RU2508547C2 - Diagnostic technique for pactreatic infectious necrosis virus in salmon by polymerase chain reaction - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: there are performed two rounds of a polymerase chain reaction with the primers B37 - B853r and B123 - B320r to detect a fragment of a segment B coding a RNA-dependent RNA-polymerase of a pancreatic infectious necrosis virus that is followed by an electrophoretic measurement of a size of an amplified fragment of a nucleotide sequence. If the electrophoregram shows the fragments of the length of 860 and/or 240 pn in the analysed sample, the pancreatic infectious necrosis virus is diagnosed in salmon.

EFFECT: invention is applicable for the diagnostic purposes in scientific research institutions, veterinary laboratories, and fish farms.

2 dwg, 3 tbl, 3 ex

Description

The present invention relates to the field of biotechnology, molecular genetic diagnosis of animal viral diseases, scientific research in veterinary medicine and molecular biology.

Infectious pancreatic necrosis (Infectious pancreatic necrosis virus, IPNV) is a highly contagious viral disease that affects juveniles of cultivated salmon and some fish species of other families living in fresh and in sea water. The pancreatic infectious necrosis virus causes significant economic damage to fish farms of the Russian Federation.

In the complex of measures for the rehabilitation of farms from the virus of infectious pancreatic necrosis, the leading place belongs to diagnostics. The lack of commercially available diagnostic kits in the domestic market necessitated the creation of a test system for the identification of IPNV by polymerase chain reaction.

Currently, the improvement of IPNV diagnostic methods is urgently needed because traditional methods of virus isolation in cell cultures do not always allow the virus to be identified and take a long time.

The principle of PCR is to multiply (amplify) a certain portion of the DNA of a detected object by copying it using the DNA polymerase enzyme and specific primers. Since the IPNV genome is represented by a double-stranded RNA molecule in the form of two segments A and B, preliminary - before staging, PCR-RNA is converted to cDNA due to the reverse transcriptase enzyme. Specific primers (forward and reverse) restrict a specific fragment of the nucleotide sequence so that the elongation of a new cDNA strand during reverse transcription and subsequent amplification in PCR occurs only between them. The main parameters for the efficient passage of the amplification reaction, which provide specificity and sensitivity, are the correct choice of the genome region of the identified agent, the structure and temperature regime of annealing of oligonucleotide primers.

Known methods for detecting a fragment of the genome of the virus of infectious pancreatic necrosis of salmon by PCR using primers to segment A [1].

Also described is a method for detecting RNA of the virus of infectious pancreatic necrosis by the method of "nested" PCR (nested-PCR) with primers for segment A, which have the following structure:

1 5'-CCAAACCAACAGGTCCTATCCTAC-3 '(external direct)

2 5'-TGATGCCGTTGTTCTCATCAGCTG-3 '(external reverse)

3 5'-GAAGGAGATGACATGTGCTACACC-3 '(internal direct primer with biotinylated label at the 5'-end)

4 5'-GAGAGATGTGTTTGCCACCATCTC-3 '(internal reverse)

The fragment obtained in the first round of PCR serves as a matrix in the second round of PCR. In the second round, two labeled primers are used: one has a biotinylated tag at the 5'-end, the other contains a ³² P.

Known methods for detecting fragments of the pancreatic necrosis virus viral genome are not without drawbacks: the use of a radioactive label requires special safety measures and laboratory licensing; in the method proposed by K. Williams et al., A VP2 gene fragment characteristic of all birnaviruses is amplified, which does not exclude the possibility of false positive results. The primers described in the literature were selected for the genes of segment A. At the same time, it was found that IPNV isolates isolated from different geographical places are characterized by high genetic diversity, mainly due to the variability of the genes encoded by segment A. In this regard, it is highly likely that segment A primers may not be suitable for newly isolated viruses with a modified genotype. This primarily concerns isolates from bodies of water in regions where research on the presence of IPNV has not previously been conducted.

To identify the pathogen by PCR, it is advisable to use primers for the most conservative region of the genome. In the case of IPNV, this may be segment B encoding a key enzyme for the replication of the viral genome of an RNA-dependent RNA polymerase.

The research task included the development of an effective method for detecting fragments of the genome of the virus of infectious pancreatic necrosis of the salmon by nested PCR using 4 specific oligonucleotide primers.

The first priority was the design of four specific primers for IPNV, which are the main component of PCR and ensure its specificity and sensitivity.

Segment B was used to select primers, while the publications mainly described primers for segment A. When designing primers and evaluating their specificity, we used nucleotide sequences and the BLAST program available on the Internet at the NCBI website. The proposed method is as follows: using computer DNASTAR programs (Lasergene Co., USA), based on the program provided in the GenBank Internet resource databases (CLUA), select references according to the genotypes of the pancreatic infectious necrosis virus edovatelnost NC_001916 strain Jasper. Primers are checked for lack of homology with sequences of other viruses and the human genome by the BLAST program using the web resource of the National Center for Biotechnological Information (http://www.ncbi.nlm.nih.gov/). Based on the computer analysis, 2 pairs of primers were selected: external B37 and B853r and internal B123 and B320r.

Title 5 '- 3' length B37 ACG TTG GTG GCA CCC GAC ATA C 22 B123 TGT CGG ACA TST TCA ACT CAC C 22 B320r CAG TCG AGGCAG AGCGGC PBX 21 B853r GTG TST CCT TTGGTT TTGCCT ATG 24

The synthesis of the developed oligonucleotide primers is ordered at a commercial service center.

Four primers for segment B were selected in such a way that they allow the use of nested and semi-nested PCR techniques, and can also be used for sequencing.

Primers have the following characteristics: complementarity of the selected region of the gene of segment B, the absence of self-complementary regions within each primer and between the direct and reverse, flank the region of fragments of gene B of size 860 bp and ≈240 bp, respectively. The synthesis of the developed oligonucleotide primers is ordered at a commercial service center.

Example 1

Amplification of specific fragments of salmon salmon pancreatic necrosis virus cDNA using developed primers to diagnose the disease.

In the process of conducting practical experiments, the optimal conditions for the passage of the polymerase chain reaction with the developed primers are selected.

The reverse transcription reaction is preliminarily carried out with a pair of external primers. The reverse transcription reaction takes place at 42 ° C for 45 minutes, then the resulting cDNA is heated at 95 ° C for 3 minutes and used for PCR. The composition of the reaction mixture is shown in Table 1. IPN reference strains (provided by Dr. E. Neuvonen, Veterinary Institute, Helsinki, Finland. The strain was previously tested by ELISA) as a positive control at the stage of reverse transcription and PCR, and water or cell culture medium (e.g., MEM Needle).

The polymerase chain reaction is carried out in the volume of the reaction mixture of 25 μl per 1 DNA sample.

The composition of the reaction mixture is presented in table 2. The temperature-time mode of the reaction for the Tertsik amplifier (DNA technology, Russia) is presented in table 3. The amplification conditions and the reaction mixture are the same for the first and second rounds.

After the amplification reaction, the PCR products are analyzed by electrophoretic separation in a 2% agarose gel with the addition of ethidium bromide.

During PCR, amplification products of cDNA of the pancreatic necrosis virus of about 860 bp in the first round of PCR and 240 bp in the second round of PCR were obtained, which was confirmed in all experiments. The electrophoregram of the PCR results is shown in Fig. 1. When taking PCR results into account, control samples were primarily evaluated. In the electrophoretic track with a positive control sample (K +), a luminous band was present at the level of the corresponding fragment of 860 or 240 bp in length (in the first and second round, respectively; evaluated by marker M).

Experimental samples were evaluated by the presence in the corresponding lane of a specific band, which in positive samples was located at the same level as the band in the positive control sample. The band was absent in negative samples (Fig. 2).

Example 2

Determination of the sensitivity of the amplification reaction using developed specific oligonucleotide primers.

Tenfold dilutions of an IPNV-infected cell suspension with an initial titer of 7.5 lg TCD ₅₀ / ml were analyzed. (10 ^7.5 TCD ₅₀ / ml).

When conducting "nested" PCR, the last dilution in which a specific band was detected was a 10 ^-7 dilution, which corresponds to 0.5 lg TCD ₅₀ / ml or ~ 3 TCD ₅₀ / ml. The electrophoregram of the PCR results is shown in Figure 2.

Example 3

Determination of the specificity of the amplification reaction using the developed specific oligonucleotide primers.

The specificity of the primers was tested on samples of hematopoietic tissue infectious necrosis virus, pancreatic infectious necrosis virus and salmon hemorrhagic septicemia virus. A specific band was detected only if there was an infectious pancreatic necrosis in the virus sample.

The proposed option was tested with a positive result and regular reproducibility in 2010-2011 on 500 samples obtained from a homogenate of the internal organs of fish from farms of the Moscow, Ryazan regions and the Republic of Karelia, as well as infected cell cultures.

The present invention will find application in diagnostic studies in research institutes, veterinary laboratories, fish farms.

Literature

1. Wiliams K., Blake S., Sweeney A., Singer J.T., Nicholson B.L. // Multiplex Reverse transcriptase PCR assay for simultaneous detection of three fish viruses // J of clinical microbiology. - 1999. - V.37 (No. 12). - R. 4139-4141.

2. Rimstad E., Homes E., Olsvik O., Hyllseth B. // Identification of a double-stranded RNA virus by using polymerase chain reaction and magnetic separation of the synthesized DNA segments // J of clinical microbiology - 1990 -. V.28 (No. 10). - R. 2275-2278.

The invention is illustrated by tables and figures, which display the following information:

table 2 The composition of the reaction mixture for PCR for 1 reaction with a volume of 25 μl PCR components Initial concentration Final concentration Volume per reaction PCR mix 2 red 2.5 x 1x 10 μl dntp 10 µM 0.2 µM 0.5 μl “Direct” primer B37 (B123) * 10 µM 0.2 µM 0.5 μl Reverse Primer B853 (B320) * 10 µM 0.2 µM 0.5 μl Water 8.5 μl cDNA (template) 5 μl * primers for the second round of PCR are indicated in parentheses

Table 3 Temperature-time regime of PCR (device "Tertsik", Russia) Stage description Temperature ° C Duration sec Number of cycles one Pre-heating the device "pause" 94 - - 2 Blueberry DNA Denaturation 95 120 one 3 DNA denaturation 95 twenty 3 four Hybridization of primers with specific sites fifty twenty 5 Synthesis of Complementary Chains 72 fifty 6 DNA denaturation 95 twenty thirty 7 Hybridization of primers with specific sites 58 twenty 8 Synthesis of Complementary Chains 72 fifty 9 Final synthesis of comp circuits 72 120 one 10 Storage 10 - -

Claims (1)

A method for the diagnosis of salmon infectious pancreatic necrosis virus by polymerase chain reaction, using two direct and two reverse oligonucleotide primers to detect a fragment of segment B encoding the RNA-dependent RNA polymerase of the pancreatic infectious necrosis virus of the following structure - B37: ACGTTGGTGGACCC: TGTCGGACATCTTCAACTCACC, B320r: CAGTCGAGGCAGAGCGGCATC, B853r: GTGTCTCCTTTGGTTTTGCCTATG, with electrophoretic determination of the size of the amplified fragment of the nucleotide sequence, where by the presence on the electron oforegramme fragments of 860 and / or 240 bp in the sample diagnose infectious pancreatic necrosis virus of salmon.

Images