RU2582956C2 - METHOD FOR DETECTING p.Q368X MYOCILIN (MYOC) GENE MUTATION CAUSING PRIMARY OPEN-ANGLE GLAUCOMA - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention refers to medicine. Presented is a method for detecting p.Q368X (c.1102C>T) MYOC gene mutation accompanied by a congenital form of primary open-angle glaucoma (POAG). The DNA is recovered from peripheral blood lymphocytes by phenol-chloroform extraction, and a real-time polymerase chain reaction is performed and followed by determining an end-point maximum melting curve. The MYOC gene region is amplified in the presence of two oligonucleotide sequences with EvaGreen dye.

EFFECT: invention provides the effective diagnosis of POAG in patients of hereditary tainted families.

1 dwg, 2 tbl, 2 ex

Description

The invention relates to medicine, namely to medical genetics and ophthalmology, can be used to diagnose congenital forms of hereditary glaucoma.

Primary open-angle glaucoma (POAG) refers to a group of diseases with a hereditary predisposition that arise and develops under the influence of heredity and the environment [Quigley and Broman, 2006]. The contribution of genetic factors to the development of POAG, according to various authors, ranges from 20 to 60% [Liu et al., 2011]. Currently, most researchers believe that the main diagnostic sign of this diverse group of diseases is specific glaucomatous optic neuropathy [Hewitt et al., 2006 b; Liu et al., 2011; Liu and Allingham, 2013]. Primary open-angle glaucoma, along with diabetic retinopathy and macular degeneration, constitute the three main pathologies in the structure of human blindness in terms of socio-economic damage, the impact on the level of health and quality of life of patients. The chronic asymptomatic course of primary open-angle glaucoma, often manifested in middle age and steadily progressing throughout life, in particular juvenile forms of POAG, which often cause disability at a young age, determines the need to study risk factors and development mechanisms of this disease in order to develop effective methods diagnosis and prevention, taking into account the individual characteristics of each patient. Primary open-angle glaucoma (POAG) is the most common clinical form of the disease and makes up 70 to 90% of all cases of this disease in Europe, America and Russia [Libby, 2005; Allingham, 2009; Liu and Allingham, 2013]. According to the World Health Organization (WHO), glaucoma is in second place among all diseases leading to blindness [http://www.who.int/topics/blindness]. Recent advances in genomic and postgenomic technologies have allowed the identification of POAG forms with a monogenic inheritance type among multifactorial forms of the disease [Allingham et al., 2009; 2011; 2013]. A number of population-based studies have demonstrated that the presence of a family history of glaucoma-burdened history is an important risk factor for glaucoma [Nemesure et al., 2007; Ramdas et al., 2011]. The pronounced genetic heterogeneity, differences in the mechanisms of occurrence and the variety of clinical manifestations of various forms of glaucoma often complicate the search and identification of mutations, which is necessary to determine the risk of occurrence and the rate of disease progression in probands and their relatives, as well as preventive measures in high-risk families for POAG. In this regard, the study of etiopathogenesis and genetic aspects of various forms of primary open-angle glaucoma is one of the most pressing problems of ophthalmogenetics and molecular medicine. At the same time, timely and accurate diagnosis of a hereditary defect in POAG will allow the most qualitative and earliest possible appointment of therapeutic and rehabilitation measures to ensure full social adaptation of people with primary open-angle glaucoma.

The advantages of the proposed development over existing analogues are the optimality of the developed approaches for the DNA diagnosis of diseases based on the identification of the existing originality of the gene pool of the peoples of the Volga-Ural region.

According to published data, most cases of genetically determined primary open-angle glaucoma are inherited mainly by the autosomal dominant type [Bhattacharya et al., 2013]. However, the pronounced genetic heterogeneity of the disease, as well as the different penetrance of mutations causing POAG, often does not allow us to accurately determine the mechanism of inheritance of the disease [Libby, 2005; Allingham, 2009; Liu and Allingham, 2013]. Among all the identified genes involved in the functioning of the outflow of aqueous humor from the anterior chamber of the eye, the most significant is the myocillin gene (MYOC), whose contribution to the development of POAG, according to various authors, reaches 2-10% in various ethnic groups [Fuse et al. , 2010; Alingham et al., 2011].

However, in a fairly large number of families who turn to an ophthalmologist for an explanation of the risk of POAG in the offspring, as a rule, they are not able to identify a genetic defect and correctly conduct a genealogical examination due to the rather high genetic heterogeneity of this disease and the lack of data on phenotypic manifestations of one or another mutation in genes whose damage causes POAG. According to various authors, the percentage of families with undiagnosed genetic defects leading to hereditary forms of POAG, depending on the ethnic group, is, on average, about 80% (Ramdas et al., 2011; Child et al., 2013).

The most common mutation of the myocillin gene, p.Q368X (p. 1102C> T), is characteristic of 1.6% of patients with POAG of the Caucasian race [Faucher M., et al., 2002]. It accounts for about 30% of all mutations found in the MYOC gene [Resch et al., 2009; Fingert et al., 2011]. With regard to the prevalence of mutations p.Q368X (c.1102C> T) of the MYOC gene, racial and / or ethnic specificity is shown, caused, in some cases, by the founder's effect, and also, possibly, by the geographical and social isolation of some populations [Brezin A.P. et al., 1998; Campos-Mollo et al., 2007; Fautsch et al., 2010; Fingert et al., 2011 Cheng et al., 2012]. p.Q368X has been identified in patients with POAG from the USA [Gong et al., 2004], Canada [Faucher et al., 2002], Australia [Baird et al. (2003)], Europe [Melki et al., 2003; Hogewind et al., 2007], South America [Liu et al., 2012; Mendoza-Reinoso et al., 2012] and Russia [Rakhmanov B.B., 2005].

Mutations occurring in the myocilin gene are not equivalent in their phenotypic manifestation. So, the p.Q368X mutation is characterized by a later manifestation of the disease and a more benign course compared with p.Y437H, p.I477N and, especially, p.P370L, which lead to the development of juvenile forms of POAG with an aggressive course [Campos-Mollo et al ., 2007; Cai et al., 2012].

A known method for the detection of p.Q368X mutation (p. 1102C> T) in the myocilin gene {MYOC) by RFLP analysis (Baird PN, Dickinson J., Craig JE, Mackey DA The Taal restriction enzyme provides a simple means to identify the Q368 STOP mutation of the myocilin gene in primary open angle glaucoma. Am J Ophthalmol. - 2001 - V. 131 (4). - P. 510-511). However, restriction analysis is a relatively expensive and time-consuming method, which requires electrophoretic separation of the restriction in acrylamide or agarose gels, subsequent sequencing, and moreover, it takes more than 3 days to perform RFLP analysis.

Also known is a method for detecting and mutating p.Q368X (p. 1102C> T) in the myocilin gene (MYOC) by analyzing single-stranded DNA conformational polymorphisms (SSCP analysis) (Craig JE, Baird PN, Healey DL, McNaught AI, McCartney PJ, Rait JL, Dickinson JL, Roe L., Fingert JH, Stone EM, Mackey DA Evidence for genetic heterogeneity within eight glaucoma families, with the GLC1A Gln368 STOP mutation being an important phenotypic modifier. Ophthalmology. - 2001 .-- V. 108 (9). - P. 1607-1620). The biggest disadvantage of this method is the rather low sensitivity - from 50 to 97% even when using capillary electrophoresis. Moreover, false-negative results do not guarantee the absence of mutations in the sample.

Deep sequencing - an analysis that is widely used to detect any changes in the nucleotide sequence, was developed by Frederick Senger in 1977 and is now widely used after the completion of the Human Genome project to rescan the nucleotide sequence of human DNA (Sanger F. Determination of nucleotide sequences in DNA // Biosci Rep. - 2004. - V. 24 (4-5). - P. 237-253). Significant disadvantages of this method are its complexity and the need for expensive equipment and reagents, as well as a certain amount of time (about 3 days).

A prototype of the invention is the work of Souzeau et al. (Souzeau E., Burdon K.P., Dubowsky A., Grist S., Usher B., Fitzgerald J.T., Crawford A., Hewitt AW, Goldberg I., Mills RA, Ruddle JB, Landers J., Mackey DA, Craig JE Higher prevalence of myocilin mutations in advanced glaucoma in comparison with less advanced disease in an Australasian disease registry.Ophthalmology. - 2013 .-- V. 120 (6) - P. 1135-1143 .). The main disadvantages of the closest analogue are its complexity and the need to use expensive equipment and reagents.

The technical result of the invention is to simplify the method and improve the accuracy of determining the mutation p.Q368X (s.1102C> T) in the myocilin gene (MYOC) and reduce the study time (up to 2 days) by developing specific oligonucleotide primers for real-time PCR with analysis melting curve at the end point of amplification in patients with POAG and in heterozygous carriers of this mutation. The advantage of PCR with fluorescence detection is the absence of the need for the stages of RFLP analysis and electrophoresis, which reduces the risk of contamination and dramatically reduces the time and complexity of the analysis. Interpretation of the results is carried out using the software of the amplifier with the possibility of real-time PCR (Allelic Discrimination) in automatic mode.

The specified technical result is achieved by the fact that in a method involving the extraction of DNA from peripheral blood lymphocytes by phenol-chloroform extraction and real-time polymerase chain reaction with fluorescence detection, DNA fragments containing the mutation p.Q368X are amplified (p.1102C> T ) in the myocilin gene (MYOC) in the presence of the intercalating dye EvaGreen® and oligonucleotides:

Q368X - F, GTCCAGAACTGTCATAAGATA,

Q368X - R, CCAAGAATACGGGAACTG,

(fragment length 100 bp) flanking a region with a possible content of mutation p.Q368X (c. 1102C> T).

The method is as follows.

DNA is isolated from peripheral blood lymphocytes. As a preservative, a solution of the following composition is used: 0.48% citric acid, 1.32% sodium citrate, 1.47% glucose. During blood sampling, 4 ml of venous blood is added to 1 ml of preservative and mixed well.

To obtain DNA of the required degree of purity and sufficient molecular weight, the method of DNA extraction from blood by phenol-chloroform extraction described by Matthew is used (Mathew C. C. The isolation of high molecular weight eucariotic DNA. // Methods in Molecular Biology / Ed. Walker JMYL: Human Press. 1984. - V. 2. - P. 31-34).

1. Blood in a test tube with a preservative is thoroughly mixed and poured into a 50 ml centrifuge glass, add 30 ml of chilled lysis buffer containing 320 mM sucrose, 1% Triton X-100 solution, 5 mM MgCl ₂ , 10 mM Tris HCl ( pH 7.6).

2. The mixture is centrifuged for 20 minutes at 4000 rpm.

3. The supernatant is drained, 0.4 ml of 10% SDS and proteinase K (concentration of 10 mg / ml) are added to the resulting precipitate. The lysis mixture is left for 16 hours in an incubator at a temperature of 37 ° C.

DNA extraction is carried out in the following order:

4. To the lysate add 0.5 ml of phenol saturated with 1M Tris HCl to a pH of 7.8.

5. The mixture is shaken on a shaker and centrifuged for 10 minutes at 6000 rpm.

6. Select the aqueous phase containing DNA and undenatured proteins.

7. The selected phase is treated with a mixture of phenol-chloroform (1: 1), and then chloroform.

8. The preparations are precipitated with two volumes of chilled ethanol 96%.

9. The resulting DNA precipitate is dissolved in 1.5 ml of deionized H ₂ O; the solution is stored at -20 ° C.

Subsequently, the obtained DNA is used as a matrix for real-time polymerase chain reaction (PCR) to amplify the desired fragment of the coding region of the MYOC gene. Preparation of samples for PCR is carried out in a laminar box using a special set of pipettes and tips with aerosol filters.

- DNA samples before PCR are completely thawed at room temperature. After thawing, the contents of the tubes are thoroughly mixed and centrifuged at 5000 rpm.

- The concentration of DNA samples on a spectrophotometer is measured.

- DNA samples are diluted with deionized water to the optimal concentration required for real-time PCR (30 ng / μl).

The main components of the reaction:

1. A mixture for PCR (670 mm Tris-HCl (pH 8.8); 0.1% Tween-20, 2 mm dNTPs, 10 mm specific primers).

2. Taq polymerase

3. EvaGreen® dye (20x aqueous solution)

- For PCR analysis of one sample, the following reaction components are added to the amplification tube (table 1):

- For PCR analysis of several samples, prepare the reaction mixture for the required number of samples. To do this, mix the following PCR components in a separate sterile tube: deionized water, EvaGreen® dye, PCR mixture and Taq polymerase.

- All components are mixed in a microcentrifuge-vortex, then the reaction mixture is poured into amplification tubes or dies of 2 μl per well or in a test tube.

- Contribute DNA (1.0 μl) to the wells of the plate or to the tubes, taking into account the negative controls.

- Carefully close the plate or tubes and put in real-time PCR amplifier

The specific sequences of oligonucleotide primers for the detection of the p.Q368X mutation (s.1102C> T) in the MYOC gene and their optimal concentrations in the reaction mixture, the amplified fragment size, and PCR temperature are shown in Table 2.

Detection of the results is carried out on amplifiers with the possibility of analysis of fluorescence at the end point - "Rotor-Gene" 3000/6000 ("Corbet Research)), Australia); "IQCycler," iQ5 "," CFX96 "(" BioRad ", USA), ABI 7300/7500/7900 (" Applied Biosystems)), USA). The study time is 2 days. After PCR, analysis of the fluorescence curves for individual wells in the “Calculation” window of the “Data Analysis” section and analysis of the melting curves of DNA samples in the “Normalization of Melting Curves” window should be performed according to the protocol of the instrument used. The presence of a mutation p.Q368X (s.1102C> T) in the studied locus should be judged by a certain form of melting curves compared to the norm (figure 1).

As specific examples, a total of 1045 patients (496 patients with POAG and 589 individuals from the control group) with POAG registered in the Ufa State Research Institute of Eye Diseases in Ufa, their families, and healthy donors living in the Volga-Ural region.

The criterion for inclusion in the study was the diagnosis of “Primary open-angle glaucoma” (H40.1 according to ICD-10), established on the basis of clinical, laboratory, instrumental and molecular genetic methods of research in accordance with modern diagnostic criteria proposed by the Federal State Budgetary Institution Moscow Research Institute Helmholtz Eye Disease Ministry of Health and Social Development of Russia. The diagnosis of glaucoma was established on the basis of anamnesis data, according to the results of a complete clinical examination, including: a study of central visual acuity, a study of peripheral visual field and static perimetry on SYNIMED equipment (USA), non-contact tonometry in dynamics (daily) on a REICHERT (USA) pneumometer, colorimetric analysis of the optic nerve disc on a CARL ZEISS retinophot, biomicroscopy of the anterior segment of the eye and fundus. The study clarified data on the ethnicity of patients by interviewing and ascertaining the nationality of parents up to the third generation. Particular attention was paid to establishing the birthplace of probands, their parents and first parents; identification of consanguineous marriages in the families of the examined patients. Thus, the study included 496 patients with POAG and 589 healthy individuals from three ethnic groups (Russians (223 people), Tatars (124 people) and other nationalities (242 people)) from the Volga-Ural region.

Molecular genetic analysis of the frequency of the mutation p.Q368X (s.1102C> T) in the MYOC gene was carried out in patients suffering from primary open-angle glaucoma, presumably of hereditary etiology.

At the first stage of the studies, the mutation p.Q368X (С.1102C> Т) was screened in the MYOC gene in 496 unrelated patients from the Republic of Bashkortostan. In 8 unrelated patients, this mutation was detected in a heterozygous state, which accounts for 1.6% of all examined families with POAG. By ethnicity, patients with the p.Q368X mutation (p. 1102C> T) were distributed as follows: 6 - Russians, 1 Tatar and 1 Mestizo (Russian / Tatar). All patients had a history of POAG. Thus, taking into account the relative prevalence of the p.Q368X mutation (s.1102C> T) in the MYOC gene in patients from European populations, it is easy to explain the segregation of mutant alleles in the MYOC gene and among POAG patients from the Republic of Bashkortostan. Based on this analysis, patients with the p.Q368X mutation (s.1102C> T) in the MYOC gene were diagnosed with an autosomal dominant form of primary open-angle glaucoma. Therefore, the total contribution of the p.Q368X mutation identified in patients with POAG (p. 1102C> T) in the MYOC gene was 0.8%. Next, healthy donors from population samples of Russians, Tatars, Bashkirs and Métis, the most numerous ethnic groups living in the Volga-Ural region, were analyzed. The mutation p.Q368X (s.1102C> T) in the MYOC gene was identified in a heterozygous state in 1 Russian patient (0.17%). Carriers of the p.Q368X mutation in the MYOC gene have a risk of developing a disease ranging from 60 to 100% throughout life.

The relative predominance of the p.Q368X mutation in the MYOC gene in patients with primary open-angle glaucoma makes it expedient to test it first during genetic analysis. Also, if a patient has a p.Q368X mutation in the MYOC gene from treatment regimens, it is necessary to exclude the use of glucocorticoid drugs, such as dexamethasone, prednisolone, etc. In the literature, there is evidence that carriers of p.Q368X (c. 1102C> T) in the MYOC gene under the action of dexamethasone, the cells of the iris trabecular network become more sensitive to various factors and effects (mechanical stretching, oxidative stress, changes in hormonal regulation) and undergo apoptosis, which may be associated either with the induction of expression of myocilin and in cells, or with the association of defective myocilin in them with mitochondria, which play a key role in programmed cell death [Rozsa et al., 2006; Yuan He et al., 2009; Colak et al., 2012].

Thus, given the existence of an expression of interpopulation differences in the mutation frequency p.Q368X (s.1102C> T) in the MYOC gene, the analysis of genetic heterogeneity in primary open-angle glaucoma in certain regions and ethnic groups is an urgent problem of medical genetics, a necessary condition for the development of optimal of this region of DNA diagnostic approaches for hereditary forms of POAG.

Example 1. Patient L.N., born in 1956, the city of Ufa, the Republic of Bashkortostan. The diagnosis of primary open-angle glaucoma was established in 2012. The patient is currently being operated on. On the part of parents and immediate relatives - heredity is burdened. Primary open-angle glaucoma was detected in the patient’s mother. During molecular genetic testing, 8 ml of venous blood was taken from the patient with subsequent DNA isolation and real-time PCR was performed with fluorescence detection of the p.Q368X mutation (s.1102C> T) in the MYOC gene in a reaction mixture containing 1.0 μg genomic DNA corresponding to the amount of buffer containing the PCR mixture (670 mM Tris-HCl (pH 8.8); 0.1% Tween-20, 2 mM dNTPs, 10 mM specific primers, EvaGreen® dye - 0.3 μl and Taq polymerase, DNA was then amplified in a CFX96 amplifier (BioRad, USA) with the possibility of performing a fluorescence analysis at the final according to the program: initial denaturation: 94 ° C - 2:00, 40 amplification cycles: denaturation 95 ° C - 0:10, annealing 56/60 ° C - 1:00. Investigation of the patient's DNA revealed heterozygous carriage p.Q368X (with .1102C> T) in the MYOC gene.The study time was 2 days.

Example 2. Patient AK, born in 1958, the city of Ufa, the Republic of Bashkortostan. The diagnosis of primary open-angle glaucoma was established in 2012. On the part of the patient’s mother, heredity is burdened by primary open-angle glaucoma. 8 ml of venous blood was taken from the patient, followed by DNA extraction and setting up a real-time PCR reaction with fluorescence detection of the p.Q368X mutation (p.1102C> T) in the MYOC gene. DNA amplification was performed in a CFX96 thermocycler (BioRad, USA) with the possibility of performing end-point fluorescence analysis according to the program: initial denaturation: 94 ° C - 2:00, 40 amplification cycles: denaturation 95 ° C - 0:10, annealing 56/60 ° C - 1:00. A study of the patient’s DNA revealed heterozygous carriage of the p.Q368X mutation (p. 1102C> T) in the MYOC gene. The diagnosis of the hereditary form of primary open-angle glaucoma has been confirmed.

In conclusion, it should be noted that in connection with the intensive accumulation of knowledge about the main etiological, pathogenetic mechanisms at the molecular genetic level, the possibilities for additional research methods are expanding significantly, among which DNA diagnostic methods are becoming especially relevant. Since they make it possible to find out the root cause of the disease, the discovery of pathogenetic mechanisms that subsequently greatly facilitate the treatment of the disease. The results obtained in this study allow us to assess the likelihood of developing primary open-angle glaucoma in patients from families with burdened heredity. The establishment of hereditary forms of primary open-angle glaucoma using molecular genetic methods allows the patient to properly organize the treatment and rehabilitation process, optimize the drug therapy of the disease, and significantly reduce the economic costs of repeated expensive diagnostic procedures.

Table 1 The components of the reaction mixture Deionized water 6.4 μl Mix for PCR 2.0 μl Taq polymerase 0.2 μl EvaGreen® Dye 0.4 μl Test sample (30 ng DNA / μl) 1.0 μl Total volume 10 μl

Claims (1)

A method for detecting the p.Q368X mutation (s.1102C> T) in the MYOC gene, accompanied by the development of a hereditary form of primary open-angle glaucoma, including the extraction of DNA from peripheral blood lymphocytes by phenol-chloroform extraction, polymerase chain reaction with the possibility of fluorescence analysis at the end point characterized in that the MYOC gene region is amplified in the presence of two sequences of oligonucleotides with EvaGreen® dye:
Q368X - F, GTCCAGAACTGTCATAAGATA,
Q368X - R, CCAAGAATACGGGAACTG,
flanking region with a possible content of mutation p.Q368X (c. 1102C> T) in the MYOC gene.

Images