KR101288419B1 - Primer composition and kit for isothermal amplification reaction for detecting Pectobacterium carotovorum subsp. comprising specific primer set, and method for detecting Pectobacterium carotovorum subsp. using the primer set - Google Patents

Primer composition and kit for isothermal amplification reaction for detecting Pectobacterium carotovorum subsp. comprising specific primer set, and method for detecting Pectobacterium carotovorum subsp. using the primer set Download PDF

Info

Publication number
KR101288419B1
KR101288419B1 KR1020110104129A KR20110104129A KR101288419B1 KR 101288419 B1 KR101288419 B1 KR 101288419B1 KR 1020110104129 A KR1020110104129 A KR 1020110104129A KR 20110104129 A KR20110104129 A KR 20110104129A KR 101288419 B1 KR101288419 B1 KR 101288419B1
Authority
KR
South Korea
Prior art keywords
primer
detecting
primer set
lamp
pcc
Prior art date
Application number
KR1020110104129A
Other languages
Korean (ko)
Other versions
KR20130039518A (en
Inventor
김정구
박동석
윤병수
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020110104129A priority Critical patent/KR101288419B1/en
Publication of KR20130039518A publication Critical patent/KR20130039518A/en
Application granted granted Critical
Publication of KR101288419B1 publication Critical patent/KR101288419B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00—Reactions demanding special reaction conditions
    • C12Q2527/101—Temperature

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 서열번호 1 내지 4의 프라이머 세트를 포함하는 배추무름병균을 검출하기 위한 등온증폭반응용 프라이머 조성물, 상기 프라이머 세트를 포함하는 배추무름병균 검출용 키트 및 상기 프라이머 세트를 이용하여 배추무름병균을 검출하는 방법에 관한 것이다.The present invention is a primer composition for isothermal amplification reaction for detecting Chinese cabbage bacterium comprising a primer set of SEQ ID NOs: 1 to 4, a kit for detecting cabbage bacterium bacterium comprising the primer set and cabbage bacterium using the primer set It relates to a method for detecting.

Description

특정 프라이머 세트를 포함하는 배추무름병균을 검출하기 위한 등온증폭반응용 프라이머 조성물 및 상기 프라이머 세트를 이용하여 배추무름병균을 검출하는 방법 {Primer composition and kit for isothermal amplification reaction for detecting Pectobacterium carotovorum subsp. comprising specific primer set, and method for detecting Pectobacterium carotovorum subsp. using the primer set}A primer composition for isothermal amplification reaction for detecting cabbage bacterium comprising a specific primer set and a method for detecting cabbage bacterium using the primer set {Primer composition and kit for isothermal amplification reaction for detecting Pectobacterium carotovorum subsp. comprising specific primer set, and method for detecting Pectobacterium carotovorum subsp. using the primer set}

본 발명은 서열번호 1 내지 4의 프라이머 세트를 포함하는 배추무름병균을 검출하기 위한 등온증폭반응용 프라이머 조성물, 상기 프라이머 세트를 포함하는 배추무름병균 검출용 키트 및 상기 프라이머 세트를 이용하여 배추무름병균을 검출하는 방법에 관한 것이다.The present invention is a primer composition for isothermal amplification reaction for detecting Chinese cabbage bacterium comprising a primer set of SEQ ID NOs: 1 to 4, a kit for detecting cabbage bacterium bacterium comprising the primer set and cabbage bacterium using the primer set It relates to a method for detecting.

Pectobacterium carotovorum subsp. carotovorum (舊名 Erwinia carotovora subsp. carotovora)은 그람 음성 세균으로 식물 세포벽의 펙틴질을 분해하는 효소를 대량 분비하여 광범위한 식물체에 무름병을 일으킨다. 재배면적 기준으로 우리나라 제 2 작물인 배추의 경우 무름병에 의한 피해 규모가 매년 130여 ha에 이를 정도로 그 피해가 심각하며, 무름병이 가장 번성하는 시기인 여름에는 거의 배추 재배를 할 수 없는 실정이다. 특히 전국 배추 생산량의 72%를 점유하고 있어 우리나라 여름과 초가을 배추 생산에 중요한 부분을 담당하고 있는 강원도 고랭지 여름 배추의 피해는 매우 심각하다. 또한 이 세균에 의한 무름병의 피해는 재배 과정에서뿐만 아니라 저장 중이나 유통과정에서도 나타나며, 재배 과정에서의 피해가 5% 수준일지라도, 장마철과 같이 환경 조절이 어려워 고온 다습하게 저장될 경우 그 피해는 100%에 달하는 경우도 있어 그 심각성이 더해진다.Pectobacterium carotovorum subsp. Carotovorum (Erwinia carotovora subsp. carotovora) is a Gram-negative bacterium that secretes large amounts of enzymes that break down the pectin of plant cell walls, resulting in a wide range of plants. In terms of cultivation area, Chinese cabbage, which is the second largest crop in Korea, is about 130 ha annually, and the damage is severe. In summer, when the most proliferative disease occurs, it is almost impossible to grow cabbage. In particular, the damage of summer cabbages in Gangwon-do, which is an important part of Chinese cabbage production in the summer and early autumn, accounts for 72% of the national cabbage production. In addition, the damage caused by the bacterium by the bacteria appears not only in the cultivation process, but also during storage and distribution. Even if the damage during the cultivation process is about 5%, it is difficult to control the environment, such as during the rainy season. In some cases, the severity is added.

배추의 무름병 증상은 그 정도에 따라 세균 상의 변화를 나타낸다. 초기에는 주로 Pectobacterium carotovorum subsp. carotovorum이 발견되고 병징이 진전됨에 따라 Xanthomonas campestris pv. campestris가 발견되며 특히 후기증상에서는 어떤 병원균도 발견되지 않고 부생균이 주로 존재하는 것으로 나타나고 있다. 또한 무름병이 진전됨에 따라 병원균 밀도가 급속히 감소 되는 것이 보이며, 이는 발병 초기 단계에서 신속한 방제의 중요성을 의미하고 또한 신속한 방제를 위해서는 신속한 조기진단이 우선되어야 한다.The symptoms of bruising in Chinese cabbage show the degree of bacterial change depending on the extent. Initially, mainly Pectobacterium carotovorum subsp. As carotovorum was discovered and symptoms developed, Xanthomonas campestris pv. Campestris are found, especially in late symptoms, no pathogens are found, and by-products are predominantly present. In addition, as the disease progresses, the density of pathogens is rapidly reduced, which indicates the importance of rapid control at the early stage of the onset, and rapid early diagnosis should be prioritized for rapid control.

다양한 분자 생물학적 기법이 무름병균을 검출하기 위해 이용되고 있는데, 첫째 PCR-SSCP 방법으로 표적 유전자를 PCR 방법으로 증폭하고 증폭된 유전자의 야생형과 돌연변이형의 유전자 구조적 변화를 분석하는 것으로 검출 감도가 낮다는 단점이 있다. 둘째 혼성화 방법을 이용한 Line hybridization assay 법으로 프로브나 표적 유전자가 많이 필요하다는 단점이 있다. 셋째 PCR-Sequencing 방법으로 표적 유전자를 PCR 방법으로 증폭하고 정제하여 sequencing을 하는 방법으로 시간과 비용이 많이 든다는 단점이 있다.A variety of molecular biological techniques are used to detect inflorescence. First, PCR-SSCP method amplifies the target gene by PCR method and analyzes the structural changes of the wild type and mutant type of the amplified gene, which is low in sensitivity. There are disadvantages. Secondly, there is a disadvantage in that a lot of probes or target genes are required as a line hybridization assay using hybridization method. Third, the method of amplifying and purifying target genes by PCR method and sequencing by PCR-sequencing method has a disadvantage of costly time and cost.

종래 기술로 P. carotovorum sub sp. carotovorum의 검출을 위한 PCR 진단법(The Korean Journal of Microbiology, Vol. 45, No. 4, December 2009, p. 306-311)이 공지되어 있다.In the prior art, P. carotovorum sub sp. PCR diagnostics for the detection of carotovorum (The Korean Journal of Microbiology, Vol. 45, No. 4, December 2009, p. 306-311) are known.

국내공개번호 2009-0111933호Domestic Publication No. 2009-0111933

본 발명은 상기에서 언급한 종래의 분자생물학적 방법들의 단점들을 보완하기 위해서 등온증폭반응이라는 방법을 사용하여 표적 유전자 부위를 등온증폭반응용 프라이머를 사용하여 등온에서 증폭하여 무름병균을 신속하고 정확하게 검출하는 방법을 제공하고자 하는 것이다.The present invention amplifies the target gene region at an isothermal temperature using a primer for isothermal amplification reaction using a method called isothermal amplification reaction to compensate for the shortcomings of the conventional molecular biological methods mentioned above to quickly and accurately detect To provide a way.

본 발명은 등온증폭반응(LAMP)을 통해 무름병균을 검출하기 위한 lytic murein transglycolase 유전자의 서열번호 1 내지 4의 프라이머 세트를 포함하는 프라이머 조성물에 관한 것이다.The present invention relates to a primer composition comprising a primer set of SEQ ID NOS: 1 to 4 of a lytic murein transglycolase gene for detecting atypical bacteria through isothermal amplification (LAMP).

또한, 본 발명은 상기 프라이머 세트를 포함하는 무름병균 검출 키트에 관한 것이다.The present invention also relates to an inflorescence bacterium detection kit comprising the primer set.

또한, 본 발명은 등온증폭반응(LAMP)을 사용하여 일정한 온도에서 유전자를 증폭하여 무름병균을 신속하고 정확하게 검출하는 방법에 관한 것이다. In addition, the present invention relates to a method for rapidly and accurately detecting atypical bacteria by amplifying a gene at a constant temperature using an isothermal amplification reaction (LAMP).

본 발명은 기존의 PCR 반응을 수행하여 배추무름병균을 검출하는 방법보다 신속하고 감도가 좋은 등온증폭반응법을 이용하여 짧은 시간 안에 일정한 온도에서 배추무름병균을 검출할 수 있다.The present invention can detect the cabbage bacteria at a constant temperature in a short time using an isothermal amplification reaction method that is faster and more sensitive than the method of detecting cabbage bacteria by performing a conventional PCR reaction.

등온증폭반응을 이용하게 되면 기존의 유전자 증폭반응을 위한 장비가 필요하지 않으며 일정한 온도를 맞출 수 있는 실험실의 어떠한 장비를 사용해도 유전자를 증폭할 수 있는 장점이 있으며 또한 현장 적용성이 뛰어나 생물학 테러나 이동형 유전자 검출 장비 개발에 크게 도움이 될 것이다.The use of isothermal amplification reactions eliminates the need for conventional gene amplification reactions, and has the advantage of amplifying genes using any equipment in the laboratory that can maintain a constant temperature. It will greatly help development of portable gene detection equipment.

도 1은 PCC-LAMP을 위한 4개 프라이머의 시퀀스 및 위치를 나타낸다.
도 2는 PCC-LAMP의 최적의 반응 온도를 나타낸다.
도 3은 4개의 PCC-LAMP 프라이머의 필요조건을 나타낸다.
도 4는 PCC-LAMP의 검출 한계를 나타낸다.
도 5는 PCC 특이 증폭을 위한 LAMP 프라이머의 특이성을 나타낸다.
도 6은 SYBR Green I에 의한 LAMP 생성물의 관찰을 나타낸다.
도 7은 field samples로의 PCC-LAMP의 응용에 관한 것이다. 1 shows the sequence and position of four primers for PCC-LAMP.
2 shows the optimal reaction temperature of PCC-LAMP.
3 shows the requirements of four PCC-LAMP primers.
4 shows the detection limit of PCC-LAMP.
5 shows the specificity of LAMP primers for PCC specific amplification.
6 shows the observation of the LAMP product by SYBR Green I. FIG.
7 relates to the application of PCC-LAMP to field samples.

본 발명은 서열번호 1 내지 4의 프라이머 세트를 포함하는 무름병균을 검출하기 위한 등온증폭반응용 프라이머 조성물에 관한 것이다. 상기 서열번호 1 내지 4의 프라이머 세트는 무름병을 진단하는데 이용되는 lytic murein transglycolase 유전자 내의 서열이며, 서열번호 1의 프라이머는 정방향 프라이머이며, 서열번호 2의 프라이머는 역방향 프라이머이다. 서열번호 3은 정방향 내부 프라이머이며, 서열번호 4는 역방향 내부 프라이머이다.The present invention relates to a primer composition for isothermal amplification reaction for detecting atypical bacteria comprising the primer set of SEQ ID NO: 1 to 4. The primer sets of SEQ ID NOS: 1 to 4 are sequences in the lytic murein transglycolase gene used for diagnosing the disease, primers of SEQ ID NO: 1 are forward primers, and primers of SEQ ID NO: 2 are reverse primers. SEQ ID NO: 3 is a forward inner primer and SEQ ID NO: 4 is a reverse internal primer.

본 발명에 있어서, "프라이머"는 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 한다. 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity)뿐만 아니라 온도 및 이온 강도와 같은 프라이머 이용 조건에 의존할 것이다.In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

본 명세서에 있어서, 프라이머로서 이용된 올리고뉴클레오티드는 또한 뉴클레오티드 유사체(analogue), 예를 들면, 포스포로티오에이트 (phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)를 포함할 수 있거나 또는 삽입 물질(intercalating agent)를 포함할 수 있다.As used herein, oligonucleotides used as primers may also include nucleotide analogues, such as phosphorothioate, alkylphosphothioate or peptide nucleic acid, or It may comprise an intercalating agent.

또한, 본 발명은 서열번호 1 내지 4의 프라이머 세트; 및 증폭 반응을 수행하기 위한 시약을 포함하는, 무름병균을 검출하기 위한 키트를 제공한다.In addition, the present invention is a primer set of SEQ ID NO: 1 to 4; And a kit for detecting the atypical bacterium, comprising a reagent for performing an amplification reaction.

본 발명의 키트에서, 프라이머 세트는 전술한 바와 같으며, 상기 증폭 반응을 수행하기 위한 시약은 DNA 중합효소, dNTPs, 버퍼 등을 포함할 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 설명서를 추가로 포함할 수 있다.In the kit of the present invention, the primer set is as described above, and the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, buffers, and the like. In addition, the kit of the present invention may further include a user manual describing the conditions for performing the optimal reaction.

또한, 본 발명은 식물체 검체로부터 게놈 DNA (gDNA)를 분리하는 단계; 상기 분리된 게놈 DNA를 주형으로 하고, 서열번호 1 내지 4의 프라이머 세트를 이용하여 등온증폭반응을 수행하여 유전자의 표적 서열을 증폭하는 단계; 및 상기 증폭 산물을 검출하는 단계를 포함하는, 무름병균을 검출하는 방법을 제공한다.In addition, the present invention comprises the steps of separating genomic DNA (gDNA) from plant specimens; Amplifying a target sequence of a gene by using the isolated genomic DNA as a template and performing isothermal amplification using a primer set of SEQ ID NOs: 1 to 4; And detecting the amplification product.

본 발명은 분자유전학적 기법인 등온증폭반응을 이용하여 무름병관련 유전자 부위인 lytic murein transglycolase유전자를 증폭하여 기존의 PCR처럼 온도의 증감 없이 일정한 온도에서 증폭반응을 진행하여 무름병균을 신속하고 정확하게 검출하는 방법에 관한 것이다.The present invention amplifies the lytic murein transglycolase gene, which is a gene part related to the disease by using isothermal amplification, which is a molecular genetic technique, and rapidly and accurately detects the influenza bacteria by performing an amplification reaction at a constant temperature without increasing or decreasing the temperature as in the conventional PCR. It is about a method.

본 발명의 방법은 식물체 검체로부터 게놈 DNA를 분리하는 단계를 포함한다. 상기 게놈 DNA를 분리하는 방법은 당업계에 공지된 방법을 이용할 수 있으며, 예를 들면, wizard prep 키트(Promega 사)를 이용할 수 있다. 상기 식물체 검체는 배추, 양파, 감자 등 식물체에 무름병을 일으킬 수 것을 말하고, 본 발명에서는 배추일 수 있다.The method includes separating genomic DNA from plant specimens. The method for separating genomic DNA may use a method known in the art, for example, a wizard prep kit (Promega) may be used. The plant sample may refer to a cabbage, onions, potatoes, etc., which may cause the disease in the plant, and in the present invention may be cabbage.

상기 분리된 게놈 DNA를 주형으로 하고, 서열번호 1 내지 4의 프라이머 세트를 이용하여 등온증폭반응을 수행하여 lytic murein transglycolase 유전자의 표적 서열을 증폭할 수 있다. 상기 등온증폭반응은 50 내지 65℃범위에서 특히, 61℃에서 30분 내지 1시간 30분 이내에 수행될 수 있다.Using the isolated genomic DNA as a template, isothermal amplification using the primer sets of SEQ ID NOS: 1 to 4 can be used to amplify the target sequence of the lytic murein transglycolase gene. The isothermal amplification reaction may be performed in the range of 50 to 65 ° C., in particular, at 61 ° C. within 30 minutes to 1 hour 30 minutes.

본 발명의 방법에 있어서, 상기 증폭된 표적 서열은 검출 가능한 표지 물질로 표지될 수 있다. 일 구현예에서, 상기 표지 물질은 형광, 인광 또는 방사성을 발하는 물질일 수 있으며, 이에 제한되지 않으나, 상기 표지 물질은 Cy-5 또는 Cy-3일 수 있으며, 표적 서열의 증폭시 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 증폭을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지될 수 있다. 또한, 방사성 물질을 이용한 표지는 증폭 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 증폭 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 프라이머 세트는 상기에 기재된 바와 같다.In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling substance. In one embodiment, the labeling material may be a fluorescent, phosphorescent or radioactive material, but is not limited thereto, and the labeling material may be Cy-5 or Cy-3, and 5 ′ of the primer upon amplification of the target sequence. When amplification is performed by labeling Cy-5 or Cy-3 at the end, the target sequence may be labeled with a detectable fluorescent labeling substance. In addition, the label using the radioactive material may add radioactive isotopes such as 32 P or 35 S to the amplification reaction solution when the amplification is performed, and the amplification product may be incorporated into the amplification product while the amplification product is synthesized. The primer set used to amplify the target sequence is as described above.

본 발명의 방법은 상기 증폭 산물을 검출하는 단계를 포함한다. 상기 증폭 산물의 검출은 DNA 칩, 겔 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 겔 전기영동을 수행할 수 있다. 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 증폭을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 증폭 수행시 32P 또는 35S 등과 같은 방사성 동위원소를 증폭 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.
The method of the present invention comprises detecting said amplification product. The detection of the amplification product can be performed by DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one method of detecting the amplification product, gel electrophoresis can be performed. Gel electrophoresis can be performed using agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. In addition, in the fluorescence measurement method, amplification is performed by labeling Cy-5 or Cy-3 at the 5'-end of a primer, and a target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorimeter. can do. In addition, the radiometric method is a radioactive isotope, such as 32 P or 35 S in the amplification reaction solution when the amplification reaction is performed to label the amplification product, and then radioactive measuring apparatus, for example, Geiger counter or liquid flash The radioactivity can be measured using a liquid scintillation counter.

이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.
BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

<< 실시예Example > >

1. One. LAMPLAMP 검출법에 사용된  Used in detection methods 프라이머primer

PCC의 lytic murein transglycolase 유전자 염기서열을 근거로 프라이머를 설계, 제조하였다(도 1). 하기 표 1은 본 발명에서의 서열번호 1 내지 4의 프라이머 세트에 관한 것이다.Primers were designed and prepared based on the lytic murein transglycolase gene sequence of PCC (FIG. 1). Table 1 below relates to the primer sets of SEQ ID NOS: 1-4 in the present invention.

outerouter -F-F GCAGTGATGTGATCCGCAGGCAGTGATGTGATCCGCAG (서열번호 1) (SEQ ID NO 1) outerouter -R-R ACCGTTTAATCCTGCCTGGACCGTTTAATCCTGCCTGG (서열번호 2) (SEQ ID NO: 2) innerinner -- sensesense GGCATGAATGCCCCGATTGGCATGAATGCCCCGATT (서열번호 3) (SEQ ID NO: 3) innerinner -- antisenseantisense AGCGGTATCGTTCCTGAACTAGCGGTATCGTTCCTGAACT (서열번호 4) (SEQ ID NO: 4)

2. 2. LAMPLAMP 법의 최적 반응온도 결정 Determination of Optimum Reaction Temperature

PCC-LAMP의 최적 반응온도를 확인하기 위하여 반응 온도를 50.0~65.0℃로 각기 등온조건을 유지하고 실험을 수행하였다. 50.4℃부터 63.9℃의 범위에서 증폭이 가능함을 확인하였다. 특히, 50.4℃에서 58.9℃까지는 점점 증폭 정도가 높아지다가 61.0℃가 지나면서 낮아짐이 확인되었고, 최적온도는 61℃로 결정하였다(도 2). 도 2에서 Lane M은 1kb ladder(희석용액)이고, Lane N은 50.0℃에서 주형이 없는 음성 대조구이고, 1부터 9까지의 Lanes은 각각50.4, 51.3, 52.5, 54.2, 56.4, 58.9, 61.0, 63.9 및 65.0℃에서 LAMP 생성물이다. LAMP 생성물은 1부터 8까지의 Lanes 을 나타냈다. Lane 7에서 최적 반응온도는 61℃에서 결정되었다.
In order to confirm the optimum reaction temperature of the PCC-LAMP, the experiment was performed by maintaining the reaction temperature at 50.0˜65.0 ° C., respectively. It was confirmed that the amplification is possible in the range of 50.4 ℃ to 63.9 ℃. In particular, it was confirmed that the degree of amplification gradually increased from 50.4 ° C to 58.9 ° C and then decreased as 61.0 ° C passed, and the optimum temperature was determined to be 61 ° C (FIG. 2). In Figure 2 Lane M is 1kb ladder (diluent solution), Lane N is a negative control without a template at 50.0 ℃, Lanes 1 to 9 are 50.4, 51.3, 52.5, 54.2, 56.4, 58.9, 61.0, 63.9 And LAMP product at 65.0 ° C. The LAMP product showed Lanes from 1 to 8. The optimum reaction temperature in lane 7 was determined at 61 ° C.

3. 3. PCCPCC -- LAMPLAMP 의 of 프라이머의Primer 특이성 확인 Specificity check

4개의 프라이머에 대한 PCC-LAMP의 특이성을 확인하기 위하여 프라이머를 하나 또는 두 개를 제외하여 조성한 후 실험을 수행하였다. 4개의 프라이머가 모두 포함된 positive control을 제외하고는 모두 증폭이 이루어지지 않았다(도 3). 도 3에서 Lane M은 1kb ladder(희석용액)이고, Lane N은 프라이머가 없는 음성 대조군이고, Lane P는 모든 프라이머를 갖는 양성 대조군이고, 1부터 4까지의 Lanes은 inner-F (lane 1), outer-R (lane 2), inner-F and inner-R (lane 3), inner-F and outer-F (lane 4)가 부족한 LAMP 생산물들이다.In order to confirm the specificity of the PCC-LAMP for the four primers, the experiment was performed after the composition of one or two primers was removed. Amplification was not performed except for the positive control containing all four primers (FIG. 3). In Figure 3 Lane M is 1kb ladder (diluent solution), Lane N is a negative control without primer, Lane P is a positive control with all primers, Lanes 1 to 4 are inner-F (lane 1), LAMP products lacking outer-R (lane 2), inner-F and inner-R (lane 3), inner-F and outer-F (lane 4).

따라서, PCC-LAMP는 프라이머에 특이성이 높아 반응을 위해서는 4개의 프라이머가 모두 필요함을 확인하였다.
Therefore, PCC-LAMP was confirmed that all four primers are required for the high specificity of the primer.

4. 4. PCCPCC -- LAMPLAMP 의 민감도 확인Sensitivity of

PCC-LAMP의 검출한계를 확인하기 위하여 PCC-pBX437 클론을 1×106부터 1×102 copy까지 단계적으로 희석하여 실험을 수행하였다. 그 결과, copy수가 적어질수록 반응성이 단계적으로 낮아지는 것을 확인하였으며 1×106부터 1×103 copy까지 증폭이 이루어졌음을 확인하였다(도 4). 따라서 PCC-LAMP는 반응당 1×103 copy까지 검출이 가능한 것으로 판단하였다.
In order to confirm the detection limit of PCC-LAMP, experiments were carried out by diluting the PCC-pBX437 clone step by step from 1 × 10 6 to 1 × 10 2 copies. As a result, it was confirmed that the reactivity is gradually lowered as the number of copies decreases, and that amplification was performed from 1 × 10 6 to 1 × 10 3 copies (FIG. 4). Therefore, PCC-LAMP was able to detect up to 1 × 10 3 copies per reaction.

5. 5. PCCPCC -- LAMPLAMP 의 기질 특이성 확인Substrate specificity

PCC-LAMP의 기질 특이성을 분석하기 위하여 PCC외의 병원균의 genomic DNA를 주형으로 하여 실험을 수행하였다. Positive control을 제외하고 다른 병원균에서는 PCC-LAMP가 반응하지 않은 것을 확인하였다(도 5A). 또한 PCC의 5균주의 genomic DNA를 주형으로 하여 실험을 수행함으로써 PCC에 대한 PCC-LAMP의 반응성을 확인하였다. PCC-pBX437 클론으로 실험을 수행했을 때와 마찬가지로 PCC genomic DNA에서도 높은 반응성을 보이는 것을 확인하였다(도 5B). 도 5에서, Lane M은 1kb ladder(희석용액)이고, Lane N은 주형이 없는 음성 대조군이고, Lane P는 클론 PCC-pBX437을 갖는 양성 대조군이다. Panel A. 각각 벼 세균성 줄무늬병( Xanthomonas oryzae pv. Oryzicola, MAFF311018, lane 1), 시겔라 디센테리애(ATCC9361, lane 2), almonella enterica subsp. enterica (ATCC13076, lane3), Paenibacillus larvae subsp. larvae (ATCC25748, lane4) 및 Escherichia coli (ATCC29552, lane5)로부터의 주형 DNAs이다. 증폭 양성 대조구에서 단지 발생했다. Panel B. 1에서 5까지의 주형 DNA는 각각 KACC10371, KACC10401, KACC10408, KACC10566 및 KACC13960였다. 모든 lanes은 음성 대조군을 제외하고 성공적으로 증폭되었다.
In order to analyze substrate specificity of PCC-LAMP, experiments were performed using genomic DNA of pathogens other than PCC as a template. PCC-LAMP did not respond to the other pathogens except positive control (Fig. 5A). In addition, the reactivity of PCC-LAMP to PCC was confirmed by performing experiments with genomic DNA of 5 strains of PCC. As with the experiment with the PCC-pBX437 clone, it was confirmed that the PCC genomic DNA showed high reactivity (FIG. 5B). In FIG. 5, Lane M is a 1 kb ladder (diluent solution), Lane N is a negative control without template, and Lane P is a positive control with clone PCC-pBX437. Panel A. Rice Bacterial Stripe Disease (Xanthomonas oryzae pv. Oryzicola, MAFF311018, lane 1), Shigella Dicenteria (ATCC9361, lane 2), almonella enterica subsp. enterica (ATCC13076, lane 3), Paenibacillus larvae subsp. template DNAs from larvae (ATCC25748, lane4) and Escherichia coli (ATCC29552, lane5). Only occurred in amplified positive controls. The template DNAs from Panels B. 1 to 5 were KACC10371, KACC10401, KACC10408, KACC10566 and KACC13960, respectively. All lanes were successfully amplified except for the negative control.

6. 6. SYBRSYBR GreenGreen I을 이용한  With I PCCPCC 의 형광 검출Fluorescence detection

PCC-LAMP의 증폭산물을 전기영동 과정 없이 형광으로 확인하기 위하여 SYBR Green I을 포함하여 real-time LAMP를 수행하여 형광도를 측정하였고, 반응이 끝난 tube는 UV하에서 육안으로 형광 검출 여부를 확인하였다(도 6A). Real-time LAMP의 형광 증가 그래프 상에서는 positive control, 즉 프라이머와template가 모두 존재할 때 증폭이 이루어짐이 확인되었다(도 6C).In order to confirm the amplification product of PCC-LAMP by fluorescence without electrophoresis process, fluorescence was measured by real-time LAMP including SYBR Green I, and the reaction tube was visually confirmed by fluorescence detection under UV light. (FIG. 6A). On the fluorescence increase graph of the real-time LAMP, it was confirmed that amplification was performed when both positive control, that is, primer and template were present (FIG. 6C).

이는 전기영동 상에서도 동일한 결과를 나타내었다(도 6B). 또한 육안으로 확인했을 때, template를 포함하지 않은 negative control (tube1)에서 약간의 형광이 나타나는 것이 확인되었지만 프라이머를 포함하지 않은 negative control (tube2)의 경우에서 봤을 때 프라이머의 비 특이적 dimer 형성으로 인한 형광으로 판단하였다. 특히 SYBR Green I에 의한 육안 판별은 굳이 real-time LAMP를 위해 고가의 장비를 사용하지 않더라도 LAMP 반응 후, tube에 직접 SYBR Green I을 첨가해주는 것만으로도 확인이 가능함을 확인하였다. 프라이머 이합체(primer dimer)에 의한 형광은 증폭산물에 의한 형광에 비교했을 때 비교적 약하기 때문에, SYBR Green I을 이용한다면 전기영동 과정 없이 쉽게 LAMP 증폭산물을 확인할 수 있다.
This showed the same result on electrophoresis (FIG. 6B). In addition, when visually confirmed, a slight fluorescence was observed in the negative control without a template (tube1), but in the case of the negative control without a primer (tube2), due to non-specific dimer formation of the primer. Judging by fluorescence. In particular, visual discrimination by SYBR Green I confirmed that it is possible to add SYBR Green I directly to the tube after the LAMP reaction even if expensive equipment is not used for real-time LAMP. Fluorescence by primer dimers is relatively weak compared to fluorescence by amplification products, so using SYBR Green I can easily identify LAMP amplification products without electrophoresis.

7. 현장 시료에서의 7. On site sample PCCPCC 검출detection

실험실에서 배양된 균주가 아닌 실제 시료에서도 PCC-LAMP 적용이 가능한지 알아보기 위하여 무름병 증상을 보이는 배추의 genomic DNA를 PCC-LAMP로 진단하였고, 무름병에 걸리지 않은 배추와 감자의 genomic DNA를PCC-LAMP로 진단한 결과와 비교하였다. 무름병에 걸리지 않은 배추와 감자는 증폭되지 않은 반면, 무름병 증상을 보이는 배추는 PCC-LAMP에 의해 증폭됨을 확인하였다(도 7). 따라서 실제 시료에서도 PCC-LAMP가 적용 가능함이 확인하였다.In order to determine whether PCC-LAMP can be applied to real samples but not cultured in the laboratory, genomic DNA of Chinese cabbage with incurable disease was diagnosed with PCC-LAMP, and genomic DNA of Chinese cabbage and potato not affected by PCC-LAMP The diagnosis was compared with the result. Chinese napa cabbage and potatoes were not amplified, while napa cabbage showing symptoms were confirmed to be amplified by PCC-LAMP (Fig. 7). Therefore, it was confirmed that PCC-LAMP can be applied to actual samples.

서열목록 전자파일 첨부Attach an electronic file to a sequence list

Claims (4)

서열번호 1 내지 4의 프라이머 세트를 포함하는 무름병균을 검출하기 위한 등온증폭반응용 프라이머 조성물.Primer composition for isothermal amplification reaction for detecting the influenza bacteria comprising a primer set of SEQ ID NO: 1 to 4. 서열번호 1 내지 4의 프라이머 세트; 및 증폭 반응을 수행하기 위한 시약을 포함하는, 무름병균을 검출하기 위한 키트.Primer sets of SEQ ID NOs: 1-4; And a reagent for performing an amplification reaction. 식물체 검체로부터 게놈 DNA (gDNA)를 분리하는 단계;
상기 분리된 게놈 DNA를 주형으로 하고, 서열번호 1 내지 4의 프라이머 세트를 이용하여 등온증폭반응을 수행하여 lytic murein transglycolase 유전자의 표적 서열을 증폭하는 단계; 및 상기 증폭 산물을 검출하는 단계를 포함하는, 무름병균을 검출하는 방법.Separating genomic DNA (gDNA) from plant specimens;
Amplifying a target sequence of the lytic murein transglycolase gene by using the isolated genomic DNA as a template and performing isothermal amplification using the primer sets of SEQ ID NOs: 1 to 4; And detecting the amplification product. 제 3항에 있어서, 상기 등온증폭반응은 50~65℃에서 수행되는 것을 특징으로 하는 방법.The method of claim 3, wherein the isothermal amplification reaction is carried out at 50 ~ 65 ℃.
KR1020110104129A 2011-10-12 2011-10-12 Primer composition and kit for isothermal amplification reaction for detecting Pectobacterium carotovorum subsp. comprising specific primer set, and method for detecting Pectobacterium carotovorum subsp. using the primer set KR101288419B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020110104129A KR101288419B1 (en) 2011-10-12 2011-10-12 Primer composition and kit for isothermal amplification reaction for detecting Pectobacterium carotovorum subsp. comprising specific primer set, and method for detecting Pectobacterium carotovorum subsp. using the primer set

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020110104129A KR101288419B1 (en) 2011-10-12 2011-10-12 Primer composition and kit for isothermal amplification reaction for detecting Pectobacterium carotovorum subsp. comprising specific primer set, and method for detecting Pectobacterium carotovorum subsp. using the primer set

Publications (2)

Publication Number Publication Date
KR20130039518A KR20130039518A (en) 2013-04-22
KR101288419B1 true KR101288419B1 (en) 2013-07-23

Family

ID=48439683

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020110104129A KR101288419B1 (en) 2011-10-12 2011-10-12 Primer composition and kit for isothermal amplification reaction for detecting Pectobacterium carotovorum subsp. comprising specific primer set, and method for detecting Pectobacterium carotovorum subsp. using the primer set

Country Status (1)

Country Link
KR (1) KR101288419B1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105018631B (en) * 2015-08-12 2018-12-18 中国农业科学院蔬菜花卉研究所 Method, its Primer composition and detection kit based on loop-mediated isothermal amplification technique detection carrot soft rot Pectinatus
CN108866219B (en) * 2018-08-13 2021-08-03 华中农业大学 Konjac soft rot germ specific sequence and detection primer and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
강희완 등. 한국식물병리학회지. Vol. 14, No. 2, 페이지 164-170 (1998) PCR다형성 밴드 유래 DNA probe에 의한 Erwinia carotovora subsp. carotovora 특이적 검출 *
노지나 등. 미생물학회지. Vol. 45, No. 4, 페이지 306-311 (2009) Pectobacterium carotovorum의 검출을 위한 PCR 진단법의 개발 *

Also Published As

Publication number Publication date
KR20130039518A (en) 2013-04-22

Similar Documents

Publication Publication Date Title
Aslam et al. Recent advances in molecular techniques for the identification of phytopathogenic fungi–a mini review
Gao et al. RT-qPCR based quantitative analysis of gene expression in single bacterial cells
CN109251963A (en) The method and kit of mycoplasma contamination in Constant Temperature Detection cell culture fluid
Moura-Melo et al. Targeting helicase-dependent amplification products with an electrochemical genosensor for reliable and sensitive screening of genetically modified organisms
US20140154696A1 (en) Pcr diagnostics of dermatophytes and other pathogenic fungi
EP3105324B1 (en) Ngs systems control and methods involving the same
WO2017050934A1 (en) Improved detection of short homopolymeric repeats
Barkan Studying the structure and processing of chloroplast transcripts
KR101288419B1 (en) Primer composition and kit for isothermal amplification reaction for detecting Pectobacterium carotovorum subsp. comprising specific primer set, and method for detecting Pectobacterium carotovorum subsp. using the primer set
CN105463093A (en) Primer, kit and amplification method for fish mitochondria whole genome amplification
CN108411030A (en) The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108
KR101814740B1 (en) Method for Detection of Food Poisoning Bacteria By Using Gene Amplification and Kit for Use in The Same Method
Xiujie et al. Comparison of five endogenous reference genes for specific PCR detection and quantification of rice
WO2011092792A1 (en) Specific mould detection microarray, and method of use for same
CN102443633A (en) Method for real time quantitative PCR detection of hematopoietic chimeras and designing of genetic marker primers of hematopoietic chimeras
He et al. An efficient and accurate droplet digital PCR method for rapid transgene copy number detection and homozygous identification in cotton (Gossypium hirsutum)
RU2642273C1 (en) Method of differentiating yersinia pestis strains on basic and nonbasic subtypes by pcr method in real time mode
Ijaz et al. Molecular phytopathometry
KR101510306B1 (en) Primer sets and probe for detecting Alternaria brassicicola, and leaf spot detction method using the same
JP2013201924A (en) Method for detecting equine infectious anemia virus
CN102424863B (en) Enhanced fluorescence quantitative PCR (polymerase chain reaction) method
Wen-Tao et al. Research progress in techniques for detecting genetically modified organisms
CN103290130B (en) Detection method for Cry2Ae genes in transgenic product and kit thereof
CN103361410B (en) Plasmid standard molecule for detecting transgenic rice Ke-Ming-Dao No.2 and construction of plasma standard molecule
Adane et al. A Brief Review on Molecular Diagnostic Tools: Principles, Application and Limitations

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant