RU2458142C1 - Diagnostic technique for biomaterials for presence of agrobacteria - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: technique involves DNA recovery from the biomaterial and real-time polymerase chain reaction with using probes marked by fluorescent dyes and fluorescence extinguishers. It involves preparing two reaction mixtures one of which contains the primers atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc and the probe FAM-cgttcggctc ggcatctcga tattccc-BHQ1, while the other one contains the primers ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca and the probe Joe-gtatccggct atgcgccgag tttgg BHQ1. The polymerase chain reaction is real-time at primer annealing temperature 55-62C in 30-45 cycles with continuous fluorescence control, its increment observing in one or more reaction mixtures enables diagnosing the presence of agrobacteria in the samples.

EFFECT: invention enables extending the range of genotypes of the diagnosed agrobacteria.

5 cl, 7 dwg, 6 ex

Description

The invention relates to biotechnology of agricultural plants and can find application for the needs of agriculture and crop production in the diagnosis of plant infection (such as, for example, grapes, apple trees, plums, cherries, raspberries, currants, etc.) by agrobacteria. In addition, the invention can be used in the analysis of the results of agrobacterial transformation, in the analysis of various substrates (soil, water), in veterinary medicine and medicine, since some strains of agrobacteria are conditionally pathogenic.

A known method for the determination of bacteria (including agrobacteria) [1], the essence of which is to analyze the morphophysiological symptoms of plant infection. However, this method is not accurate enough, since tumors on plants induce not only agrobacteria, but also some viruses, insects, and nematodes. In addition, this method can identify a pathogen already at a time when the disease has developed quite strongly. As a result, time may be lost for effective protective measures.

A known method for the diagnosis of plants [1] for the presence of bacterial infection, based on a microscopic examination of the affected tissues. It is used to determine the type of pathogen or to establish a pathogen in plant tissues during the detection of the characteristic features inherent in the pathogen (color, spore size, etc.). Based on the totality of the detected signs, using the determinant, a systematic position and type of pathogen are established. However, this method is also applicable only in the case of a significant infection of the plant, requires a highly qualified researcher and is time consuming.

A known method for the determination of bacteria [1] based on a description of their cultural traits (growth rate on nutrient media, size, color, shape of colonies, etc.). However, this method is quite long and laborious.

For DNA diagnostics of various pathogens, the classic version of the polymerase chain reaction (PCR) is used, followed by separation of the fragments on an agarose gel. This method is simple to implement and cheap, but it has one big drawback: the high probability of false positive answers due to contamination of the DNA sample with the PCR product. Nevertheless, at present, diagnostic kits based on classical PCR variants are very common.

The appearance of a new modification of the method (PCR) in real time was a new step in the development of this technology, since it allows you to control the increase in the amount of synthesized product during the reaction and does not require electrophoresis in subsequent stages. This became possible due to the addition of dyes to the reaction medium that provide fluorescence directly proportional to the amount of the synthesized PCR product — reporter fluorescence.

Real-time PCR exists in two main modifications, differing in the methods of generating reporter fluorescence. The first of them is associated with the use of intercalating fluorescent agents, the luminescence of which increases significantly upon binding to double-stranded DNA, the second is associated with the use of oligonucleotide samples labeled with fluorescent agents complementary to the region of the PCR product. The second modification of PCR is more preferable for diagnostic purposes, since it provides an additional opportunity to control the specificity of the reaction.

The use of real-time PCR allows minimizing the problem of contamination with the reaction product, accelerating the analysis procedure due to the absence of the need for electrophoresis, and allows obtaining quantitative characteristics of the presence of the DNA of interest in the sample.

At the moment, on the basis of PCR technology, a huge number of diagnostic systems for various purposes have been developed, including for the needs of agriculture and crop production.

Similar inventions are known “Method and kit for detecting the DNA of the bacterium of the disease of Lyme borreliosis - borrelia burgdorferi” [2] and “Kit of reagents for the determination of DNA of periodontal pathogenic microbes Prevotella intermedia sensu stricto, Bacteroides forsythus, Treponema denticola, Actinobacillus actinomycetemcomromonas porphi multiplex polymerase chain reaction ”[3]. A set of synthetic oligonucleotides for detecting DNA of a pathogen of vegetable diseases - gram-negative bacteria Xanthomonas campestris pv vesicaroria by polymerase chain reaction [4].

However, similar kits, as well as reaction PCR mixtures, primers, and methods for detecting agrobacterial DNA from literature and other sources of information are not known.

The applicant knows that the work on the creation of primers that are used in such sets is usually constructed as follows.

1) Using open and commercial databases of nucleotide sequences of the genomes of microorganisms, or as a result of independent determination of the nucleotide sequence of the studied microorganism, a portion of the genome is selected that is unique to this type of microorganism (or group of species).

2) Based on the selected region of the genome, using special software, the sequence of oligonucleotides used to carry out the PNR reaction is selected (often 2 primers and a sample).

At this stage, the work consists in creating the alignment of many genomic sequences and selecting a portion of the sequence where the number of mutations corresponds to the desired location of the primers.

Alignment of genomic sequences means a comparison of the sequences of many organisms with each other, the search for unique for the desired microorganism sites that have no analogues in other microorganisms.

The search for a correspondence between the number of mutations and the location of primers means that mutations that are possible in a given microorganism (naturally, data about which are already in the databases or have already been obtained independently) should not affect the genome region selected for primers, since the substitutions are in the genomic sequence (mutations) can adversely affect the performance of primers.

3) Production of primers.

4) Using practical experiments, the suitability of the selected sequences for specific purposes is proved (for example, to determine the presence / absence of a given microorganism in a biomaterial).

The closest method to the achieved technical result is a method for determining bacteria [4], adopted as a prototype. Its essence is to identify the pathogen Xanthomonas campestris. This is another type of phytopathogenic bacteria in relation to the claimed method (and the object of our study). In addition, the disadvantage of this method, adopted as a prototype, is a fairly narrow range of determined genotypes of diagnosed bacteria.

The claimed invention is free from these disadvantages.

The technical result of the invention consists in reducing the cost of the method and expanding the range of genotypes of diagnosed agrobacteria.

The specified technical result is achieved by the fact that in the method for diagnosing biomaterials for the presence of agrobacteria in them, which consists in isolating DNA from the biomaterial and carrying out the polymerase chain reaction in real time on it with probes labeled with fluorescent dyes and fluorescence quenchers, in accordance with the claimed invention after isolation of the DNA samples at a concentration of 0.1-100 ng / μl based on it are two reaction mixtures, one of which contains primers atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc and probe FAM-cgttcggctc gg catctcga tattccc-BHQ1, and the second contains primers ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca and probe Joe-gtatccggct atgcgccgag tttgg BHQ1, the primers in the reaction mixtures have a concentration of 0.2–2 mM reaction buffers, a concentration of 0.2–2 mM polymerase buffer, a , Mg 2+ cations at a concentration of 0.1-0.3 mM, nucleotides at a concentration of 2-10 μM, thermostable polymerase 0.1-0.3 units of activity per microliter of the mixture, polymerase chain reaction is carried out in real time with annealing temperature primers 55-62 ° C at 30-45 cycles, while continuous monitoring of fluorescence and by exposure ntsialnomu its build-up in one or both of the reaction mixtures are diagnosed in the presence of Agrobacterium samples.

In addition, the specified technical result is achieved in that as a thermostable polymerase with an activity of 0.1-0.3 units. per microliter of the mixture take Taq.

In addition, the specified technical result is achieved by the fact that as a thermostable polymerase with an activity of 0.1-0.3 units. per microliter of the mixture take Pfu.

In addition, the specified technical result is achieved by the fact that as a thermostable polymerase with an activity of 0.1-0.3 units. per microliter of the mixture take Vent.

However, this technical result is achieved in that as a thermostable polymerase with an activity of 0.1-0.3 units. per microliter of the mixture take Tth.

The essence of the claimed invention lies in the fact that to diagnose the presence of agrobacteria in the sample, real-time PCR is performed with primers and probes to evolutionarily conserved regions of genes characteristic of agrobacteria.

For example, when comparing the prior art:

According to the patent of the Russian Federation No. 2378383 (RU):

) A SET OF SYNTHETIC OLIGONUCLEOTIDES FOR IDENTIFICATION OF DNA OF THE CAUSE OF VEGETABLE DISEASES OF VEGETABLE CULTURES - GRAM-NEGATIVE BACTERIA PSEUDOMONAS SYRINGAE PV LACHRYMANS BY THE POLYMERASE CHAIN METHOD

According to the patent of the Russian Federation No. 2378382 (RU):

) A SET OF SYNTHETIC OLIGONUCLEOTIDES FOR IDENTIFICATION OF DNA OF THE CAUSE OF VEGETABLE DISEASES OF VEGETABLE CULTURES - GRAM-NEGATIVE BACTERIA XANTHOMONAS CAMPESTRIS PV VESICARORIA BY THE POLYMERASE CHAIN METHOD.

With a seemingly similar detection technology, well-known and other similar patents describe the detection of other pathogens; the authors found no diagnostic systems for detecting agrobacteria using real-time PCR.

An alternative to the proposed approach can be a complex of traditional microbiological methods associated with seeding pathogens on nutrient media, analysis of grown microorganisms using microscopy methods - the methods are much more laborious and time consuming.

The essential features of the invention are:

DNA of purity sufficient for enzymatic reactions is isolated from the analyzed sample, after which 2 reaction mixtures are made up of at least:

the first reaction mixture is a polymerase buffer, Mg 2+ cations at a concentration of 0.1-0.3 mM, nucleotides at a concentration of 2-10 μM, Taq polymerase (or other thermostable polymerase having 5 'exonuclease activity), 0.1- 0.3 units activity per microliter of the mixture, the DNA matrix of the test sample 0.1-100 ng / μl, primers of the following composition: atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc at a concentration of 0.2-2 mM probe: FAM-cgttcggctc ggcatctcga tattccc-BHQ1 mM, the probe may also contain other fluorescent dyes or fluorescence quenchers;

the second reaction mixture is a polymerase buffer, Mg 2+ cations at a concentration of 0.1-0.3 mM, nucleotides at a concentration of 2-10 μM, Taq polymerase (or other thermostable polymerase having 5 'exonuclease activity) 0.1-0 , 3 units activity per microliter of the mixture, the DNA matrix of the test sample 0.1-100 ng / μl, primers of the following composition:

ctctcgaaygcgrtgatgcgc, aacggaccragratrataaacgtgca at a concentration of 0.2-2 mM and a probe of the following composition: Joe-gtatccggct atgcgccgag tttgg-BHQ1 at a concentration of 0.1-1 mM, the probe may also contain other fluorescent dyes or fluorescence quenchers.

The reaction is carried out in a thermocycler at an annealing temperature of 55-62 ° C for 30-45 cycles of thermal cycling. The reaction can be carried out in a thermocycler capable of detecting the change in fluorescence in real time or in a conventional thermocycler without a detector (in this case, the passage of the reaction is judged by the change in the level of fluorescence measured before the start of the reaction and after its passage)

If the passage of the reaction in the form of an increase in the level of fluorescence of the sample is detected in at least one of the reaction mixtures, it is concluded that there are agrobacteria in the analyzed sample.

The implementation of the claimed method.

To detect agrobacteria in the sample by the described method:

1. Isolate DNA from the sample by the STAB method. To do this, homogenize the sample in a CTAB buffer (NaCl 1.4M, Tris HCl (pH 8) 0.1M, EDTA (pH 8) 20 mM, CTAB 2% m / v) (in case of analysis of a water sample, pre-concentrate the sample, for example centrifuge for 10 minutes at 3-10 thousand rpm, then drain the supernatant), incubate the resulting mixture for 1 hour at 56 ° C, extract for 40-60 minutes with chloroform, separate the fractions by centrifugation, transfer the upper (aqueous) fraction containing DNA with ethanol DNA dissolve in water. In the case of DNA extraction from the soil, melt the DNA solution obtained at the last stage into low-melting agarose (final concentration of agarose is 1%), elute with TE buffer for 24 hours, then drain the buffer. Before use, heat the sample to 80 ° C.

2. Prepare 2 reaction mixtures for PCR. The first mixture should contain 1x polymerase buffer, Mg 2+ cations at a concentration of 0.1-0.3 mM, nucleotides at a concentration of 2-10 μM, Taq polymerase (or other thermostable polymerase having 5 'exonuclease activity), 0.1 -0.3 units activity per microliter of the mixture, the DNA matrix of the test sample 0.1-100 ng / μl, primers of the following composition: atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc at a concentration of 0.2-2 mM, probe: FAM-cgttcggctc ggcatctcga tattccc-BHQ1 1 mM, the probe may contain other fluorescent dyes or fluorescence quenchers, in the second reaction mixture there is a polymerase buffer, Mg 2+ cations in a concentration of 0.1-0.3 mM,

nucleotides at a concentration of 2-10 μM, Taq polymerase (or other thermostable polymerase having 5 'exonuclease activity) 0.1-0.3 units. activity per microliter of the mixture, the DNA matrix of the test sample 0.1-100 ng / μl, primers of the following composition:

ctctcgaaygcgrtgatgcgc, aacggaccragratrataaacgtgca at a concentration of 0.2-2 mM and, probe, the following composition: Joe-gtatccggct atgcgccgag tttgg-BHQ1 at a concentration of 0.1-1 mM.

3. Carry out a polymerase chain reaction in real time with annealing temperature of primers 55-62 ° C at 30-45 cycles. Program Example:

95 ° С - 5 minutes, 40 cycles (95 ° С - 18 sec, 55 ° С - 30 sec, 72 ° С - 30 sec).

The progress of the reaction is monitored by means of a device for measuring the level of fluorescence during the reaction, when the reaction occurs in at least one of the reaction mixtures, an increase in the level of fluorescence is observed, it is concluded that there are agrobacteria in the test sample.

The claimed method is tested in real time at the laboratory base of St. Petersburg State University and is illustrated by specific examples.

Examples of specific implementation.

To detect agrobacteria in the sample by the described method:

1. Select DNA from the sample by the STAB method (preparatory step).

2. Carry out real-time PCR (analysis itself)

Example 1

Isolation of DNA from a soil sample.

Homogenize the sample in CTAB buffer (NaCl 1.4M, Tris HCl (pH 8) 0.1M, EDTA (pH 8) 20 mM, CTAB 2% m / v), incubate the mixture for 1 hour at 56 ° C, 40-60 minutes to extract with chloroform, separate the fractions by centrifugation, the upper (aqueous) fraction containing DNA, reprecipitate with ethanol, dissolve the DNA in water. Prepare a 2% solution of low-melting agarose in TE buffer, melt the agarose and mix in equal proportions with the DNA preparation. After polymerization of agarose, extract humic acids from the gel by passive elution of 1 ml of TE buffer overnight. Drain the buffer. Before staging enzymatic reactions, melt the agarose.

Example 2

Isolation of DNA from a water sample.

A water sample is placed in a centrifuge cup and centrifuged for 10 minutes at 3-5 thousand rpm. Discard the supernatant, homogenize the precipitate in CTAB buffer, incubate the resulting mixture for 1 hour at 56 ° C, extract with chloroform for 40-60 minutes, separate the fractions by centrifugation, transfer the upper (aqueous) fraction containing DNA with ethanol, and dissolve the DNA in water.

Example 3

Isolation of DNA from plant material.

Grind the plant tissues in a mortar in CTAB buffer, incubate the resulting mixture for 1 hour at 56 ° C, extract for 40-60 minutes with chloroform, separate the fractions by centrifugation, reposition the upper (aqueous) fraction containing DNA with ethanol, and dissolve the DNA in water.

After DNA isolation, its concentration was determined spectrophotometrically.

SETTING PCR

Example 4

The functioning of the diagnostic system under various temperature reaction conditions.

In the course of work, 2 reaction mixtures for PCR were prepared. The first mixture contained 1x polymerase buffer, Mg 2+ cations at a concentration of 0.1-0.3 mM, nucleotides at a concentration of 2-10 μM, Taq polymerase, 0.2 units. activity per microliter of the mixture, the DNA matrix of the test sample 100 ng / μl, primers of the following composition: atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc at a concentration of 2 mM probe: FAM-cgttcggctc ggcatctcga tattccc-BHQ1 in the reaction mixture for polymer 1 mM Mg 2+ at a concentration of 0.2 mM, nucleotides at a concentration of 2-10 μM, Taq polymerase 0.2 units. activity per microliter of the mixture, the DNA matrix of the test sample 100 ng / μl, primers of the following composition:

ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca at a concentration of 0.2-2 mM and a probe of the following composition: Joe-gtatccggct atgcgccgag tttgg-BHQ1 at a concentration of 0.1-1 mM,

real-time polymerase chain reaction was carried out with annealing temperature of primers 50-62 ° C at 40 cycles, example program:

95 ° С - 5 minutes, 40 cycles (95 ° С - 18 sec, х ° С - 30 sec, 72 ° С - 30 sec), where X ranged from 50 to 62 degrees.

The progress of the reaction was monitored by means of a device for measuring the level of fluorescence during the reaction, for example, ANK32 amplifier (tests were carried out at the laboratory base of the Institute for Analytical Instrumentation of the Russian Academy of Sciences).

The reaction results at an annealing temperature of 60 degrees are presented as an example in the form of raw data for each of the dyes (Figure 1).

Figure 1 shows the increase in fluorescence through the FAM and R6G (Joe) channels during PCR on DNA containing the vir sequences of agrobacterial genes.

Figure 2-5 presents the data on the growth of fluorescence after mathematical processing carried out using the software to the ANC 32 amplifier. Each figure corresponds to different annealing temperatures of the primers. The DNA of agrobacteria was used as a matrix.

Figure 2 shows the increase in fluorescence during PCR with annealing temperature of the primers 50 ° C.

Figure 2 shows that in sample number 1 there is a high concentration of agrobacterial DNA (as evidenced by the early onset of fluorescence growth).

The following figure (Figure 3) shows the increase in fluorescence during PCR with annealing temperature of the primers 55 ° C.

Figure 3 shows that in samples 2 and 3 there is a high concentration of agrobacterial DNA (as evidenced by the early onset of fluorescence growth).

Figure 4 shows the increase in fluorescence during PCR with annealing temperature of the primers 60 ° C. The graph shows that samples 2 and 3 contain agrobacterial DNA in high concentration (as evidenced by the early onset of fluorescence growth).

Figure 5 presents the growth of fluorescence during PCR with annealing temperature of the primers 62 ° C.

The graph shows that in sample number 1 there is a high concentration of agrobacterial DNA (as evidenced by the early onset of fluorescence growth).

Thus, under all the analyzed temperature conditions, a reaction is observed that indicates the operation of the diagnostic system in the studied reaction temperature conditions.

Example 5

The use of DNA from various biological material in the evaluation of samples for the presence of agrobacteria.

In the course of work, 2 reaction mixtures for PCR were prepared. The first mixture contained 1x polymerase buffer, Mg 2+ cations at a concentration of 0.1-0.3 mM, nucleotides at a concentration of 2-10 μM, Taq polymerase, 0.2 units. activity per microliter of the mixture, the DNA matrix of the test sample 100 ng / μl, primers of the following composition: atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc at a concentration of 2 mM probe: FAM-cgttcggctc ggcatctcga tattccc-BHQ1 in the reaction mixture for polymer 1 mM Mg 2+ at a concentration of 0.2 mM, nucleotides at a concentration of 2-10 μM, Taq polymerase 0.2 units. activity per microliter of the mixture, the DNA matrix of the test sample 100 ng / μl, primers of the following composition:

ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca at a concentration of 0.2-2 mM and a probe of the following composition: Joe-gtatccggct atgcgccgag tttgg-BHQ1 at a concentration of 0.1-1 mM,

Real-time polymerase chain reaction was carried out according to the program: 95 ° С - 5 minutes, 40 cycles (95 ° С - 18 sec, 60 ° С - 30 sec, 72 ° С - 30 sec).

The progress of the reaction was monitored by means of an instrument for measuring the level of fluorescence during the reaction, ANK32 (tests were carried out at the Institute of Analytical Instrumentation RAS).

The reaction results are presented in Fig.6, which shows the fluorescence growth curves corresponding to samples of DNA isolated from plant residues with strong agrobacterial infection (1), soil (2), water (3).

The data obtained confirm the possibility of using the system for the analysis of various biological material.

Example 6

Investigation of biological material (a plant strongly infected with agrobacteria) for the presence of agrobacteria when the reaction is set up at various DNA concentrations.

In the course of work, 2 reaction mixtures were prepared for the NDP. The first mixture contained 1x polymerase buffer, Mg 2+ cations at a concentration of 0.2 mM, nucleotides at a concentration of 2-10 μM, Taq polymerase, 0.2 units. activity per microliter of the mixture, the DNA matrix of the test sample 0.1; 1 and 100 ng / μl, primers of the following composition: atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc at a concentration of 2 mM probe: FAM-cgttcggctc ggcatctcga tattccc-BHQ1 at a concentration of 1 mM, in the second reaction mixture, a buffer for polymerase, 2+, 2 mM, nucleotides at a concentration of 2 μM, Taq polymerase 0.2 units activity per microliter of the mixture, the DNA matrix of the test sample 0.1; 1 and 100 ng / μl, primers of the following composition:

ctctcgaaygcgrtgatgcgc, aacggaccragrataaacgtgca at a concentration of 0.2-2 mM and a probe of the following composition: Joe-gtatccggct atgcgccgag tttgg-BHQ1 at a concentration of 0.1-1 mM,

Real-time polymerase chain reaction was carried out with annealing temperature of primers 60 ° С at 40 cycles. Program Example:

95 ° С - 5 minutes, 40 cycles (95 ° С - 18 sec, 60 ° С - 30 sec, 72 ° С - 30 sec). The progress of the reaction was monitored by means of a device for measuring the level of fluorescence during the reaction, for example, ANK32 amplifier (tests were also carried out at the laboratory base of the Institute for Analytical Instrumentation of the Russian Academy of Sciences).

During this experiment, according to the scheme described above, the reaction was put with DNA in concentrations: 0.1; 1 and 100 ng / μl according to the program 95 ° С - 5 minutes, 40 cycles (95 ° С - 18 sec, 60 ° С - 30 sec, 72 ° С - 30 sec).

The reaction results are presented in Fig. 7, which shows the fluorescence growth curves corresponding to samples with different DNA concentrations: 100 ng / μl, 1 ng / μl, 0.1 ng / μl (respectively, from left to right).

With the passage of the reaction, an increase in the level of fluorescence is observed. In the presented case, the level of fluorescence increases in all samples containing DNA. The threshold cycle values are 17, 22, and 25. The earliest start of growth relates to the most concentrated DNA, and at the latest to the most diluted.

Thus, we can conclude about the successful operation of the diagnostic system using DNA of the declared concentrations.

The technical and economic effectiveness of the claimed invention lies in the fact that the proposed new method for the diagnosis of biomaterials for the presence of agrobacteria is aimed at solving the problem of quick diagnosis of any biological material (scrapings, fragments of infected plants, tissue of transgenic plants), i.e. on effective and efficient detection of the presence of agrobacteria in the studied biomaterials. The claimed method according to the achieved technical result differs from analogues known in the art:

1. allows you to significantly reduce the time of diagnosis in terms of up to one working day;

2. It is highly sensitive and can detect even single agrobacteria in the sample;

3. significantly cheaper, since it does not require the use of culture media, as well as the separation of reaction products on a gel;

4. A higher-performance, cheaper and more reliable, new method allows one researcher to simultaneously analyze hundreds of test samples. The claimed technology is environmentally friendly and can be implemented for various needs of agriculture and crop production in the diagnosis of plant infection.

List of references

1. Semenkova I.G., Sokolova E.S. Plant pathology. - M., 2003.

2. RU patent for application No. 2004105688 A, 08/10/2005.

3. RU patent for application No. 2005136997 A, 10.06.2007.

4. Patent RU 2378382 C1 (prototype).

Claims (5)

1. A method for diagnosing biomaterials for the presence of agrobacteria in them, which consists in isolating DNA from the biomaterial and conducting a polymerase chain reaction on it in real time with probes labeled with fluorescent dyes and fluorescence quenchers, characterized in that after isolation from the DNA samples at a concentration of 0, 1-100 ng / μl based on it are two reaction mixtures, one of which contains atcatycgcattgtrccgggagg, cctgcgcctgacccaaacatctc primers and a FAM-cgttcggctc ggcatctcga tattccc-BHQ1 probe, and the second contains ctctcgcgtgggcggggcgcggggg atccggct atgcgccgag tttgg BHQ1, the primers in the composition of the reaction mixtures have a concentration of 0.2-2 mM, and the probes are 0.1-1 mM, the reaction mixtures contain a polymerase buffer, Mg 2+ cations in a concentration of 0.1-0.3 mM, nucleotides in a concentration of 2-10 μM, thermostable polymerase of 0.1-0.3 units. activity per microliter of the mixture, the polymerase chain reaction is carried out in real time with annealing temperature of primers 55-62 ° C at 30-45 cycles, while fluorescence is continuously monitored and its presence in one or both reaction mixtures is diagnosed by the presence of agrobacteria in the samples . 2. The method according to claim 1, characterized in that as a thermostable polymerase with an activity of 0.1-0.3 units. per microliter of the mixture take Taq. 3. The method according to claim 1, characterized in that as a thermostable polymerase with an activity of 0.1-0.3 units. per microliter of the mixture take Pfu. 4. The method according to claim 1, characterized in that as a thermostable polymerase with an activity of 0.1-0.3 units. per microliter of the mixture take Vent. 5. The method according to claim 1, characterized in that as a thermostable polymerase with an activity of 0.1-0.3 units. per microliter of the mixture take Tth.

Images