine. Suspension cultures were initiated and maintained in SZ liquid medium (Zhang et al. 1998) with 30 g / L sucrose instead of maltose. Osmotic medium (NBO) consisted of NB medium supplemented with 0.256 M mannitol and sorbitol. Hygromycin B resistant callus was selected on NB medium supplemented with 50 mg / L hygromycin B for 3-4 weeks. Preliminary regeneration was carried out on medium (PRH50), consisting of NB medium without 2,4-dichlorophenoxyacetic acid (2,4-D), but with the addition of 2 mg / L 6-benzylaminopurine (BAP), 1 mg / L α-naphthylacetic acid (NAA), 5 mg / L abscisic acid (ABA) and 50 mg / L Hygromycin B, for 1 week. Then, seedlings were regenerated by cultivation on a regeneration medium (RNH50) containing NB medium without 2,4-D and supplemented with 3 mg / L BAP, 0.5 mg / L NAA and 50 mg / L hygromycin B, before shoot regeneration . The shoots were transferred to the rooting medium with half the concentration of the base salts of Murashige and Skoog and Vitamin B5 according to Hamburg, supplemented with 1% sucrose and 50 mg / l hygromycin B (1 / 2MSH50).

Obtaining tissue culture: Mature dehydrated seeds of Oryza sativa L. japonica cv. Taipei 309 was sterilized as described in Zhang et al. 1996. Embryogenic tissues were induced by culturing sterile mature rice seeds on NB medium in the dark. Primary callus with a diameter of approximately 1 mm was separated from the scab and used to initiate cell suspension in SZ liquid. The suspensions were then maintained as described in Zhang 1995. The embryogenic tissues obtained from the suspension were removed from the liquid culture 3-5 days after the previous subculture, placed on NBO osmotic medium to obtain a circle with a diameter of approximately 2.5 cm in a Petri dish, and cultured for 4 hours before the bombing. 16-20 hours after the bombardment, tissues were transferred from NBO medium to selective NBH50 medium with hygromycin B, checking that the bombarded surface was on top and incubated in the dark for 14-17 days. Then the newly formed callus was separated from the original bombarded explants and placed close to the same medium. After another 8-12 days, a relatively dense, opaque callus was visually determined and transferred to the medium for preliminary regeneration of PRH50 for 7 days in the dark. Then, the growing callus, which became more dense and opaque, was subcultured on RNH50 regeneration medium for 14-21 days with a photoperiod of 16 hours. The regenerated shoots were transferred to Magenta boxes containing 1/2 MSH50 medium. Numerous plants regenerated from a single explant were considered siblings and considered as one independent plant line. A plant was rated positive for the hph gene if it produced thick white roots and actively grew on 1/2 MSH50 medium. When the seedlings reached the top of the Magenta boxes, they were transferred to the soil in a 6 cm pot at 100% humidity for a week, then they were transferred to a growing chamber with a lighting period of 14 hours at 30 ° C and a dark period at 21 ° C for 2-3 weeks before replanting in 13 cm pots in greenhouses. Seeds were collected and dried at 37 ° C for one week before storage.

Microparticle bombardment: All bombardments were carried out using the Biolistic PDS-1000 / He ™ system (Bio-Rad, Laboratories, Inc.). Three milligrams of gold particles with a diameter of 1.0 micrometer were washed once with 100% ethanol, twice with sterile distilled water and resuspended in 50 μl of water in an Eppendorf siliconized tube. Five micrograms of plasmid DNA representing pDOW3303 (Hpt-containing vector) and pDAB4101 (AAD-12 (v1) + AHAS) in a molar ratio of 1: 6, 20 μl of spermidine (0.1 M) and 50 μl of calcium chloride (2.5 M) was added to a suspension of gold. The mixture was incubated at room temperature for 10 minutes, centrifuged at 10,000 rpm. for 10 seconds, resuspended in 60 μl of cold 100% ethanol and dispensed 8-9 μl for each macrocarrier. Tissue samples were bombarded at 1100 lb / ⁱⁿ² and a vacuum of 27 inches of mercury as described in Zhang et al. (1996).

Post-emergence herbicide resistance in T0 rice transformed using AAD-12 (v1): Rice seedlings in a phase of 3-5 leaves were sprayed with a lethal dose of 0.16% (vol./about.) Pursuit solution (to confirm the presence of the AHAS gene), containing 1% Sunit II (vol./vol.) and 1.25% UAN (vol./vol.), using an automatic spraying device calibrated to 187 l / ha. Susceptibility or resistance was assessed 36 days after treatment (DAT). Ten of the 33 facilities sent to the greenhouse were stably resistant to Pursuit; others showed different levels of herbicide damage. Plants were selected and molecular analysis was carried out, in which seven of these 10 objects were determined as containing both PTU AAD-12 (v1) and the complete coding region of AHAS.

Inheritance of AAD-12 (v1) in Rice T1: Testing of 100 descendant plants was carried out on five T1 lines from lines with AAD-12 (v1) containing both AAD-12 (v1) PTU and the AHAS coding region. Seeds were planted taking into account the above method and sprayed with 140 g ke / ha imazetapira using an automatic device for spraying, as described above. After 14 DAT, resistant and susceptible plants were counted. Two of the five test lines were split according to a single locus, the dominant trait with Mendelian inheritance (3R: 1S), as determined by chi-square analysis. AAD-12 was inherited in conjunction with the AHAS selective marker, as determined using the 2,4-D resistance test below.

Confirmation of the high resistance to 2,4-D in rice T1: The following T1 lines, cleaved by AAD-12 (v1) as a single locus, were planted in 3-inch pots containing Metro Mix media: pDAB4101 (20) 003 and pDAB4101 ( 27) 002. In a phase of 2-3 leaves, 140 g ke / ha of imazetapir were sprayed. Plants that did not contain an insert were removed and individual plants were sprayed in phase V3-V4 in an automatic spraying device set to 187 l / ha at 1120, 2240 or 4480 g ke / ha 2,4-D DMA (2x, 4 -fold and 8-fold typical application rates for commercial use, respectively). Plants were graded at 7 and 14 DAT and compared to the non-transformed commercial Lamont rice cultivar as negative control plants.

Table 22
The response of T1 plants with AAD-12 (v1) and non-transformed controls to different levels of 2,4-D DMA: average% damage after 14 DAT Herbicide Untransformed Lemont control pDAB4101
(20) 003 pDAB4101
(27) 002 1120 g ke / ha 2,4-D DMA twenty 10 10 2240 g ke / ha 2,4-D DMA 35 fifteen thirty 4480 g ke / ha 2,4-D DMA fifty 23 40

Damage data (Table 22) indicate that lines transformed using AAD-12 (v1) are more resistant to large amounts of 2,4-D DMA than non-transformed controls. The pDAB4101 (20) 003 line was more resistant to high 2,4-D levels than the pDAB4101 (27) 002 line. Data also suggests that resistance to 2,4-D is stable for at least two generations.

Tissue collection, DNA isolation and quantification: Fresh tissue was placed in test tubes and lyophilized at 4 ° C for 2 days. After the fabric was completely dried, a tungsten granule (Valenite) was placed in a test tube and the samples were subjected to dry grinding using a Kelco ball mill for 1 minute. Then, standard DNA isolation was performed using DNeasy (Qiagen, Dneasy 69109). An aliquot of the extracted DNA was then stained with Pico Green (Molecular Probes P7589) and scanned on a fluorimeter (BioTek) with known standards to obtain a concentration in ng / μl.

Expression of AAD-12 (v1): All 33 T0 transgenic rice lines and 1 non-transgenic control were analyzed for AAD-12 expression using ELISA blots. AAD-12 was determined in clones of 20 lines, but not in the line of control plants Taipei 309. Twelve of the 20 lines containing a certain number of clones resistant to imazetapir expressed AAD-12 protein, were positive for PCR on AAD-12 PTU and positive for AHAS coding region. Expression levels ranged from 2.3 to 1092.4 ppm. total soluble protein.

Resistance of rice plants with pDAB4101 to 2,4-D herbicides and triclopyr in the field: Field resistance testing was carried out using an object with AAD-12 (v1) pDAB4101 [20] and one wild-type rice (Clearfield 131) (non-transgenic resistant to imidazolinone cultivar) in Wayside, Miss. The design of the experiment was a randomized, one-block, one-block plan. The experimental options were 2-fold application rates of 2,4-D (dimethylamine salt) at 2240 g ke / ha and triclopy at 560 g ke / ha together with the untreated control. Within each experiment, two rows of pDAB4101 [20] T1 generations and two rows of Clearfield rice were planted using a small seeder with a row spacing of 8 inches. Rice pDAB4101 [20] contained the AHAS gene as a selective marker for the AAD-12 (v1) gene. Imazetapyr was applied in the phase of one leaf as a selective means for removing from plants experimental sites any plants without AAD-12 (v1). When the rice reached phase 2 of the leaves, they were treated with herbicides using a pneumatic knapsack sprayer that released a volume of solution for spraying 187 l / ha under a pressure of 130-200 kPa. Visual assessment of damage was performed 7, 14, and 21 days after treatment.

Object responses from AAD-12 (v1) to 2,4-D and triclopyr are shown in Table 23. The non-transformed rice line (Clearfield) was badly damaged (30% after 7 DAT and 35% after 15 DAT) 2,4-D when 2240 g ke / ha, which is considered a 4-fold application rate for commercial use. An object with AAD-12 (v1) showed exceptional resistance to 2,4-D without visible damage after 7 or 15 DAT. Non-transformed rice was severely damaged (15% after 7 DAT and 25% after 15 DAT) 2-fold application rate of triclopyr (560 g ke / ha). An object with AAD-12 (v1) showed exceptional resistance to 2-fold application rates of triclopyr without the observed damage after 7 or 15 DAT.

These results indicate that transformed rice with AAD-12 (v1) showed a high level of resistance to 2,4-D and triclopyr at application rates causing severe visible damage to Clearfield rice. They also suggest the possibility of stacking numerous herbicide resistance genes with AAD-12 I in many species to provide resistance to a wider range of effective chemicals.

Table 23
Response of rice plants with AAD-12 generation T1 to 2,4-D and triclopyr in the field Treatment
herbicides % visible damage After 7 dat After 15 dat Active ingredient Application rate Object with AAD-12 (v1) pDAB4101- [20] Wild Clear-field Object with AAD-12 (v1) pDAB4101- [20] Wild Clear-field 2,4-D 2240 g ke / ha 0 fifteen 0 35 Triclopyr 840 g ke / ha 0 thirty 0 25 Unworked 0 0 0 0

EXAMPLE 14

AAD-12 (v1) in canola

Canola transformation: AAD-12 (v1) gene, conferring resistance to 2,4-D, was used to transform Brassica napus var. Nexera * 710 using Agrobacterium-mediated transformation and plasmid pDAB3759. The construct contained the AAD-12 (v1) gene, triggered by the CsVMV promoter, and the Pat gene, triggered by the AtUbi10 promoter, and an EPSPS glyphosate resistance indicator, triggered by the AtUbi10 promoter.

Seeds were surface sterilized with 10% commercial bleach for 10 minutes and washed 3 times with sterile distilled water. Then the seeds were placed on a minimal concentration medium MS with half concentration (Murashige and Skoog, 1962) and maintained in growth mode at 25 ° C and a photoperiod of 16 hours of light / 8 hours of darkness.

Hypocotyl segments (3-5 mm) were cut from 5-7-day-old seedlings and placed on K1D1 callus induction medium (MS medium with 1 mg / L kinetin and 1 mg / L 2,4-D) for 3 days as a preliminary processing. Then the segments were transferred to a Petri dish, treated with a strain of Agrobacterium Z707S or LBA4404 containing pDAB3759. Agrobacterium was grown overnight at 28 ° C. in the dark on a shaker at 150 rpm, then resuspended in culture medium.

After 30 minutes of treatment with Agrobacterium hypocotyl segments, they were placed back on callus induction medium for 3 days. After co-cultivation, the segments were placed on K1D1TC (callus induction medium containing 250 mg / L carbenicillin and 300 mg / L timentin) for one or two weeks of recovery. Alternatively, the segments were placed directly on selective K1D1H1 medium (the above medium with 1 mg / L Herbiace). Carbenicillin and timentin were antibiotics used to kill Agrobacterium. The selective Herbiace agent allows the growth of transformed cells.

The grafted hypocotyl segments were then placed on B3Z1H1 shoot regeneration medium (MS medium, 3 mg / L benzylaminopurine, 1 mg / L Zeatin, 0.5 g / L MES [2- (N-morpholino) ethanesulfonic acid], 5 mg / L silver nitrate, 1 mg / l Herbiace, carbenicillin and timentin). After 2-3 weeks, the shoots began to regenerate. Hypocotyl segments together with shoots were transferred onto B3Z1H3 medium (MS medium, 3 mg / l benzylaminopurine, 1 mg / l zeatin, 0.5 g / l MES [2- (N-morpholino) ethanesulfonic acid], 5 mg / l silver nitrate , 3 mg / l Herbiace, carbenicillin and timentin) for another 2-3 weeks.

The shoots were cut off from the hypocotyl segments and transferred onto a medium to lengthen the shoots of MESH5 or MES 10 (MS, 0.5 g / L MES, 5 or 10 mg / L Herbiace, carbenicillin, timentin) for 2-4 weeks. Elongated shoots were cultivated for root induction on MSI.1 (MS with 0.1 mg / L indolylbutyric acid). When the plants developed a well-developed root system, they were transferred to the soil. Plants were acclimatized under controlled environmental conditions in Conviron for 1-2 weeks before being transferred to the greenhouse.

Molecular analysis - Canola, materials and methods: Tissue collection, DNA extraction and quantitative analysis. Fresh tissue was placed in test tubes and lyophilized at 4 ° C for 2 days. After the fabric was completely dried, a tungsten granule (Valenite) was placed in a test tube and the samples were subjected to dry grinding using a Kelco ball mill for 1 minute. Then, standard DNA isolation was performed using DNeasy (Qiagen, DNeasy 69109). An aliquot of the extracted DNA was then stained with Pico Green (Molecular Probes P7589) and analyzed using a fluorimeter (BioTek) with known standards to obtain a concentration in ng / μl.

Polymerase chain reaction: Only 100 ng of total DNA was used as template. 20 mM of each primer was used with the Takara Ex Taq PCR Polimerase kit (Minis TAKRR001A). Primers for the PCR coding region of AAD-12 (v1) were (SEQ ID NO: 10) (forward) and (SEQ ID NO: 11) (reverse). The PCR reaction was carried out in a 9700 Geneamp thermal cycler (Applied Biosystems), exposing the samples to 94 ° C for 3 minutes and 35 cycles of 94 ° C for 30 seconds, 65 ° C for 30 seconds and 72 ° C for 2 minutes, then 72 ° C for 10 minutes. PCR products were analyzed by electrophoresis on a 1% agarose gel stained with EtBr. 35 samples from 35 plants with AAD-12 (v1) were positive when tested. Three samples of the negative control during testing were negative.

ELISA: Using the conventional ELISA described in the previous section, AAD-12 protein was determined in 5 different transformed canola objects. Expression levels ranged from 14 to over 700 ppm. total soluble protein (TSP). Samples of three different non-transformed plants were tested in parallel without a detectable signal, which indicates that the antibodies used in the analysis have minimal cross-reactivity with the canola cell matrix. These samples were also confirmed as positive in Western blot analysis. A summary of the results is presented in table 24.

Table 24
AAD-12 (v1) expression levels in canola plants Sample No. [TSP] (mcg / ml) [AAD-12]
(ng / ml) Expression (ppm TSP)
(ELISA) Western blotting 31 5614.96 1692.12 301.36 ++++ 33 4988.26 2121.52 425.30 ++++ 38 5372.25 3879.09 722.06 ++++ 39 2812.77 41.36 14.71 + 40 3691.48 468.74 126.98 +++ Control 1 2736.24 0.00 0.00 - Control 2 2176.06 0.00 0.00 - Control 3 3403.26 0.00 0.00 -

Post-emergence herbicide resistance in canola T0 transformed using AAD-12 (v1): Forty-five T0 objects transformed using pDAB3759 were sent to the greenhouse for a period of time and allowed them to acclimatize. Plants were grown until 2-4 new, normal-looking leaves appeared (i.e., plants were transferred from tissue culture conditions to greenhouse growth conditions). Then the plants were treated with a lethal dose of commercial formulations 2,4-D-Amin 4 at a rate of 560 g ke / ha. The application of the herbicide was carried out using an automatic spraying device with a spray solution volume of 187 l / ha and a spray height of 50 cm. A lethal dose is defined as the amount causing> 95% damage in untransformed controls.

Twenty-four of the facilities were resistant to 2,4-D DMA herbicide. Some objects had minor damage, but recovered after 14 DAT. The objects were perfected to T1 (and T2 generation) by self-pollination under controlled conditions in bags.

Inheritance of AAD-12 (v1) in canola: 100 descendant plants were also tested on 11 T1 lines with AAD-12 (v1). Seeds were sown and transplanted into 3-inch pots filled with Metro Mix media. Then all plants were sprayed with 560 g ke / ha 2,4-D DMA, as described above. After 14 DAT, resistant and susceptible plants were counted. Seven of the 11 test lines were split according to a single locus, the dominant trait with Mendelian inheritance (3R: 1S), as determined using chi-square analysis. AAD-12 is inherited as a stable aryloxyalkanoate auxin resistance gene in many species, and it can be stacked with one or more additional herbicide resistance genes.

Inheritance of AAD-12 (v1) in canola: 100 descendant plants were also tested on 11 T1 lines with AAD-12 (v1). Seeds were sown and transplanted into 3-inch pots filled with Metro Mix media. Then all plants were sprayed with 560 g ke / ha 2,4-D DMA, as described above. After 14 DAT, resistant and susceptible plants were counted. Seven of the 11 test lines were split according to a single locus, the dominant trait with Mendelian inheritance (3R: 1S), as determined using chi-square analysis. AAD-12 is inherited as a stable aryloxyalkanoate auxin resistance gene in many species, and it can be stacked with one or more additional herbicide resistance genes.

Confirmation of the high resistance to 2,4-D in canola T1: In the case of T1 with AAD-12 (v1), 5-6 mg of seeds were stratified, sown and a thin layer of Sunshine Mix # 5 media was added as the topsoil. Sprouted plants were selected using 560 g ke / ha 2,4-D 7 and 13 days after planting.

Table 25
T1 response with AAD-12 (v1) and non-transformed post-emergence control with various amounts of 2,4-D DMA: Average% damage after 14 DAT Herbicide
2,4-D DMA Untransformed control pDAB3759 (33) 013.001 pDAB3759 (18) 009.001 pDAB3759 (18) 022.001 pDAB3759 (18) 030.001 pDAB3759 (18) 023.001 1120 g ke / ha 90 0 0 13 5 3 2240 g ke / ha 95 one 5 83 31 6

Surviving plants were transplanted into 3-inch pots containing Metro Mix media. Surviving plants from T1 descendants that were selected using 560 g ke / ha 2,4-D were also transplanted into 3-inch pots filled with Metro Mix soil. In a phase of 2-4 leaves, plants were sprayed with 280, 560, 1120 or 2240 g ke / ha 2,4-D DMA. Plants were graded at 3 and 14 DAT and compared with untransformed control plants. A sample of damage data for T1 objects through 14 DAT is presented in Table 25. The data suggest that numerous objects are stably resistant to 2240 g ke / ha 2,4-D, while other objects showed less stable resistance to application rates up to 1120 g ke / ha 2,4-D. Surviving plants were transplanted into 51/4 '' pots containing Metro Mix media, placed under the same growing conditions as described above, and self-pollinated to produce only homozygous seeds.

Resistance of canola plants pDAB3759 to 2,4-D herbicides, dichloroprop, triclopyr and fluroxypyr in the field: Field testing of the resistance level was carried out at two sites with AAD-12 (v1) 3759 (20) 018.001 and 3759 (18) 030.001 and wild canola type (Nex710) in Fowler, Ind. The design of the experiment was a randomized full block plan with 3 repetitions. The experimental options were 2,4-D (dimethylamine salt) at 280, 560, 1120, 2240 and 4480 g ke / ha, triclopyr at 840 g ke / ha, fluroxypyr at 280 g ke / ha and untreated control. Within each experiment, one 20-foot row / object was planted for object 3759 (18) 030.0011, 3759 (18) 018.001 and wild-type lines (Nex710) using a 4-row seeder with a row spacing of 8 inches. When the canola reached a phase of 4-6 leaves, herbicide treatments were carried out using a pneumatic knapsack sprayer, releasing a volume of solution for spraying 187 l / ha under a pressure of 130-200 kPa. Visual assessment of damage was performed 7, 14 and 21 days after application.

Table 26
The response of canola plants from AAD-12 (pDAB3759) to 2,4-D, triclopyr and fluroxypyr Herbicide treatment "% visible damage after 14 DAT Active ingredient Application rate Object with AAD-12 3759 (20) 018.001 Object with AAD-12 3759 (18) 030.001 Wild Type (Nex710) 2,4-D 280 g ke / ha 0 a 0 b 0 c 2,4-D 560 g ke / ha 0 a 0 b 15 d 2,4-D 1120 g ke / ha 2 a 2 ab 33 bc 2,4-D 2240 g ke / ha 3 a 3 ab 48 a Triclopyr 840 g ke / ha 6 a 6 ab 25 cd Fluroxypyr 280 g ke / ha 7 a 8 a 37 ab

The response of canola to 2,4-D, triclopyr and fluroxypyr is shown in Table 26. Wild-type canola (Nex710) was severely damaged (72% through 14 DAT) 2,4-D at 2240 g ke / ha, which is considered 4-fold application rate. All objects with AAD-12 (v1) showed exceptional resistance to 2,4-D through 14 DAT with average damage of 2, 3 and 2%, observed at 1-, 2- and 4-fold application rates, respectively. Wild-type canola was severely damaged (25% after 14 DAT) with a 2-fold application rate of triclopyr (840 g ke / ha). Objects with AAD-12 (v1) demonstrated stability at 2-fold application rates of triclopyr with average damage of 6% after 14 DAT for two objects. Fluroxypyr at 280 g ke / ha caused severe damage to the non-transformed line (37%) after 14 DAT. Objects with AAD-12 (v1) showed increased resistance with an average damage of 8% after 5 DAT.

These results indicate that objects transformed using AAD-12 (v1) showed a high level of resistance to 2,4-D, triclopyr and fluroxypyr at application rates that were lethal or cause severe epinastic deformities in the non-transformed canola. AAD-12 has been shown to have relative efficacy against 2,4-D> triclopyr> fluroxypyr.

EXAMPLE 15

Transformation and selection of soybean object DAS-68416-4 with AAD-12

Transgenic soybean object (Glycine max) DAS-68416-4 was obtained using Agrobacterium-mediated transformation of soybean cotyledon node explants. To initiate the transformation, an inactivated strain Agrobacterium EHA101 (Hood et al., 2006) was used, carrying the binary vector pDAB4468 (Fig. 2) with a selectable marker (pat) and the gene of interest (AAD-12) inside the T region of the DNA chain.

Agrobacterium-mediated transformation was performed. Briefly, soybean seeds (cv Maverick) were germinated on basal media, cotyledon nodes were isolated, and Agrobacterium was infected. Media for initiating shoot germination, shoot elongation and rooting were supplemented with cefotaxime, timentin and vancomycin to remove Agrobacterium. Glufosinate selection was used to inhibit the growth of untransformed shoots. Selected shoots were transferred onto rooting medium for root development, and then transferred to the soil mixture for acclimatization of seedlings.

On the leaflets of the seedlings subjected to selection, glufosinate was applied for screening for putative transformants. Screened seedlings were transferred to a greenhouse, allowed to acclimatize, and then glufosinate was applied to the leaves to confirm resistance and considered them as putative transformants. Screened plants were selected and molecular analyzes performed to confirm the presence of a selectable marker gene and / or gene of interest. To obtain T1 seeds, T0 plants were allowed to self-pollinate in a greenhouse.

T1 plants were backcrossed and introgressed into elite idioplasm (Maverick). This soybean object DAS-68416-4 was obtained from an independent transformed isolate. The object was screened for its unique characteristics, such as a single insertion site, normal Mendelian cleavage and stable expression, and an excellent combination of efficiency, including herbicide resistance, and agronomic characteristics with a different genetic background and in many places with different climates. A further description of the soybean object DAS-68416-4 is provided in WO 2011/066384, incorporated by reference in its entirety in the present description.

EXAMPLE 16

Obtaining agronomic data for 2008

An agronomic study using the DAS-68416-4 soybean object and non-transgenic control (var. Maverick) was carried out in 2008 at six locations in Iowa, Illinois, Indiana, Nebraska and Ontario, Canada (2 locations). Agronomic indicators were evaluated, including calculation of the density of standing / population, seedling / plant thickness, plant height, lodging, disease frequency, insect damage and days before flowering, to study the equivalence of the soybean object DAS-68416-4 (with and without herbicide treatments) using compared to the Maverick control line. This study is referred to as the Agronomic Experiment S1.

Table 27
Agronomic indicators evaluated in the agronomic experiment S1 Sign Evaluation time Data Description Scale Early population Vc-v2 The number of plants sprouted in the ranks of each experimental plot Specific amount per pilot plot Seedling power Vc-v2 Visual assessment of the average thickness of sprouted plants per experimental plot Scale 1-10 based on the growth of untransformed soy
10 = Equivalent to the growth of untransformed plants
9 = Plant viability is 90% compared to non-transformed, etc. Plant power /
damage After seedling treatments with herbicides Damage due to herbicide treatments Scale 1-10 based on the growth of untransformed soy
10 = Equivalent to the growth of untransformed plants
9 = Plant viability is 90% compared to non-transformed, etc.

Plant height Around R6 Height from the surface of the soil to the tip of the tallest hand-stretched sheet Height in cm (average for 10 plants per experimental plot) Lodging Around R8 Visual assessment of the severity of lodging Visual assessment on a scale of 0-100%, taking into account the number of lodged plants Final population Around R8 The number of plants remaining in the ranks of each experimental plot Exact amount per test plot, including plants removed from the previous sample

Seeds of test and control soybeans were sown at a seed rate of approximately 112 seeds per 25-foot row with a row spacing of approximately 30 inches (75 cm). In each locality, three repetitive test plots were created for each version of the experiment, with each test plot consisting of 2-25 foot rows. The test plots were distributed according to a randomized full block plan (RCB) with unique randomization in each area. Each experimental plot of soybean was limited to two rows of non-transgenic soybean of similar maturity. The entire test site was surrounded by at least 10 feet of non-transgenic soybeans of similar relative maturity.

Herbicide treatments were carried out with a volume of spray solution of approximately 20 gallons per acre (187 l / ha). These treatments were planned to reproduce the maximum application rate noted on the labeling used in commercial practice. 2,4-D was applied in the form of three excess spray treatments of just 3 lb ke / acre per season. Separate application of 1.0 lb ke / acre (1,120 g / ha) was carried out pre-emergence and approximately in the phases of growth of V4 and R2. Glufosinate was applied as two excess treatments by spraying a total of 0.74 pounds of active ingredient / acre (828 g of active ingredient / ha) per season. Separate application of 0.33 pounds of active ingredient / acre and 0.41 pounds of active ingredient / acre (374 and 454 g of active ingredient / ha) was carried out approximately in the growth phases of V6 and R1.

For agronomic data, analysis of variance among field test sites using a mixed model (SAS version 8; SAS Institute 1999) was performed. Input data elements were considered fixed effects, and terrain, an intra-block, locality by input data elements, and an intra-block data element were designated as random effects. The significance of the overall effect of the conditions was evaluated using the Fisher test. Using the Student criterion, pairwise comparisons were made between the input data elements for the control and the unsprayed transgenic soybean object DAS-68416-4 (unsprayed), the soybean object DAS-68416-4, sprayed with glufosinate (soybean object DAS-68416-4 + glufosinate), the object soybean DAS-68416-4 sprayed with 2,4-D (soybean object DAS-68416-4 + 2,4-D) and soybean dish DAS-68416-4 sprayed with glufosinate and 2,4-D (soybean object DAS -68416-4 + both). The corrected P values were also calculated using the average false hypothesis deviation (FDR) fraction to control the effect of multiple comparisons (Benjamini and Hochberg, 1995).

An analysis was made of the agronomic data collected for control of the unsprayed soybean object DAS-68416-4, the soybean object DAS-68416-4 + 2,4-D, the soybean object DAS-68416-4 + glufosinate, and the soybean object DAS-68416-4 + both herbicides. No statistically significant differences were observed for the calculation of plant density, early population, seedling thickness, damage after treatment, lodging, final calculation of plant density or days before flowering (table 28). In the case of plant height, a significant two-way student criterion was calculated between the control and the soybean object DAS-68416-4 + spraying 2,4-D. However, no significant general effect of the conditions was observed, the differences were very small between the treated soybean object DAS-68416-4 and the control, and no differences were observed between the different experimental variants with the soybean object DAS-68416-4. Given these results, the soybean object DAS-68416-4 was agronomically equivalent to an almost isogenic non-transgenic control.

Table 28
Analysis of agronomic characteristics from the agronomic experiment S1 The analyzed parameter General effect of conditions
(Pr> F) ^a The control Unsprayed
(Value P ^b Correct. P) ^c Sprayed with glufosinate (Value P Correct. P) Sprayed 2,4-D
(P value Correct. P) Sprayed by both
(P value Correct. P) Density calculation 0.774 170 172 175 173 175 (Number of plants) (0,709,0,824) (0,311,0,575) (0,476,0,672) (0,269,0,575) Early population 0.714 76.7 77.4 79.1 79.0 79,4 (% seedlings) ^d (0.738,0,824) (0,301,0,575) (0,327,0,575) (0,256,0,575) The power of seedlings ^e 0.547 9.72 9.39 9.50 9.44 9.39 (0,146,0,575) (0,326,0,575) (0,222,0,575) (0,146,0,575) Power / damage 0.511 10.0 9.86 9.89 9.83 9.67 App. 2 ^e (0,461,0,671) (0,555,0,718) (0,378,0,611) (0,087,0,575) Power / damage 0.462 10.0 10.0 9.89 9.83 9.89 App. 3 ^e (1,000,1,000) (0,320,0,575) (0,141,0,575) (0,320,0,575) Vigor / injury 0.431 9.94 9.89 9.78 9.67 9.78 App. 5 ^e (0,721,0,824) (0,289,0,575) (0,085,0,575) (0,289,0,575) Height (cm) 0.144 101 98.1 99,2 96.1 97.2 (0,145,0,575) (0,390,0,611) (0,020,0,575) (0,062,0,575) Lodging (%) 0.948 17,2 18.2 21.3 20.7 21.7 (0,885,0,904) (0,551,0,718) (0,606,0,746) (0,511,0,700) The final density of standing 0.268 156 154 161 155 163 (Number of plants) (0,770,0,840) (0,335,0,575) (0,817,0,853) (0,127,0,575) Days to flowering ^f 0.452 49.0 49.5 49.4 48.7 49.2 (0,261,0,575) (0,395,0,611) (0,568,0,718) (0,668,0,801) ^a The overall effect of the conditions was evaluated using the Fisher test ^b Comparison of sprayed and unsprayed plants with control using student criterion ^c P values were adjusted using the method of average fraction of false hypothesis deviations (FDR) ^d Scale 0-100%; (Calculation of standing density divided by the number of seeds sown) * 100 ^e Visual rating on a scale of 1-10; 10 = growth equivalent to non-transformed plants ^f Visual rating on a scale of 0-100%; 0% = no damage ^f Number of days from planting to flowering B values in bold are significant (<0.05)

EXAMPLE 17

Obtaining agronomic data for 2009

An agronomic study using the DAS-68416-4 soybean object and non-transgenic control (var. Maverick) was carried out in 2009 in 8 locations located in Arkansas, Iowa, Illinois, Indiana, Missouri and Nebraska. Agronomic indicators were evaluated, including the calculation of the standing / population density, seedling / plant thickness, plant height, disease frequency, insect damage and days before flowering, to study the equivalence of the soybean object DAS-68416-4 (with and without herbicide treatments) to the control (table 29 )

Table 29
Data collected in agronomic and yield studies in 2009. Characteristic Evaluation time Description Registered Units Test* Seedlings Vc-v2 The calculation of the density of standing in the 1-meter section of the row, divided by the number of seeds sown per meter % B Seedling power V1-v3 The total capacity of seedlings 1 (low) to 10 (high) B Visible damage After processing V3 Visible damage 1 day after treatment with the herbicide in phase V3 % S

Visible damage After processing V3 Visible damage 7 days after the herbicide treatment in phase V3 % S Visible damage After processing V3 Visible damage 14 days after the herbicide treatment in phase V3 % S Days before flowering The number of days from planting before 50% of the plants reach phase R1 Days B Density calculation R2 The number of plants in the 1-meter section of the row B Visible damage After processing R2 Visible damage 1 day after treatment with herbicide in phase R2 % S Visible damage After processing R2 Visible damage 7 days after herbicide treatment in phase R2 % S

Visible damage After processing R2 Visible damage 14 days after herbicide treatment in phase R2 % S Disease frequency ~ R6 Unscheduled report of any disease that occurs in the area % B Insect damage ~ R6 Unscheduled report of any insect damage that occurred in the area % B Plant height R8 The final height of plants in the experimental plot in phase R8 cm B Maturity R8 The number of days from planting until 95% of the plants in the test plot reach their mature color Days B Lodging R8 The degree of lodging in the experimental plot From 1 (absence) to 5 (flat lying) B

Productivity R8 The mass of seeds collected from the experimental plot bushel / acre B 100 seed weight R8 Mass of 100 randomly selected seeds when collecting from the experimental plot g B * B - Testing of sprayed and unsprayed plants,
S - testing only sprayed plants

For testing, a randomized full block plan was used. Input data elements were the DAS-68416-4 soybean object, the Maverick control line, and commercially available non-transgenic soybean lines. The seeds of the test, control and reference soybeans were sown at a seed rate of approximately 112 seeds per row with a row spacing of approximately 30 inches (75 cm). In each locality, 4 repeating experimental plots were created for each experiment variant, and each experimental plot consisted of 2-25 foot rows. Each experimental plot of soybean was limited to 2 rows of non-transgenic soybean (Maverick). The entire test site was surrounded by at least 4 rows (or 10 feet) of non-transgenic soybean (Maverick). To obtain an agronomically acceptable crop, appropriate practices for controlling insects, weeds and diseases were carried out.

Herbicide treatments were carried out to reproduce the maximum application rate noted on the labeling used in commercial practice. The experimental options consisted of unsprayed control and treatments with 2,4-D, glufosinate, 2,4-D / glufosinate herbicides applied to specific growth phases. To treat 2,4-D, the herbicide was applied at a rate of application of 1.0 lb ke / acre (1.120 g ke / ha) into the growth phases V4 and R2. For glufosinate treatments, deposition was carried out on plants in the growth phases V4 and V6-R2. For treatments with both herbicides, glufosinate was applied at a rate of application of 0.33 pounds of active ingredient / acre (374 g of active ingredient / ha) and 0.41 pounds of active ingredient / acre (454 g of active ingredient / ha) for application in phases V4 and V6- R2, respectively. The input data elements for treatments with both herbicides were the soybean object DAS-68416-4 and controls, including the non-transgenic Maverick. Maverick pilot sites were expected to die after application of the herbicides.

For agronomic data, analysis of variance among field test sites using a mixed model (SAS version 8; SAS Institute 1999) was performed. Input data elements were considered fixed effects, and terrain, an intra-block, locality by input data elements, and an intra-block data element were designated as random effects. Similarly, analysis was performed at individual test sites with input data elements as fixed effects and a block and input data elements for the block as random effects. For statistical analysis, the data was rounded. Significant differences were described with a 95% significance level, and the significance of the overall effect of the conditions was evaluated using the Fisher test. Using Student's t-test, a pairwise comparison was made between an unsprayed transgenic object with AAD-12 (unsprayed), an object with AAD-12 sprayed with glufosinate (AAD-12 + glufosinate), an object with AAD-12 sprayed with 2,4-D (AAD- 12 + 2,4-D), and an object with AAD-12 sprayed with glufosinate and 2,4-D (AAD-12 + 2,4-D + glufosinate), and control.

Due to the large number of comparisons made in this study, the problem was the effect of multiple comparisons. The effect of multiple comparisons is a problem when a large number of comparisons are carried out in one study to detect unexpected effects. Under these conditions, the probability of falsely determined differences based on p-related comparisons is very high (1-0.95 ^{number of comparisons} ). In this study, four comparisons per parameter were performed (16 analyzed types of observations for agronomic data), resulting in 64 comparisons for agronomic data. Thus, the probability of determining one or more false differences based on unadjusted p values was 99% for agronomic data (1-0.95 ⁶⁴ ).

An analysis was made of the agronomic data collected for control of an unsprayed object with AAD-12, AAD-12 + glufosinate, AAD-12 + 2,4-D, and AAD-12 + 2,4-D + glufosinate. In the case of analysis over the whole area, no statistically significant differences were observed for seedling power, final population, plant power / damage (V4, R1), lodging, disease frequency, insect damage, days before flowering, days before ripening, number of beans, number of seeds, yield and plant height. In the case of calculation of the density of standing and the early population, a significant two-way student criterion was calculated between the control and AAD-12 + glufosinate, but this was not accompanied by a significant general effect of the conditions or the FDR-adjusted value of p. In the case of plant power / damage (R2), a significant two-way student criterion and a significant overall effect of the conditions between the control and AAD-12 + glufosinate and AAD-12 + 2,4-D + glufosinate were calculated, but this was not accompanied by a significant FDR-adjusted p value . The average results for all of these variables were also within the range found for the reference lines tested in this study.

EXAMPLE 18

Transformation and selection of the pDAS 1740-278 object with AAD-1

Object pDAS 1740-278 with AAD-1 was obtained using a whisker-mediated transformation of the Hi-II maize line. The transformation method used is described in US Patent Application No. 20090093366. The maize line was transformed using the FspI fragment of plasmid pDAS 1740 (FIG. 3), also referred to as pDAB3812. This plasmid construct contains an expression cassette of plants containing RB7 MARv3 :: ubiquitin promoter 1 Zea mays v2 // AAD1 v3 // PER5 3'UTR Zea mays :: RB7 MARv4 transcription unit of plants (PTU).

Received many objects. Objects that survived and produce healthy, haloxifop-resistant callus tissue were assigned unique identification codes representing the alleged transformed objects, and they were continuously transferred to a fresh selective medium. Plants were regenerated from tissue obtained from each unique object and transferred to the greenhouse.

Leaf samples were taken for molecular analysis to confirm the presence of the AAD-I transgene by Southern blotting, confirmation of DNA boundaries, and confirmation of the concomitant genomic marker. Positive T0 plants were pollinated using inbred lines to obtain T1 seeds. Plants T1 of the object pDAS 1470-278-9 (DAS-40278-9) were subjected to selection, self-pollination and characterized for five generations. At the same time, T1 plants were backcrossed and introgressed into elite idioplasm (XHH 13) by marker selection for several generations. This object was obtained from an independent transformed isolate. The object was selected according to its unique characteristics, such as a single insertion site, normal Mendelian cleavage and stable expression, the best combination of efficiency, including herbicide resistance, and agronomic characteristics with a different genetic background and in many places with different climates. A further description regarding the corn object pDAS-1740-278-9 is given in WO 2011/022469, incorporated herein by reference in its entirety.

EXAMPLE 19

Herbicide processing and agronomic data

Herbicide treatments were performed using a volume of spray solution of approximately 20 gallons per acre (187 l / ha).

These treatments were carried out to reproduce the maximum application rate noted on the labeling used in commercial practice. Weedar 64 (026491-0006) was used at a concentration of 39%, 3.76 pounds ke / gallon, 451 g ke / l and Assure II (106155) at a concentration of 10.2%, 0.87 pounds of active ingredient / gallon, 104 g active ingredient / ha.

2,4-D (Weedar 64) was applied in the form of 3 excess spray applications on the test input data elements 4 and 5 (total of 3 lb ke / acre per season). Separate application was carried out in the pre-emergence period and approximately in phases V4 and V8-V8.5. For Weedar 64, individual target application rates were 1.0 lb ke / ha or 1120 g ke / ha. Exact application rates were in the range 1096-1231 g ke / acre.

Quisalofop (Assure II) was applied as a single over-spray application to the test input data elements 3 and 5. The application time was approximately the growth phase of V6. For Assure II, the planned application rate was 0.0825 pounds of active ingredient / acre or 92 g of active ingredient / ha. Exact application rates were in the range of 90.8-103 g of active ingredient / ha. Agronomic characteristics were recorded for all tested elements in blocks 2, 3 and 4 in each area. Table 30 presents the measured characteristics.

Table 30
Agronomic data for the corn facility pDAS-1740-278-9 Sign Evaluation time Data Description Early population V1 and V4 The number of sprouted plants per experimental plot Seedling power V4 Visual assessment of the average thickness of sprouted plants per experimental plot Plant power /
damage Approximately 1-2 weeks after treatments Damage due to herbicide treatments Time to sweat pistil posts Approximately 50% of the sweeping of pistil posts The number of accumulated units of the amount of heat from the moment of sowing before 50% of the plants are swept out Time before dropping pollen Approximately 50% pollen release The number of accumulated units of the amount of heat from the moment of sowing until 50% of the plants discharge pollen Pollen vitality approximately 50% Assessment of the color and shape of pollen over a period of time Plant height About R6 Height to the tip of the sultan Ear height About R6 Height to the base of the primary cob Lodging stems About R6 Visual assessment of the percentage of plants in the experimental plot with stems broken below the primary cob Rooting About R6 Visual assessment of the percentage of plants in the experimental plot, tilting 30º or more in the first ~ 1/2 meter from the soil surface Final population About R6 The number of plants remaining in the experimental plot Days to ripen About R6 The number of accumulated units of the amount of heat from the moment of sowing until 50% of the plants reach physiological maturity Maintainability About R6 General condition of plants Disease frequency About R6 Visual assessment of the frequency of leaf diseases Insect damage About R6 Visual assessment of insect damage Note: Unit of heat = ((MAX. Temp. + MIN. Temp.) / 2) -50 ° F

An analysis was made of the agronomic data collected for control of an unsprayed object with aad-1, aad-1 + 2,4-D, aad-1 + quisalophop, and aad-1 + both herbicides. In the case of an analysis across the whole area, no statistically significant differences were observed for the values of the early population (V1 and V4), power, final population, damage to the crop, time until the pistillate columns were swept, time before the pollen was dropped, the stalks were lodged, the roots were laid down, the incidence of diseases, damage by insects, days before ripening, plant height and pollen viability (shape and color) in a combined analysis of the area. In the case of repairability and cob height, a significant two-way student criterion was calculated between the control and the object with aad-1 + quisalophop, but this was not accompanied by a significant general effect of the conditions or p values adjusted for the average fraction of false hypothesis deviations (FDR) (table 31).

Table 31
Results of a summary analysis of local agronomic characteristics for a corn object DAS-40278-9 with aad-1 (sprayed and unsprayed) and control The analyzed parameter The general effect of the conditions (pr> F) ^a The control Unsprayed (Values P ^b Correct. P) ^c Sprayed with Quisalophop (Values P Correct. P) Sprayed 2,4-D (Values P Correct. P) Sprayed by both (Values P Correct. P) Early V1 population (number of plants) (0,351) 42.8 41.3
(0.303, 0.819) 41.7
(0.443, 0.819) 41.9
(0.556, 0.819) 44.1
(0.393, 0.819) Early V4 population (number of plants) (0.768) 43.1 43.3
(0.883, 0.984) 43.7
(0.687, 0.863) 44.3
(0.423, 0.819) 44.8
(0.263, 0.819) The power of seedlings ^d (0,308) 7.69 7.39
(0.197, 0.819) 7.36
(0.161, 0.819) 7.58
(0.633, 0.819) 7.78
(0.729, 0.889) Final population (number of plants) (0,873) 40.1 39.6
(0.747, 0.889) 39.7
(0.802, 0.924) 39.9
(0.943, 1.00) 41.1
(0.521, 0.819)

Crop damage - 1st treatment ^e NA ^l 0 0 0 0 0 Crop Damage - 2nd treatment ^f (0.431) 0 0
(1.00, 1.00) 0
(1.00, 1.00) 0
(1.00, 1.00) 0.28
(0.130, 0.819) Crop Damage - 3rd Treatment ^f NA 0 0 0 0 0 Crop Damage - 4th treatment ^f NA 0 0 0 0 0 Time to sweat pistil posts
(units of heat) ^f (0.294) 1291 1291
(0.996, 1.00) 1293
(0.781, 0.917) 1304
(0,088, 0,819) 1300
(0.224, 0.819)

Time before dropping pollen
(units of heat) ^f (0,331) 1336 1331
(0.564, 0.819) 1342
(0.480, 0.819) 1347
(0.245, 0.819) 1347
(0.245, 0.819) Pollen shape
0 minutes (%) ^g (0.872) 10.9 10.9
(0.931, 1.00) 11.3
(0.546, 0.819) 11,4
(0.439, 0.819) 11.3
(0.605, 0.819) Pollen shape
30 minutes (%) (0.486) 49.2 50.8
(0.618, 0.819) 46,4
(0.409, 0.819) 48.1
(0.739, 0.889) 51.9
(0.409, 0.819) Pollen shape
60 minutes (%) (0.724) 74,4 74.7
(0.809, 0.924) 73.6
(0.470, 0.819) 73.9
(0.629, 0.819) 75.0
(0.629, 0.819) Pollen shape
120 minutes (%) (0.816) 82.6 82.6
(1.00, 1.00) 82.6
(1.00, 1.00) 82.6
(1.00, 1.00) 82.5
(0.337, 0.819) Pollen color
30 minutes (%) ^h (0,524) 51.9 52,5
(0.850, 0.960) 48.9
(0.306, 0.819) 50.3
(0.573, 0.819) 53.6
(0.573, 0.819)

Pollen color
60 minutes (%) (0.332) 75.3 75.9
(0.612, 0.819) 74,2
(0.315, 0.819) 74,2
(0.315, 0.819) 75.9
(0.612, 0.819) Pollen color
120 minutes (%) NA 84.0 84.0 84.0 84.0 84.0 Lodging of stems (%) (0.261) 5.11 5.22
(0.356, 0.819) 5.00
(0.356, 0.819) 5.00
(0.356, 0.819) 5.00
(0.356, 0.819) Root lodging (%) (0.431) 0.44 0.17
(0.457, 0.819) 0.72
(0.457, 0.819) 0.17
(0.457, 0.819) 0.11
(0.373, 0.819) Repairability ⁱ (0.260) 4.67 4.28
(0.250, 0.819) 3.92
(0,034 ^m , 0,819) 4.17
(0.144, 0.819) 4.11
(0.106, 0.819) Disease frequency ^j (0.741) 6.42 6.22
(0.383, 0.819) 6.17
(0.265, 0.819) 6.17
(0.265, 0.819) 6.17
(0.265, 0.819) Insect damage ^k (0.627) 7.67 7.78
(0,500, 0,819) 7.78
(0,500, 0,819) 7.72
(0.736, 0.889) 7.56
(0,500, 0,819)

Days to maturity (units of heat) ^f (0.487) 2411 2413
(0.558, 0.819) 2415
(0.302, 0.819) 2416
(0.185, 0.819) 2417
(0.104, 0.819) Plant height (cm) (0.676) 294 290
(0.206, 0.819) 290
(0.109, 0.819) 291
(0.350, 0.819) 291
(0.286, 0.819) Ear height (cm) (0,089) 124 120
(0,089, 0,819) 118
(0.018 ^m , 0.786) 121
(0.214, 0.819) 118
(0.016 ^m , 0.186) ^a The overall effect of the conditions was evaluated using the Fisher test ^b Comparison of sprayed and unsprayed objects with control using Student's criterion ^c P values adjusted using the mean false hypothesis rejection (FDR) method ^d Visual rating on a scale of 1–9; 9 = tall plants with large coarse leaves ^e Scale 0-100%; while 0 = no damage and 100 = dead plant ^f Number of units of heat accumulated since planting ^g Scale 0-100%; % pollen grains with destroyed shells ^h Scale 0-100%; with% pollen grains with a bright yellow color ⁱ Visual assessment on a scale of 1-9, where 1 is the absence of visible green tissue ^j Visual rating on a scale of 1–9, where 1 is poor disease resistance

^k Visual rating on a scale of 1-9, where 1 is poor insect resistance ^l NA = no statistical analysis was performed due to lack of variability among parallels or treatments ^m Statistical differences indicated by a value of P <0.05

EXAMPLE 20

Additional agronomic tests

The agronomic characteristics of the 40278 corn line compared to the almost isogenic corn line were evaluated under various environmental conditions. The experimental options included 4 genetically different hybrids and their corresponding almost isogenic control hybrids, tested in just 21 locations.

Four tested hybrids were hybrids with ripening from medium to late in the range from 99 to 113 days of relative maturation. In experiment A, object DAS-40278-9 was tested with the genetic background of the inbred C × conversion BC3S1 line. This hybrid has a relative maturity of 109 days and was tested in 16 locations (Table 32). In experiment B, a hybrid with a background of the inbred line E × conversion of BC3S1, a hybrid with a relative maturation of 113 days, was tested. This hybrid was tested in 14 locations using a slightly different set of locations than in experiment A. In experiments C and D, hybrids with a background of BC2S1 × inbred line D conversion and BC2S1 × inbred line F conversion, respectively, were tested. Both of these hybrids have a relative maturity of 99 days, and they were tested in 10 identical locations.

For each test, a randomized full block plan with two repetitions per terrain and two-row experimental plots was used. The row was 20 feet long, and each row was sown at 34 seeds per row. During the tests, standard regional agricultural technology was used.

Data was collected and analyzed according to eight agronomic characteristics; plant height, ear height, lodging of shoots, lodging of roots, final population, grain moisture, test weight and yield. The plant height and cob height parameters provide information on the appearance of hybrids. Agronomic characteristics the percentage of lodging of stems and lodging of the roots determines the harvestability of the hybrid. By counting the final population, seed quality and seasonal growing conditions affecting the crop are measured. Using the percentage of grain moisture during harvesting, the ripening of the hybrid is determined, and using the yield (bushels / acre, adjusted for humidity) and test mass (mass in pounds per bushel of corn, adjusted for 15.5% moisture) describe the reproductive ability of the hybrid.

An analysis of variance was carried out at the field test sites using a linear model. The input data element and terrain were included as fixed effects in the model. Mixed models were studied, including terrain and terrain by the input data element as random effects, but terrain by the input data element explained only a small part of the variance and its component of the variance often did not differ significantly from zero. In the case of lodging of the stems and roots, a logarithmic transformation was used to stabilize the dispersion, however, the average values and ranges were recorded on the original scale. Significant differences were described with a 95% significance level. The significance of the overall effect of the conditions was evaluated using Student's criterion.

The results of these studies of agronomic characteristics can be found in table 32. No statistically significant differences were observed for any of the four hybrids 40278 compared with the isogenic control lines (at p <0.05) for parameters of the height of the ears, lodging of stems, lodging of roots, moisture of grain, test mass and yield. The final population count and plant height were statistically significant in experiments A and B, respectively, but did not show similar differences when compared with other tested hybrids 40278. Some of the observed fluctuations may be the result of a low level of genetic variation left after DAS-40278 backcrossing -9 to elite inbred lines. The total range of values of all measured parameters is within the range of values obtained for conventional maize hybrids, and does not lead to the conclusion of increased weed contamination. In conclusion, agronomic evidence suggests that 40278 maize is biologically equivalent to conventional maize.

Table 32
Analysis of agronomic characteristics Experiment A Parameter (units) Experiment option Average Range P value Min Max. Plant Height (inches) Aad-1 96.31 94.00 99.00 0.6174 The control 95.41 95.00 98.00 Cob Height (inches) Aad-1 41.08 30.00 48.00 0.4538 The control 44,42 40.00 47.00 Lodging of stems (%) Aad-1 3.64 0.00 27.70 0.2020 The control 2.49 0.00 28.57 Root lodging (%) Aad-1 1.00 0.00 7.81 0.7658 The control 0.89 0.00 28.33 Final population (plants / acre in thousand) Aad-1 31.06 27.00 36.00 0,0230 The control 32.17 27.00 36.00 Grain moisture (%) Aad-1 22.10 14.32 27.80 0.5132 The control 21.84 14.52 31.00 Test weight (lb / bushel) Aad-1 54.94 51.10 56.80 0.4123 The control 54.66 51.00 56.80 Productivity (Bushels / Acre) Aad-1 193.50 138.85 229.38 0.9712 The control 187.05 99.87 256.72 Experiment B Parameter (units) Experiment option Average Range P value Min Max. Plant Height (inches) Aad-1 106.92 104.00 108.00 0.0178 The control 100.79 95.00 104.00

Cob Height (inches) Aad-1 51.75 49.00 50.00 0.1552 The control 45.63 38.00 50.00 Lodging of stems (%) Aad-1 1.24 0.00 15.07 0.1513 The control 0.72 0.00 22.22 Root lodging (%) Aad-1 0.64 0.00 6.15 0.2498 The control 0.40 0.00 9.09 Final population (plants / acre in thousand) Aad-1 31.30 26.00 37.00 0.4001 The control 30.98 25.00 35.00 Grain moisture (%) Aad-1 23.71 14.34 28.70 0.9869 The control 23.72 13.39 31.10 Test weight (lb / bushel) Aad-1 56.96 50.90 59.50 0.2796 The control 56.67 52.00 60.10 Productivity (Bushels / Acre) Aad-1 200.08 102.32 258.36 0.2031 The control 205.41 95.35 259.03 Experiment C Parameter (units) Experiment option Average Range P value Min Max. Plant Height (inches) Aad-1 95.92 94.00 96.00 0.1262 The control 90.92 90.00 90.00 Cob Height (inches) Aad-1 47.75 41.00 50.00 0.4630 The control 43.75 37.00 46.00 Lodging of stems (%) Aad-1 6.74 0.00 27.47 0.4964 The control 5.46 0.00 28.12

Root lodging (%) Aad-1 0.3512 0.00 7.58 0.8783 The control 0.3077 0.00 33.33 Final population (plants / acre in thousand) Aad-1 32.78 29.00 36.00 0,0543 The control 31.68 24.00 35.00 Grain moisture (%) Aad-1 19.09 13.33 25.90 0.5706 The control 19.36 13.66 26,50 Test weight (lb / bushel) Aad-1 54.62 42.10 58.80 0.1715 The control 55.14 52.80 58.40 Productivity (Bushels / Acre) Aad-1 192.48 135.96 243.89 0.2218 The control 200.35 129.02 285.58 Experiment D Parameter (units) Experiment option Average Range P value Min Max. Lodging of stems (%) Aad-1 7.29 0.00 9.26 0.4364 The control 4.17 0.00 39.06 Final population (plants / acre in thousand) Aad-1 29.93 27.00 34.00 0,0571 The control 31.86 29.00 35.00 Grain moisture (%) Aad-1 18.74 19.40 24.40 0.4716 The control 19.32 13.35 25.70 Test weight (lb / bushel) Aad-1 56.59 54.80 58.30 0,0992 The control 55.50 52.70 57.40 Productivity (Bushels / Acre) Aad-1 203.55 196.51 240.17 0.7370 The control 199.82 118.56 264.11

The agronomic characteristics of hybrid maize containing object DAS-40278-9, compared to the almost isogenic line of maize, were collected from many field test sites in different geographical areas during the growing season. The results for hybrid maize lines containing object DAS-40278-9, compared with plants without an insert, are presented in table 33.

"Name" - "Name", "Hybrid corn containing event DAS-40278-9" - "Hybrid corn containing the object DAS-40278-9", "Control hybrid corn" - "Control hybrid corn," Yield "-" Yield "," Grain moisture "-" Grain moisture "," Final population (plants / acre in 1000s) "-" Final population (plants / acre in thousand) "]

Table 33
Yield, percent moisture content of the grain and the final population for hybrid corn containing the object DAS-40278-9, compared with the almost isogenic control line Title Productivity Grain moisture (%) Final population (plants / acre in thousand) Hybrid corn containing the object DAS-40278-9 218.1 21.59 31.69 Hybrid Control Corn 217.4 21.91 30,42

Agronomic characteristics of hybrid maize lines containing the object DAS-40278-9, and plants without an insert, sprayed with quisalophop herbicides (280 g ke / ha) in the growth phase V3 and 2,4-D (2.240 g ke / ha) in the growth phase V6 are presented in table 34.

Table 34
Agronomic data for object DAS 40278-9 compared with the almost isogenic control line Test Productivity Grain moisture (%) Lodging of stems (%) Root lodging (%) Final population (plants / acre, thousand) Spray Test Hybrid corn No. 1 DAS-40278-9 214.9 23,4 0.61 2.19 thirty Control hybrid corn No. 1 177.9 23.46 0.97 36.32 28.36 LSD (0.5) 13.3 1,107 0.89 10.7 1,1 No spraying Hybrid corn No. 1 DAS-40278-9 219.6 22.3 0.95 1.78 30.8 Control hybrid corn No. 1 220.3 22.51 0.54 1,52 30.55 LSD (0.5) 6.9 0,358 0.98 1.65 0.7 Spray Test Hybrid corn No. 2 DAS-40278-9 198.6 26.76 0.38 2.08 29.29 Control hybrid corn No. 2 172.3 23.76 1,5 39.16 28.86

LSD (0.5) 13.3 1,107 0.89 10.7 1,1 No spraying Hybrid corn No. 2 DAS-40278-9 207.8 24.34 0.22 0.59 31 Control hybrid corn No. 2 206.2 24.88 0.35 0.12 30.94 LSD (0.5) 8.0 0.645 0.55 1.79 0.9

EXAMPLE 21

2,4-D boosts 2,4-D resistant soybean growth

Transgenic soybeans with the AAD-12 transgene provide protection to the soybean plant, while weeds are destroyed by applying 2,4-D. Surprisingly, 2,4-D also increased the growth of 2,4-D resistant soybeans. This increased growth leads to an increase in plant height and / or productivity of the sprayed experimental plots as compared to the un sprayed experimental plots.

The increase in plant growth and / or yield resulting from the 2,4-D treatment is described for soy plants genetically engineered resistant to 2,4-D. The tests were conducted in a variety of locations covering the soybean cultivation area in North America. The input data elements included elite lines into which the object DAS-68416-4 (causing resistance to 2,4-D) was introgressed. The experimental options consisted of unsprayed plants and plants sprayed with 2,4-D in the growth phases V3 and R2. The experimental plots were examined for various agronomic characteristics throughout the season, including plant height and grain yield. Weeds were monitored throughout the season in sprayed and unsprayed test plots to eliminate any competitive effect. At the end of the test, when analyzing the data, a significant increase in plant height and yield was observed for those input data elements that were sprayed with 2,4-D, compared to unsprayed. Increased yield is an additional benefit of weed control using 2,4-D in relation to soybean resistant to 2,4-D.

Field trials were started in 2011 to compare the agronomic characteristics of the soybean object DAS-68416-4 (international patent application No. 2011/066384) sprayed with 2,4-D with the agronomic characteristics of the unsprayed soybean object DAS-68416-4. Field trials included input data elements of 4 elite soybean lines into which the soybean object DAS-68416-4 was introgressed, and corresponding isogenic soybean lines without inserts from 4 elite soybean lines not containing the soybean object DAS-68416-4. The tests were carried out in various geographical areas (10 locations in total). The experiment was carried out in the form of a modified split plot with two repetitions per terrain. Entire experimental plots were experimental variants, and sub-plots were input data elements. Each test site consisted of two rows of 12.5 feet long, planted at a distance of 30 inches. The sprayed test plots were treated with 2,4-D (1120 g ke / ha) applied to the growth phases V3 and R2. Throughout the season, field experimental plots were maintained in accordance with generally accepted agricultural techniques and cleaned of weeds.

To determine how 2,4-D treatment affects the agronomic characteristics of soybeans, various agronomic characteristics of soybean plants were measured. The tested agronomic characteristics and growth phases at the time of data collection are presented in table 35.

Table 35
List of agronomic characteristics measured in 2011 harvest studies to compare the sprayed 2,4-D and the unsprayed soybean object DAS-68416-4 Measured characteristic Growth phase at the time of measurement 1. Germination: Calculation of standing density (indicated above), divided by the number of seeds sown in a 1-meter section, multiplied by 100. Calculated based on an early calculation of standing density 2. Seedling power: The percentage of power, where 0% represents the experimental plot with all the dead plants, and 100% represents the experimental plot where the plants look very healthy. V1-v3 3. Days before flowering: Days from planting until 50% of the plants in the test plot begin to bloom. R1

4. Calculation of standing density in R2: The number of plants in a typical 1-meter section of the row in the growth phase of R2. R2 5. Disease frequency: The severity of diseases in the experimental plot, evaluated on a scale of 0-100%. R6 6. Insect damage: Percentage of plant tissue in a test site damaged by insects. R6 7. Plant height: The average height of the plants in centimeters in each test plot, measured from the surface of the soil to the top after the leaves fall. R8 8. Lodging: The percentage of lodging at the time of harvest, where 0% = no lodging and 100% = all plants in the test plot are on the ground. R8 9. Days to ripen. The days from planting until 95% of the beans in the test plot reach a color corresponding to their dried state. R8 10. Cracking: Percentage of cracked beans in a test plot. R8 11. Productivity: Bushels per acre adjusted for 13% moisture. R8 12. Mass of 100 seeds: For each experimental plot, 100 seeds are selected and their weight is recorded in grams. R8

At the end of the soybean growing season, data from all localities were pooled and local analysis was performed. Data analysis was performed using JMP® Pro 9.0.3 (SAS, Cary, NC). The average values obtained by the least squares analysis are presented in Table 28. Processing of the 2,4-D soybean object DAS-68416-4 containing the AAD-12 transgene led to the conditioning effect of increased growth. Increased growth led to a significantly higher yield and plant height, as measured in field experimental plots sprayed with 2,4-D, compared with field experimental plots sprayed with 2,4-D. These increases were evident when data were analyzed cumulatively across all areas. In contrast, the increased yield of the soybean object DAS-68416-4, sprayed with 2,4-D, decreased when analyzing the terrain-variant experiment. The average plant height and yield increased by approximately 5% with 2,4-D treatment (Table 36).

Table 36
Least squares averages in a local analysis to compare a DAS-68416-4 soybean object sprayed with 2,4-D with unsprayed plants. Levels not marked with the same letter vary significantly Experiment Options 2,4-D at 1120 g ke / ha (in the growth phases of V3 and R2) Unsprayed Seedlings (%) 77 (A) 74 (A) Power V1-V3 (%) 87 (A) 87 (A) Days to flowering (Days from planting) 44 (A) 44 (A) The calculation of the density of standing in R2 (plants / m) 21 (A) 22 (A) Disease frequency in R6 (%) 1 (A) 1 (A) Insect damage in R6 (%) 2 (A) 2 (A) Height (cm) 81 (A) 77 (A) Ripening (Days from planting) 109 (A) 109 (A) Lodging (%) 10 (A) 8 (B) Cracking (%) 0 (A) 1 (A) Productivity (Bushels / Acre) 56.4 (A) 53.7 (B) 100 seed weight (g) 14.8 (A) 14.8 (A)

As shown in table 37, in at least one of ten locations (location No. a3) a significantly higher yield was recorded for unsprayed plants of the soybean object DAS-68416-4 compared to sprayed 2,4-D plants of the soybean object DAS-68416- four. When summarizing the results from all areas, the processing of the 2,4-D soybean object DAS-68416-4 containing the AAD-12 transgene showed a conditioning effect leading to increased growth. For example, the yield of plants of the soybean plant DAS-68416-4 sprayed with 2,4-D was 56.4 bushels / acre, which is significantly higher than the yield of unsprayed plants of the soybean object DAS-68416-4, 53.7 bushels / acre . Similarly, the height of the plants of the soybean object DAS-68416-4 sprayed with 2,4-D was 81 cm, being significantly greater than the height of the unsprayed plants of the soybean object DAS-68416-4, amounting to 77 cm.

Table 37
Least squares average yields in specific locations for comparing a DAS-68416-4 soybean object sprayed with 2,4-D with unsprayed plants. Levels not marked with the same letter vary significantly Area Number Experiment option Productivity
(bushels / acre) Productivity% Area No. a1 Sprayed 51 A 121.5 Unsprayed 42 B one hundred Area No. a2 Sprayed 67 A 115.6 Unsprayed 58 B one hundred Area number a3 Sprayed 44 B 88 Unsprayed fifty A one hundred Area No. a4 Sprayed 68 A 97 Unsprayed 70 A one hundred Area number a5 Sprayed 75 A 102.8 Unsprayed 73 A one hundred Area number a6 Sprayed 57 A 132.6 Unsprayed 43 B one hundred Area No. a7 Sprayed 48 A 102,2 Unsprayed 47 A one hundred

Area number a8 Sprayed 39 A 91 Unsprayed 43 A one hundred Area number a9 Sprayed 57 A 101.8 Unsprayed 56 A one hundred Area number a10 Sprayed 59 A 107.3 Unsprayed 55 A one hundred Average Sprayed - - 106

EXAMPLE 22

2,4-D boosts 2,4-D resistant soybean growth in 2,4-D / glyphosate combination

In 2010, similar field trials were carried out as in the previous example, but with two 2,4-D treatments in combination with glyphosate. The results showed that the increased growth of 2,4-D resistant soybeans in terms of plant height and / or yield of sprayed experimental plots as compared to unsprayed test plots is the result of 2,4-D treatment.

Significant effects of conditions were observed for a number of measured parameters. 2,4-D and glyphosate were applied to the growth phases of V3 and R2. The tests were carried out in various geographical areas (a total of six locations). The tested agronomic characteristics and growth phases at the time of data collection are presented in table 30. In the case of sprayed soybeans, the average height of plants increased by 6%, and the average yield increased by 17% (table 38). In addition, in the case of sprayed soybeans, the average seed weight increased by 6%.

Table 38
Least squares averages in a local analysis to compare 2,4-D resistant soybean sprayed with 2,4-D and glyphosate with unsprayed plants. Levels not marked with the same letter vary significantly Experiment Options 2,4-D and glyphosate at 1120 g ke / ha (in the growth phases V3 and R2) Unsprayed Seedlings (%) 54 (A) 54 (A) Power V1-V3 (%) 7 (A) 7 (A) Days to flowering (Days from planting) 41 (A) 41 (A) The calculation of the density of standing in R2 (plants / m) 15 (A) 15 (A) Disease frequency in R6 (%) 4 (A) 4 (A) Insect damage in R6 17 (A) 14 (B) Height (cm) 109 (A) 103 (B) Ripening (Days from planting) 117 (A) 116 (B) Lodging (%) 17 (A) 9 (B) Cracking (%) 0 (A) 0 (A) Productivity (Bushels / Acre) 43.4 (A) 37.0 (B) 100 seed weight (g) 12.2 (A) 11.5 (B)

As shown in table 39, variations in specific geographic locations were also observed in this example. In the case of sprayed soybeans, the average yield increased by 21.6% (table 39).

Table 39
Least squares average yields in specific locations for comparing 2,4-D resistant soybean sprayed with 2,4-D and glyphosate to unsprayed plants Area Number Experiment option Productivity (Bushels / Acre) Productivity% Area No. b1 Sprayed 39 A 162.5 Unsprayed 24 B one hundred Area number b2 Sprayed 51 A 104.1 Unsprayed 49 A one hundred Area number b3 Sprayed 56 A 155.5 Unsprayed 36 B one hundred Area number b4 Sprayed 35 A 106.1 Unsprayed 33 A one hundred Area number b5 Sprayed 48 A 104.3 Unsprayed 46 A one hundred Area number b6 Sprayed 32 A 97.0 Unsprayed 33 A one hundred Average Sprayed - - 121.6

EXAMPLE 23

Yield test results for comparing experiment options with and without spraying

2,4-D resistant transgenic crops transformed using aryloxyalkanoate dioxygenase (AAD) resulted in increased yields when treated with a stimulating amount of a herbicide containing an aryloxy alkanoate residue. Soy objects containing the AAD-12 gene expression cassette were tested in repeated yield tests under and without spraying. One series of experiments was carried out, including soybeans with early maturity, adapted to the northern latitudes, and another series of experiments, which included soybeans with late ripening, adapted to more southern latitudes. In previous experiments, there have been cases where the input data elements of soybeans containing the AAD-12 gene expression cassette, treated with 2,4-D during the growing season, showed increased yields relative to unsprayed controls.

For testing, we used a modified plan with split plots with 2 repetitions. Each test site was 2 rows wide with a row spacing of 30 inches and a length of 12.5 feet. Created a passageway with a width of 2.5 to 3 feet between the test sites, located by a continuous chain, to ensure movement during the test during the season. The sprayed blocks were sprayed sequentially (twice) during the growing season with 2,4-D-choline + glyphosate (premix) at 2185 g ke / ha + AMS at 2% of the mass.

Table 40
The list of analyzed areas for yield tests with a comparison of experiment options with and without spraying Terrain Test Atlantic, IA with early ripening Brookings sd with early ripening Cherry grove, mn with early ripening Deerfield, MI with early ripening Kirklin, IN with early ripening Otterbein, IN with early ripening Richland, IA with early ripening Wyoming, IL with early ripening Atlantic, IA late-ripening Carlyle, IL late-ripening Fisk MO late-ripening Otterbein, IN late-ripening Seymour, IL late-ripening Stewardson, IL late-ripening Sycamore, GA late-ripening Tallassee, AL late-ripening

The first treatment was carried out in the growth phase V3, and the second treatment in the growth phase R2. The experimental and control experimental plots of field trials were weed-free throughout the season using conventional herbicides or manual weeding. Data were collected on seedlings, seedling power, damage to the crop, flowering date, calculation of the standing density in R2, disease frequency, insect damage, plant height, ripening date, lodging, cracking, 100 seed weight and yield. Data was analyzed using JMP® Pro 9.0.3. Table 40 shows the locations used for the final analysis. Some of the areas in which they landed were not included in the analysis because of the variability in the experimental plot.

Local analysis was performed to test soybeans with early ripening and late ripening. Tables 41 and 42 present a variance analysis of yield for testing early maturity and late maturity soybeans, respectively.

Table 41
Dispersion analysis of yield by area (8 locations) in trials with a comparison of sprayed and unsprayed soybeans with early ripening Initial data N parameters Df Dfden Fisher test value Value P> F Title 8 8 57,030 3,780 0.001 Sign one one 5,989 12,409 0.013 Name * Sign 8 8 183,000 0.530 0.833

In soybean trials with both early and late ripening, a significant name effect was observed (P = 0.05). This was expected because each elite line of soybeans into which the object was introgressed had a different genetic background.

Table 42
Dispersion analysis of crop yields by area (8 locations) in trials with a comparison of sprayed and unsprayed soybeans with late ripening Source
data N parameters Df Dfden Fisher test value Value P> F Title eleven eleven 76,020 3,096 0.002 Sign one one 7,039 3,050 0.124 Title*
Sign eleven eleven 257,700 0.499 0,903

A significant effect of the experimental conditions was determined in the case of testing soybeans with early ripening, indicating that the variants of the experiment with and without spraying differ in yield. In the case of testing late-ripening soybeans, no significant effect of the experimental conditions was observed, which indicates that the sprayed and unsprayed experimental plots do not differ in yield.

Table 43
Table of average values of the yield obtained by the method of least squares in the test of productivity of soybean with early ripening Experiment Option Number Productivity (Bushels / Acre) 289-1 (HOMO), Unsprayed 42.0 A 289-1 (HOMO) Sprayed 46.0 A 289-2 (HOMO), Unsprayed 41.8 A 289-2 (HOMO) Sprayed 45.7 A 7471638-26 (HOMO), Unsprayed 38,2 B 7471638-26 (HOMO), Sprayed 42.9 A 76983-1 (HOMO), Unsprayed 38,4 B 76983-1 (HOMO) Sprayed 42.5 A 76983-2 (HOMO), Unsprayed 39.6 A 76983-2 (HOMO) Sprayed 42.9 A

75209 (HOMO), Unsprayed 46,4 A 75209 (HOMO), Sprayed 47.6 A 75209 [1] (HOMO), Unsprayed 48.1 B 75209 [1] (HOMO), Sprayed 52.7 A 75357-71 (HOMO), Unsprayed 46.2 A 75357-71 (HOMO), Sprayed 49.5 A 99345-31 [4] (HOMO), Unsprayed 40.1 B 99345-31 [4] (HOMO), Sprayed 46.0 A

In the case of soybean tests with both early and late ripening, the effect of the name-experiment interaction was not significant, which indicates that the effect of the experimental conditions (or lack of effect) was the same for each input data element in a particular test.

Table 43 presents the average yield for each combination of the input data element-variant of the experiment in the test of soybeans with early ripening, where HOMO means homozygous. The values followed by the same letter (within the specified variety) do not differ by the Student criterion at P = 0.05. Four input data elements were observed exhibiting higher yields by sequential spraying in V3 and R3 using 2,4-D-choline + glyphosate (premix) at 2185 g ke / ha + AMS.

Table 44 presents the average yield for each combination of the input data element-version of the experiment. The values followed by the same letter (within the specified variety) do not differ by the Student criterion at P = 0.05. As indicated above, in the case of testing late-ripening soybeans, no significant effect of the experimental conditions or the effect of the experimental variant on the input data element was observed, therefore, multiple comparisons of the averages were not carried out. The letters in the table indicate that no differences were observed between the experiment variants with and without spraying when testing soybeans with late ripening.

Table 44
Table of average values of the yield obtained by the method of least squares in the test of soybean yield with early ripening 2012 Experiment Option Number Productivity (Bushels / Acre) 348-1 (HOMO), Spray 54.5 A 348-1 (HOMO) Sprayed 54.7 A 348 [3] (HOMO), Unsprayed 51.1 A 348 [3] (HOMO), Sprayed 54.5 A 4075433-15 (HOMO), Unsprayed 59.6 A 4075433-15 (HOMO) Sprayed 60,4 A 75226-1 (HOMO), Unsprayed 52.1 A 75226-1 (HOMO) Sprayed 55.2 A 75226-2 (HOMO), Unsprayed 51.1 A 75226-2 (HOMO) Sprayed 52,2 A 75505 (HOMO), Unsprayed 50.1 A 75505 (HOMO) Sprayed 54.6 A 99753-81 (HOMO), Unsprayed 56.1 A 99753-81 (HOMO), Sprayed 55,4 A 75358-72 (HOMO), Unsprayed 50.7 A 75358-72 (HOMO), Sprayed 53.8 A 75358-72 [1] (HOMO), Unsprayed 48,4 A 75358-72 [1] (HOMO), Sprayed 50.1 A 99753-75 [4] (HOMO), Unsprayed 52.1 A 99753-75 [4] (HOMO) Sprayed 53,4 A Control -1, Unsprayed 49.2 A Control -1, Sprayed 51,4 A Control -2, Unsprayed 49.6 A Control -2, Sprayed 52.0 A

The results of the yield tests presented in this example again indicate that in some environmental conditions, in the case of certain soybean genotypes, an increase in yield after treatment with 2,4-D can be observed. In the last two years, such an increase in yield was observed in yield tests conducted in the area of growth of MG 2.

EXAMPLE 24

Comparison of soy and corn

Yield results in field trials of soybeans containing the AAD-12 transgene indicate that 2,4-D treatment can increase soybean yields in specific environmental conditions for specific soybean genotypes. These results are unexpected when compared with transgenic maize objects containing the AAD-1 transgene. The yield of AAD-1 transgenic maize plants did not show a stable statistically significant increase in yield after spraying with 2,4-D. These AAD-1 transgenic maize plants are biologically equivalent to conventional maize.

Additional field trials in various geographical areas were carried out from 2010 to 2012 on hybrid maize lines. Throughout these field trials, yields of corn lines sprayed with 2,4-D (2,185 g ke / ha and 4,370 g ke / ha) were compared with untreated control lines of corn (e.g., non-sprayed 2,4-D). The results of these experiments further confirm that maize plants containing the AAD-1 transgene do not lead to a significant increase in yield as a result of spraying with 2,4-D. For comparison, for some soybean genotypes, an increase in yield after treatment with 2,4-D is shown. The observed increase in yield in soybean genotypes, demonstrated after treatment with 2,4-D, is an unexpected improvement applicable to increase crop yields. The described method can be extended to the use of 2,4-D treatment to increase the yield of transgenic crops, for example, expressing the AAD-12 gene.

Although the foregoing invention has been described in some detail by way of illustrations and examples for clarity of understanding, it will be apparent that specific changes and modifications may be practiced within the scope of the claimed claims.

Claims (24)

1. A method of increasing the yield of a 2,4-D resistant soybean plant, including the use of 2,4-D at the growth stage of V3 and R2 of a 2,4-D resistant soybean plant, where a 2,4-D resistant soybean plant is treated 2 , 4-D with a spread rate of 1000 to 2000 g ke / ha. 2. The method according to p. 1, where the processing is carried out at least three times. 3. The method of claim 1, wherein the 2,4-D resistant soybean plant is under stress. 4. The method of claim 1, wherein the 2,4-D resistant soybean plant for weed control is also treated with a herbicide other than 2,4-D. 5. The method of claim 4, wherein the herbicide other than 2,4-D is a phosphoric herbicide or an aryloxyphenoxypropionic herbicide. 6. The method of claim 5, wherein the phosphoric herbicide comprises glyphosate, glufosinate, derivatives thereof, or combinations thereof. 7. The method of claim 5, wherein the phosphoric herbicide is in the form of an ammonium salt, an isopropylammonium salt, an isopropylamine salt, or a potassium salt. 8. The method according to claim 5, where the aryloxyphenoxypropionic herbicide contains chlorazifop, fenoxaprop, fluazifop, haloxifop, quizalofop, their derivatives or their combinations. 9. The method of claim 1, wherein 2,4-D enters a 2,4-D resistant soybean plant through root uptake. 10. The method of claim 5, wherein the phosphoric herbicide enters a 2,4-D resistant soybean plant through root uptake. 11. The method of claim 5, wherein the aryloxyphenoxypropionic herbicide enters a 2,4-D resistant soybean plant through root uptake. 12. A method of increasing the yield of soybean plants resistant to 2,4-D, comprising (a) transforming soybean cells with a nucleic acid molecule containing a nucleotide sequence encoding an aryloxyalkanoate dioxygenase (AAD); (b) selection of transformed cells; (c) regeneration of soybean plants from transformed cells; and (d) the use of 2,4-D in the growth stage of V3 and R2 of a 2,4-D resistant soybean plant, where a 2,4-D resistant soybean plant is treated with 2,4-D at a spread rate of from 1000 to 2000 g / ha. 13. The method of claim 12, wherein the aryloxyalkanoate dioxygenase (AAD) is AAD-12. 14. The method of claim 12, wherein the nucleic acid molecule contains a non-aryloxyalkanoate dioxygenase (AAD) selective marker. 15. The method of claim 14, wherein the selective marker is a phosphinotricin acetyltransferase (pat) gene or a bialaphos resistance gene (bar). 16. The method of claim 12, wherein the nucleic acid molecule is optimized for soy plants. 17. The use of 2,4-D in the production of transgenic plants with resistance to 2,4-D with increased yield compared to their non-transgenic parent plants, where the transgenic plant is a 2,4-D resistant soybean plant, where 2,4-D is used at the growth stage of V3 and R2 of a 2,4-D resistant soybean plant and where a 2,4-D resistant soybean plant is treated with 2,4-D at a spread rate of from 1000 to 2000 g ke / ha . 18. The use of claim 17, wherein 2,4-D contains 2,4-D-choline or 2,4-D-dimethylamine (DMA).

Images