RU2555542C1 - Synthetic oligonucleotide kit for detecting number of beta-glucuronidase gene replicas in transgenic plants - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly a synthetic oligonucleotide kit for detecting the number of beta-glucuronidase replicas in transgenic plants, which includes carrying out a polymerase chain reaction using primers and a decomposable sample.

EFFECT: invention provides efficient detection of the number of beta-glucuronidase replicas in transgenic plants.

1 dwg, 1 tbl, 1 ex

Description

The invention relates to the field of molecular biology and genetic engineering of plants. It can be used to detect the copy number of the recombinant beta-glucuronidase gene in transgenic plants.

Reporter genes, including the beta-glucuronidase gene [Jefferson R.A., Kavanagh T. A., and Bevan M.W., are often used for research in plant genetic engineering, optimization of transformation methods, and genetic constructs. (1987) GUS fusions: beta-glucuronidase a sasensitive and versatile gene fusion marker, in higher plants // EMBOJ. 6 (13): 3901-3907]. The beta-glucuronidase gene is a convenient model object for construction and transfection due to the simplicity of visualization of transgenic sites during the biochemical color reaction of cleavage of the substrate product, 5-bromo-4-chloro-3-indolyl-β-D-glucuronide, with the expressed product. As a result of genetic modification, it is possible to achieve the maximum number of copies of recombinant DNA and increase the expression of the reporter gene, which can subsequently be replaced with the target gene without optimizing the transfection method and construction again.

It is known that Southern blot analysis is most often used to determine the copy number of a recombinant construct in transgenic plants [Southern E.M. (1975) Detection of specific sequences among DNA fragments separated by gelelectrophoresis // J Mol Biol. 98 (3): 509-517]. To determine the number of copies of the transgene, the total DNA of the test sample fragmented with restrictase enzymes with a high frequency of restriction site occurrences is used. Fragmented DNA is separated in an electrophoresis gel and transferred to a nitrocellulose membrane, followed by hybridization by a radioactive (fluorescent) labeled probe with a known DNA sequence. After hybridization, excess sample is washed from the membrane and the hybridization products are visualized by autoradiography. The disadvantages of the method are the complexity, duration, and there is also the possibility of error if several copies of the recombinant construct are located between restriction sites, which can be interpreted as one copy during imaging of the membrane.

Reverse dot blot hybridization using tandem head-to-tail monomers containing probes synthesized by staggered complementary primers is known to use reverse dot blot hybridization to detect copies of recombinant DNA [Patent US WO 1993009245 A1, 05.13.1993. A method for detecting the presence or absence of a nucleic acid sequence based on binding to a polymer substrate of selected oligonucleotide probes with complementary regions in the nucleic acid sequence to be detected. The main disadvantage of this method is the inability to determine the number of copies of the integrated DNA, because the method allows only to determine the presence or absence of a gene.

Of the known solutions, the closest is the use of real-time polymerase chain reaction for the detection of copies of the beta-glucuronidase gene [Chen G.Q. and Lin J. (2010) Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri // American Journal of Agricultural and Biological Sciences 5 (3): 415-421]. To carry out the polymerase chain reaction, primers are used - short DNA seeds, between which a certain sequence is synthesized, where DNA sequences with the following nucleotide composition are used as primers:

5′ACAACGTCGTGACTGGGAAAA3 ′

5′TGTGCTGCAAGGCGATTAAG3 ′

SYBR® Green is used as a fluorescent dye, as the copies of amplicons increase, the level of fluorescence increases, for comparison, a positive control is used. Subsequently, as a result of mathematical calculation, data on the number of copies of the gene in the extracted DNA are displayed.

The main disadvantages of this method are:

1. The calculation of the number of copies of the construct in the "test tube", which does not allow to estimate the number of copies per genome;

2. The use of non-specific dyes, such as SYBR® Green (Life technolodies, USA), places high demands on the specificity of the reaction - any double-stranded DNA, including primer dimers, will generate fluorescence, which increases the risk of error, and reaction inhibition is also possible , respectively, the efficiency of detection of copies of the beta-glucuronidase gene of the closest analogue D1 strongly depends on the PCR conditions and the quality of the PCR mixture. In addition, the owner of the SYBR Green trademark and TaqMan DNA probe (Life technologies Inc.) in the specification for the dye does not indicate the possibility of its use for diagnosing the number of copies of genes [http://www.lifetechnologies.com/ru/ru/home/ life-science / pcr / real-time-pcr / qpcr-education / taqman-assays-vs-sybr-green-dye-for-qpcr.html], table.

The objective of the invention is the selection of universal oligonucleotides applicable for accurate measurement of the number of copies of the beta-glucuronidase reporter gene in the studied transgenic plants.

The problem is solved by determining the sequence of primers, namely, to detect the number of copies of the beta-glucuronidase gene in transgenic plants, a pair of oligonucleotides is proposed together with a fluorescently labeled hybridization probe of the following nucleotide composition:

primerGUS-f GATCGCGAAAACTGTGGAAT

primerGUS-r TAATGACTGACCGCATCGAA

probe GUS Q 5 ′ TATAGACTGACCGCATCGAA F 3 ′, where F is a fluorophore, Q is a quencher.

The inventive set of synthetic oligonucleotides for detecting copies of the beta-glucuronidase gene is tested on various types of transgenic vascular plants.

Progress using a set of synthetic oligonucleotides for detecting the beta-glucuronidase gene of transgenic plants consists of the following steps.

1) Plant material before PCR using the inventive kit is carried out through a sample preparation procedure, for example using the Diamont DNA kit (ABT LLC, Russia) in accordance with the manufacturer's instructions; during this procedure, DNA is extracted from the plant material, which, in turn, is used for PCR.

2) An agrobacterial vector containing the beta-glucuronidase gene is used as a standard. The concentrations of the test sample and standard are adjusted to the same value. The size of the standard (PG) is calculated from the number of base pairs and their molecular weights. The genome size of the sample is examined by flow cytometry (pg). Carry out ten-fold dilutions (1x, 10x, 100x, 1000x, 10000x). In the software of the device - the CFX96 amplifier (Bio-Rad, USA) - the wells of the standard with conditional dilutions of 10 ⁴ , 10 ³ , 10 ² , 10, 1 are virtually designated.

3) The polymerase chain reaction is carried out on a CFX96 thermocycler. Amplification is carried out according to the following program:

1 cycle: 95 ° С - 180 sec, 39 cycles: 95 ° С - 10 sec, 60 ° С - 30 sec, 72 ° С - 30 sec; final stage: 72 ° С - 10 min, cooling at 4 ° С.

The incubation mixture with a final volume of 25 μl contains: 16.5 μl of H2O; 2 μl of DNA; 2.5 μl of 10X buffer; 1 μl of 10 μM of each primer; probe 10 μM 0.5 μl; 1 μl 60 mM dNTPs; 1 unit Taq polymerase.

4) Amplification products are detected by the analytical part of the device. The reliability of the OEF polymerase chain reaction is confirmed by the data of the PCR-RV calibration curve (E, R ^ 2, Slope) (Fig. 1)

5) The calculation of the number of copies of the gene is carried out from the ratio of the sequence number of the threshold cycle of amplification of the sample and standard.

Example 1

Calculation of the number of copies of beta-glucuronidase for transgenic acid sorrel (Rumex acetosa L.) transformed with pBIK102iGs vector.

Pre-conduct PCR standard and PCR sample (each in a separate tube):

Conditions:

Dilution 1/10 ⁴

According to the calibration schedule of the PCR standard, the following concentrations were obtained:

The concentration of the standard in the PCR mixture = 0.02 * 10 ⁶ PG

The concentration of the sample in the PCR mixture = 0.02 * 10 ⁶ PG

Genome size standard = 1,664 * 10 ^- 5 pg

Sample genome size (C-value) = 3.3 pg

OEFexp (relative dilution) = 0.563

The number of copies of the gene in test tubes:

for standard = 0.02 * 10 ⁶ pg / 1.664 * 10 ^-5 pg = 0.012 * 10 ¹¹ copies

sample = ^{0.563 * 0.012 * 10 11/10000} = 0.0067 * 10 7 copies

Number of sorrel genomes in vitro = 0.02 * 10 ⁷ pg / 3.3 pg = 0.006 genomes

The number of copies of the gene for the sorrel genome = 0.0067 * 10 ⁷ / 0.006 * 10 ⁶ = 1.1

The data on the number of copies calculated by the proposed method and the Southern blot method during analysis differ only by tenths and are equal when rounding (Table 1). The kit for the synthesis, detection and subsequent calculation of the number of copies of beta-glucuronidase in transgenic plants is more effective.

Based on the consideration of the required effort and time for Southern blotting, the claimed invention is more effective. Provided that different approaches to generating a fluorescent signal are used, the use of a fluorescent DNA probe is more effective due to the higher specificity and stability of the reaction. In addition, the use of an additional destructible sample increases the sensitivity of the reaction and allows the use of trace amounts of DNA for analysis, while a concentration of 5-10 mg / ml is necessary for various types of blotting. Using the method of flow cytometry allows immediately before the experiment to establish the relative DNA content in the plant, thereby it is possible to carry out calculations individually for each sample.

Claims (1)

A set of synthetic oligonucleotides for detecting the number of copies of beta-glucuronidase in transgenic plants, including the polymerase chain reaction using primers and destructible samples, characterized in that they use a set of synthetic oligonucleotides for detecting copies of the beta-glucuronidase gene with primers and the following hybridization probe:
primerGUS-f GATCGCGAAAACTGTGGAAT
primerGUS-r TAATGACTGACCGCATCGAA
probe 5 'Q TATAGACTGACCGCATCGAA 3' F, where
F - fluorophore, Q - quencher.

Images