RU2592204C1 - Method for early prediction of habitual miscarriage - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention can be used for early prediction of miscarriage. Method involves RNA recovery from epithelial cells of cervical canal in females, reverse transcription to produce mDNA, determination of CASP-3α expression (relative units) and COX-2 by quantitative polymerase chain reaction and calculation y₁ and y₂ by equations of linear discriminant function of following type:

y₁=-0.8383+155.755*x₁+27.2986*x₂,

y₂=-207.714+3,007.030*x₁+533.609*x₂,

where x₁ is level of mRNA expression of CASP-3α (relative units), x₂ is level of mRNA expression of COX-2 (relative units). Early miscarriage is predicted, if y₁ is more y₂. Development of pregnancy is predict if y₂ is greater than y₁. Presented invention enables effective prediction of miscarriage in 92.10 % cases.

EFFECT: method application enables timely implementation of required therapeutic and preventive actions for prevention of habitual miscarriage.

1 cl, 3 tbl

Description

The invention relates to the field of medical diagnosis, can be used for early prediction of miscarriage.

Miscarriage of early pregnancy is an urgent problem of modern obstetrics, as it is a polyetiological condition that combines various disorders in the reproductive system and in the body of a woman as a whole (Tetruashvili N.K., Agadzhanova A.A. Patient examination and pre-gestational training program with the usual miscarriage (clinical lecture) // Akush. and gyn. - 2012. - No. 6. - S. 87-91). Spontaneous miscarriages in the early stages are found in 15% of all registered cases of pregnancy. Moreover, up to 80% of reproductive losses occur in the first trimester (Carp H.J.A. Recurrent pregnancy loss: causes, controversies and treatment // Informa, 2007. - 290 p.). In fact, the number of women with miscarriage may be slightly higher, as part of spontaneous miscarriages occurs even before a woman visits a gynecologist in connection with the fact of pregnancy (Radzinsky V.E., Dimitrova V.I., Mayskova I.Yu. Non-developing pregnancy / / M.: Geotar Media, 2009 .-- 208 p.). About 1-2% of women suffer from habitual miscarriage. Habitual miscarriage may be associated with the presence of chromosomal abnormalities, thrombophilic conditions in the mother, as well as with immune and endocrine disorders, however, in 50% of cases, the cause of the miscarriage is undetermined (Ortel TL Antiphosphlipid syndrome: laboratory testing and diagnostic strategies // Am.J. Hematol .- 2012. - Vol. 87, Suppl. 1. - P. 75-81). Therefore, the study of the causes of miscarriage is still one of the urgent problems in obstetrics and gynecology.

Among the causes of miscarriage, one of the leading places is occupied by inflammatory diseases (Kitaya K., Yasuo T. Immunohistochemistrical and Clinicopathological Characterization of Chronic Endometritis // American Journal of Reproductive Immunology. - 2008. - Vol.66, Iss. 5. - P. 410 -415). Evidence of the role of chronic endometritis in the genesis of early miscarriages is the fact that women with chronic endometritis have a significantly lower frequency of implantation of the embryo compared with patients with normal endometrium (11% and 58%, respectively) (Kovaleva Yu.V. Role of endometrial pathology in the structure of the causes of miscarriage // Bulletin of the Federal Center for Cardiology and Injection named after V.A. Almazov. - 2010. - No. 6. - P.35).

However, the diagnosis of chronic endometritis is currently a significant challenge. Currently, a complex of clinical and medical data is used for this, as well as endometrial biopsy data obtained with an aspiration biopsy or diagnostic curettage of the uterine mucosa under the control of hysteroscopy. However, the diagnostic value of histological examination for the diagnosis of chronic endometritis and the prognosis of miscarriage has not been established (Kasius JC, Broekmans FJ, Sie-Go DM, Bourgain C. et al. The reliability of the histological diagnosis of endometritis in asymptomatic IVF cases: a multicenter observer study // Hum Reprod. - 2012 .-- Vol. 27 (1). - P. 153). In most cases, in the detection of chronic endometritis, which is the cause of miscarriage, a specific pathogen cannot be identified, which indicates the non-specific nature of the inflammation due to changes in local immunoreactivity (Cakmak H., Taylor HS Implantation failure: molecular and clinical treatment // Hum. Reprod. Update. - 2011. - Vol.17 (2). - P. 242-253).

When considering fetal-maternal interactions from the point of view of the immune response, it should be emphasized that the interaction of the mother and the fetus is immunologically unique, as it should provide tolerance to the allogeneic fetus and at the same time maintain protection against possible pathogens. Clinical studies have shown a strong relationship between intrauterine bacterial and viral infections and pregnancy complications such as miscarriages, premature birth, intrauterine growth retardation and late gestosis (Arechavaleta-Velasco F., Gomez L., Ma Y. et al. Adverse reproductive outcomes in urban women with adeno-associated virus-2 infections in early pregnancy // Hum. Reprod.- 2008. - Vol.- P. 23, 29-36). Thus, the inflammatory response can have a huge impact on the course of pregnancy.

The choice of determining the expression of Cyclooxygenase-2 (COX-2) and Caspase-3α (CASP-3α) as a diagnostic method for miscarriage is associated with a high specificity of the method, since COX-2 is the main enzyme for the synthesis of prostaglandins, and CASP-3α is an effector protease participating in the process of apoptosis (Akhmatova N.K., Kiselevsky M.V. Congenital immunity: antitumor and anti-infectious // Moscow: Practical Medicine, 2008. - 255 p .; Horne A., Stock S., King A. Innate immunity and disorders of female reproductive tract // Reproduction. - 2008. - Vol. 135. - P. 739-749).

Since methods for early diagnosis of miscarriage based on the expression of CASP-3α and COX-2 have not been identified, methods for diagnosing miscarriage based on the determination of other immunological parameters were taken as analogues.

A known method for predicting miscarriage of early infectious genesis (RU No. 2444734, publ. 10.03.2012), based on determining the level of the soluble form of the sFlt-1 receptor in the blood serum of a pregnant woman in the first trimester. With its value equal to 0.389 ng / ml or lower, pregnancy termination is predicted. The method allows to reduce the threat of perinatal losses due to the timely identification of pregnant risk groups and the beginning of adequate therapeutic measures.

This method has disadvantages. Material sampling for the study was carried out in women with concomitant gynecological pathology, which, in turn, does not provide reliable data indicating that it is by this method that prediction of miscarriage is possible.

A known method for predicting miscarriage in the first trimester of pregnancy (RU No. 2341800, publ. 20.12.2008), based on the determination of the substance P (SP) and tumor necrosis factor (FNO) in the blood serum of a pregnant woman by ELISA. Then, the prognostic coefficient K is calculated using the formula. If the value of the prognostic coefficient K is greater than 0.48, then the threat of termination of pregnancy is predicted for this pregnant woman. Using the method allows to increase the accuracy, sensitivity and specificity of predicting the course of the first trimester of pregnancy. The disadvantage of this method is its complexity.

There is also a method for predicting miscarriage in the second trimester of pregnancy (RU No. 2340899, publ. 10.12.2008), based on the determination of the content of transforming growth factor-2 (TGF-2) in the blood serum of a pregnant woman. If TGF-2 is less than 1806.8 pg / ml, then the threat of abortion is predicted. If TGF-2 is more than 1806.8 pg / ml, then the substance level P (SP) is additionally determined and, if it is more than 0.274 ng / ml, then the threat of termination of pregnancy in the second trimester is also predicted. Using the method allows to increase the accuracy, sensitivity and specificity of predicting the course of the second trimester of pregnancy. The disadvantages of this method are its lack of specificity and high complexity.

A known method for predicting miscarriage at the pregravid stage (RU No. 2184968, published July 10, 2002), in which the immunogenetic profile of peripheral blood leukocytes in a married couple is studied, the discriminant function F is determined based on HLA antigens of classes I, II the formula

F (x) = 0.78A1 + 0.74A9 + 0.77A11 + 1.71 A28-0.94A29-0.95B21 + 5.04B39-

-1.54 B57-1.87 B65-0.22 Dr5 + 1.39 Dr7-0.83 MA9 + 0.56 MA10-1.12 MA28 +

+ 1.73 · MA29-0.74 · MB5 + 0.56 · MB7 + 0.71 · MB8 + 1.11 · MB12 + 1.62 · MB14-

-0.65; MB27-0.61; MB53-0.83; MDr2-1.60; MDr3-0.51; MDr5-0.67; MDr7-0.46;

where A1, A9, A11, A28, A29 are the genes A of the locus of the wife, MA9, MA10, MA28, MA29 are the genes A of the locus of the husband, B21, B39, B57, B65 are the genes B of the locus of the wife, MB5, MV7, MV8, MV12, MV14, MV27, MV53 - husband locus B genes, Dr5, Dr7 - wife locus Dr genes, MDr2, MDr3, MDr5, MDr7, husband locus Dr genes, N - norm if F (x)> 0, P - pathology if F (x) <0. The obtained function ensures the sensitivity of the decision prediction rule 79.4%, specificity 81%, efficiency 80.7%. The disadvantage of this method is the duration and the complexity of its implementation.

There are ways to predict late miscarriages. So, a method is described (RU No. 2465589, published October 27, 2012) based on determining the concentration of tumor necrosis factor alpha (TNF), interleukin-1 (IL-1), interleukin-6 (IL-6) in the blood serum of a pregnant woman. Additionally, the number of CD95 + lymphocytes (L CD95 +), the level of alpha-2-microglobulin fertility (FAMB), the concentration of placental growth factor (PGF) and total IgE are determined. If the obtained values correspond to the following indicators: TNF concentration (PCG / ml) - 294 ± 39.5; the concentration of IL-1 (PCG / ml) - 588 ± 46.3; the concentration of IL-6 (PCG / ml) - 85.2 ± 13.1; the amount of L CD95 + (%) - 14.1 ± 5.2, the level of FAMB (ng / ml) - 215 ± 42, the level of PGF (PCG / ml) - 21 ± 6.2; the total IgE content (PCG / ml) is 68 ± 24, a late miscarriage is predicted. The disadvantage of this method is its low sensitivity.

The objective of the present invention is to develop a highly accurate method for predicting miscarriage based on the expression of CASP-3α and COX-2, suitable for use on an outpatient basis.

EFFECT: obtaining criteria for assessing the risk of developing miscarriage, allowing to determine the clinical prognosis and tactics of conducting a woman during pregnancy, which allows to reduce economic costs and reduce the number of hospital days of patients in the gynecological department.

In accordance with the task, a method was developed for early prediction of miscarriage, based on the determination of the expression of CASP-3α and COX-2, including:

- isolation of ribonucleic acid (RNA) from epithelial cells of the cervical canal in women in early pregnancy;

- reverse transcription to obtain cDNA;

- determination of the expression of CASP-3α and COX-2 using a quantitative polymerase chain reaction;

- prediction of the probability of miscarriage according to the equations of the linear discriminant function of the following form:

y ₁ = -0.8383 + 155.755 * x ₁ + 27.2986 * x ₂ ,

y ₂ = -207.714 + 3007.030 * x ₁ + 533.609 * x ₂ ,

where x ₁ is the expression level of CASP-3α mRNA (relative units), x ₂ is the expression level of COX-2 mRNA (relative units);

- prediction of the development of miscarriage of early pregnancy, if y _{1 is} greater than y ₂ ;

- Forecasting ongoing pregnancy if y ₂ is greater than y _1.

The novelty and inventive step is that the possibility of early prediction of miscarriage based on the determination of the expression of CASP-3α and COX-2 is not currently known.

The method is as follows.

Determination of the expression of CASP-3α and COX-2 mRNA was carried out by quantitative PCR method at the Research Laboratory “Human Molecular Genetics” of the National Research University “BelGU”.

Cervical canal epithelial cells are the material for determining the expression of CASP-3α and COX-2 for the early diagnosis of miscarriage. The method was developed taking into account the MIQE standard (Bustin S., Benes V., Garson G. et al. The MIQE Guidelines: Minimum information for publication of quantitive Real-Time PCR experiments // Clin. Chem. - 2009. - No. 55, Vol. .4. - P. 611-622).

Material was taken from pregnant women at a gestational age of 6–10 weeks. The group with miscarriage consisted of 100 patients with spontaneous miscarriages for a period of 6-10 weeks, the control group consisted of 60 patients who underwent medical abortion at the same time.

The cervix was exposed in the mirrors, and mucus was removed from the cervical canal with a sterile swab. Then, using a cytobrush, the material was collected in a 1.5 ml Eppendorf tube containing 500 μl of RNAlater preservation medium (Ambion).

If there is a need for storage of the material, after placing the material in the RNAlater solution, the tubes are left in the refrigerator at a temperature of + 4 ° C for 1 day, then placed in a freezer and stored at a temperature of -28 ° C. After thawing the samples, the supernatant is drained and RNA isolation proceeds.

To isolate RNA from samples, the tubes were thawed at room temperature, then centrifuged at 12,000 rpm for 5–10 minutes, and the supernatant was removed. The resulting pellet was a suspension of epithelial cells that were suitable for RNA isolation.

After thawing the samples, RNA extraction was carried out using the phenol-chloroform extraction method described by the manufacturer using the Trizol reagent (Invitrogen, USA).

The quality of RNA was checked by electrophoresis for 15 minutes at a voltage of 10 V / cm according to the intensity of luminescence of ribosomal RNA bands in a 1.1% ethidium bromide agarose gel. Then, the samples were treated with DNAse I DNAse I RNAse free (Fermentas, USA) to remove genomic DNA according to the manufacturer's instructions.

For reverse transcription, Mint reverse transcriptase was used (Eurogen, Russia). To initiate the reaction, oligodeoxynucleotides (oligoDT) synthesized by Eurogen were used. 500 ng of RNA preliminarily heated to 55 degrees was added to the reaction (mRNA concentration was checked on a Nanodrop spectrophotometer (ThermoScientific, USA), and 4 μl of oligoDT (20 μM); reverse transcription was performed according to the manufacturer's instructions.

The quality of the obtained cDNA was evaluated using gel electrophoresis in a 1.1% agarose gel with ethidium bromide. For further PCR, dilution of the obtained cDNA with sterile water in a volume of 2 to 50 was used.

For quantitative PCR, gene primers were selected using the BLAST database (www.ncbi.nlm.nih.gov). One of the conditions for the search for primers was the difference between the amplification temperature of the forward and reverse primers of not more than 2 ° C. All primer pairs obtained were tested for the possibility of the formation of hairpins and dimers using the Beacon Designer Free Edition program (http://www.premierbiosoft.com/qOligo/Oligo.jsp?PID=1). In addition, in order to test for primer dimers, a step for analyzing the melting curve (melt curve) was added to the PCR program. The following primers were selected (Table 3). Among all the normalizing genes according to the literature (Aflatoonian R., Tuckerman E., Elliott SL et al. Menstrual cycle-dependent changes of Toll-like receptors in endometrium // Hum. Reprod. - 2007. - Vol.22. - P 586-593) and the RT-Primer Database (http://www.rtprimerdb.org/), the most stably expressed cervical and endometrial genes expressed in epithelial cells were selected and evaluated using the GeNorm-Plus program (www.biogazelle .com). Beta actin (beta-actin) and peptidyl propyl isomerase (PPIA) were chosen as normalizing genes.

Table 1 Quantitative PCR primers Name
gene Direct primer Reverse primer T annealing, ºС one CASP-3α GTGCTATTGTGAGGCGGTTG CACGGATACACAGCCACAGG 55 2 COX-2 ATCTACGGTTTGCTGTGGGG TTCTGTACTGCGGGTGGAAC 57 3 β-actin CAGGCACCAGGGCGTGATGG GATGGAGGGGCCGGACTCGT 64 four PPIA CCGCCGAGGAAAACCGTGTACT TGGACAAGATGCCAGGACCCGT 64

For real-time PCR, a mixture of qPCRmix-HS SYBR with an intercalating dye SYBRI was used, which includes high-performance hot-start Taq polymerase, a mixture of nucleotide triphosphates, magnesium, and buffer solution.

To prepare the mixture, 2 μl of DNA, 2 μl of forward and reverse primers, 5 μl of qPCRmix-HS SYBR mixture, 14 μl of sterile water were added to one tube. Amplification was performed on a CFX96 thermocycler (Biorad, USA).

Amplification Mode:

1. Preliminary denaturation - 1 cycle 95ºС 5 min;

2. Denaturation - 1 cycle 95ºС 30 s;

3. Annealing at a temperature corresponding to each primer (see table) - 30 s;

4. Elongation at 68ºС - 30 s.

The number of cycles is 50.

An additional step after amplification was added a melt curve from 55 to 95 degrees for 6 seconds in order to detect possible primer dimers.

The results were expressed in relative units, calculating them according to the formula

R = 2 ^{((Cqref1 + Cqref2) / 2 - Cqtarget)} ,

where R is the normalized expression of mRNA of the studied genes, Cqref1 and Cqref2 are Cq of normalizing genes, Cq target is Cq of the studied gene of a particular woman.

Statistical processing of the results was carried out using the program "Statistica 6.0".

Verification of the normality of the distribution of characters was carried out using the Kolmogorov-Smirnov and Shapiro-Wilk criteria.

In the case of a normal distribution of the sample for this attribute, the result was presented as the arithmetic mean ± standard deviation (M ± σ). To assess the significance of differences in characteristics that obey the law of normal distribution, Student t-test was used for two independent samples. In the absence of a normal distribution of the sample, the result was presented as the median (lower quartile; upper quartile). For correlation analysis, the Spearman test was used. Differences were considered statistically significant at a significance level of p <0.05.

To create an individual prognosis of early pregnancy miscarriage based on the expression of CASP-3α and COX-2, the discriminant analysis method was used (Table 2).

table 2 Informative signs and their discriminant comparative analysis coefficients for spontaneous miscarriages and progressive early pregnancy for COX-2 and CASP-3α, N = 114, F (2.5) = 231.97, p <0.00001 Sign
N = 114 F-test p-level Characteristic Coefficients Miscarriage Progressive Pregnancy CASP-3α 267.8731 0.000016 155.7550 3007,030 COX-2 83,3752 0,000264 27.2986 533,609 Constant -0.8383 -207,714

Table 2 shows the coefficients of the attributes that are necessary to substitute them into 2 discriminant equations, which have the form:

- determination of the values of y ₁ and y ₂ according to the equations of a linear discriminant function of the following form:

y ₁ = -0.8383 + 155.755 * x ₁ + 27.2986 * x ₂ ,

y ₂ = -207.714 + 3007.030 * x ₁ + 533.609 * x _2,

where x ₁ is the expression level of CASP-3α mRNA (relative units), x ₂ is the expression level of COX-2 mRNA (relative units);

- prediction of the development of miscarriage of early pregnancy, if y _{1 is} greater than y ₂ ;

- predicting a progressive pregnancy if y _{2 is} greater than y ₁ .

We examined 57 patients with spontaneous miscarriages for periods of 6-10 weeks and 57 patients with a progressive pregnancy of the same period. The quantitative PCR method was used to determine the expression of CASP-3α and COX-2 mRNA in the epithelium of the cervical canal.

Table 3 shows the analysis classification matrix, from which it is seen that 91.22% of women with spontaneous miscarriages of early terms were correctly classified, and in the group with progressive pregnancy - 92.98%. The recognition quality in this model was 92.10%. The reliability of the model was high (F = 231.97, p <0.00001).

Table 3 Discriminant Analysis Classification Matrix Group Miscarriage Progressive
pregnancy Total, % Quality
recognition,% CASP-3α 91.22% 8.77% one hundred 91.22% COX-2 7.77% 92.98% one hundred 92.98% Total 98.99% 101.75% 200 92.10%

Thus, the proposed invention is workable and allows you to effectively predict miscarriage in 92.10% of cases. The use of this method will allow the timely implementation of the necessary treatment and preventive measures to prevent miscarriage.

Claims (1)

A method for early prediction of miscarriage, including the isolation of RNA from epithelial cells of the cervical canal in women, reverse transcription to obtain cDNA, determination of the expression of CASP-3α and COX-2 using a quantitative polymerase chain reaction and prediction of the probability of miscarriage by linear discriminant function of the following type:
y ₁ = -0.8383 + 155.755 * x ₁ + 27.2986 * x ₂ ,
y ₂ = -207.714 + 3007.030 * x ₁ + 533.609 * x ₂ ,
where x ₁ is the expression level of CASP-3α mRNA (rel. units), x ₂ is the expression level of COX-2 mRNA (rel. units), while the development of miscarriage of early pregnancy is predicted if y _{1 is} greater than y ₂ , and predict the progression of pregnancy if y ₂ is greater than y _1.