CN105472970A - Methods of improving the yield of 2,4-D resistant crop plants - Google Patents

Abstract

This invention is related to methods for improving plant height and/or yield of crop plants which are resistant to herbicide 2,4-D by treating the plants with 2,4-D at application rates which are not harmful to the plants. In particular, provided is a method using 2,4-D application to increase yield of crop plants which express AAD-12 gene for 2,4-D resistance. The method provided is of particular interest for the treatment of crops plants including maize, soybean, spring and winter oil seed rape (canola), sugar beet, wheat, sunflower, barley, and rice.

Description

Improve the method for 2,4-D resistance crop plant yield

The cross reference of related application

This application claims the U.S. Provisional Patent Application No.61/656 submitted on June 7th, 2012, the priority of 546, clearly full content disclosed in it being incorporated to herein by carrying stating at this.

By carrying the material stated and be incorporated to and electronically submit to

Submit to the application simultaneously by carrying stating to be incorporated in full, identify following computer-readable sequence table: ASCII (text) file of 11,342 bytes that name is called " 72747_ST25.txt ", builds on May 13rd, 2013.

Background of invention

Weeds can crop rapidly in exhausted soil and other valuable nutrient required for plant expected.Have many dissimilar at present for the weed killer herbicide controlling weeds.The extremely welcome weed killer herbicide of one is glyphosate.

Develop the crop of resistance glyphosate, such as corn, soybean, canola, cotton, sugar beet, wheat, turfgrass and paddy rice.Therefore, such as, glyphosate can be sprayed to the field of the resistance glyphosate corn grown fine, significantly not damage corn plant to control weeds.

Along with the appearance of glyphosate tolerance crop (GTC) of middle 1990s genetic modification, growers obtain a kind of agriculturally impayable simple, convenient, flexibly and the instrument of cheapness to control wide spectrum broad leaved weed and grassy weed.Thus, the producer have employed GTC very soon, and abandons many generally acknowledged best agronomic practices in many cases, and such as shift of crops, the crop rotation of herbicide action mode, bucket mix, in chemistry and cultivation Weeds distribution, introduce Mechanical course etc.The soybean of current glyphosate tolerant, cotton, corn and canola the U.S. and other the Western Hemisphere countries market-oriented.More GTC (such as wheat, paddy rice, sugar beet, turfgrass etc.) has got out listing, waits for the accreditation of world market.Other resistance glyphosate species many are in stage (such as clover, sugarcane, sunflower, beet, pea, carrot, cucumber, lettuce, onion, strawberry, tomato and the tobacco of experiment to exploitation; The forestry such as willow and Chinese sweet gum species; And as horticultural species such as marigold, petunia and begonias; See network address " isb.vt.edu/cfdocs/fieldtests1.cfm, 2005 ").In addition, the cost of glyphosate sharply declines in recent years, to such an extent as to does not almost have conventional Weeds distribution program can in price and aspect of performance and the effective competition of glyphosate GTC system.

Glyphosate is going out raw (burndown) and other non-crop areas are used successfully to complete vegetation control more than 15 years.In many cases (as GTC), can continuous 3,5,10 until use glyphosate 1-3 time every year in 15 years.These situations have caused depending on unduly glyphosate and GTC technology, and to natural weed species be applied with serious be conducive to natural higher or developed the selection pressure of plant of resistance glyphosate herbicidal activity mechanism to glyphosate-tolerant.

What only comprise the Weeds distribution program of glyphosate widely uses the selection causing Glyphosate resistant plants, and selecting inherently more can the breeding (that is, weeds succession) of weed species of tolerate glyphosate than most target species.(Ng etc., 200; Simarmata etc., 2003; Lorraine-Colwill etc., 2003; Sfiligoj, 2004; Millar etc., 2003; Heap, 2005; Murphy etc., 2002; Martin etc., 2002).Although glyphosate widely uses in the whole world more than 15 years, report has developed the weeds of the resistance of glyphosate (Heap, 2005) few in number; But, just identified in the 3-5 in the past of the great majority in them.Resistant weed comprises species gramineae and broad-leaved species-wimmera ryegrass (Loliumrigidum), Annual Ryegrass (Loliummultiflorum), eleusine indica (Eleusineindica), artemisiifolia (Ambrosiaartemisiifolia), Horseweed Herb (Conyzacanadensis), wild pool wormwood artemisia (Conyzabonariensis) and rib grass (PlantagoIanceolata).In addition, the weeds not forming agronomy problem before GTC widely uses have become more common now, and under the background of GTC, (comprise the american cotton of >80% and the american corn acreage of soybean acreage and >20%) restive (Gianessi, 2005).These weeds successions main (but not being uniquely) appear in restive broad leaved weed.Some examples comprise Ipomoea (ipomea), Amaranthus (Amaranthus), Chenopodium (Chenopodium), Dandelion (Taraxacum) and Commelina (Commelina) species.

Will in the face of glyphosate-resistant weeds or the area to more restive weed species succession grower, grower can be used alternatingly by bucket mixed (tankmixing) or with the weed killer herbicide of other weeds that can control to slip through the net the weakness making up glyphosate.A kind of popular and effectively can control bucket that broad-leaved escapes in many cases to mix companion be 2,4-dichlorphenoxyacetic acid (2,4-D).2,4-D controls the existing history more than 60 years for wide spectrum broad leaved weed under agricultural and non-crop situation.The existing case report having more the species of patience, but 2,4-D remains one of the most widely used weed killer herbicide in the whole world.Further use 2,4-D be limited in its non-constant of selectivity in dicotyledon (as soybean or cotton), therefore 2,4-D be generally not used in (and usually not close) susceptible dicotyledonous crop.In addition, 2,4-D is applied in the character being limited to contingent crop damage in a way in gramineous crop.The combination of 2,4-D and glyphosate processes for providing stronger going out to give birth to before the no-tillage soybean of plantation and cotton, but, because these dicot species are to 2, the susceptibility of 4-D, these raw process of going out must at least be carried out (AgriIiance, 2003) before planting for 14-30 days.

The same with MCPA, 2,4-D is fibric acid weed killer herbicide.2,4-D has been used to the crop of Selective Control broad leaved weed and not serious damage expectation in many monocot cropss (as corn, wheat and paddy rice).2,4-D is the growth hormone derivative of synthesis, and its effect is that normal cytohormone homeostasis is lacked of proper care, and hinders balance, controlled growth, but its definite binding mode is still unknown.Triclopyr or fluroxypyr are pyridine fluoroacetic acid class classes of herbicides, and its binding mode is also the same with synthetic auxin.

These weed killer herbicides have the selectivity (such as dicotyledon is more responsive than gramineous plants) of varying level to certain plants.A kind of explanation of selectivity level difference is different by the metabolism of different plant.Generally speaking, plant metabolism 2,4-D is slow, and therefore the response difference of plant to 2,4-D more may be explained by the activity difference on target site (WSSA, 2002).The plant metabolism of 2,4-D is generally realized by two step metabolism, puts together (WSSA, 2002) typically after hydroxylating with amino acid or glucose.

Along with passage of time, microbial population has developed effective alternative route of this specific xenobiotics of degrading, and causes the permineralization of 2,4-D.This weed killer herbicide of continuous application can select the microorganism that this weed killer herbicide can be utilized as carbon source for growth, thus gives their competitive advantages in soil.Because this reason, 2,4-D of existing preparation has the relatively short soil half life period, and does not meet with and leave over effect (carryovereffect) significantly to its ensuing crop.Which increase the weeding effectiveness of 2,4-D.

Ralstonia eutropha (Ralstoniaeutropha) is the biology (Streber etc., 1987) that a kind of degraded 2,4-D ability has obtained extensively research.In coding mineralising approach, the gene of first enzymatic step is tfdA.See U.S. Patent number 6,153,401 and GENBANK accession number M16730.TfdA changes into chlorophenesic acid (DCP) (Smejkal etc., 2001) by the acid of alpha Ketoglutarate dependence dioxygenase catalytic reaction 2,4-D.DCP and 2,4-D compares has activity of weeding hardly.TfdA has been used to usually 2 in genetically modified plants, the dicotyledon (as cotton and tobacco) of 4-D sensitivity gives 2,4-D resistance (Streber etc. (1989), Lyon etc. (1989), Lyon (1993) and U.S. Patent number 5,608,147).

Having identified from environment a large amount of coding can degrade 2,4-D protein tfdA type gene and be stored in Genebank database.Many homologues similar to tfdA (amino acid identities >85%) also have the enzymic activity similar to tfdA.But, there is the homogeneity of a large amount of homologue and tfdA significantly lower (25-50%), but have and alpha Ketoglutarate dependence dioxygenase Fe ^{+ 2}the feature residue that dioxygenase is relevant.Therefore what the substrate specificity of these different dioxygenases is and indefinite.

Having the unique example of of low homology (amino acid identities 31%) with tfdA is sdpA (Kohler etc. from Dai Erfute acidovorax facilis (Delftiaacidovorans), 1999, Westendorf etc., 2002, Westendorf etc., 2003).Show the first step (Westendorf etc., 2003) of this enzymatic (S)-2,4-Dichlorophenoxy propionic acid (with other (S)-phenoxy propionic acids) and 2,4-D (phenoxy acetic acid) mineralising.So far also not by this genetic transformation to the report in plant.

The exploitation of novel herbicide tolerant crops (HTC) technology is not too successful, is due to the effect of GTC, low cost and convenience to a great extent.Therefore, the employing rate of GTC in the producer is very high.Seldom dynamic the going of people develops new HTC technology.

Aryloxy alkanoic acid chemistry substructure is that many commercial herbicides (comprise phenoxyacetate auxin (as 2,4-D and 2,4-Dichlorophenoxy propionic acid), pyridine fluoroacetic acid growth hormone (as fluroxypyr and Triclopyr), aryloxyphenoxypropionates ester (AOPP) acetyl-CoA carboxylase (ACC enzyme) inhibitor (as fluazifop-butyl (haloxyfop), quizalofop-ethyl and diclofop-methyl (diclofop)) and 5 substituted phenoxy acetic acid proporphyrinogen oxidase IX inhibitor (as seized by force grass spirit and flumicloracpentryl)) total entity.But other difference of these classes of herbicides is all quite large, does not have the evidence of degradation pathway common between these chemicals classifications in current document.Describe a kind of multifunctional enzyme (PCTUS/2005/014737 that on May 2nd, 2005 submits to) containing the degrading herbicide of multiple binding mode recently.

Summary of the invention

The present invention relates to by increase the plant height of antiweed 2,4-D crop and/or the method for productive rate to rate of application 2, the 4-D process plant of non-phytotoxic.Specifically, provide the method utilizing 2,4-D to use to increase the productive rate of crop, described crop expresses the AAD-12 gene for 2,4-D resistance.The invention further relates to 2,4-D for improving the purposes of the productive rate of anti-2,4-D crops.The method provided comprise maize, soybean, spring rape and winter rape (canola), sugar beet, wheat, sunflower, barley and paddy rice crop process in interesting especially.

In some embodiments, 2,4-D resistance crop is the genetically modified crops transformed with aryloxy alkanoic acid dioxygenase (AAD).In other embodiments, described aryloxy alkanoic acid dioxygenase (AAD) is AAD-1 or AAD-12.AAD-1 was previously described in US2009/0093366, and AAD-12 had previously been described in WO2007/053482, and their content states complete being incorporated to by carrying.

With 25gae/ha to 5000g/ha or 100gae/ha to 2500gae/ha or especially, the productive rate raising effect of 2,4-D process can be observed with the rate of application of 1000gae/ha to 2000gae/ha.In one embodiment, 2,4-D of 1000gae/ha to 1500gae/ha is used.In another embodiment, 2000gae/ha to 2500gae/ha is used.In addition, when the 2 leaf phases before blooming at crop plants use 2,4-D to 8 leaves are interim, the productive rate raising effect of 2,4-D process is particularly evident.But the rate of application required for crop plants and/or leaf phase change along with plant, their height and weather conditions.

Term " productive rate increase " refers to plant yield to be increased up to 50% or more.In one embodiment, productive rate increases at least 10%.In another embodiment, productive rate increases at least 20%.In another embodiment, productive rate increases to from 10% to 60%.In another embodiment, productive rate increases to from 20% to 50%.In another embodiment, productive rate increase is statistically significant.The growth enhanced activity of 2,4-D for 2,4-D resistance crop can be measured in field trial or pot experiment.The weed killer herbicide that the known usual mode of action is different is harmful to productive rate, or does not act on productive rate.

In one aspect, provide the method for the productive rate of raising 2,4-D resistance crop, described method comprises the herbicide treatment plant comprising aryloxy alkanoic acid moieties with quantity of stimulus.

In one embodiment, 2,4-D resistance crop plant is the genetically modified plants transformed with aryloxy alkanoic acid dioxygenase (AAD).In other embodiments, described aryloxy alkanoic acid dioxygenase (AAD) is AAD-1 or AAD-12.In another embodiment, the weed killer herbicide comprising aryloxy alkanoic acid moieties is phenoxy herbicide or phenoxy acetic acid class weed killer herbicide.In other embodiments, the weed killer herbicide comprising aryloxy alkanoic acid moieties is 2,4-D.In other embodiments, described 2,4-D comprise 2,4-D choline or 2,4-D dimethylamine (DMA).

In one embodiment, cotton, soybean and canola is selected from the genetically modified plants that aryloxy alkanoic acid dioxygenase (AAD) transforms.In another embodiment, described process is carried out at least one times with 2, the 4-D rate of application also for Weeds distribution.In another embodiment, described process twice is carried out with 2, the 4-D rate of application also for Weeds distribution.In other embodiments, use 2,4-D at V3 and the R2 vegetative stage of the soybean with 2,4-D tolerance.In another embodiment, described process at least three times is carried out with 2, the 4-D rate of application also for Weeds distribution.In another embodiment, the weed killer herbicide comprising aryloxy alkanoic acid moieties arrives 2,4-D resistance crop plant via root absorption.

In another embodiment, also with being different from herbicide treatment 2, the 4-D resistance crop of 2,4-D to control weeds.In other embodiments, described in be different from 2,4-D weed killer herbicide be phosphorous weed killer herbicide (phosphor-herbicide) or aryloxyphenoxypropionic class weed killer herbicide.In other embodiments, phosphorous weed killer herbicide comprises glyphosate, phosphine oxamate, their derivative, or their combination.In other embodiments, phosphorous weed killer herbicide is the form of ammonium salt, isopropyl ammonium salt, isopropyl amine salt or sylvite.In another embodiment, phosphorous weed killer herbicide arrives 2,4-D resistance crop via root absorption.In another embodiment, described aryloxyphenoxypropionic class weed killer herbicide comprises chloroazifoppropynyl (chlorazifop, racemic-(2R)-2-{4-[(3,5-dichloropyridine-2-base) oxygen base] phenoxy group } propionic acid), oxazole diclofop-methyl (fenoxaprop), fluazifop (fluazifop), fluazifop-butyl (haloxyfop), quizalofop-ethyl, their derivative or its combination.In other embodiments, described aryloxyphenoxypropionic class weed killer herbicide arrives 2,4-D resistance crop via root absorption.

In one embodiment, with described 2, the 4-D resistance crops of 2, the 4-D process of 25gae/ha to 5000gae/ha at least one times.In another embodiment, with described 2, the 4-D resistance crops of 2, the 4-D process of 100gae/ha to 2000gae/ha at least one times.In another embodiment, with described 2, the 4-D resistance crops of 2, the 4-D process of 100gae/ha to 2500gae/ha at least one times.In another embodiment, with described 2, the 4-D resistance crops of 2, the 4-D process of 1000gae/ha to 2000gae/ha at least one times.In other embodiments, described 2,4-D comprise 2,4-D choline or 2,4-D dimethylamine (DMA).

In one embodiment, the method for raising 2,4-D resistance crop productive rate is provided.The method comprises:

A () is with the nucleic acid of nucleotide sequence comprising coding aryloxy alkanoic acid dioxygenase (AAD)

Molecular Cloning plant cell;

B () selects the cell transformed;

C () goes out plant from the cytothesis of described conversion; With

D () is with plant described in the herbicide treatment comprising aryloxy alkanoic acid moieties of quantity of stimulus.

In one embodiment, described aryloxy alkanoic acid dioxygenase (AAD) is AAD-1 or AAD-12.In another embodiment, described nucleic acid molecules comprises selection marker thing, and described selection marker thing is not aryloxy alkanoic acid dioxygenase (AAD).In other embodiments or alternate embodiment, described selection marker thing is phosphinothricin acetyl transferase gene (pat) or selected gene (bar).In another embodiment, described nucleic acid molecules is that plant is optimized.

On the other hand, provide the weed killer herbicide comprising aryloxy alkanoic acid moieties and manufacture the purposes had in the genetically modified plants of 2,4-D resistance compared to its non-transgenic mother plant with the productive rate of increase.In one embodiment, the weed killer herbicide comprising aryloxy alkanoic acid moieties is 2,4-D.In other embodiments, use described 2,4-D at least one times with 2,4-D of 25gae/ha to 5000gae/ha.In another embodiment, described 2,4-D are used at least one times with 2,4-D of 100gae/ha to 2000gae/ha.In another embodiment, described 2,4-D are used at least one times with 2,4-D of 100gae/ha to 2500gae/ha.In another embodiment, described 2,4-D are used at least one times with 2,4-D of 1000gae/ha to 2000gae/ha.In other embodiments, described 2,4-D comprise 2,4-D choline or 2,4-D dimethylamine (DMA).In other embodiments, with described 2, the 4-D resistance crop plants at least twice of 2,4-D process before blooming.In another embodiment, described 2,4-D resistance crops are the genetically modified plants transformed with aryloxy alkanoic acid dioxygenase (AAD).In other embodiments, described aryloxy alkanoic acid dioxygenase (AAD) is AAD-1 or AAD-12.

Accompanying drawing and BRIEF DESCRIPTION OF THE SEQUENCES

Fig. 1 illustrates the enzymatic general chemical reaction of the AAD-12 invented by theme.Fig. 2 shows the representative graph of plasmid pDAB4468.Fig. 3 shows the representative graph of plasmid pDAS1740.

SEQIDNO:1 is the nucleotide sequence of the AAD-12 from Dai Erfute acidovorax facilis.

The protein sequence of the translation of SEQIDNO:2 coded by SEQIDNO:1.

SEQIDNO:3 is the nucleotide sequence that the plant of AAD-12 (v1) is optimized.

The protein sequence of the translation of SEQIDNO:4 coded by SEQIDNO:3.

SEQIDNO:5 is the nucleotide sequence that the Escherichia coli of AAD-12 (v2) are optimized.

SEQIDNO:6 is the sequence of M13 forward primer.

SEQIDNO:7 is the sequence of M13 reverse primer.

SEQIDNO:8 is the sequence of forward AAD-12 (v1) PTU primer.

SEQIDNO:9 is the sequence of reverse AAD-12 (v1) PTU primer.

SEQIDNO:10 is that forward AAD-12 (v1) encodes the sequence of PCR primer.

SEQIDNO:11 is that reverse AAD-12 (v1) encodes the sequence of PCR primer.

The sequence of SEQIDNO:12 shows " sdpacodF " AAD-12 (v1) primer.

The sequence of SEQIDNO:13 shows " sdpacodR " AAD-12 (v1) primer.

The sequence of SEQIDNO:14 shows " Nco1 of Brady " primer.

The sequence of SEQIDNO:15 shows " Sac1 of Brady " primer.

Detailed Description Of The Invention

As used in this article, term " conversion " or " conversion " refer to and are incorporated in cell by DNA.Phrase " transformant " or " genetically modified " refer to be converted or experienced Transformation Program plant, plant cell, etc.The DNA introduced is in the form of the carrier of the Insert Fragment containing DNA usually.

As used in this article; term " selection marker thing " or " selection marker thing gene " refer to such gene; optionally use in Plant Transformation, be such as used for protective plant cell from selective agent impact or resistance/tolerance for selective agent is provided.Those cells that have received the selection marker thing of function or plant is only had to break up under the condition with selective agent or to grow.The example of selective agent can comprise, and such as, antibiotic, comprises spectinomycin, neomycin, kanamycin, paromomycin, gentamicin and hygromycin.These selection marker things comprise: the gene (nptII) of neomycin phosphotransferase, it expresses the enzyme giving kanamycin antibiotic resistance, with the gene for relevant antibiotic neomycin, paromomycin, gentamicin and G418, or the gene of hygromix phosphotransferase (hpt), it expresses the enzyme giving hygromycin resistance.Other selection marker thing genes can comprise the gene of encoding herbicide resistance, comprise Bar (for the resistance of (Glufosinate) or phosphinothricin (PPT)), acetolactate synthase (ALS; for inhibitor such as sulfonylurea (SU), imidazolone type (IMI), triazolo pyrimidine class (TP), pyrimidine oxy-benzoic acid class (POB) and the resistance of sulfonyl amino carbonyl triazolineone stoping the branched-chain amino acid synthesis first step), glyphosate, 2,4-D and metal resistance or susceptibility.Phrase " positive markers " refers to and is converted and comprises the plant of described selection marker thing gene.

Various selection or detection mark can be included in selected expression vector, can identify and select the plant through transforming or transformant.There are many methods can be used for confirming that selection marker thing is in the expression in conversion of plant, such as comprise DNA sequencing and PCR (polymerase chain reaction), Southern blotting, RNA blotting, for detecting the immunological method of the protein expressed from carrier, described protein such as mediates the precipitated protein of phosphinothricin resistance, or other protein such as β-glucuronidase (GUS), luciferase, green fluorescent protein (GFP), DsRed, beta galactosidase, chloramphenicol acetyltransferase (CAT), the reporter genes such as alkaline phosphatase (consult Sambrook etc., MolecularCloning:ALaboratoryManual, ThirdEdition, ColdSpringHarborPress, N.Y., 2001, its full content is incorporated to herein by carrying stating).

Utilize selection marker thing gene select through transform cell or tissue.Selection marker thing gene comprises the gene of encode antibiotic resistance, such as the gene of encoding neomycin phosphotransferase II (NEO) and hygromix phosphotransferase (HPT), and gives the gene to the resistance of herbicides compounds.Herbicide resistance gene is encoded usually to the target protein of the insensitive modification of this weed killer herbicide or the enzyme that to be coded in plant by this herbicide degradation or detoxification before weed killer herbicide can work.Consult (1987) EMBOJ. such as DeBlock, 6:2513-2518; DeBlock etc. (1989) PlantPhysiol., 91:691-704; Fromm etc. (1990) 8:833-839; Gordon-Kamm etc. (1990) 2:603-618).Such as, by use encoding mutant target enzyme---the gene of 5-enolpyrul-shikimate acid-3-phosphate synthase (EPSPS) and acetolactate synthase (ALS) obtains the resistance to glyphosate or sulfonylurea herbicide.Phosphinothricin acetyl transferase, nitrilase or 2 by using coding to make corresponding weed killer herbicide detoxification, the bacterial gene of 4-dichlorphenoxyacetic acid ester monooxygenase obtains careless ammonium phosphine, Brominal and 2, the resistance of 4-dichlorphenoxyacetic acid (2,4-D).Enzyme/gene for 2,4-D resistance had previously had been disclosed in US2009/0093366 and WO2007/053482, was hereby incorporated to by carrying stating by its full content.

Other weed killer herbicides can Developing restraint point or meristematic tissue, comprises imidazolone or sulfonylureas.Belong to example gene code mutant ALS and the AHAS enzyme of this classification, such as, respectively by Lee etc., EMBOJ.7:1241 (1988); With the mutant ALS described in Miki etc., Theon.Appl.Genet.80:449 (1990) and AHAS enzyme.

Glyphosate resistance gene comprises mutant 5-enolpyrul-shikimate acid-3-phosphate synthase (EPSP) gene (by introducing recombinant nucleic acid and/or the various forms of mutagenesis in vivos to natural EPSP gene), aroA gene and glyphosate acetyl transferase (GAT) gene.Resistant gene for other phosphono compounds comprises phosphine oxamate (phosphinothricin acetyl transferase (PAT) gene and pyridine oxygen base or phenoxy propionic acid and cyclohexanone (ACC enzyme inhibitor encoding gene) from Streptomyces spec (comprising streptomyces hygroscopicus and green color-producing streptomycete); consult the U.S. Patent number 4 such as authorizing Shah etc.; 940; 835 and authorize the U.S. Patent number 6 of Barry etc.; 248; 876, it discloses the nucleotide sequence of the EPSPs form can giving plant glyphosate resistance.The DNA molecular of encode mutant aroA gene can obtain with ATCC accession number 39256, and the nucleotides sequence of described mutant gene is listed in the U.S. Patent number 4 authorizing Comai, 769,061, authorize the european patent application No.0333033 of Kumada etc. and authorize the United States Patent (USP) 4 of Goodman etc., 975, open in 374, it discloses the nucleotide sequence given for the glutamine synthelase of the resistance of weed killer herbicide such as L-phosphinothricin.In the Bio/Technology7:61 (1989) of European application No.0242246, in addition DeGreef etc. authorizing Leemans etc., provide the nucleotide sequence of pat gene, which depict the production of the genetically modified plants of the chimeric bar gene of expressing coding PAT activity.Give for phenoxy propionic acid and cyclohexanedione that (Exemplary gene comprising the resistance of sethoxydim and first standing grain spirit (haloxyfop) is Accl-S1, Accl-S2 and Accl-S3 gene, as described in Marshall etc., Theor.Appl.Genet.83:435 (1992).The GAT gene of conferring glyphosate resistance can be described in and authorize in the WO2005012515 of Castle etc., give for 2, the gene of 4-D, fop weed killer herbicide and pyridine oxygen basal growth element Herbicid resistant is described in WO2005107437 and U.S. Patent Application Serial Number 11/587, in 893.

Other weed killer herbicides can inhibited photosynthesis, comprises triazine (psbA and 1s+ gene) or benzonitrile (nitrilase gene).Przibila etc., PlantCell3:169 (1991) describe the Plastid transformation Chlamydomonas with encode mutant psbA gene.Authorizing Stalker U.S. Patent number 4,810, disclose the nucleotide sequence of nitrilase gene in 648, the DNA molecular containing these genes can be obtained by ATCC accession number 53435,67441 and 67442.In Biochem.J.285:173 (1992), the cloning and expressing of the DNA of coding for glutathion-S-transferase is described by Hayes etc.

For purposes of the present invention, selection marker thing gene includes but not limited to encode the gene of following material: neomycin phosphotransferase II (Fraley etc. (1986) CRCCriticalReviewsinPlantScience, 4:1-25); Cyanamide hydratase (Maier-Greiner etc. (1991) Proc.Natl.Acad.Sci.USA, 88:4250-4264); Aspartokinase; Dihydrodipicolinate synthase (Perl etc. (1993) Bio/Technology, 11:715-718); Tryptophan decarboxylase (Goddijn etc. (1993) PlantMol.Bio., 22:907-912); Dihydrodipicolinate synthase and desensitized aspartokinase (Perl etc. (1993) Bio/Technology, 11:715-718); Bar gene (Toki etc. (1992) PlantPhysiol., 100:1503-1507 and Meagher etc. (1996) and CropSci., 36:1367); Tryptophan decarboxylase (Goddijn etc. (1993) PlantMol.Biol., 22:907-912); Neomycin phosphotransferase (NEO) (Southern etc. (1982) J.Mol.Appl.Gen., 1:327; Hygromix phosphotransferase (HPT or HYG) (Shimizu etc. (1986) Mol.CellBiol., 6:1074); Dihyrofolate reductase (DHFR) (Kwok etc. (1986) PNASUSA4552); Phosphinothricin acetyl transferase (DeBlock etc. (1987) EMBOJ., 6:2513); DPA dehalogenase (Buchanan-Wollatron etc. (1989) J.Cell.Biochem.13D:330); Acetohydroxy acid synthase (Anderson etc., U.S. Patent number 4,761,373; Haughn etc. (1988) Mol.Gen.Genet.221:266); 5-enolpyrul-shikimic acid-phosphate synthase (aroA) (Comai etc. (1985) Nature317:741); Halogenated aryl nitrilase (Stalker etc., disclosed PCT application WO87/04181); Acetyl-CoA carboxylase (Parker etc. (1990) PlantPhysiol.92:1220); Dihydropteroate synthase (sulI) (Guerineau etc. (1990) PlantMol.Biol.15:127); With 32kD photosystem II polypeptide (psbA) (Hirschberg (1983) Science, 222:1346).

Also comprise the gene of coding for the resistance of following material: chloramphenicol (Herrera-Estrella etc. (1983) EMBOJ., 2:987-992); Methotrexate (MTX) (Herrera-Estrella etc. (1983) Nature, 303:209-213; Meijer etc. (1991) PlantMolBio., 16:807-820 (1991); Hygromycin (Waldron etc. (1985) PlantMol.Biol., 5:103-108; Zhijian etc. (1995) PlantScience, 108:219-227 and Meijer etc. (1991) PlantMol.Bio.16:807-820); Streptomycin (Jones etc. (1987) Mol.Gen.Genet., 210:86-91); Spectinomycin (Bretagne-Sagnard etc. (1996) TransgenicRes., 5:131-137); Bleomycin (Hille etc. (1986) PlantMol.Biol., 7:171-176); Sulfanilamide (SN) (Guerineau etc. (1990) PlantMol.Bio., 15:127-136); Brominal (Stalker etc. (1988) Science, 242:419-423); 2,4-D (Streber etc. (1989) Bio/Technology, 7:811-816); Glyphosate (Shaw etc. (1986) Science, 233:478-481); With phosphinothricin (DeBlock etc. (1987) EMBOJ., 6:2513-2518).Unless otherwise indicated, hereby the full content of all bibliography in openly middle description is incorporated to by carrying stating.

The inventory of above selection marker thing and reporter gene not means restriction.Any reporter gene or selection marker thing gene are contained in the present invention.If needed, such gene can be checked order by method known in the art.

These reporter genes and selection marker thing gene synthesize to be conducive to the mode of optimal expression in plant.That is, the coded sequence of gene is modified, to strengthen the expression in plant.Composite Logo thing gene is designed to express in plant with higher level, thus causes higher transformation efficiency.Method for the synthesis optimizing of gene can obtain from this area.In fact, some genes be optimized to increase gene outcome express in plant.

Marker gene sequence can be optimized for the expression in specific plant species, or Optimal Expression in plant section can be thought and modify marker gene.The preferred codon of plant can be determined by the codon the highest according to the frequency of the maximum protein of expression in interested specified plant species.Consult, such as EPA0359472; EPA0385962; WO91/16432; Perlak etc. (1991) Proc.Natl.Acad.Sci.USA, 88:3324-3328; With (1989) NucleicAcidsResearch, 17:477-498 such as Murray; U.S. Patent number 5,380,831; With U.S. Patent number 5,436,391, incorporate them into herein by carrying stating.By this way, nucleotide sequence can be optimized for the expression in any plant.Be well known that, the whole or any part of gene order can be optimize or synthesis.That is, the sequence of fully optimized or part optimization can also be used.

In addition, several Changing Strategy utilizing agrobacterium-mediated conversion system has been developed.Such as, binary vector strategy is that wherein T-DNA is in different plasmids from the remainder of Ti-plasmids based on such double-mass model system.In common integrated strategy, the sub-fraction of T-DNA and alien gene are placed in identical carrier, this carrier is recombinated with Ti-plasmids subsequently.

As used in this article, term " plant " comprises dicotyledon and monocotyledon.The example of dicotyledon comprises tobacco, arabidopsis, soybean, tomato, pawpaw, canola, sunflower, cotton, clover, potato, vine, pigeonpea, pea, Brassica plants (Brassica), chickpea, sugar beet, rape, watermelon, muskmelon, pepper, peanut, pumpkin (pumpkin), radish, spinach, pumpkin (squash), broccoli, cabbage, carrot, cauliflower, celery, Chinese cabbage, cucumber, eggplant, and lettuce.Monocotyledonous example comprises corn, paddy rice, wheat, sugarcane, barley, rye, Chinese sorghum, orchid, bamboo, banana, cattail, lily, oat, onion, millet and rye.

As 2 of this paper theme, the exploitation of 4-D resistant gene and follow-up resistance crop provides one and well selects, for using (in-cropapplication) to control the broad leaved weed species of resistance glyphosate (or quite tolerant and succession (shifted)) in planting.2,4-D is the powerful broadleaf herbicide of a kind of wide spectrum, cheaper, if can provide stronger crop tolerance in dicotyledonous and unifacial leaf, it will particularly useful place to grower.In the opportunity of using and ratio, resistance to 2,4-D transgenic dicot crops also have stronger flexibility.As 2 of this paper theme, another purposes of the herbicide tolerance trait of 4-D is that it can be used for preventing 2,4-D from drifting about (drift), volatilizees (volatilization), is inverted (inversion) (or the mobile phenomenon of other off normal (off-site)), misuse, artificial destruction etc. infringement to normal sensitive crop.Another benefit of AAD-12 gene is, different from all tfdA homologues characterized at present, AAD-12 is except achirality phenoxy auxin of degrading is (as 2,4-D, MCPA, 4-chlorophenoxyacetic acid) outside, pyridine radicals fluoroacetic acid growth hormone (such as Triclopyr, fluroxypyr) of can also degrading.Consult table 1.Show in Fig. 1 by the generality explanation of the enzymatic chemical reaction of the AAD-12 of this paper theme.(O ₂addition be stereospecific; Decomposes becomes phenol and glyoxylic ester to be spontaneous.) should be understood that, what chemical constitution in Fig. 1 was shown is molecular backbone, includes various different R group etc. (such as shown in table 1 those), but not necessarily specifically shows in FIG.In the world, the multiple mixture that people have employed the combination of different phenoxy auxin deals with specific weeds spectrum and the environmental condition of different regions.In plant, use AAD-12 gene greatly to widen provides the growth hormone weed killer herbicide of protection to compose, thus increases flexibility and the controlled weeds spectrum of controlled weeds.

Now identify a gene (AAD-12), when its by genetically engineered for express in plant time, there is certain character, make likely do not exist intrinsic patience or intrinsic patience not high enough thus allow use phenoxy auxin herbicide plant in use phenoxy auxin herbicide.In addition, be not enough to equally allow optionally occasion at natural tolerance, AAD-12 can provide the protective effect for pyridine fluoroacetic acid class weed killer herbicide in plant corpus, thus expands the potential utility of these weed killer herbicides.At present can with a kind of combination of, two kinds or several phenoxy auxin herbicide in a sequential manner or bucket mix the plant of mode process only containing AAD-12.In order to control the broadleaf weed of abundant species, the scope of the ratio of often kind of phenoxy auxin herbicide can be from 25 to 4000gae/ha, and is more typically from 100 to 2000gae/ha.Equally, the mixture of a kind of, two kinds of pyridine fluoroacetic acid growth hormone compounds or several pyridine fluoroacetic acid growth hormone compound can be applied to plant that express AAD-12, that reduce by the risk of described herbicide injury.In order to control more broadleaf weed, the scope of the ratio of often kind of pyridine fluoroacetic acid class weed killer herbicide can be from 25 to 2000gae/ha, and is more typically from 35 to 840gae/ha.

Glyphosate is broad leaved weed species and the grassy weed species of controlled manufacture-illegal Chang Guangpu, is thus widely used.But, in GTC and the application of non-crop Reusability glyphosate (and will continue) select to make weeds succession be the natural species that more tolerate or glyphosate resistance biotype.The bucket of the effective ratio of use is all mixed the method that weed killer herbicide companion (tankmixherbicidepartners) is defined as the appearance of a kind of delaying drug resistance weeds by most Herbicid resistant management strategy, each weed killer herbicide companion provides the control to same species, but has the different modes of action.AAD-12 is superposed with glyphosate tolerance proterties (and/or other herbicide tolerance trait), make to use glyphosate, phenoxy auxin (as 2 to same crop-selective, 4-D) become possibility with pyridine fluoroacetic acid class weed killer herbicide (as Triclopyr), thus the mechanism that a kind of permission controls the glyphosate resistance dicotyldenous weed species in GTC is provided.Using of these weed killer herbicides can be: use in the bucket mixture of the two or more weed killer herbicides containing the different mode of action simultaneously; Single herbicide composition successively before planting, emerge before or use separately after emerging; The timesharing do not waited from roughly 2 hours to roughly 3 months is used; Or, can in crop under kind 7 months until harvesting crops time (or the results space before (preharvestinterval) of single weed killer herbicide, get the shortest person)) any time representative of using arbitrary number often plant any combination of the weed killer herbicide of chemical classes.

In the control of miscellaneous grass family and broad leaved weed, have flexibility (with regard to time of application, often kind of weed killer herbicide ratio and control obstinate or resistant weed ability with regard to) be very important.The scope that the glyphosate superposed with Glyphosate resistance gene/AAD-12 in crop is used can be approximately 250-2500gae/ha; Phenoxy auxin herbicide (one or more) can be used according to about 25-4000gae/ha; And pyridine fluoroacetic acid growth hormone weed killer herbicide (one or more) can be used by 25-2000gae/ha.Optimum combination and the time of these application depend on concrete condition, species and environment, and can be determined best by means of present disclosure by the those of ordinary skill in Weeds distribution field.

Plantlet is all resistance usually in the whole cycle.In any time that gene is expressed, transformed plant all has resistance usually to new herbicide application.In this article, use the constitutive promoter (mainly CsVMV and AtUbi10) tested up to now, show needle all exists in whole life cycle the tolerance of 2,4-D.This point normally can be expected, but occasions of other non-metabolic activities at some, the impact that the expression that tolerance significantly may be subject to the mechanism of action position of such as resistance reduces, for so non-metabolic activity, this is a kind of improvement.An example is that anti-agriculture reaches (RoundupReady) cotton, in the case, if spray comparatively early, then plant is tolerance, if but sprayed too late, then glyphosate would concentrate on (because it is not fallen by metabolism and is transferred) in meristematic tissue; The Meng Shan viral promotors that all (Monsanto) uses is expressed bad in spending.The invention of this theme provides improvement in these areas.

Herbicide formulations (such as ester, acid or salt pref; Or solvable concentrate, emulsifiable concentrate or can solution body) and bucket mix the Weeds distribution that additive (such as adjuvant, surfactant, drift retardants or compatilizer) significantly can affect the combination of particular herbicide or one or more weed killer herbicides.These have any combination of any aforementioned herbicides chemical composition within the scope of the present invention.

Those skilled in the art also can understand the benefit combination of two or more modes of action being composed and/or controlled the natural more weed species of tolerance or opposing to increase in check weeds.Also this way can be generalized to the chemistry realizing herbicide tolerant in crop by manpower intervention (with transgenosis mode or non-transgenic mode).In fact, encodes glyphosate resistance (such as resistance plant or bacterium EPSPS, glyphosate oxidoreductase (GOX), GAT), phosphine oxamate resistance (such as Pat, bar), suppress weed killer herbicide (the such as imidazolone of acetolactate synthase (ALS), sulfonylureas, triazolo pyrimidine sulfonanilide, pyrimidine radicals thiobenzoate class, and other chemical composition=AHAS, Csr1, SurA etc.) resistance, brdmo iltesi (such as Bxn), for the resistance of HPPD (4-hydroxyphenyl-pyruvic acid-dioxygenase) enzyme inhibitor, for the resistance of phytoene desaturase (PDS) inhibitor, for the resistance of Photosystem I I inhibition weed killer herbicide (such as psbA), for the resistance of Photosystem I inhibition weed killer herbicide, for the resistance of proporphyrinogen oxidase IX (PPO) inhibition weed killer herbicide (such as PPO-1), for the resistance of phenylurea herbicides (such as CYP76B1), dicamba-degrading enzymatic (consulting, such as US20030135879), and the proterties of other materials can individually or carry out superposing with multiple combination and provide the ability effectively controlling or prevent weeds succession and/or the resistance for the weed killer herbicide of any above-mentioned classification.The EPSPS modified in body can use in some preferred embodiments, can also use I class, II class and III class Glyphosate resistance gene.

About other weed killer herbicides, some other preferred ALS inhibitor include but not limited to: such as chlorine sulphur is grand for sulfonylurea, halosulfuronmethyl (halosulfuron), nicosulfuron, sulfometuronmethyl (sulfometuron), Sulfosulfuron, trifloxysulfuron), imidazolone type (imidazoloninones) (such as imazamox, Imazethapyr, Scepter), triazolo pyrimidine sulfonanilide (such as cloransulammethyl, diclosulam, florasulam, pyrrole flumetsulam, metosulam, and penoxsuam), pyrimidine phosphorothioate benzoates (such as two careless ether (bispyribac) and pyrithiobac-sodium), and flucarbazonesodium.Some preferred HPPD inhibitor include but not limited to: mesotrione, isoxazole humulone and sulphur humulone.Some preferred PPO inhibitor include but not limited to: flumicloracpentryl, flumioxazin, flufenpyrethyl, pyrrole grass ether, careless fluorine of rattling away, butafenacil, triazolone grass ester, sulfentrazone and diphenyl ether (such as acifluorfen, Fomesafen, lactofen and Oxyfluorfen).

In addition, AAD-12 individually or the HTC proterties other with one or more superpose after can be other with one or more input proterties (such as resistance to insects, fungus resistant or stress tolerance etc.) or export proterties (such as productive rate increases, oil content cloth improves, fiber quality improvement etc.) and superpose.Thus, the invention of this theme can be used to provide and has flexibly and cost-effectively control a complete set of agronomy of the crop quality of the improvement of the ability of any amount of agricultural disease.

The invention of this theme partly relates to a kind of qualification of enzyme, and this enzyme can not only be degraded 2,4-D, and has novel characteristic surprisingly, and the enzyme that these characteristics make this theme invent and such as previously known tfdA protein region separate.Although the autoploidy of this enzyme and tfdA is very low, the gene of this theme invention still can range same total family in general manner---in α-ketoglutaric acid dependence dioxygenase.The feature of this protein families is three conservative histidine residues in " HX (D/E) X23-26 (T/S) X114-183HX10-13R " motif forming (comprise) active site.Fe+2 ion (Hogan etc., 2000) coordination required for catalytic activity in these histidines and active site.Have adjusted the initial in vitro discussed herein and express experiment, to help the selection of new attribute.These experiments also show that AAD-12 enzyme is relative to the patent application (PCTUS/2005/014737 at first submit; On May 2nd, 2005 submits to) disclosed in other another kind of different enzyme of same class be totally different.The AAD-1 enzyme of those applications and this theme AAD-12 albumen only share the sequence iden of about 25%.

More particularly, the invention of this theme partly relates to the purposes of the enzyme of can not only degrade 2,4-D and pyridine fluoroacetic acid class weed killer herbicide of can also degrading.Not yet someone reports the α-ketoglutaric acid dependence dioxygenase of the ability of the weed killer herbicide with degraded different chemical classification and the mode of action.The preferred enzyme and the gene that are applicable to this theme invention purposes are referred to herein as AAD-12 (aryloxy alkanoic acid dioxygenase, AryloxyAlkanoateDioxygenase) gene and albumen.

In analytical mensuration, this theme albumen is to 2,4-D to 2, and the conversion test of 4 chlorophenesic acids (" DCP ", without herbicidal activity) is for positive.2,4-D can be converted into DCP rapidly by partially purified theme invention albumen in vitro.Another advantage that AAD-12 conversion of plant provides is that parent herbicide is metabolised to inactive forms, thus reduces the possibility gathering in the crops herbicide residues in particle or straw.

The invention of this theme also comprises the method controlling weeds, and wherein said method comprises uses pyridine fluoroacetic acid class weed killer herbicide and/or phenoxy auxin herbicide to the plant containing AAD-12 gene.

Find according to these, provide new plant, it contains the polynucleotides of such enzyme of encoding.Also do not produce the motivation of this Plants up to now, do not expect that such plant can effectively produce this enzyme yet, make it not only give the resistance of this plant to Phenoxy acid herbicides (as 2,4-D), and give plant to the resistance of pyridine fluoroacetic acid class weed killer herbicide.Therefore, the invention of this theme provides many advantages of never infering up to now this area.

The available bacterial strain of the public (being preserved in culture collection center as ATCC or DSMZ) can be obtained and use technology disclosed herein therefrom to screen new gene.Sequence disclosed herein can be used for amplification homologous gene and is cloned in recombinant expression system, to carry out screening and test further according to the invention of this theme.

As above, " background " saves and discusses, and it is Ralstonia eutropha (Ralstoniaeutropha) (Streber etc., 1987) that its degraded 2,4-D ability has obtained one of biology of extensively research.The gene of the first enzyme in this degradation pathway of encoding is tfdA.See U.S. Patent number 6,153,401 and GENBANK accession number M16730.TfdA carrys out the sour DCP (Smejkal etc., 2001) changed into without herbicidal activity of catalysis 2,4-D by a kind of α-ketoglutaric acid dependence dioxygenase reaction.TfdA has been used in genetically modified plants to usually to 2, the dicotyledon (as cotton and tobacco) of 4-D sensitivity gives 2,4-D resistance (Streber etc. (1989), Lyon etc. (1989), Lyon (1993)).From environment, identifying a large amount of coding to degrade the tfdA type gene of protein of 2,4-D, and being stored in Genebank database.Many homologues closely similar to tfdA (amino acid identities >85%) also have the enzyme characteristic similar to tfdA.But identify now a small quantities of α-ketoglutaric acid dependence dioxygenase homologue, they and tfdA have low-level autoploidy.

The invention of this theme partly relates to unexpected discovery: from Dai Erfute acidovorax facilis, with tfdA, there is novelty teabag and the New function of the edge enzyme sdpA far away (Westendorf etc., 2002 and 2003) of low homology (31% amino acid identities).Previously showed, this α-ketoglutaric acid dependence dioxygenase, is purified with its native form, degradable 2,4-D and S-2,4-Dichlorophenoxy propionic acid (Westendorf etc., 2002 and 2003).But the α-ketoglutaric acid dependence dioxygenase previously reported does not have the ability of the weed killer herbicide of degraded pyridine fluoroacetic acid chemical classes.SdpA was not expressed in plant, also did like this without any motivation, and reason part is, due to the usefulness of GTC, low cost and convenience, the exploitation of new HTC technology is restricted (Devine, 2005) to a great extent.

In view of the activity that this is new, protein and the gene of the invention of this theme are referred to herein as AAD-12 albumen and gene.Confirm that at present AAD-12 can degrade multiple phenoxyacetate auxin weed killer herbicide in vitro.But as the report of first time herein, other belong to the substrate of aryloxy alkanoic acid molecular classification to find to degrade this enzyme surprisingly.The substrate with important agronomic interest comprises pyridine fluoroacetic acid growth hormone weed killer herbicide.The chance that herbicide tolerant crop (HTC) and selection marker physical property shape are sought in this brand-new being found to be provides important foundation.This enzyme is taken the course of its own to the ability that a series of wide spectrum broadleaf herbicide (phenoxy acetic acid and pyridine fluoroacetic acid growth hormone) applies herbicide degradation activity.

Therefore, the invention of this theme is partly related to and to be degraded 2,4-dichlorphenoxyacetic acid, other phenoxyacetate auxin weed killer herbicides and pyridine fluoroacetic acid class weed killer herbicide by recombinant expressed aryloxy alkanoic acid dioxygenase (AAD-12).The present invention also partly relates to coding and to degrade the qualification of gene of aryloxy alkanoic acid dioxygenase digestive enzyme (ADD-12) of phenoxy group and/or pyridine oxygen basal growth element weed killer herbicide and purposes.

This theme enzyme makes to cause becoming possibility to the tolerance of the combinations of herbicides that can control nearly all broad leaved weed by express transgenic.AAD-12 can be used as outstanding herbicide tolerant crop (HTC) proterties and such as other HTC proterties [as glyphosate resistance, phosphine oxamate resistance, ALS inhibitor (such as imidazolone, sulfonylureas, triazolo pyrimidine sulfonanilide) resistance, Bromoxynil resistance, HPPD inhibitor resistance, PPO preparation resistance, etc.]) and insect resistance traits (insecticidal proteins etc. as Cry1F, Cry1Ab, Cry34/455, other Bt. albumen or non-bacillus origin) superpose.In addition, AAD-12 can be used as selection marker thing, is used for the primary transformant of assisted Selection the second gene or the genetically engineered plant of genome.

In addition, redesigned the microbial gene of this theme, the usage of codon to unifacial leaf and dicotyledon of this protein that makes to encode all has deflection (hemicot).Transformed arabidopsis, corn, tobacco, cotton, soybean, canola and paddy rice with the construct containing AAD-12, these plants have shown the high-level resistance to phenoxy group and pyridine oxygen basal growth element weed killer herbicide.Therefore, the invention of this theme also relates to " plant is optimized " gene of code book theme invention protein.

Oxygen phenylalkanoic acid ester (Oxyalkanoate) group can be used for stable acid functional group to introduce weed killer herbicide.By " acid is caught ", (acidtrapping gives phloem mobile (phloemmobility, a kind of desirable herbicide action attribute) to described acidic-group, thus can be incorporated in new weed killer herbicide in order to mobility object.The aspect of this theme invention also provides the mechanism producing HTC.There is the potential commercially available and experimental weed killer herbicide that much can be used as AAD-12 substrate.Therefore, the herbicide tolerant that this theme gene can also obtain other weed killer herbicides is used.

The Combination nova that the HTC proterties of this theme invention can be formed with other HTC proterties (including but are not limited to glyphosate tolerant) is applied.Due to resistance or the intrinsic tolerance of the new acquisition to weed killer herbicide (as glyphosate), the combination of these proterties produces the new method controlling weeds (s) species.Therefore, except HTC proterties, also comprise the new method using herbicide weed control within the scope of the invention, wherein said enzyme produces the tolerance to described weed killer herbicide in genetically modified crops.

The present invention is passable, such as, applies in the background of the industrialization of 2, the 4-D resistance trait (2,4-Dresistancetraitstackedwithcurrentglyphosateresistance) superposed with existing glyphosate resistance proterties in soybean.Therefore, the invention provides the instrument of antagonism broad leaved weed species succession and/or Herbicid resistant broad leaved weed selection (these are consequences that grower extremely relies on glyphosate in the Weeds distribution of various crop).

The transgene expression of the AAD-12 gene of this theme is illustrated in as arabidopsis, tobacco, soybean, cotton, paddy rice, corn and canola.Soybean is the preferred crop of the conversion of inventing according to this theme.But the present invention can be applicable to other unifacial leaves multiple (such as herbage or turfgrass) and dicotyledonous crops, as clover, clover, trees etc.Equally, 2,4-D (or other AAD-12 substrates) can more energetically in the moderate gramineous crop of tolerance, the tolerance of the increase that this proterties is brought will provide for grower with more effective ratio and wider time of application to use the chance of these weed killer herbicides, and without the risk of crop damage.

Further, the invention of this theme provides the term single gene of the resistance that can provide for the weed killer herbicide controlling broad leaved weed.This gene can be used in various crop, for the application of broad-spectrum herbicide combination provides possibility.The invention of this theme also can control the weeds existing chemicals to resistance, and the auxiliary succession weeds spectrum controlled because existing agricultural practice causes.The AAD-12 of this theme can also be used for the trial of other weed killer herbicide substrates being detoxified into effectively non-herbicidal form.Therefore, the exploitation that this theme is invented as other HTC proterties and/or selection marker thing technology provides condition.

Except using this theme gene to produce except HTC, this theme gene separately can/also can be used as selection marker thing, successfully select transformant cell chulture, greenhouse and large Tanaka.Only with regard to the selection marker thing as biotechnology project, this theme gene just has very high inherent value." Joker " (promiscuity) of AAD-12 and other aryloxy alkanoic acid growth hormone weed killer herbicides provides the object that this gene is used for HTC and/or selection marker thing by many chances.

Term " resistance " is discussed be difficult to not use verb " tolerance " or adjective " tolerance ".Insider has taken the much time and has discussed herbicide tolerant crop (HTC) and Herbicid resistant crop (HRC).HTC is the term of preference in the industry.But resistance is defined as by the Weed Science association of the U.S. (WeedScienceSocityofAmerica) of official " plant be exposed to usually wild type is the doses of lethal after the hereditary potency of survival and breeding.In plant, resistance can be naturally occurring, or by technological guides such as such as genetic engineering or the variants of selecting tissue cultures or mutagenesis to produce ".Unless otherwise noted, weed killer herbicide as used in this article " resistance " is heritable, its allow plant the typical weeding of certain weed killer herbicide to given plant effectively process (as weed killer herbicide handbook (TheHerbicideHandbook) when the disclosure is submitted to current edition advised) existence under can Growth and reproduction.One skilled in the art will recognize that, certain Plants likely shows the plant injury to a certain degree caused by weed killer herbicide exposure and is still regarded as " resistance ".As used in this article, term " tolerance " is more wide in range than the meaning of term " resistance ", it comprises " resistance " as defined herein, also comprises the ability of the raising of specified plant opposing weed killer herbicide induced damage in various degree (this type of damage typically produces in the wild-type plant of homologous genes type, under identical amount of herbicide).

Functional activity is transferred to the nucleotide sequence that plant or bacterial system can relate to the amino acid sequence of code book theme invention protein, described nucleotide sequence is incorporated in protein expression vector, and described carrier is suitable for it by resident host.It is a kind of that to obtain the method that coding has a nucleic acid sequences to proteins of functional activity be use the information derived from the amino acid sequence of protein disclosed herein from separating natural genetic material the bacterial species producing proteins of interest matter.Can optimize native sequences for the expression in plant, that such as hereafter discusses more in detail is such.Also can based on the polynucleotides of protein sequence design optimization.

Obtain the method for protein being used for the purposes of inventing according to this theme and have many kinds.Such as, can identify from protein mixture with the antibody of protein disclosed herein and be separated other protein.Specifically, can produce in protein compared with other related proteins the antibody of the most conservative or the most distinguished part.Then, these antibody can be used to identify the equivalent protein with activity characteristic specifically by immunoprecipitation, enzyme linked immunosorbent assay (ELISA) (ELISA) or Western blotting.Conventional program can be used easily to prepare for protein disclosed herein, antibody for equivalent protein or the fragment for these protein.These antibody are aspects for this theme invention.The antibody of this theme invention comprises monoclone antibody and polyclonal antibody, preferably in response to example or the protein of hint and the monoclone antibody that produces and polyclonal antibody.

It will be readily appreciated by those skilled in the art that the protein (and gene) that can obtain the invention of this theme from multiple source.Due to known complete herbicide degradation operon except be coded in can transposable element as except on plasmid, also be incorporated in genome, therefore can obtain (such as comprising restructuring and/or wild-type bacterium) protein of this theme invention from multiple-microorganism.

The mutant of bacterial isolates can be produced by program well known in the art.Such as, asporogenous mutant can be obtained by the ethylmethane sulfonate of separator (EMS) mutagenesis.Ultraviolet light and nitrosoguanidine can be used to produce mutant strain by program well known in the art.

Protein " from " or " available from " any theme separator of mentioning herein or implying, represent that this protein (or similar protein) can available from this separator or some other source, as other bacterial isolateses or plant." derived from " also there is this implication, and comprise the protein that can obtain from the bacterium of the modified given type expressed plant for (such as).Such as, one of ordinary skill in the art will readily recognize that and consider disclosing of bacterial gene and protein, can carry out engineeredly making it produce this protein to plant.Polynucleotides disclosed herein and/or amino acid sequence Dispersal risk preparation, nucleic acid probe (DNA, RNA or PNA) etc. can be used, and use it for from the screening of other (natural) source and reclaim other related genes.

Conventional molecular biological technology Cloning and sequencing protein described herein and gene can be used.Other information are found in Sambrook etc., and 1989, be incorporated to herein by carrying stating.

Polynucleotides and probe: the invention of this theme provides coding for the nucleotide sequence of the protein according to this theme invention purposes further.The invention of this theme provides qualification further and characterizes the method for the gene with the protein expecting activity of weeding.In one embodiment, the invention of this theme provides the unique nucleotide sequence that can be used as hybridization probe and/or use for the primer of round pcr.Primer produces characteristic gene fragments, can be used for qualification, characterizes and/or be separated specific gene of interest.The nucleotide sequence coded protein of this theme invention is completely different with the protein previously described.

The polynucleotides of this theme invention can be used for forming complete " gene ", with coded protein or peptide in the host cell expected.Such as, as those skilled in the art are easily familiar with, (prior art is known) this theme polynucleotides suitably can be placed under the control of promotor in host interested.The level of gene expression and sequential/tissue specific expression can greatly affect effectiveness of the present invention.Generally speaking, the protein expression of the higher level of degradability gene (degradativegene) can cause substrate (being target weed killer herbicide in this case) faster more degradable.Unless high expressed causes negative effect to plant health, otherwise expect that promotor is with high level expression target gene.In order to protective plant complete in whole vegetative stage, people generally wish to make AAD-12 gene in a organized way in constitutive expression.But also can use (vegetativelyexpressed) resistant gene of expressing when nourishing and growing, this permission uses target weed killer herbicide to carry out Weeds distribution, subsequently by using the sexual reproduction controlling target crop in flowering stage in crop.In addition, the expression expected and time also can be depending on the durability level of vegetation type and expectation.Some preferred embodiments use the strong constitutive promoter combined with transcriptional enhancer etc., to increase expression and tolerance is brought up to aspiration level.Before embodiment chapters and sections, hereafter discussing some such application in more detail.

As is known to the person skilled in the art, DNA-as exist with double chain form.Under this arrangement, a chain and another chain complementation, vice versa.Other complementary dna chain is produced when DNA copies in (such as) plant." coding strand " is often used to refer to the chain be combined with antisense strand in the art.MRNA transcribes " antisense " chain from DNA." there is justice " or " coding " chain has a series of codon (codon can be read as three residue units, three nucleotide of regulation specific amino acids), described codon can be read to be formed proteins of interest matter or polypeptide as opening code-reading frame (ORF).In order to produce protein in vivo, generally DNA chain is transcribed into mRNA complementary strand, mRNA complementary strand is used as protein template.Therefore, the invention of this theme comprises the purposes of the exemplified polynucleotides shown in subsidiary sequence table and/or the equivalent containing complementary strand.RNA and PNA (peptide nucleic acid) functionally of equal value with example DNA molecular is also contained in during this theme invents.

For can by such as using oligonucleotide probe qualification and obtaining according to the protein of this theme invention purposes and gene.These probes are detectable nucleotide sequences, and this nucleotide sequence can be detected due to suitable mark, or can make it have inherent fluorescence as described in international application No.WO93/16094.Probe (with polynucleotides of the present invention) can be DNA, RNA or PNA.Except adenine (A), cytimidine (C), guanine (G), thymidine (1) with uracil (U, for RNA molecule) outside, this theme invention synthesising probing needle (and polynucleotides) can also contain inosine (a kind of can with the neutral base of whole four kinds of base pairings, sometimes for replacing the mixture of whole four kinds of bases in synthesising probing needle) and/or other synthesize (non-natural) bases.Therefore, when mentioning the degenerate oligonucleotide of synthesis herein, generally use " N " or " n ", " N " or " n " can be G, A, T, C or inosine.Standard I UPAC naming rule when ambiguity password as used in this article is submitted to this subject application consistent (such as, R represents A or G, and Y represents C or T etc.).

As known in the art, if probe molecule and nucleic acid samples are hybridized, reasonably can suppose that probe and sample have significant autoploidy/similitude/homogeneity.Preferably, technology known in the art is used first to carry out multi-nucleotide hybrid, then low, in or wash under high stringent condition, such as, as Keller, G.H., M.M.Manak (1987) DNAProbes, StocktonPress, NewYork, NY, described in 169-170 page.Such as, as described herein, low stringency condition can by first at room temperature using 2XSSC (standard citric acid salt solution)/0.1%SDS (lauryl sodium sulfate) wash 15 minutes and realize.Washing is generally carried out twice.Then, can by reducing salinity and/or realizing higher stringency by improving temperature.Such as, then at room temperature can wash 15 minutes with 0.1xSSC/0.1%SDS twice after above-mentioned washing, then then wash 30 minutes at 55 DEG C with 0.1xSSC/0.1%SDS.As is known to the person skilled in the art, these temperature can be hybridized with in this paper other and used together with washing scheme (such as SSC can be replaced to use as salt with SSPE).2xSSC/0.1%SDS can by adding 50ml20xSSC and 5ml10%SDS to prepare in 445ml water.20xSSC by mixing NaCl (175.3g/0.150M), sodium citrate (88.2g/0.015M) and 1 premium on currency, then can adjust pH to 7.0 with 10NNaOH and prepares.10%SDS can be diluted to 100ml to prepare by being dissolved in by 10gSDS in 50ml autoclaving water, then.

The detection of probe provides to be determined to hybridize the means whether be maintained in a known way.This probe analysis provides the fast method of the gene of this theme of qualification invention.DNA synthesizer and conventional program synthesis can be used according to the present invention to be used as the nucleotide fragments of probe.These nucleotide sequences can also be used as the PCR primer of the gene of this theme of amplification invention.

The hybridization characteristics of molecule can be used for defining the polynucleotides of this theme invention.Therefore the invention of this theme comprises and the polynucleotides of multi-nucleotide hybrid exemplified here (and/or its complement, preferably its full complement).That is, a kind of mode limiting gene (with the protein of its coding) is, such as, with its gene with known or concrete example (any concrete herein disclosed under condition) ability of hybridizing limits.

As used in this article, " strictly " hybridization conditions refers to such condition: its hybrid specificities degree realized is identical or roughly the same with the hybrid specificities degree that the condition that the applicant uses realizes.Specifically, the hybridization being fixed on the gene-specific probe of DNA and the 32P mark on Southern trace can be undertaken by standard method (consulting such as Maniatis etc., 1982).Generally speaking, allowing to carry out under the condition detecting target sequence hybridizing and washing subsequently.For double-stranded DNA gene probes, in 6xSSPE, 5xDenhardt solution, 0.1%SDS, 0.lmg/ml denatured DNA, Overnight hybridization can be carried out the temperature of melting temperature (Tm) the following 20-25 of DNA hybridization body DEG C.

Generally can wash as following: (1) washes twice (low washing stringency) in room temperature in 1xSSPE, 0.1%SDS for 15 minutes; (2) within 15 minutes, wash once (moderate washing stringency) at Tm-20 DEG C in 0.2xSSPE, 0.1%SDS.

For oligonucleotide probe, Overnight hybridization can be carried out by melting temperature (Tm) the following 10-20 DEG C at crossbred in 6xSSPE, 5xDenhardt solution, 0.1%SDS, 0.lmg/ml denatured DNA.

Generally can wash as following: (1) washes twice (washing stringency) in room temperature in 1xSSPE, 0.1%SDS for 15 minutes; (2) within 15 minutes, wash once (moderate washing stringency) at hybridization temperature in 1xSSPE, 0.1%SDS.

Generally speaking, salt and/or temperature can be changed to change stringency.For the labeled dna fragment about length >70 base, following condition can be used: (1) is low: 1 or 2xSSPE, room temperature; (2) low: 1 or 2xSSPE, 42 DEG C; (3) moderate: 0.2x or 1xSSPE, 65 DEG C. or (4) are highly: 0.1xSSPE, and 65 DEG C.

The formation of duplex and stability dependency are in the remarkable complementarity of crossbred two interchains, and as mentioned above, mispairing is to a certain degree allowed.Therefore, the probe sequence of this theme invention comprises the sudden change (single and multiple) of described sequence, disappearance, inserts and combination, wherein suddenly change, insert and lack permission and target polynucleotide interested forms stable crossbred.Can produce sudden change in a variety of ways in given polynucleotide sequence, insert and disappearance, these methods are known to persons of ordinary skill in the art.Additive method can known in the future.

Round pcr: polymerase chain reaction (PCR) (PCR) is that the repeated enzymatic of nucleotide sequence causes synthesis.The method is known for those skilled in the art and is generally used (consulting Mullis, United States Patent(USP) Nos. 4,683,195,4,683,202 and 4,800,159, Saiki etc., 1985).The basis of PCR is the enzymatic amplification to DNA fragmentation interested, and wherein the flank of DNA fragmentation interested is two Oligonucleolide primers of hybridizing with target sequence opposite strand.The orientation of these two kinds of primers is preferably so that they point to 3' end each other.The repetitive cycling of " template thermal denaturation-primer and its complementary series anneal-extend annealing primer with archaeal dna polymerase " causes the amplification of the fragment defined by 5 ' end of two PCR primer.The extension products of each primer can be used as the template of other primers, and therefore each circulation is doubled the amount of the DNA fragmentation produced in last circulation substantially.This causes the index of particular target fragment to accumulate, and accumulates and reach millions of times at most in several hours.Completely automatically amplification procedure can be completed by using heat-staple archaeal dna polymerase (as being separated the Taq polymerase from Thermophilic Bacteria thermus aquaticus (Thermusaquaticus)).Other enzymes operable are well known by persons skilled in the art.

Example DNA sequence dna or its fragment can be used as the primer of pcr amplification.When carrying out pcr amplification, mispairing to a certain degree between tolerable primer and template.Therefore, the sudden change of exemplary primer, deletion and insertion (particularly adding at the nucleotide of 5' end) also drop in this theme scope of invention.Sudden change can be produced by method known to persons of ordinary skill in the art in given primer, insert and disappearance.

The modification of gene and protein: this theme gene and protein can merge with other gene and protein and produce chimeric protein or fusion.Invent useful gene according to this theme and protein not only comprises the full length sequence specifically exemplified, but also comprise the part of these sequences, variant, mutant, chimera and fusion thereof, section and/or fragment (comprising the continuous fragment compared to full-length molecule and inner and/or terminal deletion).The protein of this theme invention can have the amino acid of displacement, if they retain desired by functional activity." variant " gene has such nucleotide sequence, the protein that its coding is identical with example protein, or has the equivalent protein matter of the activity similar or equivalent to example protein.

With the reasonable homology level (about 85%) that two results the most front of the blast search of natural aad-12 nucleotide sequence show on 120 base-pairs of sequence.Can expect that hybridization under certain conditions can comprise these sequences.Consult GENBANK accession number DQ406818.1 (89329742; Redly educate Pseudomonas (Rhodoferax) and AJ6288601.1 (44903451; Sphingomonas (Sphingomonas).Redly educate Pseudomonas and Dai Erfute Pseudomonas is closely similar, but Sphingomonas is diverse classification on system occurs.

Term " misfolded proteins " and " equivalent protein matter " refer to have identical with exemplified protein or the substantially identical protein for the biology/functional activity of target substrate and the sequence with exemplified protein equivalence.As used in this article, " equivalence " sequence mentioned refers to such sequence, it has amino acid replacement, disappearance, interpolation or inserts, and this amino acid replacement, disappearance, interpolation or insertion can improve activity or activity do not had to the adverse effect of significance degree.The fragment of retentive activity is also included in this definition.Remain and fall within this theme scope of invention with other equivalents with the fragment of the same or analogous function of the respective segments of example albumen or activity.Can carry out changing (such as amino acid replacement or interpolation) in order to diversified object, such as, in order to improve (or reduction) protein protease stability, remove or add restriction site etc. (and not in fact/reduce the functional activity of protein significantly).The standard technique such as producing point mutation can be used easily to build the variation of gene.

In addition, such as, U.S. Patent number 5,605,793 describe by random or use DNA to re-assembly the method producing other molecular diversity after focusing on fragmentation.This can be described as gene " reorganization ", generally comprises (have expect size) fragment of the two or more different DNA molecular of mixing, repeats subsequently somely to take turns renaturation.This can improve the activity of the protein coded by initial gene.Consequently there is the chimeric protein of the activity of improvement, the substrate specificity of change, the enzyme stability of increase, the stereoselectivity of change or other features.

After atom 3D (three-dimensional) coordinate obtained and check proteins of interest and crystal structure, can design and target " reorganization ".Therefore, can some carry out " focus on reorganization " to the desirable section of modification in protein, the section that these sections such as surface exposes, and preferably do not relate to the interior segments of protein folding and crucial 3D structural intergrity.

The special change can carrying out enzyme " avtive spot " affects the inherent function about active or stereoselectivity.Muller etc. (2006).Known tauD crystal structure is used as model dioxygenase, to determine active-site residues, is attached on its intrinsic substrate taurine simultaneously.Elkins etc. (2002) " X-raycrystalstructureofEscherichiacolitaurine/alpha-keto glutaratedioxygenasecomplexedtoferrousironandsubstrates, " Biochemistry41 (16): 5185-5192.About sequence optimisation and the designability of enzyme active sites, consult Chakrabarti etc., PNAS (Aug.23,2005), 102 (34): 12035-12040.

Commercially available exonuclease or endonuclease can be used to produce full-length gene fragment according to standardization program.Such as, can come systematically to cut away nucleotide from the end of these genes with enzyme (as Bal31) or site-directed mutagenesis.Equally, multiple restriction enzyme can be used to obtain the gene of encode active fragments.Protease can be used directly to obtain the active fragment of these protein.

As disclosed herein, can truncated protein matter and still reservation function is active, this is also within the scope of the invention.Refer to that a part for protein can be cut about " protein of brachymemma ", the protein of simultaneously remaining after dicing brachymemma retains and shows the activity of expectation.Cutting is realized by various protease.In addition, Protocols in Molecular Biology can be used to produce the protein of effectively cutting, wherein by removing the DNA base of code for said proteins by restriction endonuclease digestion or the obtainable other technologies of those skilled in the art.After brachymemma, protein as described in can expressing in Heterologous System (as Escherichia coli, baculoviral, viral system, yeast etc. based on plant), is then placed in insect assay disclosed herein and measures active.As known in the art, successfully can produce the protein of brachymemma, make their reservation functions activity have the sequence being less than whole total length simultaneously.Such as, can use B.t. albumen (core protein) (consult, such as, the people (1985) such as Hofte etc. (1989) and Adang) by clipped form.As used in this article, term " protein " can comprise functional activity truncate.

Except as otherwise noted, use as Karlin and Altschul to determine sequence iden and/or the Similarity Percent of two nucleic acid used herein at Karlin and the Altschul algorithm of nineteen ninety that 1993 improve.Such Algorithms Integration is in NBLAST and the XBLAST program of the Altschul etc. of nineteen ninety.NBLAST program is used to carry out BLAST nucleotide search, scoring=100, word length=12.The room BLAST as described in (1997) such as Altschul can be used.When using BLAST and GappedBLAST program, use the default parameters of corresponding program (NBLAST and XBLAST).Consult NCBI/NIH network address.Using default parameters, obtaining the room comparison for comparing object with the AlignX function of VectorNTISuite8 (InforMax, Inc., NorthBethesda, MD, U.S.A).They are: breach opens point penalty 15, gap extension penalty 6.66 is separated penalty range 8 with breach.

Also can change the various characteristic of protein and three-dimensional feature and the activity of protein/functional not had a negative impact.Conservative amino acid displacement can tolerate/can make that conservative amino acid displacement does not have a negative impact to the activity of molecule and/or 3-d modelling.Amino acid can be attributed to lower class: nonpolar amino acid, uncharged polar amino acid, basic amino acid and acidic amino acid.Another the amino acid whose conservative substitution by this kind a amino acid being replaced with identical type falls within this theme scope of invention, as long as displacement does not have adverse effect to the biologically active of compound.Table 1 provides the list of the amino acid whose example belonging to each class.In some cases, non-conservation displacement can also be carried out.But, preferred function/biologically active of replacing the protein that significantly do not detract.

As used in this article, " separation " polynucleotides mentioned and/or " purifying " protein refer to these molecules and the occasion of being not together with other molecules occurred together with them at occurring in nature.Therefore, the intervention that " separation " and/or " purifying " shows " manually " is as described herein mentioned.Such as, the bacterium " gene " being placed in this theme invention that plant carries out expressing is " polynucleotides of separation ".Equally, the protein derived from bacterioprotein that plant produces is " protein of separation ".

Due to the degeneracy/redundancy of genetic code, multiple different DNA sequence dna can be encoded amino acid sequence disclosed herein.Produce the alternative DNA sequence dna of encode identical or basic same protein in the limit of power of those skilled in the art.These variant DNA sequences are also within this theme scope of invention.Hereafter title be " for (for/for) sequence optimisation of expression of plants " chapters and sections in also have more detailed discussion to this.

For (for/for) sequence optimisation of expression of plants: in order to obtain the high expressed of heterologous gene in plant, usually preferably again transforming described gene and more effectively expressing in plant cell (kytoplasm) to make it.Corn is exactly a kind of such plant, before conversion, preferably redesigns heterologous gene to improve the expression of heterologous gene in this plant.Therefore, in the design of the gene of encoding bacterial protein, an additional step uses again to transform heterologous gene, with optimized expression with target plant sequence (dicotyledon or monocot plant species) closer to consistent codon preference.Can also optimization to express in any one in the plant of the more specifically type discussed in herein its elsewhere.

Transformed host: the protein coding gene this theme can invented is introduced in multiple-microorganism or plant host.The invention of this theme comprises transgenic plant cells and genetically modified plants.Preferred plant (and plant cell) is corn, arabidopsis, tobacco, soybean, cotton, canola, paddy rice, wheat, turfgrass, leguminous feed (such as clover and clover), herbage etc.The genetically modified plants of other types can also be produced, as fruit, vegetables, ornamental plants and trees according to the invention of this theme.More generally, dicotyledon and/or monocotyledon can be used in the various aspects of this theme invention.

In preferred embodiments, the expression of gene directly or indirectly causes proteins of interest matter intracellular generation (and maintenance).Can plant be made by this way to have Herbicid resistant.Such host can be called as genetically modified, restructuring, transform and/or the host of transfection and/or cell.In some aspects of the invention (such as, as clone with when preparing gene of interest), can produce and use microorganism (preferred bacterium) cell according to routine techniques by the disclosure of this theme.

The plant cell of transfection this theme invention polynucleotides can be regenerated as whole plant.The invention of this theme comprises cell culture, comprises tissue cell culture, liquid culture and plate culture.By this theme invention plant to produce and/or seed for regenerating this theme invention plant is also included within this theme invention scope.Other plant tissue and part are also included within the invention of this theme.The invention of this theme comprises generation equally containing the plant of this theme invention polynucleotides or the method for cell.A kind of method for optimizing producing such plant is the seed invented by planting this theme.

Although plant may be preferred, the invention of this theme is also included in such as pseudomonas fluorescens (Pf) host strain and produces high activity restructuring AAD-12.The preferred growth temperature comprised for maintaining the soluble activating AAD-12 in this host invented in this theme; Wherein AAD-12 is with the total cell protein being greater than 40% or the fermentation condition produced with at least 10g/L; Make the high purifying process reclaiming reconstituted protein AAD-12 from Pf host; Produce the purification schemes of every kg cell at least 10g active A AD-12; The purification schemes of every kg cell 20g active A AD-12 can be produced; The active preparation process also recovering AAD-12 activity in the solution of AAD-12 can be preserved; The refrigerating process that AAD-12 activity is convenient to long term storage and long shelf life can be retained.

Insert gene to form transformed host: an aspect of this theme invention is with this theme invention polynucleotides conversion/transfect plant of expressing this theme invention protein, plant cell and other host cells.The plant transformed by this way can obtain the resistance for the multiple weed killer herbicide with the different mode of action.

Multiple method is had to can be used to the gene of desired protein to import target host under the condition allowing stable maintenance and this gene of expression.These methods are well known to those skilled in the art, and are described in such as U.S. Patent number 5,135,867.

Carrier containing AAD-12 polynucleotides is included in this theme invention scope.Such as, have multiple cloning vector to can be used for alien gene to be inserted in higher plant, described carrier contains E. coli replication system and allows to select the mark of the cell transformed.Carrier comprises such as PBR322, pUC series, serial, the pACYC184 of M13mp etc.Therefore, can at the restriction site be applicable to by the sequence insertion vector of coded protein.The plasmid obtained is for being transformed in Escherichia coli.The nutrient medium be applicable to cultivates Bacillus coli cells, then results also cracking.From genomic DNA, plasmid is reclaimed by purifying.As analytical method, generally carry out sequence analysis, restriction analysis, electrophoresis and other biological chemistry-molecular biology method.After each operation, DNA sequence dna that digestion uses can be limited and it is connected with next DNA sequence dna.Each plasmid sequence can be cloned in same or other plasmids.Depend on the method be inserted into by the gene of expectation in plant, other DNA sequence dnas may be necessary.Such as, if use Ti or Ri Plastid transformation plant cell, then must connect at least right side boundary (but being often right side and left border) of Ti or Ri plasmid T-DNA as the flank region being inserted into gene.T-DNA is used for the purposes of transformed plant cells at EP120516; Hoekema (1985); Fraley etc. (1986); Deep research and description is had with in (1985) such as An.

Multiple technologies are had to can be used for DNA to insert in plant host cell.These technology comprise and use Agrobacterium tumefaciens or rhizobiaceae as transforming agent T-DNA conversions, fusion, injection, the transmitting of Biolistic (microparticle bombardment), silicon carbide whisker, aerosol, `PEG or electroporation and other possible methods.If transformed with agrobacterium, by the DNA clone that is inserted into in special plasmid, namely must enter intermediate carrier or enter in binary vector.Due to the sequence with the sequence homology in T-DNA, intermediate carrier can be incorporated in Ti or Ri plasmid by homologous recombination.Ti or Ri plasmid is also containing the vir district that transfer T-DNA is required.Intermediate carrier can not self-replacation in agrobacterium.By helper plasmid intermediate carrier can be transferred in Agrobacterium tumefaciens and (put together).Binary vector can self-replacation in Escherichia coli and agrobacterium.They contain selection marker thing gene and joint or poly joint, and both sides are right and left T-DNA frontier district.They directly can be transformed into (Holsters etc., 1978) in agrobacterium.Agrobacterium as host cell contains the plasmid carrying vir district.It is required that T-DNA transfers in plant cell by vir district.Can containing other T-DNA.The bacterium transformed like this is used for transformed plant cells.Advantageously can cultivate plant explants, to be transferred in plant cell by DNA with Agrobacterium tumefaciens or rhizobiaceae.Then can from the vegetable material infected (as the sections of the fragment of leaf, stem, root and protoplast or suspension cultured cells) regenerating intact plants in the medium be applicable to, described medium can containing the antibiotic for selecting or biocide.Then the existence of inserting DNA in the plant obtained like this can be tested.When injection and electroporation, particular/special requirement be there is no for plasmid.Ordinary plasmids may be used, such as PUC derivative.

Transformant grows in the usual manner in plant.They can form reproductive cell and the proterties of conversion is delivered to progeny plant.Such plant can be cultivated in the normal fashion and make it and there is same transformed hereditary factors or other genic plant hybridizations.The hybrid individual obtained has corresponding phenotypic characteristic.In certain preferred embodiments of the present invention, express the gene of encoding bacterial protein from the transcript unit inserting Plant Genome.Preferably, described transcript unit is recombinant vector, described recombinant vector can stable integration in Plant Genome, and make the conversion of plant strain of mRNA selecting to express coded protein become possibility.

Once be incorporated in genome, then inserting DNA is metastable (and no longer discharging) wherein.It generally comprises selection marker thing, and selection marker thing gives the resistance of transformed plant cells to biocide or antibiotic (as kanamycin, G418, bleomycin, hygromycin or chloramphenicol etc.).Plant choosing mark generally can provide the resistance to various weed killer herbicide, and these weed killer herbicides are as phosphine oxamate (such as PAT/bar), glyphosate (EPSPS), ALS inhibitor (such as imidazolone, sulfonylureas, triazolo pyrimidine sulfanilamide (SN) etc.), Brominal, HPPD inhibitor, PPO inhibitor, ACC enzyme inhibitor and other weed killer herbicides many.The mark be used alone correspondingly should allow to select the cell through transforming, and does not select not containing the cell inserting DNA.Interested gene is preferably expressed by composing type or inducible promoter in plant.Once after expressing, mRNA translates into protein, thus by interested amino acid incorporation protein.Under the gene of the coded protein of expressing in plant can be in the control of constitutive promoter, tissue-specific promoter or inducible promoter.

Exist some by foreign recombinant vectors introduced plant cell and obtain stable maintenance and express introduce the method for gene.These technology comprise the genetic material be coated on particulate directly to introduce in cell (authorizes the U.S. Patent No. 4 of Cornell, 945,050 and authorize the U.S. Patent No. 5 of DowElanco (now for DowAgroSciences, LLC), 141,131).In addition, agrobacterium technical transform plant can be used, consult the U.S. Patent No. 5,177,010 of authorizing Toledo university (UniversityofToledo); 5,104,310 of TexasA & M; European patent application 0131624B1; The european patent application 120516 of Schilperoot, 159418B1 and 176,112; The United States Patent (USP) 5,149,645,5,469,976,5,464,763 and 4,940,838 and 4,693,976 of Schilperoot; The european patent application 116718,290799,320500 of MaxPlanck; The european patent application 604662 and 627752 of JapanTobacco, and U.S. Patent No. 5,591,616; The european patent application 0267159 and 0292435 of CibaGeigy (being Syngenta now) and U.S. Patent No. 5,231,019; The U.S. Patent No. 5,463,174 and 4,762,785 of Calgene; With the United States Patent (USP) 5,004,863 and 5,159,135 of Agracetus.Other transformation technologies comprise whisker technique.Consult the U.S. Patent No. 5,302,523 and 5,464,765 of Zeneca (being Syngenta now).Other direct DNA sends transformation technology and comprises aerosol bundle technology.See U.S. Patent number 6,809,232.Electroporation technology is also used to conversion of plant.Consult the WO87/06614 of BoyceThompsonInstitute; The United States Patent (USP) 5,472,869 and 5,384,253 of Dekalb; And WO92/09696 and WO93/21335 of PlantGeneticSystems.In addition, also the genetically modified plants of expressing proteins of interest matter can be produced with viral vectors.Such as, the United States Patent (USP) 5 of MycogenPlantScience and Ciba-Giegy (being Syngenta now) can be used, 569,597 and the United States Patent (USP) 5 of Biosource (being LargeScaleBiology now), 589,367 and 5,316, the viral vectors transforming monocots of the method described in 931.

As previously mentioned, not crucial by the method for DNA construct introduced plant host for the present invention.Any method that effectively conversion is provided can be used.Such as, there is described herein the method for various transforming plant cells, comprise and use Ti or Ri plasmid etc. to carry out agrobacterium-mediated conversion.In many cases, allow to be connected with T-DNA border on one or both sides (being more specifically right side boundary) for the carrier that transforms may be desirable.This uses Agrobacterium tumefaciens or rhizobiaceae as being useful especially during transform mode at construct, but T-DNA border also can be used for other transform modes.When agrobacterium is used for transforming plant cells, the carrier that can be introduced into T-DNA or Ti that exist in described host or Ri plasmid homologous recombination in host can be used.Carrier introducing can be carried out by electroporation, three parent's mating (tri-parentalmating) and the other technologies for transforming gram-negative bacterium well known by persons skilled in the art.Vector is not crucial to the mode in agrobacterium host for the present invention.Ti or Ri plasmid containing the T-DNA for recombinating can maybe can not cause crown gall nodule to form (gallformation), as long as there is vir gene in described host, this is not crucial to the present invention.

Under the certain situation being used for transforming by agrobacterium, the expression construct within T-DNA border can be inserted broad spectrum vector as in pRK2 or derivatives thereof, if Ditta etc. is with described in EPO0120515.Can comprise one or more mark as described herein in expression construct and T-DNA, they allow the plant cell selecting agrobacterium and the conversion transformed.The symbol thing used is not critical to the present invention, and preferred mark depends on used host and construct.

In order to use Agrobacterium transformation plant cell, explant can be combined with the agrobacterium through transforming and together with incubation time enough transform to allow it.After conversion, by killing agrobacterium with suitable antibiotic selection, and cultivate plant cell with suitable Selective agar medium.Once formation callus, Buds formation can be promoted according to the known method of Plant Tissue Breeding and plant regeneration field by using suitable plant hormone.But the callus interstage is always unnecessary.After Buds formation, described plant cell can be transferred in the medium promoting that root is formed, thus complete plant regeneration.Then can cultivate plant produces seeds, described seed may be used for setting up the generation in the future.No matter transformation technology how, preferably by the gene integration of encoding bacterial protein in such gene transfer vector: by comprising plant promoter regulating element and 3 ' untranslated transcription termination region (as Nos etc.) in this carrier, made this transfer vector be suitable for expressing said gene in plant cell.

Except diversified for except the technology of conversion of plant, the organization type contacted with alien gene also can be various.Such tissue includes but are not limited to embryogenic tissue, I, II and type III callus, hypocotyl, meristematic tissue, root tissue, the tissue etc. of expressing for phloem.Use proper technology as herein described can transform nearly all plant tissue in the process of dedifferenting.

As described above, multiple choices mark can be used when needed.The selection of symbol thing is by technical staff's tailoring, but any following selection marker thing can use together with other herein gene that is unlisted, that can play the effect of selection marker thing.Such selection marker thing includes but not limited to the aminoglycoside phosphotransferase gene (AphII) of encoding to the transposons Tn5 of the resistance of antibiotic kanamycin, neomycin and G418; Hygromycin resistance, methotrexate resistance and coding are to the resistance of glyphosate or those genes of tolerance; Phosphinothricin (two third ammonia phosphorus or phosphine oxamate), ALS inhibition weed killer herbicide (imidazolone type, sulfonylurea and triazolo pyrimidine classes of herbicides), ACC enzyme inhibitor (such as aryloxy group phenoxy propionic acid (ayryloxypropionates) or cyclohexyl diketone) and other weed killer herbicides such as Brominal and HPPD inhibitor (such as mesotrione) etc.

Except selection marker thing, may expect to use reporter.In some cases, reporter can with or do not use together with selection marker thing.Reporter is generally non-existent gene in receptor biological or tissue, and coding causes the protein of some character mutation or enzyme characteristic usually.Weising etc. provide the example of these genes 1998.Preferred reporter comprise Escherichia coli UidA locus β-glucuronidase (GUS), from the chloramphenicol acetyl transferasegene of Escherichia coli Tn9, from the green fluorescent protein of bioluminescent jellyfish Victoria multitube luminescent jellyfish (Aequoreavictoria) and the luciferase genes from North America firefly (Photinuspyralis).Then can the mensuration expressed of the appropriate time examinations reporter after described gene introduces recipient cell.Preferably such mensuration uses the gene of the encoding-glucuronidase (GUS) of the Escherichia coli UidA locus as described in (1987) such as Jefferson to carry out identification of transformed cell.

Except plant promoter regulating element, can in plant cell, the modulator promoter element from multiple source be effectively used to carry out expression alien gene.Such as, the modulator promoter element of bacterial origin can be used, as octopine synthase promoter, nopaline synthase promoter, mannopine synthase promoter; The promotor of viral source, as cauliflower mosaic virus (35S and 19S), 35T (35S promoter of further conversion, See U. S. Patent number 6,166,302, particularly embodiment 7E) etc.Plant promoter regulating element includes but not limited to core ketose-1,6-diphosphonic acid (RUBP) carboxylase small subunit (ssu), beta-conglycinin (conglycinin) promotor, β-phaseolin promotor, ADH promotor, heat-shock promoters and tissue-specific promoter.Other elements can also be there are, as matrix attachment regions, scaffold attached region, intron, enhancer, polyadenylation sequence etc., thus transcriptional efficiency or DNA integration can be improved.Although these elements can be transcribed by impact, mRNA stability etc. provides good DNA to express or function, they may be also may be optional to DNA function.These elements can optionally be included in DNA, to obtain the Optimal performance of transforming DNA in plant.Typical element includes but not limited to Adh-intron l, Adh-intron 6, alfalfa mosaic virus coat protein leader, ooze adjust albumen (osmotin) UTR sequence, maize streak virus coat protein leader and those skilled in the art can other elements.Constitutive promoter regulating element can also be used thus instruct and express (as actin, ubiquitin, CaMV35S etc.) in all cells type and free continuous gene.The gene expression (such as zein, oleosin, rapeseed protein, ACP, globulin etc.) in specific cells or organization type (as leaf or seed) is responsible for by tissue-specific promoter's regulating element, and these regulating elements also can use.

Modulator promoter element also can have activity (or non-activity) in some stage of development of plants, and has activity in plant tissue and organ.These example includes but are not limited to pollen specific, embryo-specific, corn silk specificity, cotton fiber specific, root-specific, seed endosperm specific or trophophase specificity promoter regulating element etc.May expect in some cases to use inducible promoter regulating element, it is responsible for the gene expression in response to signal specific (as physical stimulation (heat shock gene), light (RUBP carboxylase), hormone (Em), metabolite, chemicals (tetracycline response) and coerce).Transcribing and translating element of other expectations of working in plant can also be used in.Many plant-specific gene transfer vectors known in the art.

System based on Plant RNA viral also can be used for expressing bacterioprotein.For this reason, the gene of coded protein can be inserted in the coat promoter region of the suitable plant virus infecting interested host plant.Then can marking protein thus for plant provide antagonism herbicide damage protection.System based on Plant RNA viral is described in MycogenPlantSciences, the United States Patent (USP) 5,316,931 and 5,589,367 of the United States Patent (USP) 5,500,360, Biosource (being LargeScaleBiology now) of Inc..

The means of further increase tolerance or resistance level.Show herein, the plant of this theme invention can be endowed new herbicide resistance trait, and does not have observable adverse effect to the phenotype comprising productive rate.Such plant is also within this theme scope of invention.Such as, the plant of example and hint can resist 2x, 3x, 4x and 5x typical case fertilizing standards of at least one theme weed killer herbicide herein.Raising on these durability level also within the scope of the invention.Such as, the technology of the multiple expression for increasing given gene is known in the art, and can predict and can optimize and develop this type of technology further.

A kind of such method comprises the copy number increasing theme AAD-12 gene (in expression cassette and analog).Multiple copiers with gene can also be selected from transformation event.

Strong promoter and enhancer may be used for " excess load " (supercharge) expresses.The example of such promotor comprises the 35T promotor preferably utilizing 35S enhancer.35S, maize ubiquitin, arabidopsis ubiquitin, A.t. actin and CSMV promotor are included in these purposes.Other strong virus promotors are also preferred.Enhancer comprises the two enhancer of 4OCS and 35S.Matrix attachment regions (MAR) can also be used to increase transformation efficiency and transgene expression.

This theme working of an invention scheme can also use reorganization (orthogenesis) and transcription factor.

Also can to design on sequence level different but remain the misfolded proteins of same or analogous overall basic three-dimensional structure, surface charge distribution etc.Consult such as United States Patent (USP) 7,058,515; Larson etc., ProteinSci.200211:2804-2813, " Thoroughlysamplingsequencespace:Large-scaleproteindesign ofstructuralensembles "; Crameri etc., NatureBiotechnology15,436-438 (1997), " MolecularevolutionofanarsenatedetoxificationpathwaybyDNA shuffling "; Stemmer, W.P.C.1994, " DNAshufflingbyrandomfragmentationandreassembly:invitrore combinationformolecularevolution " Proc.Natl.Acad.Sci.USA91:10747-10751; Stemmer, W.P.C.1994. " RapidevolutionofaproteininvitrobyDNAshuffling " Nature370:389-391; Stemmer, W.P.C.1995.Searchingsequencespace.Bio/Technology13:549-5 53; Crameri, A., wait 1996. " Constructionandevolutionofantibody-phagelibrariesbyDNAsh uffling " NatureMedicine2:100-103; And Crameri, A. etc. 1996. " Improvedgreenfluorescentproteinbymolecularevolutionusing DNAshuffling " NatureBiotechnology14:315-319.

The activity inserting the recombination of polynucleotide in plant cell may depend on the impact of the endogenous plant DNA of contiguous Insert Fragment.Therefore, another selects to be that utilizing known is the event of excellent insertion position in Plant Genome.About cry1F and cry1Ac cotton event, consult such as WO2005/103266A1; Cry1F and/or the cry1Ac Insert Fragment in these genomic locus can be replaced with theme AAD-12 gene.Therefore, such as, target homologous recombination can be used according to the invention of this theme.Such technology is the theme of such as WO03/080809A2 and corresponding disclosed U. S. application 20030232410 thereof, and they relate to the purposes that zinc refers to recombinate for target.The purposes of recombinase (such as cre-10x and flp-frt) is also known.

It is believed that AAD-12 detoxification occurs in cytoplasm.Therefore, the means for stablizing this protein and mRNA further also belong to (comprise and block mRNA degraded) aspect of this theme invention, and therefore can apply technology known in the art.It can be the degraded (re-engineering by protein amino acid sequence effectively removes proteolytic cleavage site) of opposing protease etc. by this theme protein design.Such embodiment comprises and uses 5' and 3' loop-stem structure, as from oozing UTR and per5 (being rich in AU untranslated 5' sequence) adjusting albumen (osmotin).5' cap can also be used, as 7-methyl or 2'-O-methyl group, such as 7-methylguanosine acid residue.Consult such as; Proc.Natl.Acad.Sci.USAVol.74, No.7, pp.2734-2738 (July1977) Importanceof5'-terminalblockingstructuretostabilizemRNAi neukaryoticproteinsynthesis.Protein complex or part blocking group can also be used.

Can also carry out being best suited for 5 ' or 3 ' calculating design of UTR of AAD-12 (synthesis hairpin structure) within this theme scope of invention.Other local discuss microcomputer modelling substantially and gene shuffling and orthogenic evolution in this article.More particularly, about microcomputer modelling and UTR, the microcomputer modelling technology used in prediction/assessment 5 ' or 3 ' UTR derivative according to the present invention includes but not limited to: from GeneticsCorporationGroup, Madison, Wis. obtainable MFold version 3 .1 (consults Zucker etc., " AlgorithmsandThermodynamicsforRNASecondaryStructurePredi ction:APracticalGuide, " see RNABiochemistryandBiotechnology, 11-43, J.Barciszewski & B.F.C.Clark edits, NATOASI series, KluwerAcademicPublishers, Dordrecht, NL, (1999), Zucker etc., " ExpandedSequenceDependenceofThermodynamicParametersImpro vesPredictionofRNASecondaryStructure, " J.Mol.Biol.288,911-940 (1999), Zucker etc., " RNASecondaryStructurePrediction, " inCurrentProtocolsinNucleicAcidChemistry, S.Beaucage, D.E.Bergstrom, G.D.Glick, edit with R.A.Jones, JohnWiley & Sons, NewYork, 11.2.1-11.2.10, (2000)), COVE (RNAstructureanalysisusingcovariancemodels (stochasticcontextfreegrammarmethods)) v.2.4.2 (Eddy & Durbin, Nucl.AcidsRes.1994,22:2079-2088), it is freely distributed with source code form, and downloads by logging in network address genetics.wustl.edu/eddy/software/, and FOLDALIGN, also can freely distribute, can network address bioinf.au.dk.FOLDALIGN/ download obtain (consult " Findingthemostsignificantcommonsequenceandstructuremotif sinasetofRNAsequences, " J.Grodkin, L.J.Heyer and G.D.Stormo.NucleicAcidsResearch, Vol.25, no.18pp.3724-3732,1997, " FindingCommonSequenceandStructureMotifsinasetofRNASequen ces, " J.Gorodkin, L.J.Heyer and G.D.Stormo.ISMB5, 120-123,1997).

This theme invention embodiment can with natural evolution or the mutant (select mutant by triage techniques, then use AAD-12, other genetic transformation may be also had) of chemical induction be combined.This theme invention plant can combine with the glyphosate resistance of ALS resistance and/or evolution.Such as, Dorema ammoniacum pyridine resistance also can with the AAD-12 assortment of genes or " superposition ".

Traditional breeding technology also can be invented with this theme and combine, so that group enters forcefully, infiltrate and improve the proterties expected.

Further improvement also comprises and using together with suitable safener, with further protective plant and/or the cross tolerance that increases more weed killer herbicide.Safener plays a role to activate usually/express cP450, thus strengthen the immune system of plant.Safener reduces by physiology or molecular mechanism weed killer herbicide can not to reduce Weeds distribution effect chemical agent to the phytotoxicity of crop plants.

Herbicide-safener comprises benoxacor, cloquintocetmexyl, cyometrinil, allyl dichloride amine, dicyclonon, dietholate, fenchlorazole, fenclorim, solution grass amine, fluxofenim, solution grass oxazole, the acid of two benzene oxazole, pyrazoles solution oxalic acid (mefenpyr), mephenate, naphthalic anhydride and oxabetrinil.Also plant activator (compound that a class is new, the protective plant by the defense mechanism of activated plant) can be used in this theme working of an invention scheme.These activators comprise thiadiazoles element (acibenzolar) and probenazole.

Business-like safener may be used for protecting large seed gramineous plants crop, as corn, Chinese sorghum and wet method sowing paddy rice, makes it from mixing before plantation or going out the thiocarbamate of preemergence application and the impact of chloracetophenone amine weed killer herbicide.Also developed safener to be used for protecting cereal in winter, such as wheat, avoids the injury of postemergence application aryloxyphenoxypropionic and sulfonylurea herbicide.The application that safener protection corn and paddy rice avoid the injury of sulfonylureas, imidazolone, cyclohexanedione, isoxazole and triketone have also been obtained establishment.In the plant of safe, the enhancing of the weed killer herbicide removing toxic substances of safener induction is the main mechanism that safener relates on by extensively approving.Safener can induce co-factor, as glutathione, and weed killer herbicide detoxication enzyme, as glutathione S-transferase, cytochrome P 450 monooxygenases and glucosyltransferase.HatziosKK，BurgosN(2004)“Metabolism-basedherbicideresistance:regulationbysafeners,”WeedScience:Vol.52，No.3pp.454-467。

The purposes that cytochrome p450 monooxygenase gene superposes with AAD-12 is a preferred embodiment.Herbicide metabolism relates to P450; Such as, cP450 can be mammal or plant origin.In higher plant, known cytochrome P 450 monooxygenases (P450) implements cometabolism.It also cooperates with NADPH cytochrome P450 reductase (reductase) and to play an important role in the oxidative metabolism of xenobiotics.Report the resistance to some weed killer herbicides caused by P450 and glutathione S-transferase metabolism.Many microsome P450 kinds relating to xenobiotic metabolism in mammal obtain sign by molecular cloning.Some in them it is reported can the several weed killer herbicide of metabolism expeditiously.Therefore, the genetically modified plants with plant or mammal P450 can demonstrate the resistance to some weed killer herbicides.

An aforesaid preferred embodiment is that to the purposes of the resistance of Acetochlor, (product based on Acetochlor comprises cP450 keystoneLA, with weed killer herbicide) and/or trefanocide (as ).This type of resistance in soybean and/or corn comprises in some preferred embodiments.About the other guidance of this type of embodiment, such as Inui etc. can be consulted " AselectablemarkerusingcytochromeP450monooxygenasesforAra bidopsistransformation; " PlantBiotechnology22, (it relates to a kind of selective system for Agrobacterium tumefaciens arabidopsis thaliana transformation to 281-286 (2005), and utilizing can the human-cytochrome P450 monooxygenase of metabolism weed killer herbicide; Herbicide-resistant seedling through transform and use that Acetochlor, amiprophos-methyl, Chlorpropham, chlorine sulphur are grand, the weed killer herbicide such as monometflurazone and Pendimethalin selects); Siminszky etc. " ExpressionofasoybeancytochromeP450monooxygenasecDNAinyea standtobaccoenhancesthemetabolismofphenylureaherbicides; " PNASVol.96, Issue4,1750-1755, on February 16th, 1999; Sheldon etc., WeedScience: the 48th volume, the 3rd phase, 291-295 page, " AcytochromeP450monooxygenasecDNA (CYP71A10) confersresistancetolinuronintransgenicNicotianatabacum "; With " Phytoremediationoftheherbicidesatrazineandmetolachlorbyt ransgenicriceplantsexpressinghumanCYP1A1, CYP2B6, andCYP2C19, " JAgricFoodChem.2006 April 19; 54 (8): 2985-91 (relate to test person cytochrome p450 monooxygenase in paddy rice, wherein it is reported that rice plants demonstrates the high resistance to chloro-acetyl amine (Acetochlor, alachlor, propisochlor (metoachlor), the third careless amine and P DimethenamidP), oxyacetamide (mefenacet), pyridazinone (monometflurazone), 2,6-dinitroanilines (trefanocide and pendimethalin), phosphoramide types (amiprophos-methyl, amiprophos-methyl (pyributicarb) and urea (chlortoluron)).

Also likely change 2,4-D chemistry or use 2,4-D different chemistry to improve the efficiency of theme AAD-12 gene.This type of possible change comprises the better substrate of generation and better leaving group (higher electronegativity).Auxin transport inhibitor (such as diflufenzopyr) also can be used for the herbicidal activity of increase by 2,4-D.

Unless specifically stated otherwise or hint, term as used in this article " ", " one " and " being somebody's turn to do " expression " at least one/kind ".Its full content is incorporated to by carrying stating by all patents mentioned herein or quote, patent application, provisional application and publication, is limited not conflict mutually with the clearly instruction of this specification.

Below for illustrating for implementing embodiments of the invention.These embodiments should not be construed as restrictive.Except as otherwise noted, all by weight, all solvent mixture proportions by volume for all percentage.

Embodiment

Embodiment 1

The method of the gene to 2,4-D resistance is given in qualification in plant

There is as qualification the method for the gene of herbicide degradation activity in plant, existing public database may be excavated as NCBI (NCBI).In order to start this process, first must have and being accredited as the functioning gene sequence that coding has the protein of desired character (i.e. α-ketoglutaric acid dioxygenase activity).Then this protein sequence is used as the input of BLAST (basic Local Alignment Search Tool) (Altschul, 1997) algorithm, available is compared at storehouse NCBI protein sequence.Use default setting, search for the homologous protein sequence returned more than 100 varying levels specifically.They on amino acid levels from high homogeneity (85%-98%) to extremely low homogeneity (23%-32%) not etc.Traditionally, the sequence only with high autoploidy can be expected and retained the characteristic similar to list entries.In this case, the sequence with the autoploidy being more than or equal to 50% is only selected.As example herein, utilize clone and the recombinant expressed homologue being low to moderate 31% conservation of amino acids (tfdA relative to from Ralstonia eutropha), not only can to the weed killer herbicide of expection, to the resistance previously never also can giving level of industry with the substrate that these enzymes were tested.

Identify from ncbi database and only have the term single gene of 31% amino acid identities (sdpA) (consulting ncbi.nlm.nih.gov network address, accession number AF516752) with tfdA.First sdpA and the tfdADNA sequence of preserving in database is all translated into protein, then use the ClustalW in VectorNTI software kit to carry out Multiple sequence alignments, determine homogeneity percentage.

Embodiment 2

For the sequence optimisation expressed in plant and bacterium

In order to obtain the high level expression of heterologous gene in plant, the protein coding sequence again transforming these genes may be desirable to make it more effectively express in plant cell.Corn is exactly a kind of such plant, and it may be preferred for before conversion, redesigning heterologous gene to improve the expression of heterologous gene in this plant.Therefore, in the design of the gene of encoding bacterial protein, an additional step is exactly again transform heterologous gene so that optimal expression.

^athe number of each genoid provides in bracket.

^bstandard deviation provides in bracket.

^cpacketing average value (combinedgroupsmean) is have ignored in mean value calculation.

Again the reason transforming bacterioprotein when expressing in corn is the G+C content non-optimal of natural gene.Such as, the G+C content of many Native bacterial genes is extremely low (therefore A+T content is higher), causes the sequence that produces and known altitude to be rich in the plant control sequence of A+T similar or overlap.The aberrant transcription that some sequences being rich in A+T (such as generally seeing the TATA frame district in gene promoter) may cause gene is there is in the DNA of the gene in introduced plant.On the other hand, in the mRNA transcribed out other regulate sequences (as polyadenylation signal sequence (AAUAAA) or with the sequence of small nuclear RNA complementation relating to premessenger RNA montage) existence may cause the lability of RNA.Therefore, being designed for one of object of the gene (being more preferably called plant optimized gene) of the encoding bacterial protein that corn is expressed, is produce the DNA sequence dna with comparatively G+C rich (preferably close with the corn gene of encoding metabolic enzyme G+C content).Another object of the plant optimized gene of design encoding bacterial protein produces such DNA sequence dna, and wherein sequence modification does not hinder translation.

How high the G+C content that table 2 illustrates in corn have.For the data in table 2, GenBank (the 71st issues version (Release)) entry is come from the code area of gene, and uses MacVector ^tMprogram (Accelerys, SanDiego, Calif.) calculates base composition.Intron sequences is have ignored in calculating.

Due to the plasticity provided by the redundancy/degeneracy (that is, some amino acid are specified by more than one codon) of genetic code, the genomic evolution in different biology or category has caused the usage variance of redundant codon.This " codon preference " is reflected in the average base composition of protein coding region.Such as, the relatively low biology of G+C content is used in the codon in redundant codon the 3rd with A or T, and the biology that G+C content is higher is then used in the codon in the 3rd with G or C.It is believed that " rare " codon existed in mRNA may reduce the absolute translation speed of this mRNA, particularly when the relative abundance of the load tRNA corresponding with this rare codon is lower.Can know by inference thus, for multiple rare codon, single rare codon may be at least additivity to the minimizing of translation speed.Therefore, the translation speed with the mRNA of the rare codon of high relative amount can corresponding reduction.This speed by so that be reflected as the low-level of coded protein.

When being designed for the gene of the encoding bacterial protein that corn (or other plant, as cotton or soybean) is expressed, determine the codon preference of this plant.To be this plant distribute for the statistics codon of its protein of encoding for the codon preference of corn, and preferred codon usage display in table 3.After determining preference, determine the percentage frequency of codon in gene of interest.When there are multiple choices, second, third and the 4th selection of the preferred primary codons of plant and preferred codon should be determined.Then new DNA sequence dna can be designed, the amino acid sequence of this new DNA sequence encoding bacterioprotein, but codon carrys out the amino acid of each position in regulation protein amino acid sequence, thus different from natural bacteria DNA sequence dna (this protein of encoding) to use plant (first preferably, second preferably, the 3rd preferably or the 4th preferred) instead.Then analyzing may by modifying the restriction enzyme site produced in new sequence.For the site identified, by codon is replaced with first, second, third or the 4th select preferred codon come to be modified further.Other sites of transcribing or translating that can affect interested gene are in the sequence: exon: intron abutment (5 ' or 3 '), poly A add signal or RNA polymerase termination signal.Further analysis and modification sequence, to reduce the frequency of TA or GC doublet.Except doublet, having G or the C sequence block (block) exceeding about four identical residue can affect transcribing of sequence equally.Therefore, also by selecting to replace to the modes such as time preferred codon selection of one-level by first of codon or second, these blocks are modified.

Preferably, the plant optimized gene of encoding bacterial protein containing have an appointment 63% first select codon, about 22% to about 37% the second the 3rd or the 4th selection codon selecting codon and about 15% to about 0%, wherein percent of total is 100%.Most preferably, plant optimized gene containing have an appointment 63% first select codon, at least about 22% second select codon, about 7.5% the 3rd select codon and about 7.5% the 4th select codon, wherein percent of total is 100%.Said method enables those skilled in the art modify gene external with regard to specified plant, thus makes gene Optimal Expression in plant.This method is further specified in PCT application WO97/13402.

In order to design the plant optimized gene of encoding bacterial protein, use the codon preference table of compiling from the gene order of a specific Plants or various plants to set up redundant genetic code, design the DNA sequence dna of the amino acid sequence of code for said proteins with this redundant genetic code.The DNA sequence dna of gained has the codon diversity of higher degree, desirable base composition, strategically can arrange restriction enzyme recognition site wherein, and containing likely interference base because transcribing or the sequence of product mRNA translation.Thus, the synthetic gene being functionally equal to the protein/gene of this theme invention can be used for transforming the host comprising plant.More guidances that relevant synthetic gene produces are found in, such as, and U.S. Patent number 5,380,831.

AAD-12 plant is rebuild and analyzes: show the large scale analysis of 876 base-pairs (bp) (SEQIDNO:1) of the DNA sequence dna of natural A AD-12 code area, have some sequence motifs to be considered to unfavorable to plants with optimal expression, and codon composition is not optimum.The protein of being encoded by SEQIDNO:1 (AAD-12) is rendered as SEQIDNO:2.For improving the generation of recombinant protein in unifacial leaf and dicotyledon, create " plant optimization " DNA sequence dna AAD-12 (v1) (SEQIDNO:3) of coded protein (SEQIDNO:4), except adding except alanine residue at second (underlining in SEQIDNO:4), it is identical with natural SEQIDNO:2.This extra alanine codon (GCT; Underline in SEQIDNO:3) encode one and cross over a part for the NcoI restriction enzyme enzyme recognition site (CCATGG) of ATG translation initiation codon.Therefore it serves dual purpose: the clone operations that easyization is follow-up, improves sequence background around ATG initiation codon to optimize translation initiation simultaneously.Identical with the protein 99.3% of the coding region encodes being optimized (v1) by plant by the protein of natural coding region encodes, only No. 2 amino acid differences.On the contrary, the DNA sequence dna of DNA sequence dna and (v1) code area that plant is optimized of natural code area is only 79.7% identical.

Table 4 shows the molecular difference of password of native sequences (A and D hurdle) and plant optimization (B and E hurdle), and allows and to compare with theoretical plant optimization (C and F hurdle).

Investigation table 4 is clearly visible, and the almost identical protein although encode in natural code area and plant Optimized Coding Based district, they differ widely each other.Plant is optimized form (v1) and forms closely approximate with the codon in the theoretical plant Optimized Coding Based district of coding AAD-12 albumen.

The reconstruction of Bacillus coli expression: the coli strain of special transformation and associated carrier system are often for generation of the relatively large protein for biochemistry and analysis and research.Sometimes find that the natural gene of encoding desired proteins matter is not too suitable for high level expression in Escherichia coli, belong to even if the source organism of gene can be another kind of bacterium.Under such a condition, the protein coding region of modifying gene makes it be more suitable at expression in escherichia coli is again possible, and is expect.Escherichia coli II genoid is defined as height during the exponential phase of growth of Bacillus coli cells and the gene of expressing continuously.(Henaut, A. and Danchin, A. (1996) include in EscherichiacoliandSalmonellatyphimuriumcellularandmolecu larbiology, the 2nd volume, 2047-2066 page; Neidhardt, F., CurtissIII, R., Ingraham, J., Lin, E., Low, B., Magasanik, B., Reznikoff, W., Riley, M., Schaechter, M. and Umbarger, H. (editor) AmericanSocietyforMicrobiology, Washington, D.C.).By checking the codon composition of the code area of Escherichia coli II genoid, the average codon composition of these Escherichia coli II genoid code areas can be designed.

Someone thinks, the molecular protein coding region of average password, Simulation with I I genoid code area is preferred for the expression during colibacillary exponential phase of growth.Utilize these to instruct, devise the new DNA sequence dna of coding AAD-12 albumen (SEQIDNO:4) according to the average codon composition of Escherichia coli II genoid code area, it comprises the extra alanine at second place as above.To initial sequence, its design only based on codon composition, is transformed further, makes it comprise to be suitable for some restriction endonuclease recognition sequence of cloning in coli expression carrier.Avoid the sequence signature be harmful to, such as high stability loop-stem structure, avoid and sequence in the gene of the 3' terminal homologous of 16S rRNA (Le.ShineDalgarno sequence) simultaneously.This Escherichia coli optimization (v2) is disclosed in SEQIDNO:5, and the protein of coding is open in SEQIDNO:4.

Natural DNA sequence and the DNA sequence dna that Escherichia coli are optimized (v2) have 84.0% identical, and the DNA sequence dna (v1) that plant is optimized and the DNA sequence dna (v2) that Escherichia coli are optimized have 76.0% identical.Table 5 present natural A AD-12 code area (A and D hurdle), in Escherichia coli expression optimize AAD-12 code area (v2; B and E hurdle) codon composition and a kind of have Escherichia coli II genoid optimize password molecular AAD-12 albumen theoretical code district codon composition (C and F hurdle).

Investigation table 6 is clearly visible, and the almost identical protein although encode in natural code area and Escherichia coli Optimized Coding Based district, they differ widely each other.Escherichia coli are optimized form (v2) and form closely similar with the codon in the theoretical Escherichia coli Optimized Coding Based district of coding AAD-12 albumen.

There is the design of DNA sequence dna of saltant type soy bean EPSPS of soybean codon preference, coding conferring glyphosate tolerance.The present embodiment instructs the design of new DNA sequence dna, soybean 5-enolpyrul-shikimate acid-3-phosphate synthase (EPSPS) of this sequential coding sudden change, but this sequence is the expression process optimization in soya cells.The SEQIDNO:5 of WO2004/009761 discloses a kind of amino acid sequence with the soy bean EPSPS of triple mutant.The amino acid suddenlyd change in sequence disclosed in it is: residue 183 (replacing the threonine of native protein with isoleucine), residue 186 (replacing the arginine of native protein with lysine) and residue 187 (replacing the proline of native protein with serine).Therefore, can by position deriving the amino acid sequence of crude soya bean EPSPS albumen with the substituted amino acid in the SEQIDNO:5 of natural amino acid replacement WO2004/009761.The SEQIDNO:20 of PCT/US2005/014737 (submission on May 2nd, 2005) discloses such native protein sequence.The SEQIDNO:21 of PCT/US2005/014737 discloses a kind of soy bean EPSPS protein sequence of two sudden change, and it contains the sudden change at residue 183 (replacing the threonine in native protein with isoleucine) and residue 187 (replacing the proline in native protein with serine) place.

A kind of codon usage table for soybean (Glycinemax) protein coding sequence is obtained from Website " kazusa.or.jp/codon ", it is from 362, calculates in 096 codon (about 870 coded sequences).As shown in table 6 these data to be reformatted.D and the H hurdle of table 6 presents the distribution (to account for the percentages that this amino acid whose whole codon uses) of the synonym of the every seed amino acid found in the protein coding region of soybean gene.Obviously, in soybean protein code area, some some synonym amino acid whose (seed amino acid can be specified by 1,2,3,4 or 6 kind of codon) there is relative rarity (such as, comparing the use of GCG and the GCT codon of regulation alanine).

Data from table 6 calculate the soybean codon use table of preference.Ignore the codon that the number of times occurred in soybean gene is less than about 10% of corresponding amino acid whose total occurrence number.In order to balance the distribution that a certain all the other codons amino acid whose are selected, use following formula for often kind of codon calculating weighted mean expressivity (WeightedAveragerepresentation):

Weighted percentage=1/ (%C1+%C2+%C3+ etc.) x%C1x100 of C1

Wherein Cl is discussed codon, and C2, C3, other represent remaining synonym, and the percent value of corresponding codons takes from D and the H hurdle of table 6 (ignoring the value of bold-faced rare codon).

The weighted percentage value of often kind of codon provides on C and the G hurdle of table 6.Any selection TGA is as translation termination.Then the input of preferred codons frequency of utilization is supplied OptGene ^tMthe special genetic codon table that gene is designed program (OcimumBiosolutionsLLC, Indianapolis, Ind.).

In order to the soybean obtaining coding two sudden change EPSPS protein optimizes DNA sequence dna, the soybean preference genetic code as above obtained is used to pass through OptGene ^tMprogram is by the protein sequence reverse translation of the SEQIDNO:21 from PCT/US2005/014737.Then modify by compensating codon change (keeping the overall weighted mean expressivity of codon) simultaneously the initial DNA sequence dna obtained like this, reducing CG and TA doublet number between adjacent codon, increase CT and TG doublet number between adjacent codon, remove secondary structure in high stability chain, removal or add Restriction Enzyme recognition site and remove other and can be detrimental to the expression of transformed gene or the sequence of clone operations.Further intense adjustment sequence, with eliminate potential plant introne splice site, the long section of A/T or C/G residue and other may disturb rna stability in plant cell, transcribe or the motif of code area translation.Implement other changes and eliminate long inner open reading frame (frame except+1).All these changes are all made under following constraint: keep the codon of above-mentioned soybean preference composition, retain amino acid sequence disclosed in the SEQIDNO:21 of PCT/US2005/014737 simultaneously.

The base 1-1575 of the SEQIDNO:22 of PCT/US2005/014737 discloses the soybean preference DNA sequence dna of the EPSPS albumen of coding SEQIDNO:21 openly.The synthesis of the DNA fragmentation of the SEQIDN0:22 containing PCT/US2005/014737 has been carried out by commercial supplier (PicoScript, HoustonTex.).

Embodiment 3

The clone of expression and conversion carrier

The structure of Escherichia coli, pET expression vector: the corresponding restricted ligase (Xba1 using the site of adding with additional cloning adapters, Xho1), AAD-12 (v2) is cut out from Picoscript carrier, is then connected to pET280 streptomycin/spectinomycin resistant carrier.Then will connect product conversion in TOP10F' Escherichia coli, be plated on Luria meat soup+50 μ g/ml streptomycin and spectinomycin (LBS/S) agar plate.

Being connected with pCR2.1:pET280 to distinguish AAD-12 (v2): pET280 connection, selecting roughly 20 bacterium colonies be separated, being placed in the LB-S/S of 6ml, under agitation cultivating 4 hours for 37 DEG C.Then by each culture dibbling on LB+ kanamycin 50 μ g/ml flat board, be incubated overnight at 37 DEG C.The bacterium colony that LB-K grows is considered as being connected with pCR2.1 carrier, they is abandoned.As previously mentioned from all the other culture separation quality grains, check correctness by XbaI/XhoI digestion.Final expression construct called after pDAB3222.

The structure of pseudomonad expression vector: be cloned in pET expression vector (Novagen) " pET280S/S " of modification by AAD-12 (v2) open reading frame at first, it is XbaI-XhoI fragment.The plasmid pDAB725 obtained is confirmed with digestion with restriction enzyme and sequencing reaction.AAD-12 (v2) open reading frame from pDAB725 is transferred in pseudomonad expression vector pMYC1803 with the form of XbaI-XhoI fragment.Positive bacterium colony is confirmed by digestion with restriction enzyme.The construct pDAB739 completed is transformed in MB217 and MB324 pseudomonad expression strain.

Completing of binary vector: from Picoscript obtain plant optimize Gene A AD-12 (v1) (gene Reconstruction Design completes (seeing above), be contracted out to Picoscript to build) and validates itself sequence (SEQIDNO:3), to confirm there is not change in the sequence of expecting.Use foregoing BeckmanCoulter " DyeTerminatorCycleSequencingwithQuickStartKit " reagent, carry out sequencing reaction with M13 forward (SEQIDNO:6) and reverse (SEQIDNO:7) primer of M13.Analytical sequence data, result shows to there is not exception in AAD-12 (v1) DNA sequence dna optimized plant.AAD-12 (v1) gene is cloned in pDAB726 with the form of NcoI-SacI fragment.The construct called after pDAB723 obtained, it contains: [AtUbi10 promotor: NtOSM5'UTR:AAD-12 (v1): NtOSM3'UTR:ORF1polyA3'UTR] (by PvuII and NotI restriction enzyme digestion digestion checking).Then, the NotI-NotI fragment clone containing described box is entered the NotI site of binary vector pDAB3038.By the binary vector pDAB724 obtained, it contains following box [AtUbi10 promotor: NtOSM5'UTR:AAD-12 (v1): NtOSM3'UTR:ORF1polyA3'UTR:CsVMV promotor: PAT:ORF25/263'UTR], carry out restrictive diges-tion (with BamHI, NcoI, NotI, SacI and XmnI), to verify correct orientation.With authenticated construct (pDAB724) transform Agrobacterium completed.

The clone of other transformation construct: use method similar as above and other standards molecular cloning method to establish the every other construct (Maniatis etc., 1982) for being transformed in suitable plant species.

Embodiment 4

To be transformed in arabidopsis and to select

Arabidopsis growth conditions: by wildtype Arabidopsis thaliana seed suspension in 0.1% agarose (SigmaChemicalCo., St.Louis, Mo.) solution.The seed of suspension is preserved 2 days to complete the needs of dormancy and to ensure that seed is synchronously sprouted (layering) at 4 DEG C.

With thin vermiculite covering SunshineMixLP5 (SunGroHorticulture, Bellevue, Wash.) and with HoaglandShi solution from subsurface irrigation to moistening.Make soil mixture draining 24 hours.By lamination planting seed on vermiculite, and cover 7 days with moisturizing cover (KORDProducts, Bramalea, Ontario, Canada).

In Conviron (model C MP4030 and CMP3244, ControlledEnvironmentsLimited, Winnipeg, Manitoba, Canada) under long condition in daytime day (16 h light/8 h dark) with 120-150 μm of ol/m ²second, luminous intensity made seed germination and plant growth under stationary temperature (22 DEG C) and humidity (40-50%).Plant is first watered with HoaglandShi solution, keeps soil wetting subsequently but do not drench by deionized water.

Agrobacterium transformation: with one piece of DH5 α bacterium colony with line containing erythromycin (SigmaChemicalCo., St.Louis, Mo.) the LB+ agar plate of (200mg/L) or spectinomycin (lOOmg/L) provides bacterium colony, prepares culture (liquid LB+ erythromycin) in a small amount in order to inoculate 4ml.Culture is incubated overnight under 37 DEG C of constant concussions.Qiagen (Valencia, Calif.) SpinMiniPreps is used to carry out plasmid DNA purification according to the explanation of manufacturer.

The scheme of Weigel and Glazebrook (2002) is used to prepare Agrobacterium tumefaciens (bacterial strain Z707s, EHA101s and LBA4404s) cell of Electrocompetent.Use the electroporation method transformed competence colibacillus agrobacterium cell revised from Weigel and Glazebrook (2002).At thawed on ice 50 μ l competence agrobacterium cell, and in cell, add the plasmid of 10-25ng expectation.DNA and cell mixture are added in the electroporation cup (2mm) of precooling.Eppendorf electroporation apparatus 2510 is used to transform by following condition: voltage: 2.4kV, pulse length: 5 milliseconds.

After electroporation, in cup, add 1mlYEP culture fluid (often liter: 10g yeast extract, 10g bacto peptone, 5gNaCl) and cell-YEP suspension is transferred in 15ml culture tube.By cell lower 28 DEG C of incubations of constant concussion 4 hours in a water bath.After incubation, by culture bed board on the YEP+ agar containing erythromycin (200mg/L) or spectinomycin (100mg/L) and streptomycin (SigmaChemicalCo., St.Louis, Mo.) (250mg/L).At 28 DEG C of Incubate plates 2-4 days.

Choose bacterium colony and streak inoculation to containing on the fresh YEP+ agar plate of erythromycin (200mg/L) or spectinomycin (100mg/L) and streptomycin (250mg/L), at 28 DEG C of incubation 1-3 days.Choosing bacterium colony, carrying out pcr analysis, to verify the existence of gene insert by using vector-specific primers.Use QiagenSpinMiniPreps from the Abrobacterium colonies plasmid DNA purification chosen according to the explanation of manufacturer, difference is: 15ml is spent the night prepare in a small amount culture (liquid YEP+ erythromycin (200mg/L) or spectinomycin (100mg/L) and streptomycin (250mg/L)) 4ml equal portions for DNA purifying.Use the replacement scheme of QiagenSpinMiniPrepDNA to be the agrobacterium cell that cracking transforms, to be suspended in 10 μ l water 5 minutes at 100 DEG C.Experiment comprise from the binary vector used in Agrobacterium transformation plasmid DNA in contrast.The Taq DNA polymerase of TakaraMirusBioInc. (Madison, Wis.) is used to complete PCR reaction with the concentration of 0.5x according to the explanation of manufacturer.In MJResearchPeltier thermal cycler, carry out PCR reaction by following condition setup program: 1) 94 DEG C 3 minutes, 2) 94 DEG C 45 seconds, 3) 55 DEG C 30 seconds, 4) 72 DEG C 1 minute, totally 29 circulations, then 72 DEG C of circulations in 10 minutes.After circulation, reaction is remained on 4 DEG C.Analysing amplified and dyeed visual by Ethidum Eremide by 1% agarose gel electrophoresis.Have selected the bacterium colony that PCR primer is identical with plasmid control.

Transformation of Arabidopsis thaliana: use inflorescence infusion process arabidopsis thaliana transformation.The pre-culture of the YEP meat soup of erythromycin (200mg/L) or spectinomycin (100mg/L) and streptomycin (250mg/L) is contained with the one or more 15-30ml of the colony inoculation chosen.With 220rpm, culture is incubated overnight under 28 DEG C of constant concussions.Each pre-culture is for inoculating the culture containing the YEP meat soup of erythromycin (200mg/L) or spectinomycin (100mg/L) and streptomycin (250mg/L) of two 500ml and being incubated overnight under 28 DEG C of constant concussions by culture.Then at room temperature with about 8700xg centrifugal 10 minutes sedimentation cells, gained supernatant is discarded.Cell precipitation is resuspended in gently in 500ml infiltration medium, described infiltration medium contains: the SilwetL-77 that 1/2xMurashige and Skoog salt/Gamborg'sB5 vitamin, 10% (w/v) sucrose, 0.044 μM of benayl aminopurine (liquid storage in the DMSO of 1mg/ml, 10 μ l/ liters) and 300 μ l/ rise.The plant at about 1 monthly age to be immersed in medium 15 seconds, guarantee up-to-date inflorescence submergence.Then, plant side direction fallen and covered (transparent or opaque) 24 hours, and then washing with water, more uprightly place.22 DEG C with 16 little time/8 hours dark photoperiods cultivate plant.About 4 weeks after immersion, results seed.

The selection of conversion of plant: by the T1 seed [AAD-12 (v1) gene] newly gathered in the crops at room temperature dry 7 days.T1 planting seed to be germinateed pallet (T.O.PlasticsInc. at 26.5x51-cm, Clearwater, Minn.) in, often the lamination T1 seed (about 10 of 200mg equal portions put into by dish, 000 seed), it had previously been suspended in 40mL0.1% agarose solution, and preserved 2 days at 4 DEG C, to complete dormancy requirement and to guarantee that seed is synchronously sprouted.

SunshineMixLP5 (SunGroHorticultureInc., Bellevue, Wash.) is covered with thin vermiculite, and with Hoagland solution from subsurface irrigation to moistening, then passes through gravity drainage.Evenly sow on vermiculite with the lamination seed of pipettor by each 40ml equal portions, and cover 4-5 days with moisturizing cover (KORProducts, Bramalea, Ontario, Canada).Removing moisturizing cover, after 1 day, utilizes phosphine oxamate post-emergence spraying to carry out initial conversion body screening (pat gene of screening cotransformation).

After planting when 7 days (DAP) and 11DAP, use DeVilbiss compressed-air atomizer with 0.2% the Liberty herbicide solution (phosphine oxamate of 200g active component/L, BayerCropSciences, KansasCity, Mo.) spray T1 plant (respectively in cotyledon and 2-4 leaf phase) with the sprinkling volume of 10ml/ dish (703L/ha), use at every turn and send the efficient phosphine oxamate for 280g active component/ha.Spray the last time and within 4-7 days, identify survivor (plant of active growth) afterwards, and be transplanted to and have in 3 inches of basins of potting media (MetroMix360).Cover introduced plants 3-4 days with moisturizing cover, as be prepended to 22 DEG C growth room in or directly move on in greenhouse.Remove lid subsequently, and plant was cultivated (22 ± 5 DEG C in greenhouse at least 1 day before test AAD-12 (v1) (plant optimized gene) provides the ability of phenoxy auxin herbicide resistance, 50 ± 30%RH, 14 h light: 10 h dark, at least 500 μ E/m ²s ¹natural+to supplement light).

Then the different ratio of T1 plant Random assignment 2,4-D.For arabidopsis, 2,4-D of 50gae/ha is the effective dose of the plant of the resistance distinguished sensitive plant and have meaning level.Also application of higher ratio, for determining relevant antagonism level (50,200,800 or 3200gae/ha).

All growth hormone weed killer herbicides are all used as above-mentioned use DeVilbiss sprayer, the sprinkling volume 703L/ha (0.4ml solution/3 inch basin) used; Or used with the sprinkling volume of 187L/ha by crawler type sprayer.Use 2,4-D for being dissolved in DMSO and being diluted in technical grade (Sigma, the St.Louis of (<1%DMSO final concentration) in water, or commercial dimethylamine salt preparation (456gae/L Mo.), NuFarm, StJoseph, Mo.).2, the 4-Dichlorophenoxy propionic acid (Dichlorprop) used are bussiness class, are formulated as R-2, the sylvite (600gai/L, AHMarks) of 4-Dichlorophenoxy propionic acid.Along with herbicide rates is increased to exceed 800gae/ha, the pH of spray solution becomes extreme acidic, the leaf of immature arabidopsis thaliana of burning, and the assessment disturbing that the head of weed killer herbicide is imitated.The weed killer herbicide using these height ratios in 200mMHEPES buffer solution (pH7.5) becomes conventional practice.

Other commercial herbicides are used to replace phenoxy auxin to some T1 individualities.A point of interest determines whether pyridine fluoroacetic acid growth hormone weed killer herbicide Triclopyr and fluroxypyr can effectively be degraded in plant.Crawler type sprayer is used to spray volume by herbicide application in T1 plant with 187L/ha.Make to show and T2 is extended to from generation to generation to the T1 plant of 2,4-DDMA tolerance.

The selection result of conversion of plant: carry out first time transformation of Arabidopsis thaliana with AAD-12 (v1) (plant optimized gene).First choose in the background of unconverted for T1 transformant seed with phosphine oxamate screening scheme.Screen more than 300,000 T1 seed, identified 316 phosphine oxamate resistance plants (pat gene), this conversion/selection frequency equaling 0.10%, the normal selection frequency range of construct when belonging to PAT+Liberty for selecting.Subsequently by the T1 plant transplantation selected above in independent basin, and with the commercial aryloxy alkanoic acid herbicide spray of different ratio.

Table 7 compares AAD-12 (v1) and crt gene gives the response of 2,4-D resistance to arabidopsis T1 transformant.Plant responding is estimated damage with the % of 2WAT and is represented.Response shows as the histogram of display not damaged or the almost individuality of not damaged (<20%), moderate lesion (20-40%) or major injury (>40%).Because every strain Tl is independently transformation event, it is expected to often kind and have significant variation to the individual Tl response in fixed-ratio.Provide arithmetic mean of instantaneous value and the standard deviation of each process.Also in the end designate the scope of the individual response for each ratio and conversion in a hurdle.The arabidopsis transformed with PAT/CrylF is as growth hormone responsive type untransformed controls.AAD-12 (v1) gene gives individual T1 arabidopsis thaliana Herbicid resistant.In often kind of given process, plant responding level alters a great deal, and is attributable to the fact that every strain plant presents separate transformation events.

Importantly, under tested each 2,4-D ratios, have some individualities uninfluenced, and some individualities are had a strong impact on.Table 7 provide by other total group of ratio damage mean value be directly presented at transform with AAD-12 (v1) there is significant difference between plant and wild type or PAT/Cry1F untransformed controls.At height ratio, until 3,200gae/ha (or about 6x field rates), level of damage is tended to larger, and the frequency not damaging plant is lower.Equally, at these ratios, if do not carry out cushioning, spray solution can become highly acidic.The main arabidopsis cuticula cultivated in growth room is very thin, and serious casualty effect can disturb the test under these height ratios.However, many individualities not damaged or almost survive with no damage under 2,4-D of 3,200gae/ha.

Table 8 shows the T1 arabidopsis that carries out in a similar manner to phenoxy propionic acid---the dose response of 2,4-Dichlorophenoxy propionic acid.Data show that activity of weeding (R-) isomer of 2,4-Dichlorophenoxy propionic acid can not be used as the applicable substrate of AAD-12 (v1).AAD-1 then metabolism R-2,4-Dichlorophenoxy propionic acid thus be enough to acceptable tolerance in imparting industry well, this is the distinguishing characteristics (table 8) distinguishing these two kinds of genes.AAD-1 and AAD-12 is regarded as R-and S-specificity α-ketoglutaric acid dioxygenase respectively.

AAD-12 (v1) is as selection marker thing: use the arabidopsis initial analysis transformed as mentioned above to utilize 2,4-D as selective agent, use AAD-12 (v1) as the ability of selection marker thing.About 50 T4 are incorporated into about 5 for arabidopsis seed (isozygotying for AAD-12 (v1)), in 000 wild type (responsive type) seed.Compare several process, often coil plant and accept 2,4-D using once or twice of one of following processing scheme: 11DAP after 7DAP, 11DAP or 7DAP.Because all individualities also contain pat gene in same conversion carrier, the AAD-12 therefore using 2,4-D to select can directly Yu with the PAT that phosphine oxamate is selected compare.

Process with foregoing DeVilbiss nozzle.Be resistance or susceptibility by plant identification during 17DAP.Optimization process is: 7 days and 11 days (DAP) use 2,4-D of 75gae/ha after planting, and it is effectively same in selection frequency, and individual produces less weeding damage compared to Liberty selection scheme to transforming.These results show, AAD-12 (v1) can be used as the alternative mark of the arabidopsis colony through transforming effectively.

Hereditability: make multiple T1 event self-pollination produce T2 seed.As described below filial generation test is carried out to these seeds: use 2,4-D (200gae/ha) to the T2 compatriot that 100 strains are random.By each independent T2 plant transplantation in 7.5-cm side's basin, then spray and use (use crawler type sprayer, use ratio 187L/ha).As determined by chi-square analysis (P>0.05), the T1 family (T2 plant) more than 75% is with 3 resistances of the Mendelian inheritance single locus dominant inheritance of expecting: 1 sensitive mode is separated.

Seed (T3 seed) is collected from 12 to 20 T2 individualities.As aforementioned, filial generation test is carried out to 25 T3 compatriot of each family in the T2 family of 8 Stochastic choice.Identify in each strain about 1/3rd be contemplated to the T2 family (non-segregation population) of isozygotying.These data display AAD-12 (v1) stable integration, and with Mendelian fashion heredity at least 3 generation.

Extra foliage applying Herbicid resistant in AAD-12 arabidopsis: determine that AAD-12 (v1) provides the ability of the resistance to other aryloxy alkanoic acid growth hormone weed killer herbicides in transgenic arabidopsis by the substrate that foliage applying is different.By T2 for arabidopsis kind sublayering, sow on the selective pan very similar to arabidopsis.The untransformed controls system of plantation containing PAT and insect-resistance gene CrylF in a similar fashion.Seedling is transferred in 3 inches of basins independent in greenhouse.All plants crawler type sprayer sprays with 187L/ha.Pyridine fluoroacetic acid class herbicide spray plant with following: the Triclopyr (Garlon3A, DowAgroSciences) of 280-2240gae/ha and the fluroxypyr (Starane, DowAgroSciences) of 280-2240gae/ha; And cause 2,4-D metabolites 2,4-chlorophenesic acid (DCP, Sigma) of generation (using 2,4-D, technical grade DCP of molar equivalent 280-2240gae/ha) by AAD-12 activity.All application are all prepared in water.Each process repeats 3-4 time.Plant was assessed in 3 and 14 days after treatment.

2,4-D metabolite 2,4-chlorophenesic acid (DCP) contrasts arabidopsis (Pat/Cry1F) not effect to the non-AAD-12 of transgenosis.AAD-12 conversion of plant is protected equally significantly and is avoided the damage of Triclopyr and fluroxypyr weed killer herbicide, and this damage is found in the non-resistance contrast of conversion and (consults table 9).These results confirm, the AAD-12 (v1) in arabidopsis provides the resistance to tested pyridine fluoroacetic acid growth hormone.This is that reported first has the enzyme of remarkable activity to pyridine fluoroacetic acid class weed killer herbicide.Still do not report other 2,4-D digestive enzymes with shares activity.

The analysis of molecules of AAD-12 (v1) arabidopsis: utilize the STb gene obtained from QiagenDNeasy kit, InvaderAssay (" invader mensuration ") (method of ThirdWaveAgbioKitProcedures) is implemented to multiple AAD-12 (v1) homozygous line and analyzes pat gene copy number, to determine the stable integration of the Plant Transformation unit containing PAT and AAD-12 (v1).Because these genes are contained on same plasmid, therefore this analysis supposes that they are that direct physical is chain.

Result shows, and 2,4-D resistance plants of all tests all contain PAT (thus inferring also containing AAD-12 (v1)).The scope that copy number analysis shows total Insert Fragment is from 1 to 5 copies.This also with AAD-12 (v1) protein expression data correlation, show that the existence of this enzyme creates the remarkable high-caliber resistance to all commercially available phenoxy acetic acids and pyridine fluoroacetic acid.

The arabidopsis transformed is superposed: the T1 arabidopsis seed containing the pDAB3759 plasmid (AAD-12 (v1)+EPSPS) of the glyphosate resistance proterties of encode putative as aforementioned generation with the molecule of AAD-12 (v1) and Glyphosate resistance gene.As described in use AAD-12 (v1) to select T1 transformant as selection marker thing.Trial is selected to reclaim T1 plant (independent transformation event) and as in the aforementioned 3 inches of basins transferred to greenhouse from first time.Be also tested for three different contrast Arabidopsis lines: wild type Columbia-0, AAD-12 (v1)+PATT4 homozygous line (having transformed pDAB721) and PAT+CrylF homozygous line (untransformed controls).In seedling stage to pDAB3759 conversion of plant and pDAB724 conversion of plant prescreen 2,4-D tolerance.After transplanting 4 days, plant is divided equally, with 0 in water, 26.25,105,420 or 1680gae/ha glyphosate (GlyphomaxPlus, DowAgroSciences) carry out leaf surface treatment as aforementioned by crawler type sprayer.All process all repeat 5 to 20 times.Process 7 and 14 days later evaluation plants.

Initial resistance assessment shows, with the response ratio of three check clones comparatively, to the plant of 2,4-D tolerance subsequently also to glyphosate tolerance.These results show, can give the resistance of the weed killer herbicide two kinds to the different mode of action, comprise 2,4-D and glyphosate tolerant, thus allow these two kinds of weed killer herbicides of postemergence application to plant.In addition, AAD-12+2,4-D can be used as the selection marker thing that true resistance is selected effectively.

The AAD-12 arabidopsis superposed with AAD-1 heredity produces the herbicide tolerant of more wide spectrum: AAD-12 (v1) (pDAB724) and AAD-1 (v3) (pDAB721) plant is handed over mutually, collects F1 seed.Plant eight F1 seeds, make it grow generation seed.Obtain tissue sample from eight strain F1 plants, carry out Western and analyze the existence confirming these two kinds of genes.Conclusion is that all 8 strain plants of test all express AAD-1 and AAD-12 albumen.Collect seed and dry one week before the planting.

Sow 100 F2 seeds, use 280gai/ha phosphine oxamate.96 strain F2 plants are survival after phosphine oxamate is selected, and this conforms to the expection segregation ratio (15R:1S) of the phosphine oxamate resistant gene seat of two independent assortments.Then, with 560gae/haR-2,4-Dichlorophenoxy propionic acid+560gae/ha Triclopyr process phosphine oxamate resistance plant, the sprinkling scheme that plant is used as in other tests use identical.In 3 and 14DAT, plant is graded.63 strains are had to survive equally after herbicide application in 96 strain plants of survival after phosphine oxamate is selected.The dominant character of these data and two independent assortments (wherein often kind of gene only produces resistance to the one (in R-2,4-Dichlorophenoxy propionic acid or Triclopyr any one) in these growth hormone weed killer herbicides)) expection clastotype (9R:6S) consistent.Result shows, AAD-12 (pDAB724) successfully can superpose with AAD-1 (pDAB721), thus the weed killer herbicide spectrum that increase can be used for interested crop [is respectively (2,4-D+R-2,4-Dichlorophenoxy propionic acid) and (2,4-D+ fluroxypyr+Triclopyr)].This conventional stacking that can be used to 2, the 4-D resistant genes be separated by two kinds gives 2,4-D tolerance to highstrung species.In addition, if pass through independently conversion activities arbitrary gene to be used as the selection marker thing of interested third and fourth gene, then by conventional breeding activity, often pair of gene is flocked together, then by being sprayed at the pairing weed killer herbicide of mutual exclusion between AAD-1 and AAD-12 enzyme (as shown, R-2 is respectively for AAD-1 and AAD-12,4-Dichlorophenoxy propionic acid and Triclopyr) chosen from generation to generation at F1.

Other AAD superposition is also within this theme scope of invention.Such as, the TfdA albumen (Streber etc.) that elsewhere is discussed in this article can be used for conferring herbicide resistance in the genetically modified plants of inventing at this theme and compose together with theme AAD-12.

Embodiment 5

The corn transformation of the whisker mediation using Imazethapyr to select

The clone of AAD-12 (v1): cut out AAD-12 (v1) gene (form with NcoI/SacI fragment) from intermediate carrier pDAB3283.Its orientation is connected to similarly cut containing ZmUbi1 Monocotyledon promoter pDAB3403 carrier in.T4DNA ligase is used two fragments to be linked together and be transformed in DH5 α cell.Use the QIASpin Miniprep Kit of Qiagen to carry out a small amount of preparation to the bacterium colony obtained, digestion bacterium colony is to check orientation.This first middle construct (pDAB4100) is containing ZmUbi1:AAD-12 (v1) box.Digest this construct to discharge box gene with Not1 and Pvu1, and digest unwanted skeleton.Be connected to the pDAB2212 of Not1 cutting, the latter contains the AHAS selection marker thing driven by rice actin promoters OsAct1.Final construct called after pDAB4101 or pDAS1863, containing ZmUbi1/AAD-12 (v1)/ZmPer5::OsAct1/AHAS/LZmLip.

Callus/suspension is initial: in order to obtain the immature embryo for initial callus tissue culture, the hybridization between Hi-II parent A and B (Armstrong etc. 1991) carrying out Fl and hot-house culture.When embryo size is 1.0-1.2mm (after pollination about 9-10 days), results fringe, and by using soap clean, immerse 70% ethanol 2-3 minute, then immerse 20% commercial bleaching agent (0.1% clorox) within 30 minutes, carry out surface sterilization.

Fringe is washed in sterile distilled water, sterilely cut immature embryo and at 15Agl0 medium (N6 medium (Chu etc., 1975), 1.0mg/L2,4-D, 20g/L sucrose, 100mg/L casein hydrolysate (enzymic digestion thing), 25mML-proline, 10mg/LAgNO ₃, 2.5g/LGelrite, pH5.8) upper cultivate 2-3 week, wherein blastodisc is towards the direction deviating from medium.Correct form (Welter etc. optionally will be shown at interval of two weeks, 1995) tissue is transferred on fresh 15Agl0 medium, last 6 weeks, then 4 medium (N6 medium, 1.0mg/L2 was transferred to every two weeks, 4-D, 20g/L sucrose, 100mg/L casein hydrolysate (enzymic digestion), 6mML-proline, 2.5g/LGelrite, pH5.8), on, about 2 months are lasted.

In order to initial embryogenetic suspension is cultivated, the callus deriving from single embryo of about 3ml cell pack (PCV) is joined about 30mlH9CP+ liquid nutrient medium (MS basis salt mixture (Murashige and Skoog, 1962), the MS vitamin (containing less (1/10) nicotinic acid and Geng Duo (5 times) thiamines-HC1) of improvement, 2.0mg/L2, 4-D, 2.0mg/L α-naphthaleneacetic acid (NAA), 30g/L sucrose, 200mg/L casein hydrolysate (sour digest), 100mg/L inositol, 6mML-proline, 5% (volume/volume) coconut milk (adding before being about to carry out Secondary Culture), pH6.0) in.Under dark condition, with 28 DEG C, maintain in the 125ml conical flask of 125rpm on temperature control shaking table to suspend and cultivate.Cell-line is generally set up after initial for 2 to 3 months.In process of establishing, every Secondary Culture carrying out suspension for 3.5 days, method uses wide mouth suction pipe the cell of 3mlPCV and 7ml conditioned medium to be joined in the fresh H9CP+ liquid nutrient medium of 20ml.When tissue starts multiplication growth, suspension is expanded scale and maintains in 500ml bottle, the cell of 12mlPCV and the conditioned culture media of 28ml are transferred in 80mlH9CP+ medium.Suspension is frozen in order to using in the future by it after setting up completely.

Suspension frozen and melting: after Secondary Culture two days; the suspension cell of 4mlPCV and 4ml conditioned culture media are added 8ml cryoprotector (1M glycerine, 1MDMS0,2M sucrose; be dissolved in the H9CP+ medium without coconut milk; filtration sterilization) in, and shake 1 hour at 4 DEG C with 125rpm in 125ml bottle.After 1 hour, 4.5ml is added in the Corning cryopreservation tube of cold 5.0ml.After filling, each pipe is kept 15 minutes at 4 DEG C in the fast refrigerator of control, then with the speed of-0.5 DEG C/min, it is freezing, until reach the outlet temperature of-40 DEG C.After reaching outlet temperature, pipe is transferred in the box that is full of on Cryoplus4 memory cell (FormaScientific) the interior shelf of liquid nitrogen vapor.

During thawing, pipe taken out from memory cell and is placed in closed dry ice container, then dropping into and be held in the water-bath of 40-45 DEG C until " boiling " calms down.After thawing, content is poured on folded 8 aseptic 70mmWhatman filter paper (No. 4) in 100x25mm culture dish (adding a cover).Make a few minutes in liquid absorption to filter paper, then the top layer filter paper containing cell is transferred to upper 1 week of GN6 medium (N6 medium, 2.0mg/L2,4-D, 30g/L sucrose, 2.5g/LGelrite, pH5.8).After 1 week, only the tissue possessing promising form is directly transferred on fresh GN6 medium from filter paper.Every 7-14 days by this tissue Secondary Culture, until have 1-3 gram to be used in 125ml conical flask to carry out in about 30mlH9CP+ medium suspension initial.Within every 3.5 days, by 3mlPCV Secondary Culture in new H9CP+ medium, amount to 12mlPCV until obtain, now carry out Secondary Culture as aforementioned.

Stable conversion: transform precontract 24 hours, embryo's generation Corn suspension cells previously frozen for 12ml is added 28ml conditioned culture media Secondary Culture in the 80mlGN6 liquid nutrient medium (not containing the GN6 medium of Glerite) in 500ml conical flask, and be placed on the shaking table of 125rpm at 28 DEG C.Same cell-line is used to repeat 2 times, will altogether be assigned in 3 conical flasks by 36mlPCV.GN6 liquid nutrient medium is removed after 24 hours, the GN6S/M replacing with every bottle of 72ml is high oozes medium (N6 medium, 2.0mg/L2,4-D, 30g/L sucrose, 45.5g/L sorbierite, 45.5g/L mannitol, 100mg/L inositol, pH6.0), to make cell plasmolysis.At 28 DEG C, bottle is placed in 30-35 minute on shaking table in the dark, therebetween by the GN6S/M liquid nutrient medium of the 8.1ml by proper volume add about 405mg in advance autoclaved silicon carbide whisker (AdvancedCompositeMaterials, Inc.) coming prepare the silicon carbide whisker suspension of 50mg/ml.

In GN6S/M after incubation, the content of each bottle is pooled in a 250ml centrifugal bottle.When cell settlement is to bottom, sucking-off GN6S/M liquid to about 44ml more than only, and is collected in aseptic 1L bottle in order to using in the future.By the whisker suspension of pre-wetted with maximal rate vortex 60 seconds, then add in centrifugal bottle by 8.1ml, final step adds 170 μ gDNA wherein.Immediately centrifugal bottle be placed in the industrial paint mixer of RedDevil5400 of improvement and shake 10 seconds.After concussion, add comprising together with cell, medium, the whisker GN6 liquid nutrient medium fresh with 125ml with the mixture of DNA in the content of 1-L bottle to reduce bleeding agent (osmoticant).Make cell on the shaking table of 125RPM 28 DEG C recover 2 hours, then use the glass cell harvestor unit that is connected with house vacuum pipeline to be filled on Whatman#4 filter paper (5.5cm).

While vacuumizing, the dispersible suspension of about 2ml is moved on to its surface.Filter paper is placed on the 60x20mm flat board of GN6 medium.At 28 DEG C, flat board is cultivated 1 week in magazine.

After 1 week, filter paper is transferred to GN6 (3P) medium (N6 medium, 2.0mg/L2,4-D, 30g/L sucrose, 100mg/L inositol, 3 μMs from the Imazethapyr of DG, 2.5g/LGelrite, pH5.8) 60x20mm dull and stereotyped.Flat board be placed in box and cultivate one week again.

Transform Liang Zhouhou investing tissue: scrape GN6 agarose media (N6 medium, 2.0mg/L2 that the whole cells on flat board melt to 3.0ml, 4-D, 30g/L sucrose, 100mg/L inositol, 7g/LSeaPlaque agarose, pH5.8,121 DEG C of autoclavings only 10 minutes) in, in this medium containing 3 μMs Imazethapyr (from dG).Disrupting tissue, and 3ml agarose and even tissue are poured on the surface of GN6 (3P) flat board of 100x15mm.This operation is repeated to all remaining flat boards.After embedding, flat board is used or seal one by one, then cultivate until when the separator of presumption occurs.

Separator recovers and regeneration scheme: approximately transform latter 9 weeks, from containing embedding flat board in be separated the transformation event of presumption, method is: transfer in the fresh selection medium of the same concentrations in 60x20mm flat board.If continued propagation clearly after about 2 weeks, then think that event has resistance and carries out analysis of molecules.

By callus being transferred to initial regeneration in the inducing culture 28 (3P) based on the basic element of cell division, inducing culture contain 3 μMs the Imazethapyr from Pursuit.RTM.DG, MS salt and vitamin, 30.0g/L sucrose, 5mg/LBAP, 0.25mg/L2,4-D, 2.5g/LGelrite, pH5.7.First make cell at low light according to (13 μ Em ^-2s ^-1) under growth one week, then at higher illumination (40 μ Em ^-2s ^-1) under regrowth one week, then transfer to regeneration culture medium 36 (3P), regeneration culture medium is identical with 28 (3P) except lacking plant growth regulator.Shift out little (3-5cm) plantlet and be placed in containing SHGA medium (Schenk and Hildebrandt basis salt and vitamin, 1972 without selection; Lg/L inositol, 10g/L sucrose, 2.0g/LGelrite, pH5.8) 150x25mm culture tube in.Once plantlet grows enough roots and bud system, be transplanted in the soil in greenhouse.

According to 4 experiments, do not experience traditional callus phase, on the selection flat board of embedding, body profile has become to comprise the complete plantlets of bud and root under a dark condition.Leaf texture from 9 strain plants in these " in early days again survivor " is delivered the code area PCR and plant transcription unit (PTU) PCR that carry out for AAD-12 gene and box gene.They all have complete AAD-12 code area, and wherein 3 strains do not have total length PTU (table 11).These " early stage aftergrowths " are accredited as 4101 events, to be distinguished mutually in they and the event obtained in a traditional way (being accredited as " 1283 " event).Plant (selected by routine and regenerate acquisition) from other 19 events delivers to greenhouse, cultivates ripe, has the inbred line cross pollination of patent rights, to produce T1 seed with a strain.It seems that some in these events are clones (because the banding pattern after Southern trace is similar) each other, therefore merely provides 14 unique event.From the Imazethapyr of the T0 Plant Tolerance 70g/ha of these events.Invader analyzes (AHAS gene) and shows that the scope of insert complexity copies from more than 1 to 10.13 events contain the complete coding region of AAD-12; But, analyze further and show do not have group to enter complete plant transcription unit in 9 events.After these incomplete (compromised) 1863 events all will not be advanced to the T1 stage.Further sign 4101 events are carried out.

Analysis of molecules-corn material and method: the DNA that results are organized is separated with quantitative.Flesh tissue is placed in test tube, and 4 DEG C of freeze-drying 2 days.After organizing bone dry, in test tube, place tungsten pearl (Valenite), and with Kelco ball mill, sample is dry grinded 1 minute.Then conventional DNeasyDNA separable programming (Qiagen, DNeasy69109) is carried out.Then, with PicoGreen (MolecularProbesP7589), the extraction DNA of equal portions is dyeed, and read in the fluorescence photometer (BioTek) with known standard items, obtain the concentration in units of ng/ μ l.

Invader determination and analysis: DNA sample is diluted to 20ng/ μ l, then passes through in thermal cycler in the sex change in 10 minutes of 95 DEG C of incubations.Then the oligonucleotide mixture and MgCl that provide are provided ₂(ThirdWaveTechnologies) signal probe mixture is prepared.In each hole of invader assay plate, put into the sample aliquot of 7.5 μ l, then put into the unknown sample that 7.5 μ l contrasts, standard items and 20ng/ μ l dilute.Each hole 15 μ l mineral oil (Sigma) cover.Then by flat board 63 DEG C of incubations 1 hour and at the upper reading of fluorescence photometer (Biotek).With target probe, divided by the signal percentages of internal reference probe to background, ratio is calculated to the signal percentage of background.Produced by Southern engram analysis and confirm the ratio of known copy standard items, for determining the copy estimative figure of unknown event.

Polymerase chain reaction (PCR): use altogether 100ng STb gene as template.Use often kind of primer and the TakaraExTaqPCR polymerase kit (MirusTAKRR001A) of 20mM.Primer for AAD-12 (v1) PTU is: forward GAACAGTTAGACATGGTCTAAAGG (SEQIDNO:8) and reverse GCTGCAACACTGATAAATGCCAACTGG (SEQIDNO:9).In 9700Geneamp thermal cycler (AppliedBiosystems), carry out PCR reaction: to sample carry out 94 DEG C 3 minutes, 94 DEG C 30 seconds, 63 DEG C 30 seconds, 72 DEG C 1 point 35 circulations of 45 seconds, and subsequently 72 DEG C 10 minutes.

Primer for AAD-12 (v1) code area PCR is: forward ATGGCTCAGACCACTCTCCAAA (SEQIDNO:10) and reverse AGCTGCATCCATGCCAGGGA (SEQIDNO:11).In 9700Geneamp thermal cycler (AppliedBiosystems), carry out PCR reaction: to sample carry out 94 DEG C 3 minutes, 94 DEG C 30 seconds, 65 DEG C 30 seconds, 72 DEG C 1 point 35 circulations of 45 seconds, and thereafter 72 DEG C 10 minutes.By the electrophoretic analysis PCR primer on 1% Ago-Gel that dyes with EtBr.

Southern engram analysis: carry out Southern engram analysis with the genomic DNA available from QiagenDNeasy kit.Use BSMI and SWAI restriction enzyme, the genome leaf DNA of total 2 μ g or the genome callus DNA of 10 μ g is carried out digested overnight, to obtain PTU data.

After digested overnight by the sample aliquot of 1 about 100ng on 1% gel electrophoresis to confirm catapepsis.After confirmation, each sample is spent the night with 40 volts of electrophoresis on bulk 0.85% Ago-Gel.Then in 0.2MNaOH, 0.6MNaCl, make gel sex change 30 minutes.Then in 0.5MTrisHCl, 1.5MNaCl of pH7.5 by gel and 30 minutes.Then the device of gel of assembling containing 20xSSC is to realize gels overnight force of gravity to nylon membrane (MilliporeINYC00010).Spend the night after transfer, ((StratageneUV is cross-linked instrument 1800) applies UV light to film to be cross-linked instrument with the micro-joule of 1200x100.Then in 0.1%SDS, 0.1SSC, film is washed 45 minutes.In washing after 45 minutes, film is dried 3 hours at 80 DEG C and is stored in 4 DEG C until when hybridizing.Use plasmid DNA, utilize above-mentioned code area PCR to prepare hybridization template segments.Product cuts after electrophoresis on 1% Ago-Gel, re-uses Qiagen (28706) Gel Extraction protocol and extracts gel.Then film is carried out in PerfectHyb buffer solution (SigmaH7033) pre-hybridization step 1 hour of 60 DEG C.Use PrimeitRmTdCTP labeled reactant (Stratagene300392) scheme makes the probe (PerkinElmer) based on p32.Use ProbeQuant.G50 post (Amersham27-5335-01) purification probe.Southern blot overnight is hybridized with the CPM of 2,000,000 countings.At 0.1%SDS, 0.1SSC at trace being placed in 65 DEG C after Overnight hybridization, carry out washing in twice 20 minutes.Then trace is made to contact film over night, at-80 DEG C of incubations.

AAD-12 transform T0 corn in post-emergent herbicide tolerance: 4 T0 events are tamed in greenhouse, grow to from verticil bear 2-4 sheet new, the normal blade of outward appearance (namely plant from tissue cultures transition be greenhouse growth conditions).In greenhouse at 27 DEG C at 16 h light: cultivate plant under the condition of 8 h dark.Then commercial formulation is used any one process plant in (Imazethapyr) or 2,4-DAmine4.Spray prove the function of the selection marker thing gene be present in test event.Weed killer herbicide is used with the spraying altitude crawler type sprayer of the sprinkling volume of 187L/ha, 50cm.Plant is sprayed with the Imazethapyr (70gae/ha) of lethal dose or 2, the 4-DDMA salt (2240gae/ha) that significantly can damage unconverted corn strain of certain ratio.Lethal dose is defined as the ratio causing Hi-II inbred line >95% to damage.Hi-II is the genetic background of transformant of the present invention.

Various gene provides the weed killer herbicide of resistance to achieve safe to several body.But individuality clone ' 001 ' (also known as 4101 (0)-001-001) from event " 001 " have met with minor injury, but are recovered at 14DAT.To the research further of 3 in 4 events, individuality and 5XH751 are hybridized and takes the next generation to.For 2,4-D and Imazethapyr tolerant plants, often kind of herbicide tolerant plants exists for the positive for the existence of AAD-12 code area (PCR mensuration) or AHAS gene (invader mensuration).AAD-12 albumen is all detected in all containing in 2,4-D tolerance T0 plant event of complete coding region.The copy number of transgenosis (AHAS also has AAD-12 according to inferring) is from the marked change of 1 to 15 copy.Make individual T0 plant growth to maturation and have the inbred line cross pollination of patent rights with one, to produce T1 seed.

In T1 corn, the checking of high 2,4-D tolerances: T1AAD-12 (v1) seed is planted in 3 inches of basins containing MetroMix medium, and sprays to eliminate invalid event with 70gae/ha Imazethapyr in the double leaf phase.The plant transplantation of survival is in 1 gallon of basin containing MetroMix medium and under being placed in foregoing identical growth conditions.In the V3-V4 phase, with the crawler type sprayer being set to 187L/ha, 560 or 2240gae/ha2,4-DDMA are sprayed to plant.In 3 and 14DAT, plant scoring is also compared with 5XH751xHiII check plant.Set up the grading scale (not damaged is to extremely growth hormone damage) of 0-10 to distinguish prop root damage.Carry out prop root scoring at 14DAT and show 2,4-D tolerance.2,4-D causes prop root deformity, and is the coincident indicator of growth hormone herbicide injury in corn.Prop root data (seen in following table) prove that 2 in 3 test events tolerate by force 2240gae/ha2,4-DDMA.Event " pDAB4101 (0) 001.001 " is obviously unstable; But other two events are to 2,4-D and 2,4-D+ Imazethapyr or the strong patience of 2,4-D+ glyphosate (consulting table 12).

AAD-12 (v1) hereditability in corn: also filial generation test has been carried out to AAD-12 (v1) the T1 family that 7 have hybridized with 5XH751.Seed is planted in 3 inches of basins described above.In 3 leaf phases, as aforementioned crawler type sprayer sprays 70gae/ha Imazethapyr to all plants.After 14DAT, antagonism and sensitive plant count.Determined, in tested 6 strains, have 4 to be separated (1R:1S) as single locus, dominant mendelian character by chi-square analysis.Use 2,4-D to spray the plant of survival subsequently, all plants are considered to tolerate 2,4-D (ratio >=560gae/ha).AAD-12 can be used as the heredity of strong aryloxy alkanoic acid growth hormone resistant gene in multiple species when handing over mutually with commodity heterozygote.

Superposition AAD-12 (v1) is to increase weed killer herbicide spectrum: AAD-12 (v1) (pDAB4101) and the anti-agriculture of a kind of breeding are reached (eliteRoundupReady) inbreeding strain (BE1146RR) and hand over and collect F1 seed mutually.Plant from two F1 systems seed and in the V2 phase with the process of 70gae/ha Imazethapyr with superseded invalid event.For the plant of survival, be separated and repeat (reps) with crawler type sprayer (being calibrated to 187L/ha) with 1120gae/ha2,4-DDMA+70gae/ha Imazethapyr (in order to confirm the existence of AHAS gene) or 1120gae/ha2,4-DDMA+1680gae/ha glyphosate (in order to confirm that anti-agriculture reaches the existence of gene) process.At 3DAT and 16DAT, plant is marked.Spray data display AAD-12 (v1) can superpose with glyphosate tolerance gene (as anti-agriculture reaches CP4-EPSPS gene) or other herbicide tolerance gene routinely, thus provide the weed killer herbicide of increase to compose, can safely for corn.Similarly, these multiple genetically modified molecules or breeding stack combinations observe imidazolone+2,4-D+ glyphosate tolerant in F1 plant, do not have negative phenotype.

The corn plant that pDAB4101 transforms is to the land for growing field crops tolerance of 2,4-D, Triclopyr and fluroxypyr weed killer herbicide: reach to 2 AAD-12 (v1) pDAB4101 events (4101 (0) 003.R.003.AF and 4101 (0) 005.R001.AF) and 1 anti-agriculture the Wayside that (RR) contrast the Fowler of heterozygote (2P782) in Indiana State and the state of Mississippi and carry out land for growing field crops level resistance test.Seeds are planted at Wayside with 40 inches of line-spacings, at Fowler with 30 inches of line-spacings plantation seeds with taper sower.Experimental design is the complete block design of randomization of 3 repetitions.Herbicide treatment is: with 1120,2240 and 4480gae/ha use 2,4-D (dimethylamine salts), with 840gae/ha use Triclopyr, with 280gae/ha use fluroxypyr and untreated contrast.AAD-12 (v1) event comprises AHAS gene as selection marker thing.F2 corn event is separated, and therefore uses 70gae/ha Imazethapyr process AAD-12 (v1) plant to eliminate Null plants.When the corn arrival V6 phase, compressed air knapsack type sprayer is used to send 187L/ha carrier bulk to carry out herbicide treatment with 130-200kpa pressure.Within 7,14 and 21 days, carry out range estimation Injury score after treatment.The rank of 0-10 is used to carry out prop root lesion assessment at 28DAT, wherein 0-1 is that prop root slightly merges, 1-3 is that prop root moderate is expanded/wriggled (wandering) and propagation, 3-5 are that prop root moderate merges, 5-9 is that prop root severe merges and deformity, and 10 suppress completely for prop root.

In table 14 after Graphics Processing 14 days AAD-12 (v1) events to the response of 2,4-D, Triclopyr and fluroxypyr.The most serious at 14DAT crop damage.RR contrasts corn (2P782) by 2, the 4-D major injuries (44% in 14DAT) used with 4480gae/ha (8 times to normal land for growing field crops usage rate).All AAD-12 (v1) event all demonstrates outstanding tolerance (0% damage) to difference 1,2 and 4 times to 2,4-D of land for growing field crops usage rate at 14DAT.Contrast corn (2P782) is by 2 times of Triclopyrs to normal rate (840gae/ha) major injury (31% in 14DAT).AAD-12 (v1) event proves to have tolerance (in average 3% damage of 14DAT two events) to 2 times of Triclopyrs to normal rate.11% range estimation damage of wild-type corn is caused with the fluroxypyr that 280gae/ha uses at 14DAT.AAD-12 (v1) event is presented at 5DAT tolerance to be increased (average 8% damage).

The deformity of prop root can be caused to Yield-increasing Baallus In Maize growth hormone weed killer herbicide at V6 vegetative stage.Table 15 shows the seriousness of the prop root damage that 2,4-D, Triclopyr and fluroxypyr cause.In 2P782 contrast type corn, the Triclopyr used with 840gae/ha causes the most serious prop root to merge and deformity, causes the prop root Injury score of average out to 7.

Two AAD-12 (v1) corn events all do not show the prop root damage that Triclopyr process causes.Along with the increase of 2,4-D ratio, the prop root damage in 2P782 corn increases.During with 4480gae/ha use 2,4-D, ADD-12 event does not show prop root damage; But prop root serious as seen in 2P782 heterozygote merges and deformity.In wild-type corn, fluroxypyr only causes moderate prop root to expand and wriggle, and AAD-12 (v1) event does not show prop root damage.

These data clearly show that AAD-12 (v1) gives corn to 2, the high-level tolerance of 4-D, Triclopyr and fluroxypyr, the wherein far super business usage rate of the ratio of weed killer herbicide, and the range estimation causing non-AAD-12 (v1) corn serious and prop root damage.

Embodiment 6

Transformation of tobacco

By the method Agrobacterium tumefaciens transformation of tobacco similar but incomplete same with published method (Horsch etc., 1988).In order to be provided for the derived tissues transformed, tobacco seed (Nicotianatabacumcv.KY160) surface sterilization is also planted on the surface of TOB medium, TOB medium is without hormone Murashige and Skoog medium (Murashige and Skoog, 1962) with agar solidified.In the culturing room having illumination, cultivate plant 6-8 week at 28-30 DEG C, sterile collection leaf is used for Transformation Protocol.From (except middle arteries and veins) aseptic block cutting about l square centimeter these leaves.On the shaking table being set in 250rpm in 28 DEG C of bottles the agrobacterium bacterial strain of overnight incubation (containing pDAB3278 (also known as pDAS1580), the EHA101S of AAD-12 (v1)+PAT) culture centrifugation being resuspended in aseptic Murashige & Skoog salt, being adjusted to 600nm final optical density is 0.5.Leaf block to be immersed in this bacterial suspension about 30 seconds, then dip in dry on aseptic paper handkerchief, right side be placed on upward TOB+ medium (Murashige and the Skoog medium containing 1mg/L heteroauxin and 2.5mg/L benzyladenine) upper and in 28 DEG C of dark incubation.Leaf block is moved to containing 250mg/L cefotaxime (Agri-Bio two days later, NorthMiami, Fla.) and 5mg/L grass ammonium phosphine (active component of Basta (Bayer Cropscience Co., Ltd (BayerCropSciences))) TOB+ medium, and under 28-30 DEG C of illumination incubation.Leaf block to be transferred to weekly the fresh TOB+ medium containing cefotaxime and Basta for twice by the last fortnight, thereafter once in a week.After bacterial treatment leaf block four to six week, from then on take out the plantlet gone out from transforming focus hair tonic in tissue preparation thing and also plant to Phytatray ^tMcontain in the medium TOB of 250mg/L cefotaxime and 10mg/LBasta in II container (Sigma).These plantlets are cultivated in illumination cultivation room.After 3 weeks, carry out stem cutting and again take root in identical medium.After 2-3 week, plant can be transferred to greenhouse.

As follows plant is moved to greenhouse: wash away the agar on root, be transplanted in the soil of 13.75cm side's basin, basin is placed in in bag (SCJohnson & Son, Inc.), put into running water in the bottom of sack, and be placed in indirect light in 30 DEG C of greenhouses under 1 week.After 3-7 days, open sack; To plant fertilising, be allowed to condition in the sack opened and grow, until plant adapts to greenhouse, now remove sack.Allow plant common warm grown under greenhouse condition (30 DEG C, 16 hours daytimes, 8 hours nights, smallest natural light+supplement light=500 μ E/m ²s ¹).

Before breeding, carry out DNA analysis, to determine insert copy number from the sampling of T0 plant.For simplicity, the pat gene with AAD-12 (v1) molecular linkage is measured.Flesh tissue is placed in test tube, and 4 DEG C of freeze-drying 2 days.After organizing bone dry, in test tube, place tungsten pearl (Valenite), and with Kelco ball mill, sample is dry grinded 1 minute.Then conventional DNeasyDNA separable programming (Qiagen, DNeasy69109) is carried out.Then, with the equal portions dyeing of PicoGreen (MolecularProbesP7589) to the DNA extracted, and read in the fluorescence photometer (BioTek) with known standard items, obtain the concentration in units of ng/ μ l.

DNA sample is diluted to 9ng/ μ l, then passes through in thermal cycler in the sex change in 10 minutes of 95 DEG C of incubations.Then the oligonucleotide mixture and MgCl that provide are provided ₂(ThirdWaveTechnologies) signal probe mixture is prepared.In each hole of Invader assay plate, put into the aliquot of 7.5 μ l, then put into the unknown sample that 7.5 μ l contrasts, standard items and 20ng/ μ l dilute.Each hole is covered with 15 μ l mineral oil (Sigma).Then by flat board 63 DEG C of incubations 1.5 hours and at the upper reading of fluorescence photometer (Biotek).With target probe, divided by the signal percentages of internal reference probe to background, ratio is calculated to the signal percentage of background.To be produced by Southern engram analysis and the ratio of the known copy standard items confirmed copies for the identification of the estimation of unknown event.

Identical extraction DNA sample is also used to measure the existence of AAD-12 (v1) gene in all events by PCR.Use altogether 100ng STb gene as template.20mM is used often to plant primer and TakaraExTaqPCR polymerase kit.Primer for plant transcription unit (PTU) PCRAAD-12 is: (SdpacodF:ATGGCTCATGCTGCCCTCAGCC) (SEQIDNO:12) and (SdpacodR:CGGGCAGGCCTAACTCCACCAA) (SEQIDNO:13).In 9700Geneamp thermal cycler (AppliedBiosystems), carry out PCR reaction: make sample experience 94 DEG C 3 minutes, 94 DEG C 30 seconds, 64 DEG C 30 seconds, 72 DEG C 1 point 45 seconds 35 circulations and thereafter 72 DEG C 10 minutes.By the electrophoretic analysis PCR primer on 1% Ago-Gel that dyes with EtBr.18 PCR positive events have 1-3 the pat gene copied and (can infer 1-3 the AAD-12 copied (v1), because these genes are physical linkages), 4 to 12 of each event in them clone's pedigrees are regenerated and move to greenhouse.

Post-emergent herbicide tolerance in the T0 tobacco that AAD-12 (v1) transforms: spray the T0 plant that large-scale 2,4-D, Triclopyr or fluroxypyr attack each event in 19 events by the plant high to 3-4 inch.Spraying to use uses crawler type sprayer to carry out as aforementioned with the sprinkling volume of 187L/ha.With 0,140,560 or 2240gae/ha, 2, the 4-D dimethylamine (RiversideCorp) mixed in deionized water are used to the representativeness clone of each event.Fluroxypyr is used equally with 35,140 or 560gae/ha.Triclopyr is used with 70,280 or 1120gae/ha.Each process repeats 1-3 time.Grade in 3 and the damage of 14DAT record.Each event of test has more tolerance than unconverted check clone KY160 to 2,4-D.In several event, at 560gae/ha or more under low dosage, there is some initial Epinasties relevant to growth hormone weed killer herbicide in 2,4-D.Some events is without damage when using 2,4-D with 2240gae/ha (being equal to 4x field rates).Generally speaking, AAD-12 (v1) event is more responsive to fluroxypyr, and be secondly Triclopyr, the impact by 2,4-D is minimum.T0 plant is utilized to distinguish the quality of the size event with regard to resistance to the response of 560gae/ha fluroxypyr.By event classification be " low " (14DAT>40% damage), " in " (20-40% damage), " height " (<20% damage).The non_uniform response of some events between repeating, is considered as " variable ".

The checking of high 2,4-D tolerances in T1 tobacco: 2 to 4 T0 individualities that each event is survived under being retained in height ratio 2,4-D and fluroxypyr, and make its self-pollination in greenhouse produce T1 seed.Make T1 earthing of seeds, and be seeded in selective pan in the mode quite similar with arabidopsis, use 560gai/ha phosphine oxamate (pat gene selection) the unconverted invalid event of selective removal in this segregation population subsequently.Survivor is transferred in the 3 inches of independent basins in greenhouse.These product tie up in T0 generation and provide the high-caliber resistance of 2,4-D.Expection is not directly better from the response uniformity in the T1 plant of tissue cultures.These plants and wild type KY160 tobacco are compared.The crawler type sprayer being set to 187L/ha is used to spray all plants.Plant is sprayed with the fluroxypyr of 2, the 4-D dimethylamine (DMA) of 140-2240gae/ha scope, the Triclopyr of 70-1120gae/ha scope or 35-560gae/ha scope.All application are all prepared in water.Each process repeats 2-4 time.Plant was assessed in 3 and 14 days after treatment.Damage grading is specified to plant for growth retardation, chlorosis and necrosis.In T1 generation, is separated, and therefore it is expected to because the difference of distribution type can exist some variable responses.

For 4x field rates (2240gae/ha) or under 2,4-D do not observe damage.In an event strain, observe some damages with Triclopyr process, but maximum damage is observed in fluroxypyr process.Fluroxypyr damage is of short duration, and during to 14DAT, the new growth of an event and untreated contrast are almost as broad as long (table 17).Importantly it should be noted that unconverted tobacco is to fluroxypyr extreme sensitivity.These results show that AAD-12 (v1) can provide 2,4-D tolerances of level of industry, are also even like this in the highstrung dicotyledonous crops of growth hormone (as tobacco).These results also show, and can give the resistance to pyridine fluoroacetic acid class weed killer herbicide Triclopyr and fluroxypyr.For grower, can the regulation various active herbicide tolerant crop that becomes divisional processing protected by AAD-12 with different Weeds distribution spectrum, this is exceedingly useful.

AAD-12 (v1) hereditability in tobacco: also 100 Progeny plants tests have been carried out to 7 T1 strains in AAD-12 (v1) strain.By above code by earthing of seeds, sowing transplanting, just do not select to remove Null plants by Liberty.Then, as aforementioned 560gae/ha2,4-DDMA spray all plants.After 14DAT, antagonism and sensitive plant count.Determined, in tested 7 strains, have 5 to be separated (3R:1S) as single locus, dominant mendelian character by chi-square analysis.AAD-12 can be used as the heredity of strong aryloxy alkanoic acid growth hormone resistant gene in multiple species.

PDAS1580 tobacco plant is to 2,4-D, 2, the land for growing field crops tolerance of 4-Dichlorophenoxy propionic acid, Triclopyr and fluroxypyr weed killer herbicide: the large Tanaka of Indiana State and the state of Mississippi, land for growing field crops level resistance test is carried out to 3 AAD-12 (v1) strains (event pDAS1580-[1]-018.001, pDAS1580-[1]-004.001 and pDAS1580-[1]-020.016) and 1 wild-type lines (KY160).According to shown growth conditions, by transplanting platform (HummertInternational) upper plantation T1 seeds in 72 holes containing Metro360 medium, tobacco explants is allowed to grow in greenhouse above.Select optionally to remove Null plants by Liberty as aforementioned.The plant transplanted is transported in station, land for growing field crops, uses industrial vegetable planter to plant with the interval of 14 or 24 inches.Utilize drip irrigation in base, the state of Mississippi, utilize in base, Indiana State sprinkling irrigation to keep plant vigorous growth.

Experimental design is four split plot designs repeated.Primary area (mainplot) is herbicide treatment, and subarea (subplot) is tobacco lines.Herbicide treatment comprise with 280,560,1120,2240 and 4480gae/ha use 2,4-D (dimethylamine salts), with 840gae/ha use Triclopyr, with 280gae/ha use fluroxypyr and untreated contrast.Each district take 25-30ft as a line.The compressed air knapsack type sprayer that after transplanting, 3-4 week use sends 187L/ha carrier bulk with 130-200kpa pressure carries out herbicide treatment.Within 7,14 and 21 days, carry out after treatment damaging, the range estimation grading of growth inhibition and Epinasty.

AAD-12 (v1) event is shown to the response of 2,4-D, Triclopyr and fluroxypyr in table 18.2, the 4-D major injuries that use with 560gae/ha (being considered to 1 times of land for growing field crops usage rate) untransformed tobacco strain (63%, at 14DAT).All AAD-12 (v1) product tie up to 14DAT and all show outstanding tolerance to 2,4-D, namely observe the average lesion of 1,4 and 4% respectively at 2,4 and 8 times of ratios.Untransformed tobacco strain is seriously damaged (at 14DAT, 53%) by the Triclopyr of 2x ratio (840gae/ha); But, the tolerance of average 5% damage of AAD-12 (v1) strain display 14DAT3 strain.The fluroxypyr used with 280gae/ha causes the major injury (99%) of non-transformed strain at 14DAT.AAD-12 (v1) strain is presented at 14DAT tolerance to be increased (average 11% damage).

These results show, under representational field condition, the display of AAD-12 (v1) transformation event strain is to being multiple times than 2 of industry ratio, the high-level tolerance of 4-D, Triclopyr and fluroxypyr, and these weed killer herbicides being multiple times than industry ratio are lethal to untransformed tobacco, or cause serious epinasty deformity.

AAD-12 (v1) resists the protective effect of 2,4-D of lifting ratio: be presented at the result that AAD-12 in greenhouse (v1) resists the protective effect of 2,4-DDMA of height ratio and be shown in Table 19.When selecting with 560gai/haLiberty by same approach as the aforementioned, obtain T1AAD-12 (v1) plant from 3R:1S departure event.Also plant T1AAD-1 (v3) seed as the tobacco control (consulting PCT/US2005/014737) transformed.Unconverted KY160 is used as sensitive control.Use the crawler type sprayer being set to 187L/ha to spray 2,4-DDMA of 140,560,2240,8960 and 35840gae/ha to plant, and grade in 3 and 14DAT.

AAD-12 (v1) and AAD-1 (v3) all available protecting tobacco antagonism dosage damages up to 2,4-D of 4x industry usage rate.But when up to 64x standard field rates, AAD-12 (v1) obviously proves to protect advantage significantly than AAD-1 (v3).

AAD-12 superposition increases weed killer herbicide spectrum: carry out phase mutual cross to the AAD-12 isozygotied (v1) (pDAS1580) and AAD-1 (v3) (pDAB721) plant (consulting PCT/US2005/014737 for the latter), and collect F1 seed.By the F1 earthing of seeds of twice phase mutual cross from each gene, and repeat, namely with one of following process to test 4 that identical sprinkling scheme process hybridizes with other at every turn: 70,140,280gae/ha fluroxypyr (selecting AAD-12 (v1) gene); 280,560,1120gae/haR-2,4-Dichlorophenoxy propionic acid (selecting AAD-1 (v3) gene); Or 560,1120,2240gae/ha2,4-DDMA (checking 2,4-D tolerance).The T2 plant of isozygotying of each gene also can be used as contrast and plants.At 3 and 14 DAT, plant is graded.Sprinkling result is shown in table 20.

Result confirms, AAD-12 (v1) successfully can superpose with AAD-1 (v3), therefore increases weed killer herbicide spectrum (being respectively phenoxy acetic acid class+phenoxy propionic acid class and phenoxy acetic acid class+pyridine fluoroacetic acid class for AAD-1 and AAD-12) that can be applied to crop interested.The complementarity of weed killer herbicide cross tolerance pattern makes people that these two genes can be used easily as complementary and stackable land for growing field crops selection marker thing (field-selectablemarkers).In the unconspicuous crop of single-gene tolerance possibility, those skilled in the art can recognize can by superposing the second genes conferring resistance to increase the tolerance to identical weed killer herbicide.This can use same gene and identical or different promotor; But, as what observe herein, make superposition and follow the trail of two kinds of complementary traits to become easy to the distinctive cross-protection of phenoxy propionic acid class [AAD-1 (v3)] or pyridine fluoroacetic acid class [AAD-12 (v1)].

Embodiment 7

Transformation of soybean

Complete the improvement to the following proterties of soybean by gene transfer technique: herbicide tolerant (Padgette etc., 1995), amino acid modified (Falco etc., 1995) and insect-resistant (Parrott etc., 1994) etc.External source proterties is introduced crop species and needs such method, it allows to produce routinely and uses selection marker thing sequence, transgenic strain containing simple insert.Transgenosis should be hereditary as individual feature locus, to simplify breeding.Report by zygote plumular axis (McCabe etc., 1988) or somatic embryo generation culture (Finer and McMullen, 1991) microparticle bombardment and agrobacterium-mediated cotyledon explant (Hinchee etc., 1988) or the conversion of zygotic embryo (Chee etc., 1989) by exogenous gene delivery in the cultivated soybean.

The transformant coming from agrobacterium-mediated conversion tends to have the simple insert (Birch, 1991) of low copy number.For studying three kinds of target tissues (zygote plumular axis (Chee etc., 1989 of gene transfer being entered soybean; McCabe etc., 1988), cotyledon (Hinchee etc., 1988) and somatic embryo generation culture (Finer and McMullen, 1991)) there are respective benefit and shortcoming.The latter has obtained as the target tissue of direct gene transfer and has studied widely.Embryogenesis culture has the tendency of suitable high yield, and can long term maintenance.But, the sterility of primary transformant and chromosome aberration are associated (Singh etc. with the age of embryo generation suspension by someone, 1998), therefore for using the soybean transformation system of this tissue, the new culture of sustained start is seemingly necessary.This system needs high-caliber 2,4-D (40mg/L concentration) carrys out initial embryo callus, this causes the problem of essence to the use of AAD-12 (v1) gene, because when not growing further containing the locus transformed during 2,4-D in medium.Therefore, be desirable based on merismatic conversion for 2, the 4-D resistance plants of application AAD-12 (v1).

The Gateway clone of binary constructs: AAD-12 (v1) coding sequence is contained in the different Gateway donor vehicle of different plant promoter to 5.Clone enzyme reaction (InvitrogenCorporation, CarlsbadCalif., catalog number (Cat.No.) 11791-019) by LR subsequently the AAD-12 obtained (v1) expression of plants box is cloned in Gateway appointment binary vector.

NcoI-SacI fragment containing AAD-12 (v1) coded sequence is hydrolyzed from DASPICO12, is connected in the NcoI-SacI restriction site of corresponding following Gateway donor vehicle: pDAB3912 (attL1//CsVMV promotor //AtuORF233'UTR//attL2); PDAB3916 (attL1//AtUbi10 promotor //AtuORF233'UTR//attL2); PDAB4458 (attL1//AtUbi3 promotor //AtuORF233'UTR//attL2); PDAB4459 (attL1//ZmUbi1 promotor //AtuORF233'UTR//attL2); With pDAB4460 (attL1//AtAct2 promotor //AtuORF233'UTR//attL2).The construct containing following expression of plants box that name obtains: pDAB4463 (attL1//CsVMV promotor //AAD-12 (v1) //AtuORF233'UTR//attL2); PDAB4467 (attL1//AtUbi10 promotor //AAD-12 (v1) //AtuORF233'UTR//attL2); PDAB4471 (attL1//AtUbi3 promotor //AAD-12 (v1) //AtuORF233'UTR//attL2); PDAB4475 (attL1//ZmUbi1 promotor //AAD-12 (v1) //AtuORF233'UTR//attL2); With pDAB4479 (attL1//AtAct2 promotor //AAD-12 (v1) //AtuORF233'UTR//attL2).Through Restriction Enzyme digestion and these constructs of sequence verification.

Clone enzyme reaction by GatewayLR expression of plants box is recombinated in GatewayDestination binary vector pDAB4484 (RB7MARv3//attR1-ccdB-chlorampenicol resistant-attR2//CsVMV promotor //PATv6//AtuORF13'UTR).Gateway technology uses the Site-specific recombinase based on bacteriophage lambda to replace restriction endonuclease and ligase to be inserted in expression vector by gene of interest.InvitrogenCorporation, GatewayTechnology:AUniversalTechnologytoCloneDNASequence sforFunctionalAnalysisandExpressioninmultipleSystems, technical manual, catalog number (Cat.No.) 12535-019 and 12535-027, Gateway technological vision E, Sep.22,2003, #25-022.DNA recombination sequence (attL and attR) and LR clonase enzyme mix allow in any carrier having the DNA fragmentation of recombination site to transfer to containing corresponding site any flank.The attLl site of donor vehicle is corresponding with the attRl of binary vector.Equally, the attL2 site of donor vehicle is corresponding with the attR2 of binary vector.Use Gateway technology, flank has the expression of plants box (from donor vehicle) in attL site (flankedbyattLsites) can recombinate in the attR site of binary vector.The construct containing following expression of plants box obtained is labeled as: pDAB4464 (RB7MARv3//CsVMV promotor //AAD-12 (v1) //AtuORF233'UTR//CsVMV promotor //PATv6AtuORF13'UTR); PDAB4468 (RB7MARv3//AtUbi10 promotor //AAD-12 (v1) //AtuORF233'UTR//CsVMV promotor //PATv6//AtuORF13'UTR); PDAB4472 (RB7MARv3//AtUbi3 promotor //AAD-12 (v1) //AtuORF233'UTR//CsVMV promotor //PATv6//AtuORF13'UTR); PDAB4476 (RB7MARv3//ZmUbi1 promotor //AAD-12 (v1) //AtuORF233'UTR//CsVMV promotor //PATv6AtuORF13'UTR); With pDAB4480 (RB7MARv3//AtAct2 promotor //AAD-12 (v1) //AtuORF233'UTR//CsVMV promotor //PATv6//AtuORF13'UTR).Through Restriction Enzyme digestion and these constructs of sequence verification.

The conversion that method for transformation l-is agrobacterium-mediated: the transformation of soybean target reported at first be the meristematic cell (Hinchee etc., 1988) in cotyledon node zone and the Shoot propagation thing (McCabe etc., 1988) from apical meristem.Based in the cotyledonary node method of Agrobacterium tumefaciens, in explant prepared product and culture media composition stimulation joint, assist merismatic propagation (Hinchee etc., 1988).Still do not know whether these process begin really to dedifferente and all-round callus tissue culture.Reclaim multiple clones of transformation event from single explant, and rarely have recovery chimera plant (Clemente etc., 2000; Olhoft etc., 2003) show, originate as individual cells, transgenic cell propagation produces the bud of proliferative transgenosis meristematic cultures or uniform conversion subsequently, and the latter experiences further Shoot propagation.Soybean Shoot propagation method is at first based on microparticle bombardment (McCabe etc., 1988), agrobacterium-mediated conversion (Martinell etc. are used for recently by transformation, 2002)), the method seems not experience dedifferenting, because system is the successful identification based on germline mosaic for this reason of level same with cotyledonary node method or type.Equally, this be one can ideally for 2,4-D selective system not based on the scheme of 2,4-D.Therefore, cotyledonary node method may be the method for the prioritizing selection of exploitation 2,4-D resistant soybean cultivated species.

The Plant Transformation of AAD-12 (v1) tolerance phenotype is produced." Maverick " explant of seed source and agrobacterium-mediated cotyledonary node (cot-node) Transformation Protocol are for generation of AAD-12 (v1) genetically modified plants.

The preparation of agrobacterium and inoculation: to carry in 5 double base pDAB carrier (table 8) the agrobacterium bacterial strain EHA101 (Hood etc., 1986) of each for initial conversion.Each binary vector comprises AAD-12 (v1) gene and plant selectable marker (PAT) box that are positioned at T-DNA district.These plasmids are moved in agrobacterium EHA101 bacterial strain by electroporation.Gene integration analysis is carried out to the bacterium colony selected, then uses agrobacterium processed soybeans explant.All transformation experiments use Maverick seed, and this seed obtains from University of Missouri (Columbia, MO).

Use pat gene as selection marker thing, be combined weed killer herbicide phosphine oxamate as selective agent, carry out agrobacterium-mediated soybean (Glycinemax) and transform.Allow seed in the upper sprouting of the B5 basal medium solidified with 3g/L plant gel (Sigma-Aldrich, St.Louis, Mo.) (Gamborg etc. 1968).Then selected bud is transferred to root media.Optimal selection scheme is: sprout in the initial phase whole first and second, uses 8mg/L phosphine oxamate in the medium; And within whole bud elongating stage, use 3-4mg/L phosphine oxamate in the medium.

Extending before bud (3-5cm) transfers to root media, the internode end cut off will be immersed 1-3 minute hestening rooting (Khan etc. 1994) in 1mg/L indoles 3-butyric acid.Bud is taken root in the 25x100mm Glass Culture Tubes containing root media, then the soil mixture Metro-mix200 (HummertInternational for plantlet adaptation in the uncovered Magenta box of Convirons is transferred to, EarthCity, Mo.) in.Phosphine oxamate, the active component in Liberty weed killer herbicide (BayerCropScience), for the selection in the initial sum elongating stage of sprouting.The plantlet of taking root first adapts to a few week in uncovered Magenta box, then screens and transfer in greenhouse to adapt to further and set up.

The mensuration of the plantlet that presumption transforms and the analysis of T0 plant of setting up in greenhouse: the terminal leaflets 50mg/L phosphine oxamate of the selected leaf of these plantlets smears blade face (leafpaint) 2 times, midfeather one week, so that observed result screens presumption transformant.Then the seedling of screening is transferred to greenhouse, and after adaptation, in GH, on leaf, again smear phosphine oxamate to confirm the tolerance state of these plantlets, they are considered as the transformant estimated.

The existence of active pat gene can be measured further with non-damaging manner as described below: with phosphine oxamate solution [0.05-2%v/vLiberty weed killer herbicide to the plant transferred in greenhouse, preferably 0.25-1.0% (v/v),=500-2000ppm phosphine oxamate, BayerCropScience] smear a block of the leaf of T0 primary transformant or its filial generation.Phosphine oxamate lesion assessment can carry out after treatment for 1-7 days, depends on the concentration of use.2 of plant can also be detected with following non-damaging manner, 4-D tolerance: 2 are optionally used to the tenderest emerging trifoliolate leaf (trifoliolate) the ternated compound terminal leaflets that one or two (preferably two) Nodes is newly expanded below, the 4-D aqueous solution (0.25-1%v/v business 2,4-D dimethylamine preparation, preferred 0.5%v/v=2280ppm2,4-Dae).This mensuration makes people 6 littlely can assess 2,4-D sensitive plant by assessment from the planar inverted of adjacent leaflets or the leaf that rotates >90 degree up to several days after application.Response will not be made to 2,4-D to the plant of 2,4-D tolerance.Allow T0 plant in greenhouse self-pollination to produce T1 seed.The weed killer herbicide level of protection provided by AAD-12 (v1) and pat gene in genetically engineered soybean is provided with the herbicide spray T1 plant (to produce the degree of enough T0 plant clonings) of range of doses.2, the 4-D ratios that T0 plant uses generally comprise one or both selection ratios (using foregoing crawler type sprayer) within the scope of 100-1120gae/ha.With the wider doses process T1 plant that scope is 2,4-D of 50-3200gae/ha.Similarly, after emerging, the process of 200-800 and 50-3200gae/ha phosphine oxamate is used to screen the phosphine oxamate resistance of T0 and T1 plant respectively.Be the glyphosate of 280-2240gae/ha by application dosage scope after emerging, the glyphosate resistance (in the plant transformed with the construct containing EPSPS) in T1 generation or other glyphosate tolerance gene can be assessed.To individual T0 plant assessment gene of interest (existence of AAD-12 (v1) or PATv6) code area and copy number.As in the prior embodiments, T1 with T2 filial generation is utilized to be separated (with regard to herbicide tolerant) to determine the hereditability of AAD-12 (v1).

For a part of initial conversion body, assess in T0 generation according to method above.Anyly be proved to be the plant with AAD-12 (v1) code area, no matter drive the promotor of gene, all do not have response to leaf is smeared 2,4-D, and wild type Maverick soybean have response.The plant only transforming PAT is the same with wild-type plant uses 2,4-D to Leaf paint response.

2,4-D (560 or 1120gae2,4-D) is used for a part of plant that wild type control plants size is similar.Compared with wild type Maverick soybean, all plants containing AAD-12 (v1) all have obvious resistance to herbicide application.2 AAD-12 (v1) plants observe the damage (2DAT) of slight level, but damage is temporary transient, and 7DAT does not observe damage.At 7-14DAT, wild type control plants by 2, the 4-D major injuries of 560gae/ha, and is killed by 2,4-D of 1120gae/ha.The fact that these data and AAD-12 (v1) can give sensitive crop (as soybean) height endurability (higher than 2 times of field rates) is coincide.Then molecule and biochemical analysis are carried out to the plant sampling of screening, be used for confirming AAD12 (v1) gene integration, copy number and gene expression dose.

Analysis of molecules-soybean: the separation of the DNA of results tissue is with quantitative.Flesh tissue is placed in test tube, and 4 DEG C of freeze-drying 2 days.After organizing bone dry, in test tube, place tungsten pearl (Valenite), and with Kelco ball mill, sample is dry grinded 1 minute.Then standard DNeasyDNA separable programming (Qiagen, DNeasy69109) is carried out.Then, with PicoGreen (MolecularProbesP7589), equal portions of the DNA extracted are dyeed, and read in the fluorescence photometer (BioTek) with known standard items, obtain the concentration in units of ng/ μ L.

Polymerase chain reaction (PCR): use altogether 100ng STb gene as template.20mM is used often to plant primer and TakaraExTaqPCR polymerase kit (MirusTAKRR001A).Primer for AAD-12 (v1) PTU is: (forward-ATAATGCCAGCCTGTTAAACGCC) (SEQIDNO:8) and (oppositely-CTCAAGCATATGAATGACCTCGA) (SEQIDNO:9).In 9700Geneamp thermal cycler (AppliedBiosystems), carry out PCR reaction: make sample experience 94 DEG C 3 minutes, 94 DEG C 30 seconds, 63 DEG C 30 seconds, 72 DEG C 1 point 45 seconds 35 circulations and thereafter 72 DEG C 10 minutes.Primer for code area PCRAAD-12 (v1) is: (forward-ATGGCTCATGCTGCCCTCAGCC) (SEQIDNO:10) and (oppositely-CGGGCAGGCCTAACTCCACCAA) (SEQIDNO:11).In 9700Geneamp thermal cycler (AppliedBiosystems), carry out PCR reaction: make sample experience 94 DEG C 3 minutes, 94 DEG C 30 seconds, 65 DEG C 30 seconds, 72 DEG C 1 point 45 seconds 35 circulations and thereafter 72 DEG C 10 minutes.By the electrophoretic analysis PCR primer on 1% Ago-Gel that dyes with EtBr.

Southern engram analysis: carry out Southern engram analysis with the STb gene available from QiagenDNeasy kit.Be that the genomic DNA digested overnight of 10 μ g is to obtain integral data by total amount.The aliquot of getting about 100ng after digested overnight on 1% gel electrophoresis to confirm catapepsis.After confirmation, sample is spent the night with 40 volts of electrophoresis on bulk 0.85% Ago-Gel.Then in 0.2MNaOH, 0.6MNaCl, make gel sex change 30 minutes.Then in 0.5MTrisHCl, 1.5MNaCl of pH7.5 by gel and 30 minutes.Then the device of gel of assembling containing 20xSSC is to realize the spend the night force of gravity of gel to nylon membrane (MilliporeINYC00010).Spend the night after transfer, utilize with the crosslinked instrument of 1200x100 micro-joule that ((StratageneUV is cross-linked instrument 1800) applies UV light to film.Then in 0.1%SDS, 0.1SSC, film is washed 45 minutes.In washing after 45 minutes, film is dried 3 hours at 80 DEG C and is stored in 4 DEG C until when hybridizing.Use plasmid DNA, utilize above-mentioned code area PCR to prepare hybridization template segments.1% Ago-Gel make product electrophoresis and cuts out, then using Qiagen (28706) Gel Extraction protocol to carry out gel extraction.Then film is carried out in PerfectHyb buffer solution (SigmaH7033) pre-hybridization step 1 hour of 60 DEG C.Use PrimeitRmTdCTP labeled reactant (Stratagene300392) solution development based on the probe (PerkinElmer) of p32.Use this probe of ProbeQuant.G50 post (Amersham27-5335-01) purifying.The CPM using 2,000,000 to count hybridizes southern blot overnight.Washing in twice 20 minutes is carried out at 0.1%SDS, 0.1SSC at trace being placed in 65 DEG C after Overnight hybridization.Then trace is made to contact film over night, at-80 DEG C of incubations.

Biochemical analysis-soybean: sample of tissue and extract AAD-12 (v1) albumen from soybean leaf.2,4-D have been smeared but N-2 leaf after being 1DAT gets leaf texture's sample of about 50 to 100mg from blade face.Take out end N-2 leaflet, and be cut into small pieces or 2 single hole punching press leaves dish (diameter is about 0.5cm), freezing on dry ice immediately.Correspondingly complete protein analysis (ELISA and Western analysis).

T1 filial generation is assessed: allow T0 plant self-pollinates to obtain T1 family.Use phosphine oxamate as selective agent, use with 560gai/ha at Vl-V2 vegetative stage, carry out progeny testing (compartment analysis).The plant of survival is measured further to 2,4-D tolerances of the one or more vegetative stages from V2-V6.Seed is produced, to allow to carry out weed killer herbicide inspection widely to genetically engineered soybean by self-pollination.

AAD-12 (v1) transgenosis Maverick bean plant is produced by agrobacterium-mediated conversion system.The T0 Plant Tolerance that obtained to 2,4-D of field fertilizing standards, and creates the seed that can educate up to 2 times.The frequency of the transgenic soy bean plant that can educate is up to 5.9%.Confirm that AAD1-12 (v1) gene integration is in soybean gene group through Southern engram analysis.This analysis shows that most of genetically modified plants contain low copy number.Go out the ELISA positive with the plant performance of AAD-12 (v1) antibody screening, in Western analyzes, present correct band.

The conversion of embryo's generation soybean callus of method for transformation 2-aerosol bundle mediation: as U.S. Patent number 6,809, described in 232 (Held etc.), the construct provided herein can be provided, complete cultivation and the beam treatment (beaming) thereafter of embryo's generation soybean callus, to create transformant.

Method for transformation 3-biolistic bombardment soybean: this hypocotyl meristem that mature seed can be used to originate has come (McCabe etc. (1988)).Follow the biolistic bombardment method set up, it is expected to the recovery of the bean plant transformed.

The conversion of method for transformation 4-whisker mediation: the method that can describe according to (2005) such as previous Terakawa carries out whisker preparation and whisker transforms.Follow the biolistic bombardment method set up, it is expected to the recovery of the bean plant transformed.

The surface sterilization 1 minute in 70% ethanol of Maverick seed, to be immersed in 1% clorox 20 minutes subsequently, then to rinse 3 times with sterile distilled water.Seed soaks 18-20 hour in distilled water.Plumular axis is excised, by removing primary leaf exposed top ends meristematic tissue from seed.In the 5-cm culture dish containing 12ml medium, plumular axis is placed on [BM:MS (Murashige and Skoog1962) basal salt media, 3% sucrose and 0.8% plant gel Sigma in bombardment medium, pH5.7], top is pointed in top zone.

Method for transformation 5-can according to former method (Khalafalla etc. 2005; El-Shemy etc. 2004,2006) optimize the conversion of embryo callus of particle bombardment mediation.

Embodiment 8

AAD-12 (v1) in cotton

Cotton Transformation scheme: make cotton seeds (Co310 genotype) surface sterilization 1 minute in 95% ethanol, flushing, to sterilize with 50% commodity bleaching agent 20 minutes, then rinse three times with sterile distilled water, make thereafter that its G medium (table 21) in MagentaGA-7 container is upper to be sprouted and at 40-60 μ E/m ²high light intensity under maintain, the photoperiod is set at 16 h light of 28 DEG C and 8 h dark.

From seedling segregant leaf segment section (about 5mm) square of 7-10 age in days to M liquid liquid nutrient medium (table 21) in petri diss (Nunc, money number 0875728).The sections (about 30 minutes) cut with Agrobacterium solution process, transfers to thereafter in semi-solid M medium (table 21) and carries out Dual culture 2-3 days.After Dual culture, sections is transferred to MG medium (table 21).With carbenicillin as the antibiotic killing agrobacterium, careless ammonium phosphine is the selective agent of the Growth of Cells only allowed containing metastatic gene.

The preparation of agrobacterium: with microbionation 35mlY medium (table 21) (containing streptomycin (100mg/ml stores liquid) and erythromycin (100mg/ml stores liquid)) of 1 collarium, spend the night 28 DEG C of growths in darkness, shake at 150rpm simultaneously.Agrobacterium solution poured in second day into aseptic oakridge to manage in (Nalge-Nunc, 3139-0050) and in BeckmanJ2-21 with 8,000rpm centrifugal 5 minutes.Outwell supernatant and precipitation be resuspended in also vortex concussion in 25mlM liquid (table 21).An aliquot is put into Glass Culture Tubes (Fisher, 14-961-27) for Klett reading (Klett-Summerson, model 800-3).With M liquid culture medium, new suspension being diluted to Klett meter reading is every ml10 ⁸individual colony-forming units, cumulative volume 40ml.

After three weeks, be separated the callus from cotyledon sections and be transferred to fresh MG medium.Callus is transferred on MG medium and is cultivated 3 weeks again.Parallel relatively in, can to MG culture media supplemented 2,4-Dichlorophenoxy propionic acid (adding medium with 0.01 and 0.05mg/L concentration) is to compensate 2, the degraded of 4-D, this is because 2,4-Dichlorophenoxy propionic acid is not the substrate of AAD-12 enzyme, and 2,4-Dichlorophenoxy propionic acid more has activity to cotton than 2,4-D.Another relatively in, compared with standard medium, be placed on and do not reduce containing the sections display callus on the MG medium of growth regulator, but still have callus growth.Then callus is transferred to CG medium (table 21), and transferred to fresh Selective agar medium after three weeks.Again after three weeks, callus is transferred to the D medium (table 21) of shortage plant growth regulator for embryonic callus induction.This medium forms embryo callus after 4-8 week, non embryogenic callus can be different from according to the color of its yellowish white and particulate cellular.After this very fast embryo starts regeneration, and color is significant green.Cotton regenerated and formation embryo may need the time, and one of method accelerating this process is to organizing applying to coerce.Drying is the method that common realization is coerced, and the method is by using less medium and/or adopting multiple plate sealing means (adhesive tape and Parafilm) to change the microenvironment of tissue and plate.

Be separated larger, well-developed embryo, transfer to raw embryo in DK medium (table 21).After 3 weeks, the embryo of sprouting is transferred in fresh culture and sprouts and take root by (or when embryo occurs).After 4-8 week, any well-developed plant is transferred in soil and is cultured to maturation.In ensuing two or three months, plant has grown to a certain degree, can spray to determine whether it has 2,4-D resistance it.

Cell transformation: start some experiments, in these experiments with the agrobacterium process cotyledon sections containing pDAB724.More than 2000 sections obtained thus use different growth hormone option process to breed pDAB724 cotton healing tissue, and these options are: 0.1 or 0.5mg/LR-2,4-Dichlorophenoxy propionic acid, standard 2,4-D concentration and without growth hormone process.Owing to comprising pat gene in construct, select callus with careless ammonium phosphine.Callus line analyses (form with PCR and Invader) is used to determine and confirm whether this gene exists at callus phase; Then embryogenetic callus strain is sent to and carry out Western analysis.Dry technology is used to coerce embryogenetic cotton healing tissue, to improve the quality and quantity that reclaim tissue.Utilize Western to analyze the expression of AAD-12 (v1) gene, complete PTU has been screened to about 200 callus events.

Plant regeneration: AAD-12 (v1) the cotton strain producing plant by such scheme is delivered to greenhouse.For proving that AAD-12 (v1) gene provides 2 in cotton, the resistance of 4-D, with sending 560gae/ha2, the crawler type sprayer of 4-D sprays AAD-12 (v1) vegetable lamb and wild type cotton plant with the sprinkling volume of 187L/ha.3 days and 14 days assessment plants after treatment.The plant self-pollinates of surviving under 2,4-D of selection ratio is made to produce T1 seed or produce F1 seed with the outbreeding of original seed cotton strain.Plant the seed produced subsequently and also assess Herbicid resistant as previously mentioned.HT or the IR proterties that AAD-12 (v1) event can be expected with other combines.

Embodiment 9

The Agrobacterium transformation of other crops

Consider disclosing of this theme, other crops of technical transform known in the art can be used according to the invention of this theme.Agrobacterium-mediated rye is transformed, consults such as Popelka and Altpeter (2003).For agrobacterium-mediated transformation of soybean, consult such as Hinchee etc., 1988.Agrobacterium-mediated Chinese sorghum is transformed, consults such as Zhao etc., 2000.For agrobacterium-mediated Barley transformation, consult such as Tingay etc., 1997.Agrobacterium-mediated wheat wheat is transformed, consults such as Cheng etc., 1997.For agrobacterium-mediated rice conversion, consult such as Hiei etc., 1997.

The latin name of these and other plants provides below.Should be clear and definite, these and other (non-agrobacterium) transformation technologies can be used for AAD-12 (v1) to be transformed in such as these or other plant, include but not limited to, corn (Zeamays), wheat (Triticumspp.), paddy rice (Oryzaspp. and Zizaniaspp.), barley (Hordeumspp.), cotton (Abromaaugusta and Gossypiumspp.), soybean (Glycinemax), sugar is used and garden beet (Betaspp.), sugarcane (Arengapinnata), tomato (Lycopersiconesculentum) and other kinds, tomatillo (Physalisixocarpa), yellow water eggplant (Solanumincanum) and other kinds, with tree tomato (Cyphomandrabetacea), potato (Solanumtuberosum), sweet potato (Ipomoeabatatas), rye (Secalespp.), capsicum (Capsicumannuum, chinense, and frutescens), lettuce (Lactucasativa, perennis, and pulchella), cabbage (Brassicaspp.), celery (Apiumgraveolens), eggplant (Solanummelongena), peanut (Arachishypogea), Chinese sorghum (all Chinese sorghum species), clover (Medicagosativa), carrot (Daucuscarota), beans (Phaseolusspp. and other genus), oat (Avenasativa and strigosa), pea (Pisum, Vigna, and Tetragonolobusspp.), sunflower (Helianthusannuus), pumpkin (Cucurbitaspp.), cucumber (Cucumissativa), tobacco (Nicotianaspp.), arabidopsis (Arabidopsisthaliana), turfgrass (Lolium, Agrostis, Poa, Cynodon, belong to other), clover (Trifolium), vetch (Vicia).These plants with such as AAD-12 (v1) gene are included in the invention of this theme.

In the cropping system of many fallen leaves and evergreen timber, AAD-12 (v1) likely can increase the practicality that should use in season of primary auxin weed killer herbicide.Triclopyr, 2,4-D and/or fluroxypyr resistance wood species used these weed killer herbicides and the flexibility of the sorrow of not damaged by increasing top (over-the-top).These species include but not limited to: alder (Alder species (Alnusspp.)), Ash (Ash species (Fraxinusspp.)), white poplar and poplar species (Populus species (Populusspp.)), fagus (beech species (Fagusspp.)), birch (Betula species (Betulaspp.)), cherry (Prunus species (Prunusspp.)), eucalyptus (eucalyptus species (Eucalyptusspp.)), hickory (hickory species (Caryaspp.)), maple (maple species (Acerspp.)), Oak Tree (oak species (Quercusspp)) and pine tree (Pinus species (Pinusspp)).Be used for growth hormone resistance viewing and admiring the selectivity Weeds distribution of kind and solid kind also within the scope of the invention.Example includes but not limited to: rose (Rosa spp (Rosaspp.)), summer cypress (burningbush) (Euonymus species (Euonymusspp.)), petunia (Petunia species (Petuniaspp)), Qiu Haishang (Begonia species (Begoniaspp.)), cuckoo (Genus Rhododendron species (Rhododendronspp)), Malus spectabilis or apple (Malus species (Malusspp.)), pears (pear species (Pyrusspp.)), peach (Prunus species (Prunusspp)), with Aztec marigold (Tagetes species (Tagetesspp.)).

Embodiment 10

Other evidences of wonderful result: AAD-12 is to AAD-2

AAD-2 (v1) initial clones: identify from ncbi database and only have another gene of the homologue of 44% amino acid identities (consulting ncbi.nlm.nih.gov network address, accession number AF516752) as with tfdA.For keeping consistency, this gene is claimed to be AAD-2 (v1) in this article.By following steps determination homogeneity percentage: first AAD-2 and tfdADNA sequence (being respectively SEQIDNO:12 and the GENBANK accession number M16730 of PCT/US2005/014737) is translated into protein (being respectively SEQIDNO:13 and the GENBANK accession number M16730 of PCT/US2005/014737), the ClustalW in VectorNTI software kit is then used to carry out Multiple sequence alignments.

Slow-growing Soybean rhizobia (Bradyrhizobiumjaponicum) bacterial strain containing AAD-2 (v1) gene is available from northern area research laboratory (NorthernRegionalResearchLaboratory) (NRRL, bacterial strain B4450).According to NRRL scheme recovery freeze-drying bacterial strain and in 20% glycerine, be stored in-80 DEG C for internal use as Dow bacterial isolates DB663.Then, from then on freezing storage is got a collarium cell and is separated at the flat lining out of tryptic soy agar, and 28 DEG C of incubations 3 days.By single colony inoculation in the 100ml tryptic soy broth in 500ml tri-baffled flask, with 150rpm on plate shaker 28 DEG C be incubated overnight.Use the Gram-negative scheme of the DNeasy kit (Qiagen catalog number (Cat.No.) 69504) of Qiagen from being wherein separated STb gene.Design following primer with amplified target gene from genomic DNA, forward: 5'ACTAGTAACAAAGAAGGAGATATACCATGACGAT3'[(brjap5'(speI) SEQIDNO:14 (adding SpeI restriction site and ribosome bind site (RBS)) of PCT/US2005/014737] and oppositely: the 5'TTCTCGAGCTATCACTCCGCCGCCTGCTGCTGC3'[(brjap3'(xhoI) SEQIDNO:15 (adding XhoI site) of PCT/US2005/014737].

Reaction by setting up 50 microlitres as follows: FailSafe buffer solution 25 μ l, various primer 1 μ l (50ng/ μ l), gDNA1 μ l (200ng/ μ l), water (H ₂o) 21 μ l, Taq polymerase 1 μ l (2.5 units/μ l).Three kinds of FailSafe buffer solution-A, B and C are used in three independently reaction.Then FailSafePCR system (Epicenter catalog number (Cat.No.) F599100) is used to carry out the PCR:95 DEG C of thermal denaturation of 3.0 minutes circulation under the following conditions; 30 95 DEG C 1.0 minutes, 50 DEG C 1.0 minutes, 72 DEG C circulations of 1.5 minutes; Then be 72 DEG C of final circulations of 5 minutes.The PCR primer of the about 1kb obtained is cloned into pCR2.1 (Invitrogen catalog number (Cat.No.) K4550-40) (scheme according to supporting), with the TOP10F' Escherichia coli of Competent as host strain, verifies nucleotide sequence.

In picking 10 white colony to 3 obtained μ lLuria meat soup+1000 μ g/ml ampicillin (LBAmp), and 37 DEG C of shake overnight incubation.Use NucleospinPlus Plasmid Miniprep Kit (BDBiosciences catalog number (Cat.No.) K3063-2) according to supporting scheme plasmid purification from each culture.Restrictive diges-tion is carried out to confirm the existence of PCR primer in pCR2.1 carrier to the DNA be separated.With Restriction Enzyme EcoRI (NewEnglandBiolabs catalog number (Cat.No.) R0101S) digested plasmid DNA.Use M13 forward [5'GTAAAACGACGGCCAG3'] (SEQIDNO:6) and reverse [5'CAGGAAACAGCTATGAC3'] (SEQIDNO:7) primer according to the explanation of manufacturer, check order with BeckmanCEQQuickStart kit (BeckmanCoulter catalog number (Cat.No.) 608120).In order to internal consistency, give this gene order and the new common name AAD-2 (v1) of respective egg white matter thereof.

Completing of the binary vector of AAD-2 (v1): pcr amplification AAD-2 (v1) gene from pDAB3202.In PCR reaction, change in primer, to introduce AflIII and SacI restriction site respectively in 5' primer and 3' primer.Consult PCT/US2005/014737.Use FailSafePCR system (Epicentre), utilize primer " NcoIofBrady " [5'TATACCACATGTCGATCGCCATCCGGCAGCTT3'] (SEQIDNO:14) and " SacIofBrady " [5'GAGCTCCTATCACTCCGCCGCCTGCTGCTGCAC3'] (SEQIDNO:15) to amplify DNA fragmentation.PCR primer is cloned in pCR2.1TOPOTA cloning vector (Invitrogen), use BeckmanCoulter " DyeTerminatorCycleSequencingwithQuickStartKit " sequencing reagent, with M13 forward and M13 reverse primer authentication sequence.Sequencing data identifies the clone (pDAB716) that has correct sequence.Then by AflIII/SacIAAD-2 (v1) gene fragment clone in NcoI/SacIpDAB726 carrier.The construct (pDAB717) obtained is verified: AtUbi10 promotor: NtOSM5'UTR:AAD-2 (v1): NtOSM3'UTR:ORF1polyA3'UTR by restrictive diges-tion (with NcoI/SacI).This construct is cloned in binary vector pDAB3038 with the form of NotI-NotIDNA fragment.To the construct obtained (pDAB767): AtUbi10 promotor: NtOSM5'UTR:AAD-2 (v1): NtOSM3'UTR:ORF1polyA3'UTR:CsVMV promotor: PAT:ORF25/263'UTR carries out restrictive diges-tion (with Nod, EcoRI, HinDIII, NcoI, PvuII and SalI) to verify correct direction.Then the construct completed (pDAB767) is transformed in agrobacterium.

The arabidopsis that assessment transforms: the AAD-12 (v1) optimized with plant of plantation fresh harvest or the T1 seed of natural A AD-2 (v1) genetic transformation, then selects phosphine oxamate resistance as previously mentioned.2,4-D (50-3200gae/ha) of the different ratio of plant Random assignment.Weed killer herbicide is used with 187L/ha sprayed volume by crawler type sprayer.Use 2,4-D is business dimethylamine salt preparation (456gae/L, NuFarm, StJoseph, Mo.), is mixed in 200mMTris buffer solution (pH9.0) or 200mMHEPES buffer solution (pH7.5).

Relative to conversion and unconverted check clone, AAD-12 (v1) and AAD-2 (v1) provides 2, the 4-D resistances that can detect really, but, the ability that each construct gives 2,4-D resistance to T1 arabidopsis thaliana individuality has very large changeability.Surprisingly, from the frequency of quite tolerant plant and ensemble average damage, AAD-2 (v1) and AAD-2 (v2) transformant all much lower than AAD-12 (v1) gene to the resistance of 2,4-D.The plant that AAD-2 (v1) transforms all is failed at 200gae/ha2, survive under 4-D, and Overall population damage is about 83% (consulting PCT/US2005/014737) relative not damaged (the range estimation damage of <20%).On the contrary, during with 3,200gae/ha2,4-D process AAD-12 (v1), its population average lesion is about 6%.Plant optimize AAD-2 (v2) tolerance slightly improve than natural gene, but, AAD-12 and AAD-2 plant optimized gene relatively show that AAD-12 (v1) has significant advantage in plant.

Consider that external comparison of AAD-2 (v1) (consulting PCT/US2005/014737) and AAD-12 (v2) shows that the two all can effectively degrade 2,4-D, and all have the S type specificity of chiral aryloxy alkanoic acid substrate, these results are out of expectation.In individual T1 plant, AAD-2 (v1) is with different horizontal expressions, but the protein of this expression provides the protection to 2,4-D damage hardly.The protein expression level (in plant) of the AAD-2 gene that natural A AD-2 gene and plant are optimized does not have obvious substantial differences (consulting PCT/US2005/014737).These data have proved discovery in the early time, and because these find, in plant, produce AAD-12 (v1) functional expression and the consequent Herbicid resistant to 2,4-D and pyridine fluoroacetic acid class weed killer herbicide are all beyond expectation.

Embodiment 11

(in-crop) application in the crop of phenoxy auxin herbicide in the soybean only using AAD-12 (v1) to transform, cotton and other dicotyledonous crops.

AAD-12 (v1) makes people can usually to 2, use phenoxy auxin herbicide (as 2 in the crop of 4-D sensitivity, 4-D and MCPA) and pyridine oxygen basal growth element (Triclopyr and fluroxypyr), directly to control the broad leaved weed of wide spectrum.280 arrive 2,4-D of 2240gae/ha uses most broad leaved weed species that can control to exist in agricultural environment.More typically, 560-1120gae/ha is used.For Triclopyr, the scope of rate of application is generally from 70 to 1120gae/ha, is more generally 140-420gae/ha.For fluroxypyr, the scope of rate of application is generally from 35 to 560gae/ha, is more generally 70-280gae/ha.

An advantage of this extra instrument is that the cost of broadleaf herbicide composition is extremely low, and when it uses with higher rate, 2 of higher rate, 4-D, Triclopyr and fluroxypyr can provide the potential control action remaining weeds (short-livedresidualweed) short life cycle, but not residual weed killer herbicide, as glyphosate, control action be there is no to the weeds sprouted afterwards.This instrument additionally provides a kind of mechanism and herbicide action pattern is combined with the convenience of HTC, as the integrated management policy for Herbicid resistant and weeds succession.

Another advantage that this instrument provides wide spectrum broad leaved weed control weed killer herbicide (such as, 2,4-D, Triclopyr and fluroxypyr) and normally used residual Weeds distribution weed killer herbicide bucket can be mixed.These weed killer herbicides general before planting or plantation time use, but may exist and the weeds having occurred and established large Tanaka before plantation, its effect is often lower.By expanding the purposes of these aryloxy group growth hormone weed killer herbicides, when making it comprise plantation, emerge before or use before plantation, the flexibility of residual Weeds distribution program is increased.One skilled in the art will realize that residual weed killer herbicide program can be different according to crop interested, but typical program comprises chloroacetamide (chloracetmide) weed killer herbicide and dinitraniline weedicide family, also comprises the weed killer herbicide such as clomazone and sulfentrazone and multiple ALS inhibition, PPO inhibition and HPPD inhibition weed killer herbicide.

Other benefits may comprise: to need to use after aryloxy acetic acid growth hormone herbicide application, before plantation 2,4-D, the tolerance (consulting previous embodiment) of Triclopyr or fluroxypyr; And due to not exclusively caused less to the pollution damage problem of dicotyledonous crops of the drum cleaning containing 2,4-D, Triclopyr or fluroxypyr.Dicamba (with other weed killer herbicides many) still can be used for continuing the dicotyledonous crops volunteer plant (volunteer) that control has transformed AAD-12 (v1).

Those skilled in the art also will appreciate that, above example be applicable to any to 2,4-D (or other aryloxy group growth hormone weed killer herbicides) if responsive but transformed by AAD-12 (v1) stable gene, can by crop of its protection.The technical staff in Weeds distribution field will appreciate that, AAD-12 (v1) transforms and makes to be used alone or to become possibility with the multiple phenoxy group of weed killer herbicide conbined usage or pyridine oxygen basal growth element Commercial herbicides.The concrete ratio representing other weed killer herbicides of these chemistry is by determining at the weed killer herbicide label of CPR (CropProtectionReference) book or similar compilation inediting or any bibliography about crop protection (such as from the CropProtectionGuide (2005) of Agriliance) that is commercial or academic space.Each substituting weed killer herbicide that can use in HTC due to AAD-12 (v1), no matter by be used alone, bucket mixes or use successively, be all deemed to be within the scope of the present invention.

Embodiment 12

Phenoxy auxin and pyridine oxygen basal growth element weed killer herbicide are applied only transforming in the crop in the corn of AAD-12 (v1), paddy rice and other unifacial leaf species

In a similar fashion, with AAD-12 (v1) transforming gramineous species (such as but be not limited only to corn, paddy rice, wheat, barley or turfgrass and herbage), permission is used efficient phenoxy group and pyridine oxygen basal growth element in the uncertain crop of selectivity at typical condition.Most species gramineae to growth hormone weed killer herbicide as phenoxy auxin (namely 2,4-D) has natural tolerance.But, due to the crop-selective of low relative levels, cause because time of application window shortens or unacceptable damage risk and make the use in these plants little.Therefore, with AAD-12 (v1) transforming monocot crop, just can use and the aforementioned treatment combination similar for dicotyledonous crops, such as, use 280 to 2240gae/ha 2,4-D, control most of broad leaved weed species.More generally use 560-1120gae/ha.For Triclopyr, the scope of rate of application is generally from 70 to 1120gae/ha, is more generally 140-420gae/ha.For fluroxypyr, the scope of rate of application is generally from 35 to 560gae/ha, is more generally 70-280gae/ha.

An advantage of this additional means is that the cost of broadleaf herbicide composition is extremely low, and 2,4-D of higher rate, the control action potential short-term being remained to weeds that provides of Triclopyr and fluroxypyr.By contrast, non-Residual-type weed killer herbicide (as glyphosate) does not provide the control action to the weeds sprouted afterwards.The convenience that this instrument additionally provides a kind of machine-processed herbicide action pattern and HTC carries out rotation, as the integrated management policy (no matter people whether rotation crop species) of Herbicid resistant and weeds succession in glyphosate tolerant crop/AAD-12 (v1) HTC federation policies.

Another advantage that this instrument provides wide spectrum broad leaved weed control weed killer herbicide (such as, 2,4-D, Triclopyr and fluroxypyr) and normally used residual Weeds distribution weed killer herbicide bucket can be mixed.These weed killer herbicides general before planting or plantation time use, but may exist and the weeds having occurred and established large Tanaka before plantation, its effect is often lower.By expanding the purposes of these aryloxy group growth hormone weed killer herbicides, when making it comprise plantation, emerge before or use before plantation, the flexibility of residual Weeds distribution program is increased.One skilled in the art will realize that residual weed killer herbicide program can be different according to crop interested, but typical program comprises chloroacetamide (chloracetmide) weed killer herbicide and dinitraniline weedicide family, also comprises the weed killer herbicide such as clomazone and sulfentrazone and multiple ALS inhibition, PPO inhibition and HPPD inhibition weed killer herbicide.

Corn, paddy rice and other monocotyledon tolerance to the increase of phenoxy group or pyridine oxygen basal growth element makes likely to use these weed killer herbicides in crop, and there is no the restriction of vegetative stage, do not have plant lodging yet, launching phenomenon such as the potential of the stem fragility of growth regulatory factor induction or the prop root of distortion etc. in mouse tail (" rat-tailing "), plant lodging, corn may.Each substituting weed killer herbicide that can use in HTC due to AAD-12 (v1), no matter by be used alone, bucket mixes or use successively, be all deemed to be within the scope of the present invention.

Embodiment 13

AAD-12 (v1) in paddy rice

Medium illustrates: with 1MKOH, the medium of use is adjusted to pH5.8, and solidifies with 2.5g/L plant gel (Sigma).Embryo callus is cultivated in the 100x20mm petri diss containing 40ml semisolid culturemedium.Paddy rice plantlet is cultivated in 50ml medium in Magenta box.Cell suspending liquid is remained in the 125ml conical flask containing 35ml liquid nutrient medium, rotate under 125rpm.Induction and maintenance Embryonal suspensor mass in 25 –, 26 DEG C of dark, carry out plant regeneration with 16 hours of photoperiod and whole plants cultivates (Zhang etc., 1996).

As described in forefathers (Li etc., 1993) NB basal medium in (but being revised as adaptively containing 500mg/L glutamine) induction and maintain embryo callus.Replacing containing useful 30g/L sucrose starting in the SZ liquid nutrient medium (Zhang etc., 1998) of maltose and keeping the cultivation that suspends.Height oozes medium (NBO) and is made up of NB medium, is added with mannitol and each 0.256M of sorbierite.The NB medium supplementing 50mg/L hygromycin B is selected Hygromycin B resistant callus 3-4 week.The medium be made up of NB medium (PRH50) carries out pre-regeneration one week, wherein NB medium is without 2,4-dichlorphenoxyacetic acid (2,4-D), but add 2mg/L6-benayl aminopurine (BAP), 1mg/L α-naphthaleneacetic acid (NAA), 5mg/L abscisic acid (ABA) and 50mg/L hygromycin B.Then by cultivating until shoot regeneration carrys out Regenerated plantlet regeneration culture medium (RNH50) is upper, regeneration culture medium contains NB medium and without 2,4-D, and supplements 3mg/LBAP, 0.5mg/LNAA and 50mg/L hygromycin B.Bud transferred to Murashige and Skoog basis salt and GamborgB5 vitamin containing half intensity, supplement in the root media of 1% sucrose and 50mg/L hygromycin B (1/2MSH50).

Tissue cultures is grown: by the ripe dry seed sterilizing in the japonica rice Taibei 309 cultivated species (OryzasativaL.japonicacv.Taipei309), as Zhang etc., described in 1996.Embryonal connective tissue is induced by the aseptic ripe rice paddy seed of dark culturing on NB medium.Elementary callus diameter being about 1mm shifts out from scultellum, is used for starting cell suspension in SZ liquid nutrient medium.Then maintenance suspension as described in Zhang (1995).3-5 days after a front squamous subculture, takes out the derivative embryonal connective tissue of suspension from liquid culture, and is placed on that NBO is high to be oozed in medium, forms the annulus of the about 2.5cm of diameter, bombard after cultivating 4h in petri diss.16-20 hour after bombardment, will organize from NBO media transfer to NBH50 hygromycin B Selective agar medium, guarantee by the surface bombarded upward, and incubation 14-17 days in the dark.Then be separated by the explant bombarded the callus making new advances and formed from original, and be placed on the neighbouring position on same medium.After 8-12 days, visual assessment is relatively fine and close, opaque callus, they is transferred in the pre-regeneration culture medium of PRH50, in the dark through 7 days.Then by the callus that becomes in finer and close and opaque growth on RNH50 regeneration culture medium under 16 hours of photoperiod squamous subculture, through 14-21 days.Regeneration bud (regeneratingshoot) is transferred in the Magenta box containing 1/2MSH50 medium.Be considered as compatriot from multiple plant of single explant regeneration, using they as one independently plant lines treat.If plant produces abundant, white root and grows vigorous on 1/2MSH50 medium, then this plant is assessed as and hph gene is positive.Once plantlet reaches the top of Magenta box, just they are transferred in the soil of 6-cm basin, keep 1 week under 100% humidity, then move on in growth room, under 14-h illumination under 30 DEG C and dark 21 DEG C keep 2-3 week, then transfer in the 13-cm basin in greenhouse.Collect seed, 37 DEG C of dryings one week before storage.

Microparticle bombardment: all bombardment BiolisticPDS-1000/He ^tMsystem (Bio-Rad, Laboratories, Inc.) is implemented.The gold grain of the diameter 1.0 microns of 3mg 100% ethanol is washed once, washes twice with sterile distilled water and be resuspended in 50 μ l water in the Eppendorf pipe of silicidation.5 g plasmid DNA (representing pDOW3303 (carrier containing Hpt) and the pDAB4101 (AAD-12 (v1)+AHAS) of 1:6 mol ratio), 20 μ l spermidines (O.lM) and 50 μ l calcium chloride (2.5M) are added in golden suspension.In incubation at room temperature mixture 10 minutes, precipitate 10 seconds with 10000rpm, be resuspended in 100% cold ethanol of 60 μ l, and give each huge carrier distribution 8-9 μ l.As described in (1996) such as Zhang, with 1100psi and 27 inches mercury vacuum bombardment tissue sample.

Post-emergent herbicide tolerance in the T0 paddy rice that AAD-12 (v1) transforms: use crawler type sprayer (being demarcated as 187L/ha) the Pursuit solution (in order to confirm the existence of AHAS gene) of 0.16% (volume/volume) of the lethal dose containing 1%SunitII (volume/volume) and 1.25%UAN (volume/volume) to spray the paddy rice plantlet of 3-5 leaf phase.After treatment 36 days (DAT), the grading of susceptibility or resistance is carried out.Deliver in greenhouse in 33 events 10 to the strong tolerance of Pursuit; Other the herbicide injury being then subject to varying level.Plant samples and carries out characterization of molecules, and 7 of identifying in these 10 events not only comprise AAD-12 (v1) PTU but also comprise whole AHAS code area.

AAD-12 (v1) hereditability in T1 paddy rice: filial generation test is carried out to 100 strain plants of 5 the T1 strains comprised in AAD-12 (v1) strain of AAD-12 (v1) PTU and AHAS code area.Crawler type sprayer is also used to spray 140gae/ha Imazethapyr as previously mentioned according to above program plantation seed.After 14DAT, antagonism and sensitive plant count.Determined, in tested 5 strains, have 2 to be separated (3R:1S) as single locus, dominant mendelian character by chi-square analysis.Determine as tested by hereafter 2,4-D tolerances, AAD-12 and AHAS selection marker thing be divided into from.

High by 2 in T1 paddy rice, the checking of 4-D tolerance: by following T1AAD-12 (v1) single isolated genes seat strain, namely pDAB4101 (20) 003 and pDAB4101 (27) 002 kinds plants in 3 inches of basins containing MetroMix medium.Spray with 140gae/ha Imazethapyr in the 2-3 leaf phase.Remove invalid event, spray 1120,2240 or 4480gae/ha2,4-DDMA (be respectively 2,4 and 8 times of general business usage rate) with the crawler type sprayer being set to 187L/ha to each individuality in the V3-V4 phase.In 7 and 14DAT, plant is marked, and compare with the unconverted business rice varieties `Lamont` as negative control plant.

Damage data (table 22) display AAD-12 (v1) transformed lines is stronger than unconverted contrast to the tolerance of 2,4-DDMA of height ratio.The tolerance of pDAB4101 (20) 003 strain to high level 2,4-D is stronger than pDAB4101 (27) 002 strain.Data also show that 2,4-D tolerance stablized at least two generations.

Tissue harvest, DNA are separated and quantitatively: flesh tissue is placed in test tube, and 4 DEG C of freeze-drying 2 days.After organizing bone dry, in test tube, place tungsten pearl (Valenite), and with Kelco ball mill, sample is dry grinded 1 minute.Then standard DNeasyDNA separable programming (Qiagen, Dneasy69109) is carried out.Then, with PicoGreen (MolecularProbesP7589), the DNA equal portions extracted are dyeed, and scan in fluorescence photometer (BioTek) together with known standard items, obtain the concentration in units of ng/ μ l.

AAD-12 (v1) expresses: use ELISA trace to analyze AAD-12 to all 33 T0 transgenic rice lines and 1 non-transgenic reference and express.In the clone of 20 strains, AAD-12 detected, but do not detect in the strain check plant of the Taibei 309.20 strains have some clones to Imazethapyr tolerance, and wherein 12 strains are expressed AAD-12 albumen, are that AAD-12PCRPTU is positive and are that AHAS code area is positive.The scope of expression is 2.3 to the 1092.4ppm of total soluble protein.

PDAB4101 rice plants is to 2, the land for growing field crops tolerance of 4-D and Triclopyr weed killer herbicide: at the Wayside of the state of Mississippi, carries out land for growing field crops level resistance test with AAD-12 (v1) event pDAB4101 [20] and a wild rice (Clearfield131) (non-transgenic imidazolinone-resistance kind).Experimental design is the random block design completely of single repetition.Herbicide treatment adds untreated contrast with 2,4-D (dimethylamine salts) of 2 times of ratios of 2240gae/ha use with the Triclopyr that 560gae/ha uses.In each herbicide treatment, plant planter is used to plant two row T1 for pDAB4101 [20] and two row Clearfield rice with 8 inches of line spaces.PDAB4101 [20] rice comprises the selection marker thing of AHAS gene as AAD-12 (v1) gene.Imazethapyr is used as selective agent to remove any AAD-12 (v1) Null plants in district in 1 leaf phase.When paddy rice arrived for 2 leaf phase, use compressed air knapsack type sprayer to send 187L/ha carrier bulk with 130-200kpa pressure and carry out herbicide treatment.Within 7,14 and 21 days, carry out range estimation damage grading after application.

The response of AAD-12 (v1) event to 2,4-D and Triclopyr is shown in table 23.2, the 4-D major injuries that use with 2240gae/ha (thinking that 4 times to business usage rate) non-transformed rice strain (Clearfield) (at 7DAT30%, at 15DAT35%).AAD-12 (v1) event does not observe damage in 7 or 15DAT, proves the excellent tolerability to 2,4-D.The Triclopyr (560gae/ha) of 2 times of ratios has significantly damaged non-transformed paddy rice (at 7DAT15%, at 15DAT25%).AAD-12 (v1) event does not observe damage in 7 or 15DAT, proves the excellent tolerability of the Triclopyr to 2 times of ratios.

These results show that AAD-12 (v1) rice transformation shows 2,4-D and Triclopyr (under causing Clearfield paddy rice seriously to estimate the ratio of damage) high-caliber resistance.Also prove that multiple herbicide tolerance gene can superpose the resistance of the effective chemicals provided wide spectrum with AAD-12I in multiple species.

Embodiment 14

AAD-12 (v1) in canola

Canola transforms: utilize agrobacterium-mediated conversion and plasmid pDAB3759, to give AAD-12 (v1) genetic transformation colea Nexera*710 mutation (Brassicanapusvar.Nexera*710) to 2,4-D resistance.Construct contains by the AAD-12 of CsVMV promoters driven (v1) gene and the Pat gene by AtUbi10 promoters driven, and by the EPSPS glyphosate resistance proterties of AtUbilO promoters driven.

By seed 10% commercially available bleaching agent surface sterilizing 10 minutes, with sterile distilled water rinsing 3 times.Then, seed is placed on the MS basal medium (MurashigeandSkoog, 1962) of half strength, and maintains and be set as 25 DEG C, the photoperiodic growth protocols of 16 h light/8 h dark.

Cut hypocotyl sections (3-5mm) from the seedling of 5-7 age in days, and be placed in callus inducing medium K1D1 (MS medium adds 1mg/L kinetin and 1mg/L2,4-D) upper 3 day, as pretreatment.Then these sections are transferred to Pi Shi flat board, with the agrobacterium Z707S containing pDAB3759 or the process of LBA4404 bacterial strain.Agrobacterium spends the night at 28 DEG C of dark-grown on 150rpm shaking table, in the medium resuspended subsequently.

With agrobacterium process hypocotyl sections after 30 minutes, they are put back to callus inducing medium upper 3 day.After Dual culture, sections is placed on K1D1TC (callus inducing medium containing 250mg/L carbenicillin and 300mg/L Ticarcillin/Clavulanate Acid), makes it recover 1 week or 2 weeks.Or, sections is directly placed in (the above-mentioned medium containing 1mg/LHerbiace) on Selective agar medium K1D1H1.Carbenicillin and Ticarcillin/Clavulanate Acid are the antibiotic for killing agrobacterium.Selective agent Herbiace allows the Growth of Cells be converted.

Then be placed in there is the hypocotyl sections of callus on B3Z1H1 (Herbiace of the MES [2-(N-morpholino) ethyl sulfonic acid] of the benayl aminopurine of MS medium, 3mg/L, the zeatin of 1mg/L, 0.5gm/L, the silver nitrate of 5mg/L, 1mg/L, carbenicillin and Ticarcillin/Clavulanate Acid) shoot regeneration medium (shootregenerationmedium).After 2-3 week, bud (shoot) starts regeneration.Hypocotyl sections is transferred on B3Z1H3 medium (Herbiace of the MES [2-(N-morpholino) ethyl sulfonic acid] of the benayl aminopurine of MS medium, 3mg/L, the zeatin of 1mg/L, 0.5gm/L, the silver nitrate of 5mg/L, 3mg/L, carbenicillin and Ticarcillin/Clavulanate Acid) together with described bud (shoot), regrowth 2-3 week.

Cut bud (shoot) from hypocotyl sections, and transfer on bud elongation medium MESH5 or MES10 (MS, 0.5gm/LMES, 5 or 10mg/LHerbiace, carbenicillin, Ticarcillin/Clavulanate Acid), cultivate 2-4 week.The bud (elongatedshoot) extended above is cultivated to induce root at MSI.1 (having the MS of the indolebutyric acid of 0.1mg/L).Be transplanted in soil when plant has the good root system set up.Plant tames 1-2 week in Conviron under controlled environmental condition, is then transferred to greenhouse.

Analysis of molecules-canola materials and methods: the separation of the DNA of results tissue is with quantitative.Flesh tissue is placed in test tube, and 4 DEG C of freeze-drying 2 days.After organizing bone dry, in test tube, place tungsten pearl (Valenite), and with Kelco ball mill, sample is dry grinded 1 minute.Then standard DNeasyDNA separable programming (Qiagen, DNeasy69109) is carried out.Then, with PicoGreen (MolecularProbesP7589), the DNA equal portions extracted are dyeed, and read in the fluorescence photometer (BioTek) with known standard items, obtain the concentration in units of ng/ μ l.

Polymerase chain reaction (PCR): use altogether 100ng STb gene as template.20mM is used often to plant primer and TakaraExTaqPCR polymerase kit (MirusTAKRR001A).Primer for AAD-12 (v1) code area PCR is (SEQIDNO:10) (forward) and (SEQIDNO:11) (oppositely).In 9700Geneamp thermal cycler (AppliedBiosystems), carry out PCR reaction: make sample experience 94 DEG C 3 minutes, 35 94 DEG C 30 seconds, 65 DEG C 30 seconds, 72 DEG C circulations of 2 minutes, and thereafter 72 DEG C 10 minutes.By the electrophoretic analysis PCR primer on 1% Ago-Gel that dyes with EtBr.There are 35 sample tests of the plant of AAD-12 (v1) event for positive from 35 strains.Three negative control sample tests are for negative.

ELISA: use the ELISA established described in previous section to detect the AAD-12 albumen in 5 different canola conversion of plant events.The scope of expression is from the 14ppm of total soluble protein (TSP) to more than 700ppm.The unconverted plant sample that three of parallel testing are different does not detect signal, shows that the antibody that uses in this mensuration and canola cellular matrix have minimum cross reactivity.Analyzed by Western and also confirm that these samples are for positive.The summary of result is shown in Table 24.

Post-emergent herbicide tolerance in the T0 canola that AAD-12 (v1) transforms: 45 T0 events in the event of personal construct pDAB3759 conversion in the future deliver to greenhouse, and allow it to adapt to a period of time in greenhouse.Make plant growth to occur 2-4 new, the leaf (namely plant is transitioned into greenhouse growth conditions from tissue cultures) that has normal appearance.Then use 2,4-D amine 4 commercial formulation of lethal dose with 560gae/ha rate process plant.Weed killer herbicide is used with the spraying altitude crawler type sprayer of the sprinkling volume of 187L/ha, 50cm.Lethal dose is defined as the ratio causing unconverted contrast >95% damage.

24 events tolerate 2,4-DDMA herbicide application.But some events really suffers minor injury recovers at 14DAT.Under controllable bag cultivation condition, event proceeds to T1 (with T2 generation) by self-pollination.

AAD-12 (v1) hereditability in canola: also 100 Progeny plants tests have been carried out to 11 T1 strains in AAD-12 (v1) strain.Sow seed and be transplanted to and be full of in 3 inches of basins of MetroMix medium.Then, as aforementioned 560gae/ha2,4-DDMA spray all plants.After 14DAT, antagonism and sensitive plant count.Determined, in tested 11 strains, have 7 to be separated (3R:1S) as single locus, dominant mendelian character by chi-square analysis.AAD-12 also can superpose with one or more other herbicide resistance genes as the heredity in multiple species of strong aryloxy alkanoic acid growth hormone resistant gene.

AAD-12 (v1) hereditability in canola: also 100 Progeny plants tests have been carried out to 11 T1 strains in AAD-12 (v1) strain.Sow seed and be transplanted to and be full of in 3 inches of basins of MetroMix medium.Then, as aforementioned 560gae/ha2,4-DDMA spray all plants.After 14DAT, antagonism and sensitive plant count.Determined, in tested 11 strains, have 7 to be separated (3R:1S) as single locus, dominant mendelian character by chi-square analysis.AAD-12 also can superpose with one or more other herbicide resistance genes as the heredity in multiple species of strong aryloxy alkanoic acid growth hormone resistant gene.

The checking of high 2,4-D tolerances in T1 canola: for T1AAD-12 (v1), using the earthing of seeds of 5-6mg, sowing and add the top layer of skim SunshineMix#5 medium as soil.7 and 13 days after planting, select emerging plant with 560gae/ha2,4-D.

Surviving plants is transplanted in 3 inches of basins containing MetroMix medium.By the surviving plants from T1 filial generation, they were selected with 560gae/ha2,4-D, were also transplanted to and were full of in 3 inches of basins of MetroMix soil.In the 2-4 leaf phase, spray plant with 280,560,1120 or 2240gae/ha2,4-DDMA.3 and 14DAT to plant scoring and compare with unconverted check plant.The damage data of the visible 14DATT1 event sampling of table 25.Data show that multiple event has strong resistance to 2240gae/ha2,4-D, and other events show to have not too strong tolerance to up to 2,4-D of 1120gae/ha.The plant transplanting of survival is to comprising 51/4 of MetroMix medium " to be placed in under growth conditions identical in the past in basin, and self-pollination to be only to produce homozyous seed.

PDAB3759 canola plant is to 2,4-D, 2, the land for growing field crops tolerance of 4-Dichlorophenoxy propionic acid, Triclopyr and fluroxypyr weed killer herbicide: at the Fowler of Indiana State, carries out land for growing field crops level resistance test to two AAD-12 (v1) events 3759 (20) 018.001 and 3759 (18) 030.001 and a wild type canola (Nex710).Experimental design is 3 complete block design of randomization repeated.Herbicide treatment comprise with 280,560,1120,2240 and 4480gae/ha use 2,4-D (dimethylamine salts), with 840gae/ha use Triclopyr, with 280gae/ha use fluroxypyr and untreated contrast.In each herbicide treatment, on 8 inches of line spaces with four lines sower plant single 20ft capable/event 3759 (18) 030.0011,3759 (18) 018.001 of event and wild-type lines (Nex710).When the canola arrival 4-6 leaf phase, use compressed air knapsack type sprayer to send 187L/ha carrier bulk with 130-200kpa pressure and carry out herbicide treatment.Within 7,14 and 21 days, carry out range estimation damage grading after application.

The response of canola to 2,4-D, Triclopyr and fluroxypyr is shown in table 26.2, the 4-D major injuries that use with 2240gae/ha (being considered as 4 times of ratios) wild type canola (Nex710) (at 14DAT for 72%).All AAD-12 (v1) event all shows the outstanding tolerance to 2,4-D at 14DAT, and the average lesion observed at 1,2 and 4 times of ratio is respectively 2,3 and 2%.Triclopyr (840gae/ha) major injury of 2 times of ratios wild type canola (be 25% at 14DAT).The display of AAD-12 (v1) event has tolerance (at 14DAT two event average lesion 6%) to the Triclopyr of 2 times of ratios.The fluroxypyr used with 280gae/ha causes the major injury (37%) of non-transformed strain at 14DAT.AAD-12 (v1) event is presented at 5DAT tolerance to be increased (average 8% damage).

These results show, be lethal for non-transformed canola or cause serious epinasty deformity 2,4-D, under Triclopyr and fluroxypyr ratio, AAD-12 (v1) transformation event shows high-caliber tolerance.The relative potency of AAD-12 display is 2,4-D> Triclopyr > fluroxypyr.

Embodiment 15

The conversion of AAD-12 soybean event DAS-68416-4 and selection

Transformed by agrobacterium-mediated soybean cotyledon node explant and create genetically engineered soybean (Glycinemax) event DAS-68416-4.With unloading first agrobacterium bacterial strain EHA101 (Hood etc., 2006) start conversion, this bacterial strain carries the binary vector pDAB4468 (Fig. 2) with selection marker thing (pat) and the gene of interest (AAD-12) in T chain DNA district.

Carry out agrobacterium-mediated conversion.In brief, soya seeds (Maverick cultivated species) is sprouted on minimal medium, segregant leaf segment, and use Agrobacterium infection.Bud starts (shootinitiation) medium, bud extends (shootelongation) medium and root media is added with cefotaxime, Ticarcillin/Clavulanate Acid and vancomycin, for removing agrobacterium.Phosphine oxamate is utilized to select to suppress the growth of non-transformed bud (non-transformedshoot).The bud of selection is transferred to make root development on root media, then transfer on soil mixture to make plantlet tame.

The terminal leaflet (terminalleaflet) of selected plantlet is smeared with phosphine oxamate, to screen the transformant of presumption.The plantlet filtered out is transferred to greenhouse, makes it tame, then smear leaf to confirm tolerance again with phosphine oxamate, be considered as the transformant estimated.To the plant sampling of screening, carry out analysis of molecules and confirm selection marker thing gene and/or gene of interest.Allow T0 plant in greenhouse self-pollination to produce T1 seed.

Make T1 plant backcross and gene transgression in breeding kind matter (Maverick).This event, i.e. soybean event DAS-68416-4 produce from independently transforming separated strain.Select this event to be feature based on its uniqueness, such as single insertion point, normal Mendel are separated and the brilliance of stable expression and the effect (comprising herbicide tolerant) in genotype background widely and varying environment place and agronomy performance combines.Other descriptions of soybean event DAS-68416-4 have been disclosed in WO2011/066384, are incorporated to herein by its full content by carrying stating.

Embodiment 16

The generation of 2008 agronomy data

2008, be positioned at Iowa, Illinois, the state of Indiana, the Nebraska State and Ontario, Canada (2 places) 6 places carried out about event DAS-68416-4 soybean and non-transgenic reference (Maverick mutation) agronomy research.Assessment agronomy decisive factor, comprise strain number (standcount)/colony's number (populationcount), seedling/plant vigor, plant height, lodging, the incidence of disease, insect damage and number of days before blooming, investigate the identity property of the soybean event DAS-68416-4 (use and do not use herbicide treatment) compared with control series Maverick.This research is called as agronomy experiment S1.

With the planting rates of the row of each 25 feet about 112 seeds plantation test soya seeds and contrast soya seeds, wherein line space is about 30 inches (75cm).In each place, 3 that set up each process are repeated plot, and wherein each plot is made up of the row of 2-25 foot.Plot, with the complete block of randomization (RCB) design arrangement, has unique randomization in each place.Each soybean plot with the similar Non-transgenic soybean of 2 row maturity for border.Whole test site by the similar Non-transgenic soybean of the relative maturity of at least 10ft around.

Herbicide treatment is used with the sprinkling volume (187L/ha) of about 20 gallons every acre.What these were used is intended to the industrial practice repeating maximum label rate (maximumlabelrate).Cross the mode of spreading fertilizer over the fields (broadcastover-the-topapplications) in top with 3 times and use 2,4-D, season, total amount was 3lbae/A.Before emerging and about V4 and R2 vegetative stage time use 1.0lbaeA (1,120g/ha) respectively.Excessively push up the mode of spreading fertilizer over the fields with 2 times and use phosphine oxamate, total amount 0.74lbai/A in season (828gai/ha).0.33lbai/A and 0.41lbai/A (374 and 454gai/ha) is used respectively at about V6 and R1 vegetative stage.

Use mixed model (SAS version 8; SASInstitute1999) variance analysis is carried out to the agronomy data of each field trial point.Those selected (Entry) is considered as fixed effect, and place, block in place, by those selected other position (location-by-entry) be designated as stochastic effects by place intra block other those selected (entry-by-blockwithinlocation).F inspection is used to assess the significance of overall process effect.Use t inspection in contrast and do not spray soybean event DAS-68416-4 (sprinkling), with the soybean event DAS-68416-4 (soybean event DAS-68416-4+ phosphine oxamate) of phosphine oxamate sprinkling, with 2, soybean event DAS-68416-4 (the soybean event DAS-68416-4+2 that 4-D sprays, soybean event DAS-68416-4 (both the soybean event DAS-68416-4+) transgenosis of 4-D) and with both phosphine oxamate and 2,4-D spraying contrasts (pairedcontrast) between those selected between two.False discovery rate (FDR) is also used to calculate corrected P value to control multiplicity (Benjamini and Hochberg, 1995).

To collecting from contrast, the agronomy data analysis not spraying soybean event DAS-68416-4, soybean event DAS-68416-4+2,4-D, soybean event DAS-68416-4+ phosphine oxamate and soybean event DAS-68416-4+ two kinds of weed killer herbicides.To strain number, early stage colony, seedling vigor, use rear damage, lodging, final strain number or Post flowering number of days and do not observe statistical significant difference (table 28).For height, between contrast and soybean event DAS-68416-4+2,4-D are sprayed, observe the significance of paired t-test.But do not observe significant overall process effect, the difference between soybean event DAS-68416-4 process and contrast is very little, and does not have common difference between different soybean event DAS-68416-4 process.Visible based on these results, soybean event DAS-68416-4 and near isogene non-transgenic reference are that agronomy is equal to.

^athe overall process effect that O uses F inspection to estimate.

^buse the sprinkling of t inspection and do not spray process and the comparison contrasted.

^cp value after using False discovery rate (FDR) code to correct.

^d0-100% scale; (with the number of strain number divided by the seed of plantation) * 100.

^eby the visually rank of 1-10 scale; The growth that 10=is equal to non-transformed plant.

^fby the visually rank of 0-100% scale; 0%=not damaged.

^ffrom implantation time until the number of days of blooming.

The P value of runic is significance (<0.05).

Embodiment 17

The generation of agronomy data in 2009

2009 be positioned at the Arkansas State, Iowa, Illinois, the state of Indiana and the Nebraska State 8 places carried out about soybean event DAS-68416-4 and non-transgenic reference (Maverick mutation) agronomy research.Assessment agronomy decisive factor, comprise strain number/colony's number (populationcount), seedling/plant vigor, plant height, the incidence of disease, insect damage and number of days before blooming, to investigate the identity property (table 29) of soybean event DAS-68416-4 soybean (use and do not use herbicide treatment) relative to contrast.

* B – sprays and does not spray test, and S – only sprays test

Test uses the complete block design of randomization.Those selected is soybean event DAS-68416-4, Maverick control series and commercially available Non-transgenic soybean system.Often to go planting rates plantation test soya seeds, the contrast soya seeds and reference soya seeds of about 112 seeds, wherein line space is about 30 inches (75cm).In each place, 4 that set up each process are repeated plot, and wherein each plot is made up of the row of 2-25 foot.Each soybean plot with 2 row Non-transgenic soybean (Maverick) for border.Whole testing position with the Non-transgenic soybean (Maverick) of at least 4 row (or 10 feet) around.Apply suitable insect, weeds and Disease epizootic practice to produce the acceptable crop of agronomy.

Use herbicide treatment to repeat the industrial practice of maximum label rate.Process is configured to: non-sprinkling contrast, and the vegetative stage of regulation use 2,4-D, phosphine oxamate, 2,4-D/ phosphine oxamate weed killer herbicides.2,4-D is used, uses weed killer herbicide at V4 and R2 vegetative stage with the ratio of 1.0lbae/A (1,120gae/ha).For phosphine oxamate process, at V4 and V6-R2 vegetative stage, plant is used.For using both, use phosphine oxamate with the ratio of 0.33lbai/A (374gai/ha) and 0.41lbai/A (454gai/ha) respectively at V4 and V6-R2.Soybean event DAS-68416-4 and the contrast comprising non-transgenic Maverick for those selected using two kinds of weed killer herbicides.Expection Maverick plot can be dead after herbicide application.

Use mixed model (SAS version 8; SASInstitute1999) variance analysis is carried out to the agronomy data of each field trial point.Those selected (Entry) is considered to fixed effect, and place, block in place, by those selected other position (location-by-entry) be designated as stochastic effects by place intra block other those selected (entry-by-blockwithinlocation).Complete the analysis in each place in a similar fashion, using those selected as fixed effect, using block with press block other those selected as stochastic effects.In order to statistical analysis, data do not round up.In 95% confidence level declaration significant difference, and F is used to check the significance assessing overall process effect.Use T inspection at the AAD-12 do not sprayed (sprinkling), with the AAD-12 (AAD-12+ phosphine oxamate) of phosphine oxamate sprinkling, with 2, AAD-12 (the AAD-12+2 that 4-D sprays, 4-D) with phosphine oxamate and 2, AAD-12 (AAD-12+2, the 4-D+ phosphine oxamate) transgenosis that both 4-D spray those selected and contrast between those selected and contrast between two.

Due to a large amount of contrasts carried out in this research, multiplicity is a problem.Multiplicity can throw into question when comparing in a large number to find unexpected effect in single research.Under these conditions, p value (comparison-wisepvalue) is descended based on the comparison and mistake declares that the probability of difference is very high (l-0.95 ^{relatively number}).In this research, analyzing thing for often kind has 4 times to compare (16 kinds of observation types analyzed agronomy), causes agronomy to be compared 64 times.Therefore, in agronomy, declare that the probability of one or more false difference is 99% (1-0.95 based on uncorrected p value ⁶⁴).

To collecting from contrast, AAD-12, AAD-12+ phosphine oxamate do not sprayed, AAD-12+2,4-D and AAD-12+2, those selected agronomy data analysis of 4-D+ phosphine oxamate.Analyze between position, to seedling vigor, final colony, plant vigor/damage (V4, Rl), lodging, the incidence of disease, insect damage, bloom before number of days, maturation front number of days, beanpod number, number seeds, productive rate and plant height do not observe statistical significant difference.For strain number and early stage colony, observe paired t-test in contrast and AAD-12+ phosphine oxamate between those selected and there is significance, but the p value not having significant overall process effect simultaneously or correct through FDR.For plant vigor/damage (R2), at contrast and AAD-12+ phosphine oxamate and AAD-12+2,4-D+ phosphine oxamate those selected observe significant paired t-test and significant overall process effect between the two, but the p value simultaneously not having significant FDR to correct.Within the average result scope that also this reference strain of testing in studying finds of all these variablees.

Embodiment 18

The conversion of AADl event pDAS1740-278 and selection

The conversion mediated by the whisker of corn strain Hi-II creates AAD1 event, pDAS1740-278.The method for transformation used is described in U.S. Patent Application No. 20090093366.The Fspl fragment (also referred to as pDAB3812) of plasmid pDAS1740 (Fig. 3) is transformed in corn strain.This Plasmid Constructs contains expression of plants box, and this expression of plants box contains RB7MARv3:: maize ubiquitin 1 promotor v2//AADlv3//corn PER53'UTR::RB7MARv4 plant transcription unit (PTU).

Create many events.To those survivals and the event producing healthy anti-fluazifop-butyl callus specifies unique identification code to represent the transformation event of presumption, and constantly they are transferred on fresh Selective agar medium.Go out plant from the regeneration being derived from each unique event, plant is transferred in greenhouse.

Get leaf sample for analysis of molecules, assist confirmation to verify the genetically modified existence of AAD-I by Southern trace, the confirmation of DNA border and genomic marker.With inbred line to positive T0 pollinate to obtain T1 seed.The T1 plant of selection event pDAS1470-278-9 (DAS-40278-9), carries out self-pollination and sign, continues for five generations.Meanwhile, T1 plant backcrossed and carries out gene transgression in breeding kind matter (XHH13) by mark assisted Selection, continuing some generations.This event produces and transforms separated strain from another.The selection of this event is the feature based on its uniqueness, and such as single insertion point, normal Mendel are separated and the brilliance of stable expression and the effect (comprising herbicide tolerant) in genotype background widely and varying environment place and agronomy performance combines.Other descriptions about corn event pDAS-1740-278-9 have been disclosed in WO2011/022469, are incorporated to herein by its full content by carrying stating.

Embodiment 19

Herbicide application and agronomy data

Herbicide treatment is used with the sprinkling volume (187L/ha) of about 20 gallons every acre.

Use herbicide treatment to repeat the industrial practice of maximum label rate.Use 3,76lbae/gal, the Weedar64 (026491-0006) of concentration 39% of 451gae/l and the AssureII (106155) of the concentration 10.2% of 0.87lbai/gal, 104gai/g.

For test those selected 4 and 5, excessively push up the mode of spreading fertilizer over the fields with 3 times and use 2,4-D (Weedar64) (total amount in season of 3Ibae/A).Be applied in for each time before emerging and about V4 and the V8-V8.5 stage and carry out.It is 1.0lbae/A that each the target for Weedar64 uses ratio, or 1120gae/ha.The actual scope using ratio is 1096-1231gae/A.

For test those selected 3 and 5, cross with single and push up the mode of spreading fertilizer over the fields and use quizalofop-ethyl (AssureII).Opportunity of using is about V6 vegetative stage.It is 0.0825lbai/A that target for AssureII uses ratio, or 92gai/ha.The actual scope using ratio is 90.8-103gai/ha.Have recorded for those selected Agronomic Characteristics of all tests in the block 2,3 and 4 in each place.Table 30 lists measured feature.

To from contrast, aad-l, aad-l+2 of not spraying, 4-D, aad-+quizalofop-ethyl and aad-+two those selected carrying out of agronomy data of collecting analyze.For intersite analysis, in across place Macro or mass analysis to early stage colony (Vl and V4), vigor, final colony, crop damage, reel off raw silk from cocoons before time, pollen come off before time, stem lodging, root lodging, the incidence of disease, insect damage, the front number of days of maturation, plant height, pollen viability (shape and color) value do not observe statistical significant difference.

For stagnant green and fringe height, observe significant paired t-test at contrast and aad-l+ quizalofop-ethyl between those selected, but not with significant overall process effect or the p value (table 31) that corrects through False discovery rate (FDR).

^ause the overall process effect that F inspection is estimated.

^buse the sprinkling of t inspection and do not spray process and the comparison contrasted.

^cuse the P value that False discovery rate (FDR) code corrects.

^dby the visually rank of 1-9 scale; 9=has the high plant of the leaf of health greatly.

^e0-100% scale; Wherein 0=does not damage and 100=Plant death.

^fthe number of the heat unit of accumulation from plantation.

^g0-100% scale; Wherein the pollen grain of % has the wall subsided.

^h0-100% scale; Wherein the pollen grain of % has goldenrod.

ⁱby the visually rank of 1-9 scale, wherein 1 for not having visible chlorenchyma.

^jby the visually rank of 1-9 scale, wherein 1 is that disease resistance is poor.

^kby the visually rank of 1-9 scale, wherein 1 is that resistance to insects is poor.

^lnA=does not carry out statistical analysis owing to not having variability between each repetition or process.

^mthe significant difference indicated by P value <0.05.

Embodiment 20

Other agronomic trials

Assess the Agronomic Characteristics of corn system 40278 under various varying environment, and compare with near-isogenic line corn system.Process comprises hybrids different in 4 kinds of heredity, tests their suitable near-isogenic line contrast hybrid in 21 places altogether.

4 test hybrids to be relative maturity scope be 99-113 days medium to ripe hybrid in late period.Experiment A tests the event DAS-40278-9 in genetic background inbreeding CxBC3S1 transforms.This hybrid has the relative maturity of 109 days, it has been carried out testing (table 32) 16 positions.Experiment B tests hybrid background inbred line ExBC3S1 and transforms, i.e. 113 days relative maturity hybrids.The one group place slightly different from experiment A is used to test this hybrid in 14 places.Experiment C and D tests hybrid background BC2S1 respectively and transforms X inbred line D and BC2S1 conversion x inbred line F.These hybrids all have 99 days relative maturities, and test identical 10 positions.

For each test, use the complete block design of randomization, two, each position is repeated and two row plot.Line length is 20 feet, and with every row 34 each row of planting seed.Conventional regional agronomic practices is applied in trial.

Collect data, and analyze 8 kinds of Agronomic Characteristics; The lodging of plant height, fringe height, stem, root lodging, final colony number, seed humidity, test weight and productive rate.Plant height and these two parameters of fringe height provide the information about hybrid outward appearance.Percentage stem lodges and root lodges, and these two Agronomic Characteristics determine the property gathered in the crops of hybrids.Final colony number is weighed seed quality and is affected the seasonal growth condition of productive rate.Percentage seed humidity during results defines the maturity of hybrid, and productive rate (bushel/acre for humidity correcting) and the test weight (weight of a bushel of corn, in pound, correct to 15.5% humidity) fertility of hybrid is described.

Linear model is used to carry out variance analysis to each field trial point.Model comprises those selected with place as fixed effect.Explore and comprise place and by those selected other position mixed model as stochastic effects, but only explain the sub-fraction of variance by those selected other position, and its component of variance does not often have significant difference with zero.Bar (stock) lodging and root are lodged, use logarithmic transformed come stabilisation variance, but average and scope are all reported with initial ratings.With 95% confidence level declaration significant difference.Use the significance of t inspection assessment overall process effect.

Result from these agronomy CHARACTERISATION TESTS can see table 32.With regard to the parameter such as fringe height, stem lodging, root lodging, seed humidity, test height and productive rate, compared with 4 40278 hybrids contrast with isogenic line, be showed no the difference (when P<0.05) of statistically significant.Final colony counting and plant height have significant difference respectively in experiment A and B, but do not find similar difference compared with other 40278 hybrids tested.Seen difference some be attributable to the remained low-level hereditary variability that backcrosses of DAS-40278-9 event and breeding inbred line.The overall range of the value of measured parameter all falls in the scope of the value of traditional corn hybrid gained, therefore do not go out weediness increase conclusion.Generally speaking, agronomy characterization data shows that 40278 corns and ordinary maize are biology equivalences.

The Agronomic Characteristics of the hybrid maize containing event DAS-40278-9 and the near-isogenic line corn collected from the multiple field trials between diversified geographical environment in the season of growth are compared.Comparing of result that the hybrid maize containing event DAS-40278-9 is and Null plants is listed in table 33.

In table 34 be grow V3 stage spraying herbicide quizalofop-ethyl (280gae/ha) and grow the V6 stage spray 2, hybrid maize containing the event DAS-40278-9 system of 4-D (2,240gae/ha) and the Agronomic Characteristics of Null plants.

Embodiment 21

2,4-D increases the growth of 2,4-D resistant soybean

When 2,4-D use destroy weeds time, having the genetically modified genetically engineered soybean of AAD-12 provides protective effect to bean plant.Observe unexpectedly, 2,4-D also add the growth of resistance to 2,4-D soybean.This growth increase result in sprays the plant height in plot and/or productive rate increases compared to non-sprinkling plot.

Describe through genetically engineered and tolerate 2, the bean plant of 4-D is owing to using the increase of plant growth caused by 2,4-D and/or productive rate.Test in the multiple places throughout U.S.'s northern bean growing area.Those selected comprises the excellent strain wherein having infiltrated and had event DAS-68416-4 (state of tolerance 2,4-D).Process comprises: without spraying, and all carries out 2,4-D sprinkling process at V3 and R2 vegetative stage.Measure each Agronomic Characteristics in the whole season in plot, comprise plant height and seed productive rate.In whole season to spraying and all controlling, to eliminate any competitive effect without the weeds of spraying in plot.When off-test, data analysis record those selected height of using 2,4-D to spray and productive rate with do not accept to process those selected compared with remarkable increase.The increase of productive rate be cut weeds control outside 2,4-D another benefits that 2,4-D resistant soybean is given.

Carried out field trial in 2011, the Agronomic Characteristics of the soybean event DAS-68416-4 (international patent application No.2011/066384) sprayed using 2,4-D compares with the Agronomic Characteristics of the soybean event DAS-68416-4 do not sprayed.Field trial contain wherein soybean event DAS-68416-4 4 elite soybean strains of gene transgression and correspondence not containing those selected of the invalid isogenic line of 4 elite soybean strains of soybean event DAS-68416-4.Between different geographical position, (altogether 10 places) carry out planting experiment.Setup Experiments is the split plot design of improvement, the repetition of two, each place.The whole district is process, and subarea is for those selected.Each plot is made up of two row of 12.5 feet long, with 30 inch separation plantations.Sprinkling plot is processed in 2,4-D (1120gae/ha) sprinkling of V3 and R2 vegetative stage.In whole season, field plots maintains the practice of normal agronomy, and keeps not having weeds.Each Agronomic Characteristics measuring bean plant determines that 2,4-D's uses the performance how affecting soybean Agronomic Characteristics.The Agronomic Characteristics of test and the vegetative stage when Data Collection are listed in table 35.

At the end of soybeans they grow season, the data from all places are merged, carries out point analysis entirely.Data analysis uses pro9.0.3 (SAS, Cary, NC) carries out.The least square average that this analysis draws is reported in table 28.Cause growing the regulating action increased to using containing 2,4-D of the genetically modified soybean event DAS-68416-4 of AAD-12.The final result that growth increases is, sprays productive rate and plant height measured value in the field plots of 2,4-D and as compared to the field plots not using 2,4-D to spray significantly higher.When carrying out cumulative analysis to the data in all places, can confirm these increases.By contrast, increase because place/process interacts (locationbytreatmentinteraction) with the productive rate of the soybean event DAS-68416-4 of 2,4-D sprinkling and reduce.Being used by 2,4-D in table 36 makes average height and productive rate all increase about 5%.

As shown in table 37, the soybean event DAS-68416-4 plant of not spraying 2,4-D reports significantly higher productive rate with soybean event DAS-68416-4 plant 1 (the place #a3) compared at least in 10 places spraying 2,4-D and gathers in the crops.When accumulating the result in all places, show to using 2,4-D containing the genetically modified soybean event DAS-68416-4 of AAD-12 the regulating action causing growing increase.Such as, the productive rate spraying the soybean event DAS-68416-4 plant of 2,4-D is 56.4 bushels/acre, more much bigger than the productive rate 53.7 bushels/acre without the soybean event DAS-68416-4 plant of spraying.Equally, the height spraying the soybean event DAS-68416-4 plant of 2,4-D is 81cm, more much higher than the height 77cm without the soybean event DAS-68416-4 plant of spraying.

Embodiment 22

In 2,4-D/ glyphosate composition 2,4-D increase the growth resisting 2,4-D soybean

The field trial similar to previous embodiment is implemented, unlike 2,4-D of administered twice and glyphosate composition in 2010.Result shows, and compares with non-sprinkling plot, and growth increase (with regard to plant height and/or productive rate) of spraying anti-2, the 4-D soybean in plot is owing to using caused by 2,4-D.

Significant treatment effect is observed to the many parameters measured.2,4-D and glyphosate all spray at V3 and R2 vegetative stage.Planting experiment carries out in different geographical position (altogether 6 places).The vegetative stage when Agronomic Characteristics of test and Data Collection is listed in table 30.In table 38, have the average height of the soybean of sprinkling to add 6%, average yield adds 17%.In addition, the Average seed weights of the soybean of sprinkling is had to increase by 6%.

As shown in table 39, also observe some geographic difference in this embodiment.In table 39, the average yield of the soybean of sprinkling is had to increase by 21.6%.

Embodiment 23

The field test results of relatively spraying and processing without sprinkling

Anti-2, the 4-D genetically modified crops transformed with aryloxy alkanoic acid dioxygenase (AAD) cause when with quantity of stimulus comprise the herbicide treatment of aryloxy alkanoic acid moieties time productive rate increase.In sprinkling with without testing the soybean event comprising AAD-12 expression casette under spraying condition in repetition productivity test.A serial experiment comprises the precocious soybean adapting to northern latitude, and the experiment of another series comprises and is adapted to more by the late-maturing soybean of southern latitude.In previous experiment in some cases, comprise AAD-12 expression casette soybean those selected increase relative to not spraying contrast with productive rate after 2,4-D process in Growing season.

These tests employ the split plot design with the improvement that 2 are repeated.Each plot is 2 line width, and wherein line space is 30 inches, and length is 12.5 feet.The aisle of 2.5 to 3 feet is had between the plot of plantation that joins end to end, movable in process of the test to allow between this seasonal period.During the season of growth, sprinkling group uses 2,4-D choline+glyphosate (premixed) to spray (twice) with 2% percentage by weight with 2185gae/ha+AMS successively.

It is at V3 vegetative stage that first time uses, and second time is applied in R2 vegetative stage.By using conventional weed killer herbicide or artificial weeding, in whole season, testing field trial all keep there is no weeds with contrast field trial.Collect about emerging, seedling vigor, crop damage, flowering dates, R2 time strain number, the incidence of disease, insect damage, plant height, the maturing stage, lodging, fried pod, 100 seed weights and productive rate data.Use pro9.0.3 analyzes data.Table 40 lists the place used in final analysis.The place of some plantations is not included in analysis due to the variability in place.

All full ground point analysis has been carried out to precocious and late-maturing test.Table 41 and 42 respectively illustrates the productive rate variance analysis to precocious and late-maturing test.

For precocious and late-maturing test, all there is (P=0.05) title effect (nameeffect) significantly.This is in accordance with expectation because each wherein the elite soybean strain of gene transgression event be from different genetic background.

Precocious test records significant treatment effect, shows to spray and without sprinkling process difference to some extent on productive rate.There is not significant treatment effect in late-maturing test, shows to spray and do not spray plot to there is no difference on productive rate.

For precocious and late-maturing test, not significantly, what show for special test is each for those selected, and the effect (or without effect) of process is identical for title/process interaction effect.

Table 43 show in precocious test each those selected by other average yield for the treatment of combination, wherein HOMO representative isozygoty.After check indifference with each value (in given kind) of same letter according to the Student of P=0.05.When using 2,4-D choline+glyphosate (premixed) to spray with 2185gae/ha+AMS successively at V3 and R3, have 4 those selected show higher productive rate.

Table 44 show each those selected by other average yield for the treatment of combination.After check indifference with each value (in given kind) of same letter according to the Student of P=0.05.As reported above, significant treatment effect or process/those selected effect not being had for late-maturing test, so there is no carry out average separation.The sprinkling of letter representation in table in late-maturing test and do not spray between process and do not have difference.

Again show after using 2,4-D, increase can be had for some soybean phenotypes on productive rate in some environments from the productivity test in this embodiment.In in the past 2 years, in the productivity test that MG2 growing area is implemented, observed such productive rate increases.

Embodiment 24

The comparison of soybean and corn

The yield results carrying out the field trial of the genetically modified soybean of self-contained AAD-12 shows, for some soybean genotype, uses the productive rate that 2,4-D can increase soybean in certain environments.When with comprise the genetically modified transgenic corn events of AAD-1 compare time, the results were quite startling for these.Productive rate productive rate after spraying with 2,4-D of AAD-1 rotaring gene corn plant does not as one man demonstrate and statistically increases significantly.These AAD-1 rotaring gene corn plants are biologically equal to ordinary maize.From 2010 to 2012, in different geographic areas, hybrid maize is fastened and complete other field research.In the whole process of these field research, compare the productive rate of corn system and the untreated control corn system (such as, not using 2,4-D to spray) of spraying with 2,4-D (2,185gae/ha and 4,370gae/ha).The result of these experiments confirms further, does not significantly increase productive rate owing to spraying process with 2,4-D containing the genetically modified corn plant of AAD-1.By comparison, in some soybean genotypes, demonstrating productive rate after using 2,4-D increases.Observe in soybean genotype this use 2,4-D after productive rate increase be a unexpected improvement, can be applied to and improve the productive rate of crop.In order to the productive rate utilizing 2,4-D process to increase genetically modified crops (such as expressing the genetically modified crops of AAD-12 gene), method disclosed herein can be implemented.

Although in order to the object of clear understanding describe in detail above invention by explanation and example, it is evident that can implement some within the scope of the appended claims changes and change.

Claims (32)

1. one kind is improved the method for the productive rate of 2,4-D resistance crop plant, and it comprises the herbicide treatment plant comprising aryloxy alkanoic acid moieties with quantity of stimulus.

2. the process of claim 1 wherein that described 2,4-D resistance crop plants are the genetically modified plants transformed through aryloxy alkanoic acid dioxygenase (AAD).

3. the method for claim 2, wherein said aryloxy alkanoic acid dioxygenase (AAD) is AAD-12.

4. the weed killer herbicide comprising aryloxy alkanoic acid moieties described in the process of claim 1 wherein is phenoxy herbicide or phenoxy acetic acid class weed killer herbicide.

5. the weed killer herbicide comprising aryloxy alkanoic acid moieties described in the process of claim 1 wherein is 2,4-D.

6. the method for claim 5, wherein said 2,4-D comprise 2,4-D choline or 2,4-D dimethylamine (DMA).

7. the process of claim 1 wherein that described process is implemented at least one times with 2, the 4-D rate of application also for Weeds distribution.

8. the process of claim 1 wherein that described process is implemented twice with 2, the 4-D rate of application also for Weeds distribution.

9. the method for claim 8, wherein uses 2,4-D at V3 and the R2 vegetative stage of the soybean with 2,4-D tolerance.

10. the process of claim 1 wherein that described process is carried out at least three times with 2, the 4-D rate of application also for Weeds distribution.

11. the process of claim 1 wherein that described 2,4-D resistance crop plants are in and coerce under.

12. the process of claim 1 wherein also with 2,4-D resistance crop plants described in the herbicide treatment being different from 2,4-D to control weeds.

The method of 13. claims 12, the wherein said weed killer herbicide being different from 2,4-D is phosphorous weed killer herbicide (phosphor-herbicide) or aryloxyphenoxypropionic class weed killer herbicide.

The method of 14. claims 13, wherein said phosphorous weed killer herbicide comprises glyphosate, phosphine oxamate, their derivative, or their combination.

The method of 15. claims 13, wherein said phosphorous weed killer herbicide is the form of ammonium salt, isopropyl ammonium salt, isopropyl amine salt or sylvite.

The method of 16. claims 13, wherein said aryloxyphenoxypropionic class weed killer herbicide comprises chloroazifoppropynyl, oxazole diclofop-methyl, fluazifop, fluazifop-butyl, quizalofop-ethyl, their derivative or its combination.

17. the process of claim 1 wherein described 2,4-D resistance crop plant 25gae/ha to 5000gae/ha 2,4-D process at least one times.

18. the process of claim 1 wherein described 2,4-D resistance crop plant 100gae/ha to 2500gae/ha 2,4-D process at least one times.

19. the process of claim 1 wherein described in comprise aryloxy alkanoic acid moieties weed killer herbicide arrive described 2,4-D resistance crop plants by root absorption.

The method of 20. claims 13, wherein said phosphorous weed killer herbicide arrives 2,4-D resistance crop plant by root absorption.

The method of 21. claims 13, wherein said aryloxyphenoxypropionic class weed killer herbicide arrives described 2,4-D resistance crop plants by root absorption.

The method of 22. claims 2, the wherein said genetically modified plants transformed through aryloxy alkanoic acid dioxygenase (AAD) are selected from cotton, soybean and canola.

The method of the productive rate of 23. 1 kinds of raising 2,4-D resistance crop plants, it comprises

A () is by the nucleic acid molecules transformed plant cells of nucleotide sequence comprising coding aryloxy alkanoic acid dioxygenase (AAD);

B () selects transformant;

C () regenerates plant from this transformant; With

D () is with this plant of the herbicide treatment comprising aryloxy alkanoic acid moieties of quantity of stimulus.

24. the method for claim 23, wherein said aryloxy alkanoic acid dioxygenase (AAD) is AAD-12.

The method of 25. claims 23, wherein said nucleic acid molecules comprises selection marker thing, and this selection marker thing is not aryloxy alkanoic acid dioxygenase (AAD).

The method of 26. claims 25, wherein said selection marker thing is phosphinothricin acetyl transferase gene (pat) or selected gene (bar).

The method of 27. claims 23, wherein said nucleic acid molecules is that plant is optimized.

28.2,4-D is manufacturing the purposes had compared to its non-transgenic mother plant in 2,4-D resistant transgenic plants of the productive rate of increase.

The purposes of 29. claims 28, wherein said 2,4-D use at least one times with 25gae/ha to 5000gae/ha2,4-D.

The purposes of 30. claims 28, wherein said 2,4-D use at least one times with 100gae/ha to 2500gae/ha2,4-D.

The purposes of 31. claims 28, wherein said 2,4-D comprise 2,4-D choline or 2,4-D dimethylamine (DMA).

The purposes of 32. claims 28, wherein before blooming with described 2, the 4-D resistance crop plants at least twice of 2,4-D process.