RU2583924C1 - METHOD FOR MULTIPLEX PCR DETECTION OF Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens AND Eggerthella spp. IN CLINICAL MATERIAL - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention is intended for PCR-detection of Atopobium vaginae bacteria, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. in clinical material. DNA is recovered, amplification and electrophoresis conducted. One performs multiplex PCR using specific primers in cyclic mode. At electrophoretic detection of amplicons with sizes 286 bps, and/or 768 bps, and/or 135 bps, and/or 428 base pairs presence of Atopobium vaginae bacteria, and/or Leptotrichia amnionii and/or Sneathia sanguinegens and/or Eggerthella spp., respectively is detected.

EFFECT: invention ensures simultaneous detection in clinical material up to 4 bacteria types associated with bacterial vaginosis.

1 cl, 1 dwg, 2 tbl, 10 ex

Description

The present invention relates to medicine, namely to clinical laboratory diagnostics and medical microbiology, and can be used in medical practice for the accelerated detection and identification of Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. in clinical material for the subsequent diagnosis of bacterial vaginosis.

It was found that with bacterial vaginosis (a violation of the state of the vaginal microflora), microorganisms Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp are often found. It was shown that the presence of these microorganisms in the clinical material correlates with the severity of bacterial vaginosis. Accordingly, their early detection has diagnostic value [Fredricks D.N., Fiedler T.L., Marrazzo J.M. Molecular identification of bacteria associated with bacterial vaginosis. N. Engl. J. Med. 2005.353: 1899-1911].

In microbiological practice, for the detection and identification of microorganisms in clinical material, mainly microscopic studies of micropreparations (Gram stain, methylene blue, etc.) and the cultural method (isolation of pure cultures of microorganisms) are used [Methods of clinical laboratory research: A reference manual. Volume 3. / Ed. V.V. Menshikov. - M .: Lab, 2009. - 880 s]. The indicated methods have a number of significant drawbacks: microscopic examination using a Gram stain method allows us to differentiate by pure tinctorial traits only pure bacterial cultures, isolated mainly in the form of a colony from the surface of dense agarized media. When staining clinical material (scrapings, discharge of mucous membranes, etc.), standardization of the living conditions of bacteria and, accordingly, maintaining the constancy of their tinctorial signs is impossible, therefore, in the vast majority of cases, an unambiguous differentiation of gram-positive and gram-negative bacteria by color is problematic. Microscopy as a method, in principle, does not allow to establish the species affiliation of microorganisms. In addition, microscopy of micropreparations reveals microorganisms present in the biomaterial in an amount usually exceeding 10 ⁵ CFU / ml, while many facultative anaerobic and aerobic bacteria can exhibit a pathogenic effect with a relatively small amount (up to 10 ⁴ CFU / ml) that is not detected by microscopy. The disadvantages of light microscopy are that no more than 10 morphotypes are detected, while many species and genera of bacteria found in micropreparations are morphologically of the same type. For example, Atopobium vaginae does not have specific microscopic features and looks under the microscope as corynebacteria, which are quite common in healthy women. Light microscopy does not allow differentiating the ultrastructural features of the bacteria under study; therefore, identification of bacteria to a species, relying solely on data on shape, size and relative position, is not possible. Finally, the disadvantages of the method include subjectivity and the dependence of the result of the study on the qualifications of a laboratory doctor. Therefore, in general, the diagnostic value of microscopic examination of clinical material is relatively low, and microscopy as a method is mainly used for screening.

More specific and sensitive is the cultural method. However, many representatives of the microbiota and bacteria with which dysbiotic states are associated, including Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp., Are obligate anaerobes and are not cultured under normal conditions. Moreover, cultural research is distinguished by duration (up to 7 days) and high cost (special nutrient media, etc.), as well as a number of serious requirements for the preanalytical stage (dates, transport media, etc.). The cost of cultural research increases by orders of magnitude during the biochemical identification of selected cultures, based on the additional characteristics of colonies by more than 50-70 biochemical characteristics, while errors caused by phenotypic variability of bacteria are not excluded.

In this regard, for reliable detection of Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. Molecular biological research methods, in particular, polymerase chain reaction (PCR) with the detection of amplification products in agarose gel, seem to be promising.

Polymerase chain reaction (PCR) is an in vitro DNA amplification method that can be used to detect a specific DNA sequence within a few hours [K. Mullis The unusual origin of the polymerase chain reaction. Sci. Am., 1990, 262, 56]. The essence of the PCR method is that total DNA is preliminarily extracted from the test sample, then oligonucleotide seeds (primers) are introduced that limit specific fragments of the desired DNA. During the amplification process, the concentration of DNA increases exponentially, and therefore, even if only one double-stranded DNA molecule was initially present in the initial solution, about 10 ⁸ amplicon molecules accumulate in the solution over 30-40 cycles. This amount is sufficient for reliable visual detection of this fragment by agarose gel electrophoresis. The method allows in a short time (within a few hours) to identify and identify any microorganisms in any biomaterial obtained from the pathological process without isolating a pure culture using specially selected specific primers. The advantages of the PCR method are high specificity and sensitivity, universality of the procedure, simplicity and convenience of analysis.

The possibilities of a PCR reaction are promising in the context of the possibility of simultaneous detection and identification in a single test tube of genomic DNA of microorganisms of several different species, the so-called multiplex PCR (multiplex PCR). This is ensured by the simultaneous introduction of several pairs of species-specific primers into the reaction mixture, amplification and detection of species-specific amplicons of different sizes.

The closest analogue (prototype) is a method for identifying microorganisms of the vaginal microflora, including Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp., Including PCR amplification of 16S pPHK with detection of results in 2-3% agarose gel and comparative analysis of specific representatives of normative and conditionally pathogenic biota in women with and without bacterial vaginosis [Fredricks DN, Fiedler TL, Marrazzo JM Molecular identification of bacteria associated with bacterial vaginosis. N. Engl. J. Med. 2005.353: 1899-1911]. However, this method does not allow PCR detection in the mutiplex reaction mode.

The objective of the invention is to develop a method for the multiplex identification of Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. in clinical material.

The technical result achieved by using the invention is to reduce the duration of the study, significantly increase the sensitivity and specificity of the simultaneous detection of four types of bacteria in the clinical material: Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp.

The specified technical result is achieved by the fact that in the method of PCR detection of Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. in clinical material, including DNA extraction from the test material, amplification and electrophoresis, according to the invention, multiplex PCR is carried out using specific primers for Atopobium vaginae: 5 ′ gcgtaggcggtctgttaggtca 3 ′ and 5 ′ gttagctgcggcacggaaagtat 3 ′ 3ggagtagiagtag 3 iagnagtag 3 iagnagtag 3 iagnagtag 3 ia gnagtag 3 5 ′ cccgaggatgtcaagat 3 ′, to Sneathia sanguinegens: 5 ′ gcgatacatggcaaaactaagaaa 3 ′ and 5 ′ tgtgtacaagaccccgagaac 3 ′ and to Eggerthella spp .: 5 ′ ttgctcaagcggaacctctaatct 3 ′ and 5 ′ cyclic acgct temperature 94 ° C; then 30 cycles, each of which includes a denaturation step for 30 sec at 94 ° C, a primer annealing step for 30 sec at 59 ° C, and an elongation step for 30 sec at 72 ° C; the final cycle for 2 min at a temperature of 72 ° C, with electrophoretic detection of amplicons measuring 286 bp and / or 768 bp and / or 135 bp and / or 428 bp determine the presence of Atopobium vaginae and / or Leptotrichia amnionii and / or Sneathia sanguinegens and / or Eggerthella spp. respectively.

The invention is illustrated by a figure, which shows an electrophoregram of the amplification results using a multiplex test system.

Primer selection. As target DNA, the sequences of 16S rRNA genes were selected. The choice of these genes is due to the availability of huge amounts of data on the structure of rRNA genes in a wide variety of microorganisms. RRNA genes were found in all cellular life forms, descend from a common ancestor and are functionally constant, genetically stable. The 16S rRNA gene has highly conserved and variable regions. The use of highly conserved regions as targets for primer annealing makes it possible to reliably identify the desired bacteria to a species, avoiding errors associated with genetic variation.

To construct a test system, we searched for DNA sequences of BV-associated bacteria represented in the GenBank international nucleotide sequence bank (www.ncbi.nlm.nih.gov): Atopobium vaginae (Y17195.1), Leptotrichia amnionii (EF218612), Sneathia sanguinegens (AJ344093), Eggerthella spp. (AY738656). When using the MegAlign program (USA), a comparative analysis of the nucleotide sequences of these microorganisms was carried out and the most conservative and species-specific sites were found that allow the species species to be identified with the highest reliability. Using the PrimerSelect program of the Lasergene software package (DNASTAR, Inc., USA), pairs of oligonucleotide primers were selected that meet the following requirements: inability to form stable dimers between themselves and form hairpin structures; annealing temperature 55-70 ° C; The 3′-end of a 10 nucleotide primer is completely complementary to the DNA strand; the minimum temperature difference between the annealing primers of one pair; primer length 18-30 nucleotides. Further, similar sequences were searched across the entire gene database using the Megablast program, available on the NCBI website (www.ncbi.nlm.nih.gov), which made it possible to establish the absence of homology of the fragment of the analyzed gene of the studied microorganism to similar genes of other microorganisms. This suggests the possibility of their use as a target and the species-specificity of the selected primer sequences. To identify the genetic material of the studied microorganisms by multiplex PCR, primer pairs were selected (table 1).

The proposed detection method includes three stages: the selection of genetic material, multiplex amplification (PCR) and electrophoresis.

At the first stage, total DNA is isolated from the clinical material (detachable from the posterior fornix of the vagina). DNA isolation is carried out under the conditions regulated by the Methodological guidelines of MU 1.3.2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. To ensure the necessary degree of DNA purity and to obtain a sufficient amount of it, a nucleosorption technique is used. DNA extraction is carried out using a standard set of DNA-sorb-AM series AmpliPrime firm Interlabservis. The DNA-sorb-AM reagent kit is one of the modifications of the Boom method that is maximally adapted to DNA extraction from various types of clinical material for the diagnosis of urogenital infections [Boom R., et al. 1990. Rapid and Simple Method for Purification of Nucleic Acids. J. Clin. Microbiol. 28: 495-503].

1. In a test tube with 100 μl of the test material, add 300 μl of lysis solution. A separate tip in the tube make 25 μl of resuspended sorbent.

2. Samples are thoroughly mixed on a vortex and warmed for 5 minutes at 65 ° C. After incubation, the contents are re-mixed on a vortex and left at room temperature for 2 minutes.

3. Sorbent precipitated by centrifugation at 10 thousand rpm for 30 seconds. The supernatant is removed using a vacuum aspirator.

4. Next, 1 ml of the washing solution is added to the test tube, mixed on a vortex until the sorbent is fully resuspended.

5. The sorbent is precipitated by centrifugation at 10 thousand rpm for 30 seconds. The supernatant is removed using a vacuum aspirator.

6. The tubes are placed in a thermostat with a temperature of 65 ° C for 5-10 minutes to dry the sorbent, while the caps of the tubes are open.

7. 100 μl of TE elution buffer for DNA elution is added to the tubes. Vortex is mixed until the sorbent is fully resuspended. Place in a thermostat with a temperature of 65 ° C for 5 minutes.

8. Centrifuge the tubes at 12 thousand rpm for 1 min in a microcentrifuge.

The supernatant contains a purified DNA preparation, ready for PCR. Shelf life of drugs: 1 week - at + 2-8 ° C or 1 year - at minus 16 ° C.

II stage. Amplification of DNA.

1. The resulting DNA preparation was added to the reaction mixture (25 μl) of the following composition: 3 μl of the test DNA, 2.5 μl of 10 × Taq buffer, 2.5 μl of dNTP solution, 0.5 μl of each primer (8 primers of 2 pu each, Table 1), 0.5 μl of Taq polymerase and 12.5 μl of mQ.

2. To prevent evaporation, an additional 1 drop of sterile mineral oil is added to each tube.

3. Amplification of the desired fragments of 16S ribosomal RNA (rRNA) genes Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. they are carried out on a Tertsik MS-2 thermocycler (DNA-technology, Russia) in accordance with the optimal regime established by the authors (table 2). At the first stage, DNA is denatured at 94 ° C for 1 min, then 30 cycles, each of which includes the stage of DNA denaturation for 30 sec at 94 ° C, the stage of primer annealing for 30 sec at 59 ° C, and the elongation stage for 30 seconds at a temperature of 72 ° C. At the final stage, the reaction mixture is maintained at a temperature of 72 ° C for 2 minutes.

III stage. Electrophoretic analysis of PCR products.

The analysis is carried out using standard kits on certified equipment (Biocom, Moscow) in a 1.7% horizontal agarose gel. As an electrolyte for electrophoresis, a 1-TBE buffer is used. Electrophoresis parameters: current strength 400 mA, power 80 W, voltage 120 V. Electrophoresis is carried out for 25-30 minutes. Detection of the results is carried out by staining the agarose gel with ethidium bromide, followed by visualization with UV light on a UVT-1 transilluminator (Biocom, Russia). Documentation of the results is carried out using a system for photo documentation: a digital video camera "Mintron" and the program "Biotest-D" (Biocom, Russia). Amplification products appear as a luminous orange-red band. To control the lengths of amplification products, the corresponding DNA length marker 100 + bp DNA Ladder (EuroGen), consisting of 9 DNA fragments in the range of 100-1000 bp, is used. and an additional fragment of 1500 bp

To interpret the results of the analysis, Table 1 is used. When electrophoretic detection of the amplification product is 286 bp in size. state the presence of Atopobium vaginae in the clinical material in the presence of a 768 bp PCR product. - Leptotrichia amnionii, PCR product size 135 bp - indicates the presence of Sneathia sanguinegens, the size of the PCR product is 428 bp - Eggerthella spp.

The invention is illustrated by the following examples.

Example 1

I stage. Isolation of total DNA.

From the clinical sample No. 1 (detachable from the posterior vaginal fornix), the total DNA preparation is isolated. DNA isolation is carried out under the conditions regulated by the Methodological guidelines of MU 1.3.2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. To ensure the necessary degree of DNA purity and a sufficient amount of it, a nucleosorption technique is used. DNA extraction was carried out using a standard set of DNA-sorb-AM of the AmpliPrim series from Interlabservice.

II stage. Amplification of DNA.

1. 3 μl of the obtained DNA is added to the reaction mixture (25 μl) of the following composition: 2.5 μl of 10 × Taq buffer, 2.5 μl of dNTP solution, 0.5 μl of each primer (8 primers of 2 pu, table 1), 0.5 μl Taq polymerase and 12.5 μl mQ.

2. To prevent evaporation, an additional 1 drop of sterile mineral oil is added to each tube.

3. Amplification of the desired fragments of 16S ribosomal RNA (rRNA) genes Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. it is carried out on the Tertsik MS-2 thermocycler (DNA-technology, Russia) in accordance with the optimal regime established by the authors (table 2).

III stage. Electrophoretic analysis of PCR products.

The results are presented in the figure, lane 1.

Table 1 is used to interpret the results of the analysis. Detection of an amplification product of 286 bp indicates the presence of Atopobium vaginae in the clinical material. The absence of other distinct bands indicates the absence of Leptotrichia amnionii, Sneathia sanguinegens, and Eggerthella spp. in clinical material.

Example 2

I stage. Isolation of total DNA.

From the clinical sample No. 2 (detachable from the posterior vaginal fornix), the total DNA preparation is isolated. DNA isolation is carried out under the conditions regulated by the Methodological guidelines of MU 1.3.2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. To ensure the necessary degree of DNA purity and a sufficient amount of it, a nucleosorption technique is used. DNA extraction was carried out using a standard set of DNA-sorb-AM of the AmpliPrim series from Interlabservice.

II stage. Amplification of DNA.

1. 3 μl of the obtained DNA is added to the reaction mixture (25 μl) of the following composition: 2.5 μl of 10 × Taq buffer, 2.5 μl of dNTP solution, 0.5 μl of each primer (8 primers of 2 pu, table 1), 0.5 μl Taq polymerase and 12.5 μl mQ.

2. To prevent evaporation, an additional 1 drop of sterile mineral oil is added to each tube.

3. Amplification of the desired fragments of 16S ribosomal RNA (rRNA) genes Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. it is carried out on the Tertsik MS-2 thermocycler (DNA-technology, Russia) in accordance with the optimal regime established by the authors (table 2).

III stage. Electrophoretic analysis of PCR products.

The results are presented in the figure, lane 2.

Table 1 is used to interpret the results of the analysis. Detection of an amplification product of 768 bp indicates the presence of Leptotrichia amnionii in clinical material. The absence of other distinct bands indicates the absence of Atopobium vaginae, Sneathia sanguinegens, and Eggerthella spp. in clinical material.

Example 3

I stage. Isolation of total DNA.

From the clinical sample No. 3 (detachable from the posterior vaginal fornix), the total DNA preparation is isolated. DNA isolation is carried out under the conditions regulated by the Methodological guidelines of MU 1.3.2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. To ensure the necessary degree of DNA purity and a sufficient amount of it, a nucleosorption technique is used. DNA extraction was carried out using a standard set of DNA-sorb-AM of the AmpliPrim series from Interlabservice.

II stage. Amplification of DNA.

1. 3 μl of the obtained DNA is introduced into the reaction mixture (25 μl), of the following composition: 2.5 μl of 10 × Taq buffer, 2.5 μl of dNTP solution, 0.5 μl of each primer (8 primers of 2 pu, table 1), 0.5 μl Taq polymerase and 12.5 μl mQ.

2. To prevent evaporation, an additional 1 drop of sterile mineral oil is added to each tube.

3. Amplification of the desired fragments of 16S ribosomal RNA (rRNA) genes Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. it is carried out on the Tertsik MS-2 thermocycler (DNA-technology, Russia) in accordance with the optimal regime established by the authors (table 2).

III stage. Electrophoretic analysis of PCR products.

The results are presented in the figure, lane 3.

Table 1 is used to interpret the results of the analysis. Detection of an amplification product of 428 bp in size. indicates the presence of Eggerthella spp. B clinical material. The absence of other distinct bands indicates the absence of Atopobium vaginae, Leptotrichia amnionii, and Sneathia sanguinegens in the clinical material.

Example 4

I stage. Isolation of total DNA.

From the clinical sample No. 4 (detachable from the posterior vaginal fornix), the total DNA preparation is isolated. DNA isolation is carried out under the conditions regulated by the Methodological guidelines of MU 1.3.2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. To ensure the necessary degree of DNA purity and a sufficient amount of it, a nucleosorption technique is used. DNA extraction was carried out using a standard set of DNA-sorb-AM of the AmpliPrim series from Interlabservice.

II stage. Amplification of DNA.

1. 3 μl of the obtained DNA is added to the reaction mixture (25 μl) of the following composition: 2.5 μl of 10 × Taq buffer, 2.5 μl of dNTP solution, 0.5 μl of each primer (8 primers of 2 pu, table 1), 0.5 μl Taq polymerase and 12.5 μl mQ.

2. To prevent evaporation, an additional 1 drop of sterile mineral oil is added to each tube.

3. Amplification of the desired fragments of 16S ribosomal RNA (rRNA) genes Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. it is carried out on the Tertsik MS-2 thermocycler (DNA-technology, Russia) in accordance with the optimal regime established by the authors (table 2).

III stage. Electrophoretic analysis of PCR products.

The results are presented in the figure, lane 4.

Table 1 is used to interpret the results of the analysis. Detection of an amplification product of 135 bp indicates the presence of Sneathia sanguinegens in the clinical material. The absence of other distinct bands indicates the absence of Atopobium vaginae, Leptotrichia amnionii, and Eggerthella spp. in clinical material.

Example 5

I stage. Isolation of total DNA.

From clinical sample No. 5 (detachable from the posterior vaginal fornix), a total DNA preparation is isolated. DNA isolation is carried out under the conditions regulated by the Methodological guidelines of MU 1.3.2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. To ensure the necessary degree of DNA purity and a sufficient amount of it, a nucleosorption technique is used. DNA extraction was carried out using a standard set of DNA-sorb-AM of the AmpliPrim series from Interlabservice.

II stage. Amplification of DNA.

1. 3 μl of the obtained DNA is added to the reaction mixture (25 μl) of the following composition: 2.5 μl of 10 × Taq buffer, 2.5 μl of dNTP solution, 0.5 μl of each primer (8 primers of 2 pu, table 1), 0.5 μl Taq polymerase and 12.5 μl mQ.

2. To prevent evaporation, an additional 1 drop of sterile mineral oil is added to each tube.

3. Amplification of the desired fragments of 16S ribosomal RNA (rRNA) genes Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. it is carried out on the Tertsik MS-2 thermocycler (DNA-technology, Russia) in accordance with the optimal regime established by the authors (table 2).

III stage. Electrophoretic analysis of PCR products.

The results are presented in the figure, lane 5.

Table 1 is used to interpret the results of the analysis. Detection of amplification products of 286 bp in size. and 428 bp indicates the presence of Atopobium vaginae and Eggerthella spp. in clinical material. The absence of other distinct bands indicates the absence of Leptotrichia amnionii and Sneathia sanguinegens in the clinical material.

Example 6

I stage. Isolation of total DNA.

From the clinical sample No. 6 (detachable from the posterior vaginal fornix), the total DNA preparation is isolated. DNA isolation is carried out under the conditions regulated by the Methodological guidelines of MU 1.3.2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. To ensure the necessary degree of DNA purity and a sufficient amount of it, a nucleosorption technique is used. DNA extraction was carried out using a standard set of DNA-sorb-AM of the AmpliPrim series from Interlabservice.

II stage. Amplification of DNA.

1. 3 μl of the obtained DNA is introduced into the reaction mixture (25 μl), of the following composition: 2.5 μl of 10 × Taq buffer, 2.5 μl of dNTP solution, 0.5 μl of each primer (8 primers of 2 pu, table 1), 0.5 μl Taq polymerase and 12.5 μl mQ.

2. To prevent evaporation, an additional 1 drop of sterile mineral oil is added to each tube.

3. Amplification of the desired fragments of 16S ribosomal RNA (rRNA) genes Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. it is carried out on the Tertsik MS-2 thermocycler (DNA-technology, Russia) in accordance with the optimal regime established by the authors (table 2).

III stage. Electrophoretic analysis of PCR products.

The results are presented in the figure, lane 6.

Table 1 is used to interpret the results of the analysis. Detection of amplification products of 135 bp and 768 bp indicates the presence of Sneathia sanguinegens and Leptotrichia amnionii in clinical material. The absence of other distinct bands indicates the absence of Atopobium vaginae and Eggerthella spp. in clinical material.

Example 7

I stage. Isolation of total DNA.

From clinical samples No. 7, 8, 9 (detachable from the posterior vaginal fornix), a total DNA preparation is isolated. DNA isolation is carried out under the conditions regulated by the Methodological guidelines of MU 1.3.2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. To ensure the necessary degree of DNA purity and a sufficient amount of it, a nucleosorption technique is used. DNA extraction was carried out using a standard set of DNA-sorb-AM of the AmpliPrim series from Interlabservice.

II stage. Amplification of DNA.

1. 3 μl of the obtained DNA is added to the reaction mixture (25 μl) of the following composition: 2.5 μl of 10 × Taq buffer, 2.5 μl of dNTP solution, 0.5 μl of each primer (8 primers of 2 pu, table 1), 0.5 μl Taq polymerase and 12.5 μl mQ.

2. To prevent evaporation, an additional 1 drop of sterile mineral oil is added to each tube.

3. Amplification of the desired fragments of 16S ribosomal RNA (rRNA) genes Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. it is carried out on the Tertsik MS-2 thermocycler (DNA-technology, Russia) in accordance with the optimal regime established by the authors (table 2).

III stage. Electrophoretic analysis of PCR products.

The results are presented in the figure, lane 7, 8, 9.

Table 1 is used to interpret the results of the analysis. Detection of amplification products of 135 bp, 286 bp and 768 bp indicates the presence of Sneathia sanguinegens, Atopobium vaginae and Leptotrichia amnionii in the clinical material. The absence of other distinct bands indicates the absence of Eggerthella spp. in clinical material.

Example 8

I stage. Isolation of total DNA.

From the clinical sample No. 10 (detachable from the posterior vaginal fornix), the total DNA preparation is isolated. DNA isolation is carried out under the conditions regulated by the Methodological guidelines of MU 1.3.2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. To ensure the necessary degree of DNA purity and a sufficient amount of it, a nucleosorption technique is used. DNA extraction was carried out using a standard set of DNA-sorb-AM of the AmpliPrim series from Interlabservice.

II stage. Amplification of DNA.

1. 3 μl of the obtained DNA is added to the reaction mixture (25 μl) of the following composition: 2.5 μl of 10 × Taq buffer, 2.5 μl of dNTP solution, 0.5 μl of each primer (8 primers of 2 pu, table 1), 0.5 μl Taq polymerase and 12.5 μl mQ.

2. To prevent evaporation, an additional 1 drop of sterile mineral oil is added to each tube.

3. Amplification of the desired fragments of 16S ribosomal RNA (rRNA) genes Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. it is carried out on the Tertsik MS-2 thermocycler (DNA-technology, Russia) in accordance with the optimal regime established by the authors (table 2).

III stage. Electrophoretic analysis of PCR products.

The results are presented in the figure, lane 10.

Table 1 is used to interpret the results of the analysis. Detection of amplification products of 135 bp and 428 bp indicates the presence of Sneathia sanguinegens and Eggerthella spp. in clinical material. The absence of other distinct bands indicates the absence of Atopobium vaginae and Leptotrichia amnionii in the clinical material.

Example 9

I stage. Isolation of total DNA.

From clinical sample No. 11 (detachable from the posterior vaginal fornix), a total DNA preparation is isolated. DNA isolation is carried out under the conditions regulated by the Methodological guidelines of MU 1.3.2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. To ensure the necessary degree of DNA purity and a sufficient amount of it, a nucleosorption technique is used. DNA extraction was carried out using a standard set of DNA-sorb-AM of the AmpliPrim series from Interlabservice.

II stage. Amplification of DNA.

1. 3 μl of the obtained DNA is added to the reaction mixture (25 μl) of the following composition: 2.5 μl of 10 × Taq buffer, 2.5 μl of dNTP solution, 0.5 μl of each primer (8 primers of 2 pu, table 1), 0.5 μl Taq polymerase and 12.5 μl mQ.

2. To prevent evaporation, an additional 1 drop of sterile mineral oil is added to each tube.

3. Amplification of the desired fragments of 16S ribosomal RNA (rRNA) genes Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. it is carried out on the Tertsik MS-2 thermocycler (DNA-technology, Russia) in accordance with the optimal regime established by the authors (table 2).

III stage. Electrophoretic analysis of products of the NDP.

The results are presented in the figure, lane 11.

Table 1 is used to interpret the results of the analysis. Detection of amplification products of 286 bp in size. and 768 bp indicates the presence of Atopobium vaginae and Leptotrichia amnionii in the clinical material. The absence of other distinct bands indicates the absence of Sneathia sanguinegens and Eggerthella spp. in clinical material.

Example 10

I stage. Isolation of total DNA.

From the clinical sample No. 12 (detachable from the posterior vaginal fornix), the total DNA preparation is isolated. DNA isolation is carried out under the conditions regulated by the Methodological guidelines of MU 1.3.2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV”. To ensure the necessary degree of DNA purity and a sufficient amount of it, a nucleosorption technique is used. DNA extraction was carried out using a standard set of DNA-sorb-AM of the AmpliPrim series from Interlabservice.

II stage. Amplification of DNA.

1. 3 μl of the obtained DNA is added to the reaction mixture (25 μl) of the following composition: 2.5 μl of 10 × Taq buffer, 2.5 μl of dNTP solution, 0.5 μl of each primer (8 primers of 2 pu, table 1), 0.5 μl Taq polymerase and 12.5 μl mQ.

2. To prevent evaporation, an additional 1 drop of sterile mineral oil is added to each tube.

3. Amplification of the desired fragments of 16S ribosomal RNA (rRNA) genes Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. it is carried out on the Tertsik MS-2 thermocycler (DNA-technology, Russia) in accordance with the optimal regime established by the authors (table 2).

III stage. Electrophoretic analysis of PCR products.

The results are presented in the figure, lane 12.

Table 1 is used to interpret the analysis results. Detection of amplification products of 286 bp, 428 bp and 768 bp indicates the presence of Atopobium vaginae, Eggerthella spp. and Leptotrichia amnionii in clinical material. The absence of other distinct bands indicates the absence of Sneathia sanguinegens in the clinical material.

Thus, the proposed method for multiplex PCR detection in clinical material allows with high sensitivity and specificity to identify and identify Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp.

Claims (1)

Method for PCR detection of Atopobium vaginae, Leptotrichia amnionii, Sneathia sanguinegens and Eggerthella spp. in clinical material, including DNA extraction from the studied material, amplification and electrophoresis, characterized in that they perform multiplex PCR using specific primers for Atopobium vaginae: 5 ′ gcgtaggcggtctgttaggtca 3 ′ and 5 ′ gttagctgcggcacggaaagtat 3 ′, kaggtag 3 ′, 5 and cccgaggatgtcaagat 3 min at a temperature of 94 ° C; then 30 cycles, each of which includes a denaturation step for 30 s at 94 ° C, a primer annealing step for 30 s at 59 ° C, and an elongation step for 30 s at 72 ° C; the final cycle for 2 min at a temperature of 72 ° C, with electrophoretic detection of amplicons measuring 286 bp and / or 768 bp and / or 135 bp and / or 428 bp determine the presence of Atopobium vaginae, and / or Leptotrichia amnionii, and / or Sneathia sanguinegens, and / or Eggerthella spp. respectively.

Images