RU2601151C2 - Method of simultaneous genodiagnostic of two mutant alleles causing cvm and blad in cattle, and test system for it - Google Patents

Abstract

FIELD: biotechnologies.

SUBSTANCE: series of inventions relates to biotechnology. Method of simultaneous genodiagnostic of two mutant alleles, causing CVM and BLAD in cattle, involves DNA recovery from biological material polymerase chain reaction in real time using the reaction mixture (test system) with CVM/BLAD, containing 50 mMKCl, 50 mMTRIS-HCl, 250 nMdNTP, 2.5 mMMgCl₂, primers - in the concentration of 200 nm, allele-specific probes in concentration of 100 Nm, having the following sequence: CVM_up - gattctcaagagcttaattctaagga, CVM_low - aagtaaaccccagcaaagccac, CVM_Wt - (FAM) aggtctcatggcagttct-(BHQ1), CVM_m - (R6G) catggcatttctcacagcat-(BHQ2), BLAD_up - ttaggcagttgcgttc, BLAD_low - acgttgacgaggtcatccacca, BLAD_Wt - (ROX) accccatcgacctgtacta-(BHQ1), BLAD_m (Cy5) ccatcggcctgtactacct-(BHQ2), diluent, 2.5 units. Taq DNA polymerase, three positive and one negative control sample. During preparation for conducting reaction required volume of components is calculated, based on the number of analyzed samples plus 4, reagents are mixed, then 20 mcl of the prepared PCR mixtures are added to test tubes prepared for PCR, 5 mcl of the control and analyzed samples are added into each PCR test tube, test tubes are placed into amplifier, primers annealing takes place at the stage of cycling at 64 °C for 30 s at number of cycles amplification equal to 40. Derived data is carried out by comparing the amplified genome sections, results are interpreted based on the presence or absence of intersection of fluorescence curve with threshold line installed at appropriate level.

EFFECT: invention enables diagnosing two mutant alleles simultaneously, causing CVM and BLAD in cattle, reduces time for RT PCR performing.

2 cl, 3 dwg, 4 tbl

Description

The invention relates to the field of molecular biology and can be used in veterinary practice in the diagnosis of mutations that cause two hereditary diseases: a complex of vertebral anomalies (CVM - Complex Vertebral Malformation) and leukocyte adhesion deficiency (BLAD - Bovine Leucocyte Adhesion Deficiency) in cattle. The proposed method and the test system for its implementation can simultaneously identify CV and BL mutations at the SLC35A3 and CD 18 DNA loci, respectively, using real-time PCR (PCR-RV) based on primers and allele-specific probes.

Currently, about 60 hereditary diseases that are detected at the DNA level have been described in cattle (ICAR Guidelines ..., 2011). They cause morphological and functional abnormalities, negatively affect the health and productivity of the animal. Therefore, an important task of veterinarians is the timely diagnosis and eradication of the source that causes this disease. Knowledge of the molecular structure, determination of a heterozygous carrier are the basis for an effective fight against a hereditary disease.

The speed and accuracy of diagnostics of the complex of spinal anomalies (CVM) and leukocyte adhesion deficiency (BLAD) has significantly increased due to the establishment of the genetic nature of these molecular diseases (Kehrli ME et al., 1990; Tammen I., 1994; Batt CA et al., 1994; Marzanov N.S. et al., 1997; Amerkhanov H.A., Marzanov N.S., 1999; Agerholm JS et al., 2001; Yakovlev A.F. et al., 2004; Eggen A. et al., 2004; Oguni T. et al., 2004; Rusc A., Kaminski S., 2007; Kalashnikova L.A., 2010; Marzanova S.N. et al., 2011; 2012).

In developed countries of Europe and North America, special programs have been created to eliminate mutant CV and BL alleles in black-motley breed populations (Shuster DE etal., 1992 a, b; Czarnik U. et al., 2007; Schutz E. et al., 2008).

In the Russian Federation, prominent producers and repair young animals are checked for mutant allele carriage, and the results are mandatory, along with blood groups and kappa-casein, regularly published in pedigree bull catalogs (Shapochkin V.V., Eskin G.V., 2004 ; Popov N.A. et al., 2004; Savenko N.A. et al., 2007; Eskin G.V., 2010).

A number of diagnostic methods for CVM and BLAD are proposed in open press (Kehrli MEet al., 1990; Shuster DE et al., 1992a; Tammen I., 1994; Nagahata H. et al., 1997; Kanae Y. et al., 2005 ; Rusc A., Kaminski S., 2007). However, diagnosis with their separate identification takes a lot of time.

Thus, in molecular biology, there is an obvious need to develop a highly sensitive, specific and rapid method for the diagnosis of two mutant alleles that cause CVM and BLAD in cattle, as well as a test system for its implementation, which may be applicable in veterinary practice.

The prior art genetic test for identifying carriers of the recessive gene of complex vertebral malformations in cattle (Patent for the invention No. 2276690 publ. 05.20.2006). This invention is accepted as the closest analogue. A distinctive feature of the claimed invention from the identified analogue is the ability to determine CVM together with BLAD, i.e. there is a simultaneous determination of two mutations by the method of real-time PCR (PCR-RV), using primers and allele-specific probes. The CV mutation point is the same as in the indicated analogue, however, the detection approach is fundamentally different.

In the claimed invention, the identification of polymorphism at the SLC35A3 locus (G / T) is carried out using PCR-RV and using TaqMan probes. The study time of this polymorphism takes no more than 3 hours. In the closest analogue, CVM is diagnosed using microsatellites using the electrophoretic detection method, which is a fundamentally different method for diagnosing this polymorphism and takes more time and the necessary equipment.

The aim of the invention is to provide a method for the simultaneous diagnosis of mutant CV and BL alleles using real-time PCR (PCR-RV) and the development of a test system for its implementation using sets of oligonucleotides-primers and probes having specific sequences.

The invention provides a method for the simultaneous diagnosis of mutant CV and BL alleles in a black-motley genealogical root, which includes such well-known breeds as Holstein, black-motley, Kholmogorsk, Yaroslavl, Tagil and red-motley, as well as synthetic populations with an admixture of Holstein blood . The test system is designed for testing bulls, bulls reproducing groups of cows, repair young animals, as well as semen from sperm bank and embryos.

The technical result of the claimed invention is the ability to diagnose simultaneously two mutant alleles that cause CVM and BLAD in cattle; real-time reduction of the polymerase chain reaction (PCR-RV) (after 3 hours the result was obtained); laboriousness; the ability to perform repetitions; to control the accuracy of the study.

The indicated technical result is achieved by the fact that DNA is extracted from biological material, the polymerase chain reaction is set up in real time using a reaction mixture with CVM / BLAD. The reaction mixture contains 50 mMKCl, 50 mMTRIS-HCl, 250 nMdNTP, 2.5 mMMgCl ₂ , primers at a concentration of 200 nM, allele-specific probes at a concentration of 100 nM, diluent, 2.5 units. Taq DNA polymerase, three positive and one negative control sample. In preparation for the reaction, the required volume of components is calculated based on the number of test samples plus 4, where there are three positive control samples and one negative control sample. The reagents are mixed, then 20 μl of the prepared PCR mixture is added to the prepared for PCR tubes, 5 μl of control and test samples are added to each PCR tube. The tubes are placed in an amplifier. The primers are annealed at the cycling stage at 64 ° C for 30 s with the number of amplification cycles equal to 40. The data obtained are analyzed by comparing the amplified regions of the genes, the results are interpreted based on the presence or absence of the intersection of the fluorescence curve with the threshold line set at the corresponding level.

The test system for the simultaneous gene diagnostics of two mutant alleles causing CVM and BLAD in cattle by real-time polymerase chain reaction formulation contains a reaction mixture with CVM / BLAD (50 mMKCl, 50 mMTRIS-HCl, 250 nMdNTP, 2.5 mMMgCl ₂ , primers at a concentration of 200 nM, allele-specific probes at a concentration of 100 nM), diluent, 2.5 units Taq DNA polymerase, 3 positive controls, one negative control.

Primers and probes for carrying out the claimed invention have the following sequences:

CVM_up - gattctcaagagcttaattctaagga

CVM_low - aagtaaaccccagcaaagccac

CVM_Wt - (FAM) aggtctcatggca (G-LNA) ttct- (BHQ1)

CVM_m - (R6G) catggcatttctcacagcat- (BHQ2),

BLAD_up - ttaggcagttgcgttc

BLAD_low - acgttgacgaggtcatccacca,

BLAD_Wt - (ROX) accccatcgacctgtacta-- (BHQ1),

BLAD_m (Cy5) ccatcggcctgtactacct- (BHQ2),

The optimal composition of the reaction mixture for real-time polymerase chain reaction was experimentally established, a combination of primers, the necessary and sufficient ratio of the components of the reaction mixture were selected, and the PCR formulation mode was determined, which is important when conducting PCR analysis. The system is designed to carry out 100 reactions with a volume of 25 μl (20 μl + 5 μl of the test sample).

The selection of primers and allele-specific probes (Table 1) was performed using the Oligo 6.0 application package based on analysis of the nucleotide sequences of the SLC35A3 and CD 18 DNA loci published in the NSBI database.

The source for the diagnosis is pre-isolated DNA from samples of biological material (whole blood, sperm, embryos, milk or skin).

DNA was isolated by the sorbent method (DNA-sorb-B, FBSI Central Research Institute of Epidemiology of Rospotrebnadzor, Moscow). Next, the extracted DNA was used in the reaction: 5 μl of the sample was added to the PCR reaction mixture.

The reaction mixture for PCR analysis has the following composition: 50 mMKC1, 50 mMTRIS-HCl, 250 nMdNTP, 2.5 mMMgCl ₂ , 2.5 units Taq DNA polymerase, primers at a concentration of 200 nM, fluorescent probes at a concentration of 100 nM, while primers and allele-specific probes have specific specific sequences (Table 1).

Preparation for the reaction was carried out as follows.

The required volume of components was calculated based on the number of test samples plus 4 (three positive control samples and one negative control sample). The set of components for the reaction are presented in table 2.

The components were thawed, mixed and centrifuged. A mixture of components was prepared by adding them in the order shown in table 3, mixed and centrifuged.

PCR tubes were labeled. 20 μl of a mixture of components were added to tubes prepared for PCR. Then, 5 μl of control and test samples were added to each PCR tube in accordance with the marking, mixed by repeated pipetting and the lid tightly closed. The tubes were placed in a carousel of an amplifier, then the operation of the device was programmed.

Reaction Profile:

1. Holding the temperature at 94 ° C for 3 minutes, one repeat.

2. Cycle 1

94 ° C - 20 s

61 ° C - 20 s

64 ° C - 30 s

Repeat the cycle 10 times.

3. Cycle 2 (with detection)

94 ° C - 20 s

61 ° C - 20 s

64 ° С - 30 s - detection via channels: Green, Yellow, Orange, Red

Repeat the cycle 30 times.

In the process of cycling, denaturation, annealing of the primers and synthesis of a new DNA chain occurs at a temperature of 64 ° C. At the first cycling, 10 repetitions were carried out - no detection, since the data are not representative. During the second cycle, 30 repetitions were carried out, as a result, stable data were obtained, which are final in terms of diagnosis.

The creation of the PCR-RV template, as well as the analysis of the results of the study, was performed using the Rotor-Gene 6000 1.8 software to the RotorGene Q instrument (CorbettResearch, Australia).

The result of the analysis is the determination of mutant alleles that cause a complex of spinal anomalies (CVM) and leukocyte adhesion deficiency (BLAD) in cattle.

The interpretation of the results of the analysis of the studied samples was carried out in accordance with table. four:

1. The result of the reaction for PKO1 (positive control sample) should be positive for the channels Green and Orange, negative for the channels Yellow and Red.

2. The result of the reaction for PKO2 should be positive on the channels Green, Yellow, Orange, Red.

3. The result of the reaction for PKO3 should be positive for the channels Yellow and Red, negative for the channels Green and Orange.

4. The result of the reaction for the OKO (negative control sample) should be negative across all channels.

In case of obtaining positive results for JCE on any of the channels, the results of the study are considered invalid. It is required to take measures to identify and eliminate the source of contamination and conduct a second analysis.

The result of the analysis for the sample is considered to be uncertain if the results of the reactions through the channels Green, Yellow, Orange, Red are negative.

In this case, re-examination of the sample is necessary.

Prediction of the resulting offspring depending on the presence or absence of mutant CV and BL alleles. The presence of CV, like the BL allele, is a striking example of carriage of a mutation on the one hand, and on the other, manifestations of single nucleotide polymorphism or SNP (singlenucleotidepolymorphism) in DNA in cattle.

In the claimed invention used the technology of allele-specific TaqMan probes. In this case, the fluorescent probe is an oligonucleotide complementary to the PCR product.

The probe is labeled with a fluorophore and a fluorescence quencher, with terminal labeling of the oligonucleotide being used. In the absence of a target, i.e. the sequences complementary to the probe, the fluorophore and the quencher converge, as a result, the probe fluorescence is suppressed. In the presence of a DNA fragment complementary to the probe, the probe hybridizes with the amplicon, which leads to its cleavage during synthesis due to the 5′-exonuclease activity of Taq polymerase. The signal intensity increases on the fluorescence channel corresponding to the fluorophore with each PCR cycle, in proportion to the accumulation of amplicons.

Allele-specific probes are effective in detecting CV and BL mutations in the studied fragment of the genome. A pair of probes is selected for the locus with the mutation, so that one of them specifically hybridizes at the temperature of the synthesis of chains with the normal (wild) type allele, and the second probe with the mutant type allele.

These probes are labeled with different fluorophores, and the results of reactions with them are recorded on two different detection channels of the PCR-RV device. To determine the ST and CV alleles, 2 channels are used - Green and Yellow. The normal ST allele gives the signal growth through the Green channel, detected by the FAM fluorophore, and the mutant CV allele - through the Yellow channel, detected by the R6G fluorophore.

As for the TL and BL alleles, 2 channels are also used to determine them, only Orange and Red. The normal TL allele gives the signal growth through the Orange channel, detected by the ROX fluorophore, and the mutant BL allele - through the Red channel, detected by the Su5 fluorophore.

The results are interpreted based on the presence or absence of the intersection of the fluorescence curve with a threshold line set at an appropriate level.

The threshold transition is a characteristic of the number of DNA copies of an individual gene. With the optimal number of DNA copies, the curve is located between two threshold values of 10 and 15 amplification cycles.

When you move the curve to the left along the abscissa, this indicates a high concentration of DNA, if to the right - about its lack of reaction. All samples whose fluorescence plots cross the threshold line will be considered positive for a specific channel, i.e. containing an allele corresponding to the fluorescence channel.

The resulting picture of the reaction results using these probes on control samples is given below when determining the mutant CV allele. In fig. 1 - the results of studies of a homozygous wild-type or healthy animal or non-carrier, fluorescence is represented by two lines.

The curve without markers is located between 10 and 15 cycles above the red threshold line. The second curve with circles is below the threshold line. This situation is characteristic of a healthy animal under investigation.

In fig. 2 presents the results of a study of a heterozygous animal or carrier of a mutant CV allele. As can be seen in fig. 2, both fluorescence curves cross the threshold line set at the appropriate level in the designated area, between 10 and 15 PCR-RV cycles.

At the same time, it should be noted that the curve with circles is located above the curve without markers. This picture is characteristic of a heterozygous animal or carrier of a mutation.

When establishing this method, it was not possible to obtain sick calves empirically under economic conditions. In this regard, for the first time it was possible to simulate the synthetic recessive genotypes of sick calves at the SLC35A3 and CD 18 loci, in laboratory conditions, based on knowledge of the structures of mutant CV and BL alleles.

In fig. 3 shows a model sample of an animal homozygous for the mutant CV allele. As can be seen in fig. 3, the model sample reflects the situation characteristic of a sick calf. In this case, the curve with circles is located above the threshold, the fluorescence curve without circles, characteristic of a healthy animal, is below the threshold line.

As for the principle of determining the BL allele, it is similar to that described in relation to the diagnosis of CV mutations. The analysis is carried out according to the method described above, only through the channels Orange and Red and the entire procedure is carried out simultaneously.

The main advantages of the claimed invention are:

1. Simultaneous certification of elite animals of the black-and-white genealogical root and red-and-white breed for two mutations (CV and BL) using the claimed test system will allow the directional formation of the allele pool of bulls, bulls reproducing cow groups, repair young stocks, as well as accumulating breeding material (seed and embryo bank) from healthy animals.

2. The presence of a genetic passport for CV and BL mutations of elite animals will allow for efficient breeding and breeding work in breeding herds of black-motley genealogical root and red-motley breed.

3. When importing breeding material into the Russian Federation from abroad, a genetic passport is required. In order to stop two hereditary diseases, purchased animals after quarantine must be re-certified for the presence of mutant CV and BL alleles.

Literature

1. Amerkhanov H.A., Marzanov N.S. Genetics look to the future // Breeding. - 1999. - No. 1. - S. 7-9.

2. Kalashnikova L.A. Genomic assessment of dairy cattle // Dairy and beef cattle breeding. - 2010. - N1. - S. 10-12.

3. Catalog of manufacturing bulls of the OJSC “Head Center for the Reproduction of Farm Animals” / ed. Yeskina G.V. Bykovo. - 2010 .-- 36 p.

4. Marzanov N.S., Popov A.N., Zinovieva N.A., Polezhaeva V.A., Ignatiev V.M., Brem G. Screening of the BLAD syndrome in animals of the black-and-white root // Bulletin of the Russian Academy of Agricultural Sciences. - 1997. - No. 4. - S. 59-61.

5. Marzanova S.N., Alekseev Y.I., Konovalova N.V., Turbina I.S., Devrishov D.A., Sochivko D.G., Marzanov N.S. Development of a method for the diagnosis of complex spinal anomaly (CVM) by real-time PCR in black-motley cattle. Scientific-practical conference: "The practical use of modern scientific developments in the reproduction and selection of cattle" // Scientific-theoretical journal: Problems of the biology of productive animals. - 2011. - No. 4. Special issue. - S. 79-82.

6. Marzanova S. N., Alekseev Y. I., Konovalova N. V., Turbina I. S., Devrishov D. A., Sochivko D. G., Marzanov N. S. Diagnosis of CVM and BLAD in black and white motley cattle. Materials of the international scientific-practical conference: "The role of veterinary science and practice in the effective development of animal husbandry." Almaty - 2012 .-- S. 348-353.

7. Popov N.A., Chervyakov N.A., Belyavin N.A. et al. Catalog of manufacturing bulls of Kirovskoye OJSC. - Kirov. - 2004 .-- 73 s.

8. Savenko N.A., Boshlyakov V.N., Zhukov V.F. and other Catalog of bulls-producers of JSC "Moscow" for breeding. - Moscow: Moscow Agricultural Ministry. - 2007. - 104 p.

            9. Shapochkin V.V., Eskin G.V. Catalog of manufacturing bulls FSUE "TsSIO". Podolsk. - 2002. - 51 p.

10. Yakovlev A., Terletsky V., Mitrofanova O., Dementieva N. Determination of carriers of genetic defects among bulls // Dairy and beef cattle breeding. - 2004. - No. 7. - S. 31-32.

11. Agerholm J.S., Bendixen C, Arnbjerg J., Anderson O. Complex vertebral malformation in Holstein calves // J. Vet. Diagn. Invest. - 2001. - Vol. 13. - P. 283-289.

12. Batt C.A., Wagner P., Wiedmann M., Luo J., Gilbert R. O. Detection of bovine leukocyte adhesion deficiency by nonisotopic ligase chain reaction // Anim. Genet. - 1994. - Vol. 25. - P. 95-98.

13. Czarnik U., Grzybovski G., Kaminski S., Prusak B, Zabolewicz T. Effectiveness of a program aimed at the elimination of BLAD-carrier bulls from Polish Holstein-Friesian cattle // J. Appl. Genet. - 2007. - Vol. 48. - P. 375-377.

14. Eggen A., Duchesne A., Laurent P., Grohs C, Denis C, Gautier M., Boichard D., Ducos A. Controlling genetic disorders in the French dairy cattle population // 2 International Conference on Animal Genetics. Tokyo Japan 2004. - P.35.

15. ICAR Guidelines approved by the General Assembly held in Riga, Latvia on June 2010. Copyright ICAR. - 2011 .-- 485p.

16. Kanae Y., Endoh D., Nagahata H., Hayashi M.A. method for detecting complex vertebral malformation in Holstein calves using polymerase chain reaction-primer introduced restriction analysis // J. Vet. Diagn. Invest. - 2005. - Vol. 17. - P. 258-262.

17. KehrliM.E., SchmalstiegC, Anderson D.C., VanDerMaatenM.J., HughesB.J., AkermannM.R., WilhemsenC.L., BrownG.B., StevensM.G., Whetstone C.A. MolecularidentificationofdeficiencyoftheMac-1 (CD11b / CD18) glycoprotein // Am. J. Vet. Res. - 1990. - Vol. 51. - P. 1826-1836.

           18. Nagahata H., Miura T., Tagaki K., Ohtake M., Noda H., Yasuda T., Nioka K. Prevalence and allele frequency estimation of bovine leukocyte adhesion deficiency (BLAD) in Holstein-Friesian cattle in Japan / / J. Vet. Med. Sci - 1997 .-- Vol. 59. - P. 233-238.

19. Oguni T., Takeda Ray M., Tsuji T., Sugimoto Y., Moritomo Y., Matsumoto M., Mishina Y., Kunieda T. Identification and control of a dwarfism gene in Japanese brown cattle // 29 ^th International Conference on Animal Genetics. Tokyo Japan, 2004. P.35.

20. Rusc A., Kaminski S. Prevalence of complex vertebral malformation carriers among Polish Holstein-Friesian bull // J. Appl. Genet - 2007 .-- Vol. 48. - P. 247-252.

21. Shuster D.E., KehrliM.E.Jr., Ackermann M.R., Gilbert R.O. Identification and prevalence of a genetic defect that causes leukocyte adhesion deficiency in Holstein cattle // Proc. Nat. Acad. Sci. USA - 1992a. - Vol. 89. - P.9225-9229.

22. Shuster D.E., Bosworth B.T., KehrliM.E.Jr. Sequence of the bovine CD18-encoding cDNA: comparison with the human and murine glycoproteins // Gene. - 1992b. - Vol. 114. - P. 267-271.

23. Schutz E., Scharfenstein M., Brenig B. Implication of complex vertebral malformation and bovine leukocyte adhesion deficiency DNA-based Testing on disease frequency in the Holstein population // J. Dairy Sci - 2008. - Vol. 91. - P. 4854-4859.

24. Tammen I. Weiterentwicklung des DNA-Tests auf BLAD (Bovine Leukozyten Adhasionsdefizienz) fur den Einsatz in Rinderzucht und klinischer Diagnostik. Hannover. - 1994 .-- 128s.

Claims (2)

1. A method for the simultaneous genetic diagnosis of two mutant alleles that cause CVM and BLAD in cattle involves the isolation of DNA from biological material, the setting up of the polymerase chain reaction in real time using a reaction mixture with CVM / BLAD containing 50 mMKCl, 50 mMTRIS-HCl , 250 nMdNTP, 2.5 mMMgCl ₂ , primers at a concentration of 200 nM, allele-specific probes at a concentration of 100 Nm, having the following sequences:
CVM_up - gattctcaagagcttaattctaagga
CVM_low - aagtaaaccccagcaaagccac
CVM_Wt - (FAM) aggtctcatggcagttct- (BHQ1)
CVM_m - (R6G) catggcatttctcacagcat- (BHQ2),
BLAD_up - ttaggcagttgcgttc
BLAD_low - acgttgacgaggtcatccacca,
BLAD_Wt - (ROX) accccatcgacctgtacta-- (BHQ1),
BLAD_m (Cy5) ccatcggcctgtactacct- (BHQ2),
diluent, 2.5 units Taq DNA polymerase, three positive and one negative control samples, when preparing for the reaction, the required volume of components is calculated based on the number of test samples plus 4, the reagents are mixed, then 20 μl of the prepared PCR mixture are added to prepared tubes for PCR, 5 μl of control and test samples are added to each PCR tube, the tubes are placed in an amplifier, the primers are annealed at the cycling stage at 64 ° С for 30 s with the number of amplification cycles equal to 40, analysis was obtained These data are carried out by comparing the amplified regions of the genes, the results are interpreted based on the presence or absence of the intersection of the fluorescence curve with a threshold line set at an appropriate level. 2. A test system for simultaneous gene diagnostics of two mutant alleles that cause CVM and BLAD in cattle by the method of setting up a polymerase chain reaction in real time, characterized in that it includes a reaction mixture with CVM / BLAD containing all the necessary reagents for PCR namely, 50 mMKCl, 50 mMTRIS-HCl, 250 nMdNTP, 2.5 mMMgCl ₂ , primers at a concentration of 200 nM, allele-specific probes at a concentration of 100 nM, having the following sequences:
CVM_up - gattctcaagagcttaattctaagga
CVM_low - aagtaaaccccagcaaagccac
CVM_Wt - (FAM) aggtctcatggcagttct- (BHQ1)
CVM_m - (R6G) catggcatttctcacagcat- (BHQ2),
BLAD_up - ttaggcagttgcgttc
BLAD_low - acgttgacgaggtcatccacca,
BLAD_Wt - (ROX) accccatcgacctgtacta-- (BHQ1),
BLAD_m (Cy5) ccatcggcctgtactacct- (BHQ2),
diluent, 2.5 units Taq DNA polymerase, 3 positive controls, one negative control.

Images