RU2453557C1 - Polyepitope protein composition for inducing immune response against foot-and-mouth disease virus - Google Patents
Polyepitope protein composition for inducing immune response against foot-and-mouth disease virus Download PDFInfo
- Publication number
- RU2453557C1 RU2453557C1 RU2010144885/10A RU2010144885A RU2453557C1 RU 2453557 C1 RU2453557 C1 RU 2453557C1 RU 2010144885/10 A RU2010144885/10 A RU 2010144885/10A RU 2010144885 A RU2010144885 A RU 2010144885A RU 2453557 C1 RU2453557 C1 RU 2453557C1
- Authority
- RU
- Russia
- Prior art keywords
- protein
- foot
- mouth disease
- polyepitope
- virus
- Prior art date
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
Область техники, к которой относится изобретениеFIELD OF THE INVENTION
Данное изобретение относится к области иммунологии, белковой инженерии и биотехнологии. Оно может быть использовано для создания полиэпитопных вакцинных белков для иммунизации животных против ящура.This invention relates to the field of immunology, protein engineering and biotechnology. It can be used to create polyepitope vaccine proteins for immunizing animals against foot and mouth disease.
АктуальностьRelevance
1) Инфекционный агент ящура1) FMD Infectious Agent
Вирус ящура является типовым представителем семейства Picornaviridae и рода Aphthovirus. Его геном представлен однонитевой линейной (+) РНК с двунитевыми участками общим размером около 8500 нуклеотидов. Геномная РНК кодирует протяженный белок - предшественник, который протеолитически процессируется на промежуточные и зрелые структурные и неструктурные белки. Вирус имеет икосаэдрический капсид, составленный из четырех структурных белков - VP1, VP2, VP3 и VP4. Вирионы нестабильны при рН ниже 6,5 и легко диссоциируют с образованием 12S пентамеров. Серологическими методами удается различить семь серотипов вируса: А, О, С, Азия-1, SAT (Территории Южной Африки) -1, -2 и -3. Также установлено более 60 подтипов вируса. На территории стран СНГ обычно встречаются вирусы серотипов О и А.The foot and mouth disease virus is a typical representative of the Picornaviridae family and the genus Aphthovirus. Its genome is represented by single-stranded linear (+) RNA with double-stranded regions with a total size of about 8500 nucleotides. Genomic RNA encodes an extended precursor protein that is proteolytically processed to intermediate and mature structural and non-structural proteins. The virus has an icosahedral capsid composed of four structural proteins - VP1, VP2, VP3 and VP4. Virions are unstable at pH below 6.5 and easily dissociate with the formation of 12S pentamers. Serological methods can distinguish seven serotypes of the virus: A, O, C, Asia-1, SAT (South Africa) -1, -2 and -3. Also established more than 60 subtypes of the virus. In the CIS countries, viruses of serotypes O and A are usually found.
2) Заболевание2) Disease
Вспышки заболевания происходят во всех странах мира, где в сельском хозяйстве используется парнокопытный скот. Основной причиной распространения ящура считается международная торговля домашними животными. Наиболее восприимчивы к заболеванию ящуром крупный рогатый скот, менее восприимчивы свиньи, овцы, козы, более 70 видов диких животных и человек. Вирус передается от заболевших животных к здоровым воздушно-капельным путем. Первые признаки заболевания могут появляться через 2-3 дня после заражения. У зараженных животных появляется жар, нарушение походки, хромота, афтозное поражение слизистой оболочки ротовой полости, кожи, вымени и межкопытной щели конечностей. Несмотря на то что заболевание ящуром не приводит к высокому уровню смертности среди взрослых животных, оно проявляется в потере веса, резком понижении молочной продуктивности. Смертельный исход чаще происходит у молодых животных с ослабленным иммунитетом. У них наблюдаются нарушения функций сердечно-сосудистой системы и скелетной мускулатуры. Крупный рогатый скот, а также овцы и козы могут быть бессимптомными носителями вируса, приобретая при этом способность заражать других животных в течение 2-3 лет.Outbreaks of the disease occur in all countries of the world where artiodactyl cattle are used in agriculture. The main reason for the spread of foot and mouth disease is considered to be international pet trade. Cattle are most susceptible to foot-and-mouth disease, pigs, sheep, goats, more than 70 species of wild animals and humans are less susceptible. The virus is transmitted from sick animals to healthy airborne droplets. The first signs of the disease may appear 2-3 days after infection. Infected animals develop fever, impaired gait, lameness, and aphthous damage to the mucous membrane of the oral cavity, skin, udder, and inter-experimental gap of the extremities. Despite the fact that foot-and-mouth disease does not lead to a high mortality rate among adult animals, it manifests itself in weight loss, a sharp decrease in milk productivity. Fatal outcomes often occur in young animals with weakened immunity. They have dysfunctions of the cardiovascular system and skeletal muscles. Cattle, as well as sheep and goats, can be asymptomatic carriers of the virus, while acquiring the ability to infect other animals for 2-3 years.
3) Экономический ущерб3) Economic damage
При эпизоотии вируса серотипа О на Тайване в 1997 г. возникло более 6 тыс. очагов, пало или было забито свыше 4 миллионов свиней, общий экономический ущерб составил около 10 миллиардов долларов США. Последняя вспышка ящура в Великобритании в 2001 году привела к потерям в размере около 6 миллиардов фунтов стерлингов. При возникновении очагов ящура А-22 в балканских странах в 1996 году экономический ущерб превысил 300 миллионов долларов. Ликвидация очага этого заболевания в Московской области в 1995 году обошлась примерно в 14,6 миллионов рублей в ценах того периода, а в Приморском крае в 2000 году - в 8,7 миллионов рублей.Epizootics of the O serotype virus in Taiwan in 1997 resulted in more than 6 thousand foci, more than 4 million pigs fell or slaughtered, and the total economic damage amounted to about 10 billion US dollars. The last outbreak of foot and mouth disease in the UK in 2001 led to losses of about 6 billion pounds. With the occurrence of foci of foot-and-mouth disease A-22 in the Balkan countries in 1996, the economic damage exceeded $ 300 million. The elimination of the focus of this disease in the Moscow region in 1995 cost about 14.6 million rubles in the prices of that period, and in the Primorsky Territory in 2000 - 8.7 million rubles.
Уровень техникиState of the art
1) Разработанные методы контроля заболевания1) Developed disease control methods
В конце 19-го и начале 20-го веков единственным способом контроля ящура был забой заболевших животных. В 30-х годах прошлого столетия в Германии была создана первая вакцина против вируса ящура. Такую вакцину получали путем инактивации «живого» вируса формалином в присутствии гидроксида алюминия. Вирус для нее получали, собирая ткани эпителия и жидкость из афт зараженных животных. Этот метод получения вакцины не мог предоставить достаточное количество материала для иммунизации, необходимое для контроля заболевания. Такое положение сохранялось до того момента, когда в середине прошлого века во Франции был разработан первый метод размножения вируса в клетках эпителия языка здоровых коров и был налажен первый коммерческий выпуск вакцины против вируса ящура. Современную вакцину производят из вируса, полученного в клеточной культуре, обработкой бинарным этиленимином. В конце 90-х годов мировое производство такой вакцины составляло около 1 миллиарда доз в год [1]. В РФ упреждающее вакцинирование препаратами инактивированного вируса является основой контроля ящура в поголовье восприимчивых сельскохозяйственных животных. Для упреждающего вакцинирования необходимо осуществлять постоянный мониторинг эпидемиологической ситуации внутри страны и прилегающих к границам странах. В случае возникновения очага заболевания вакцинированию подвергаются восприимчивые сельскохозяйственные животные в соседствующих областях.In the late 19th and early 20th centuries, the only way to control foot and mouth disease was to slaughter diseased animals. In the 30s of the last century, the first vaccine against foot and mouth disease virus was created in Germany. Such a vaccine was obtained by inactivating a living virus with formalin in the presence of aluminum hydroxide. The virus was obtained for her by collecting epithelial tissue and fluid from the aft of infected animals. This vaccine preparation method could not provide enough immunization material to control the disease. This situation continued until the moment when in France in the middle of the last century the first method of virus propagation in the epithelial cells of the tongue of healthy cows was developed and the first commercial release of a vaccine against FMD was launched. A modern vaccine is produced from a virus obtained in cell culture by treatment with binary ethyleneimine. In the late 90s, the global production of such a vaccine amounted to about 1 billion doses per year [1]. In the Russian Federation, proactive vaccination with inactivated virus preparations is the basis for the control of foot and mouth disease in the stock of susceptible farm animals. For proactive vaccination, it is necessary to constantly monitor the epidemiological situation within the country and countries adjacent to the borders. In the event of a foci of the disease, susceptible farm animals in neighboring areas are vaccinated.
В изобретении RU 2332233 (2008.08.27) описан способ изготовления вакцины против ящура, включающий культивирование вируса в суспензионной культуре клеток ВНК-21 при температуре 36-37°С, очистку вирусной суспензии от балластных примесей, инактивацию, концентрирование полученного антигена вируса и соединение концентрата антигена с адъювантом. Вакцина против ящура, полученная данным способом, может содержать антигенный материал вируса типа А, О или Азия-1 в эффективном количестве 146S компонента, гель гидроокиси алюминия, сапонин и поддерживающую среду. Несмотря на то что вакцинирование подобными препаратами инактивированного вируса ящура довольно эффективно, такая вакцина не производится во многих странах мира с развитым животноводством по следующим причинам:The invention RU 2332233 (2008.08.27) describes a method for manufacturing a vaccine against foot and mouth disease, comprising cultivating the virus in a suspension culture of BHK-21 cells at a temperature of 36-37 ° C, purifying the virus suspension from ballast impurities, inactivating, concentrating the obtained virus antigen and combining the concentrate antigen with adjuvant. The foot and mouth disease vaccine obtained by this method may contain type A, O or Asia-1 antigenic material in an effective amount of the 146S component, an aluminum hydroxide gel, saponin and a support medium. Despite the fact that vaccination with such preparations of inactivated FMD virus is quite effective, such a vaccine is not produced in many countries with developed livestock for the following reasons:
1. обеспокоенность возможностью заражения животных или людей вирусом в результате утечки инфекционного материала в процессе его производства или его неполной инактивации;1. concern about the possibility of infection of animals or people with the virus as a result of leakage of infectious material during its production or its incomplete inactivation;
2. сложность быстрой наработки вакцины в чрезвычайных ситуациях возникновения очага заболевания;2. the complexity of the rapid development of the vaccine in emergency situations of the outbreak;
3. для производства вакцины необходимы дорогостоящие специально оборудованные лаборатории, обеспечивающие высокую биобезопасность производства;3. For the production of vaccines, expensive, specially equipped laboratories are needed to ensure high bio-safety of the production;
4. вирусные препараты, используемые для производства вакцины, это надосадочная жидкость клеточной суспензии, инфицированной вирусом ящура. Такие препараты, в зависимости от качества производства, могут содержать различное количество вирусных неструктурных белков, загрязняющих вакцину. У привитых такой вакциной животных, наряду с антителами против структурных белков вируса ящура, вырабатываются антитела против загрязняющих неструктурных белков. Присутствие антител против неструктурных белков делает сложным достоверное различие вакцинированных животных от зараженных с помощью иммунологических методов диагностики заболевания;4. The viral preparations used to produce the vaccine are the supernatant of a cell suspension infected with foot and mouth disease virus. Such preparations, depending on the quality of production, may contain a different amount of viral non-structural proteins contaminating the vaccine. In animals vaccinated with such a vaccine, along with antibodies against structural proteins of the FMD virus, antibodies against contaminating non-structural proteins are produced. The presence of antibodies against non-structural proteins makes it difficult to reliably distinguish vaccinated animals from infected animals using immunological methods for diagnosing the disease;
5. вакцина нестабильна при высоких температурах, что осложняет ее транспортировку и хранение.5. The vaccine is unstable at high temperatures, which complicates its transportation and storage.
Таким образом, для разрешения вышеописанных проблем необходимо создание новых вакцин, которые не требуют наработки патогена, просты в получении и относительно недороги.Thus, to solve the above problems, it is necessary to create new vaccines that do not require the development of a pathogen, are easy to obtain, and relatively inexpensive.
2) Разрабатываемые методы контроля заболевания2) Developed disease control methods
В качестве вакцин могут быть использованы ослабленные варианты вируса, утратившие патогенность в результате мутаций исходных штаммов и не требующие инактивации. Главным преимуществом «живых» вакцин является то, что они активируют гуморальный и клеточный компоненты иммунной системы, вызывая сбалансированный иммунный ответ. Кроме того, такие вакцины относительно дешевы, так как для иммунизации требуется небольшая доза вируса, поскольку он способен размножаться в зараженном организме.As vaccines, weakened variants of the virus can be used that have lost pathogenicity as a result of mutations in the original strains and do not require inactivation. The main advantage of live vaccines is that they activate the humoral and cellular components of the immune system, causing a balanced immune response. In addition, such vaccines are relatively cheap, since a small dose of the virus is required for immunization, since it can multiply in the infected body.
Ослабленный вирус ящура, обладающий некоторой степенью иммуногенности, классическим методом получают его пассажами в нечувствительных к ящуру животных (мыши, кролики) [2, 3]. Однако получение вируса, ослабленного в невосприимчивом виде животных, одновременно обладающего иммуногенностью, низкой патогенностью и инфекционного для вакцинируемого вида животных, является сложной технической задачей. Существенным недостатком вакцин на основе ослабленного вируса также является его генетическая нестабильность, способная приводить к приобретению вирулентности. Для усовершенствования вакцин на основе «живого» вируса исследователи пытались изменить геном вируса. В этом случае принцип ослабления был основан на делегировании или модификации участков геномной РНК, влияющих на инфекционные характеристики вируса [4-6]. Однако существенных положительных результатов в этих работах получено не было.The weakened foot and mouth disease virus, which has a certain degree of immunogenicity, is obtained by the classical method in passages in animals that are insensitive to foot and mouth disease (mice, rabbits) [2, 3]. However, obtaining a virus attenuated in the immune form of animals, while having immunogenicity, low pathogenicity, and infectious for the vaccinated animal species, is a complex technical task. A significant drawback of vaccines based on attenuated virus is also its genetic instability, which can lead to the acquisition of virulence. To improve vaccines based on the "live" virus, the researchers tried to change the genome of the virus. In this case, the principle of attenuation was based on the delegation or modification of sections of genomic RNA that affect the infectious characteristics of the virus [4-6]. However, no significant positive results were obtained in these studies.
Одним из подходов к созданию противоящурных вакцин является получение «пустых капсидов» или вирусподобных частиц (ВПЧ). Неинфекционные ВПЦ ящура, лишенные геномной РНК, образуются в некотором количестве в культурах клеток животных инфицированных вирусом. Такие ВПЧ содержат полный набор антигенных участков вирусного капсида и иммунологически идентичны интактным вирионам. Для разработки технологии получения ВПЧ необходима совместная экспрессия генов предшественников капсидных белков и вирусной процессирующей протеазы 3С. ВПЧ ящура удается получить с помощью рекомбинантного бакуловируса, экспрессирующего необходимые белковые компоненты в клетках шелкопряда [7]. Препараты таких ВПЧ способны индуцировать протективный иммунитет у свиней, однако стоимость таких препаратов довольно высока.One approach to creating FMD vaccines is to produce “empty capsid” or virus-like particles (HPV). Non-infectious HCV foot and mouth disease, lacking genomic RNA, are formed in some quantities in animal cell cultures infected with the virus. Such HPVs contain a complete set of antigenic sites of the viral capsid and are immunologically identical to intact virions. To develop a technology for producing HPV, the joint expression of the genes of the precursors of capsid proteins and the viral processing protease 3C is necessary. HPV foot and mouth disease can be obtained using a recombinant baculovirus expressing the necessary protein components in silkworm cells [7]. Preparations of such HPV are able to induce protective immunity in pigs, however, the cost of such drugs is quite high.
Заявка WO 2006063445 (2006.06.22) описывает создание рекомбинантной противоящурной вакцины, основанной на экспрессии в клетках животных модифицированного гена предшественника структурных белков вируса ящура, кодирующие последовательности которых разделены искусственно путем введения сайтов протеолиза для клеточной протеазы невирусного происхождения, обеспечивающей процессинг предшественника капсидных белков для сборки ВПЧ. Недостатком такого подхода является относительно низкий выход иммуногенных ВПЧ и высокая стоимость препарата.Application WO2006063445 (2006.06.22) describes the creation of a recombinant FMD vaccine based on the expression in animal cells of a modified gene for the precursor of structural proteins of foot-and-mouth disease virus, the coding sequences of which are artificially separated by introducing proteolysis sites for non-viral origin of a cell protease that processes the capsid protein precursor for assembly HPV The disadvantage of this approach is the relatively low yield of immunogenic HPV and the high cost of the drug.
Другим направлением исследования возможностей получения безопасных альтернативных вакцин против вируса ящура является использование индивидуальных вирусных белков или пептидов. Такие вакцины называют субъединичными. Поскольку иммунодоминантный эпитоп вирусной частицы расположен в G-H петле капсидного белка VP1 [8], субъединичные вакцины против вируса ящура обычно представляют собой препараты этого белка или его фрагментов [9-13]. Недостатком существующих разрабатываемых субъединичных вакцин является невысокая эффективность иммунизации для защиты животных против заражения. Для индукции протективного иммунного ответа препаратами капсидного белка VP1 у свиней, инокулированных 105-кратной дозой вируса ящура, вызывающей заражение 50% клеток культуры ткани (TCID50), требовались три иммунизации (одна затравочная и две усиливающие) по 3 и 2 мг белка соответственно [14], которые производились в течение двух с половиной месяцев.Another area of research into the possibilities of producing safe alternative vaccines against foot and mouth disease is the use of individual viral proteins or peptides. Such vaccines are called subunit. Since the immunodominant epitope of a virus particle is located in the GH loop of the VP1 capsid protein [8], subunit vaccines against FMD virus are usually preparations of this protein or its fragments [9-13]. A disadvantage of the existing subunit vaccines being developed is the low efficiency of immunization to protect animals against infection. To induce a protective immune response with VP1 capsid protein preparations in pigs inoculated with a 10 5- fold dose of foot-and-mouth disease virus infecting 50% of tissue culture cells (TCID 50 ), three immunizations (one seed and two reinforcing ones) of 3 and 2 mg of protein were required, respectively [14], which were produced over two and a half months.
VP1 и его антигенные пептиды были получены в бактериальной, дрожжевой и растительной системах экспрессии белка, а также в культурах тканей животных. Некоторые работы посвящены созданию синтетических вакцин, использующих различным образом конъюгированные пептиды VP1 [15], либо получению живых рекомбинантных вакцин с использованием векторов на основе вируса осповакцины [16, 17] либо аденовируса [18, 19]. Такие вакцины способны индуцировать нейтрализующие антитела у лабораторных животных, однако протективность таких препаратов для сельскохозяйственных животных, как правило, невелика.VP1 and its antigenic peptides were obtained in bacterial, yeast and plant protein expression systems, as well as in animal tissue cultures. Some works are devoted to the creation of synthetic vaccines using conjugated VP1 peptides in various ways [15], or to the preparation of live recombinant vaccines using vaccinia virus [16, 17] or adenovirus vectors [18, 19]. Such vaccines are able to induce neutralizing antibodies in laboratory animals, but the efficacy of such preparations for farm animals is usually low.
Механизмы протективного иммунитета против вируса ящура недостаточно изучены. Ряд данных указывает на то, что в защите от инфекции помимо гуморального иммунитета важную роль играет Т-клеточный иммунитет. В недавней работе методами компьютерного анализа было предсказано потенциальное участие N-концевой последовательности неструктурного белка вируса ящура 2С в его распознавании клетками иммунной системы [20]. Хотя такой пептид не обладает протективным действием, включение его в состав белка для иммунизации может быть целесообразным. В другой работе [21] иммуногенные Т-клеточные эпитопы были идентифицированы в составе белка, выполняющего функцию РНК-зависимой РНК полимеразы 3D. Было показано, что рекомбинантный вирус осповакцины, экспрессирующий ген 3D, способен обеспечивать частичную защиту свиней от инфекции вирусом ящура при отсутствии гуморального ответа. Было проведено картирование Т-клеточных эпитопов в составе белка 3D с использованием набора пептидов по их способности к индукции специфических пролиферативных ответов и синтезу гамма-интерферона. Идентифицированные белковые последовательности могут быть перспективны для включения в состав синтетических вакцин против вируса ящура.The mechanisms of protective immunity against FMD virus are not well understood. A number of data indicate that in addition to humoral immunity, T-cell immunity plays an important role in protecting against infection. In a recent work, computer analysis methods predicted the potential involvement of the N-terminal sequence of the non-structural protein of
В изобретении RU 2202613 (1996.09.18) описаны иммуногенные пептиды вируса ящура с последовательностями, включающими не менее восьми аминокислот, соответствующих фрагментам неструктурных белков, которые были отобраны благодаря иммунореактивности со специфичными к вирусу ящура антителам или благодаря иммунореактивности со специфичными к вирусу Т-лимфоцитами. Основными недостатками этого подхода является относительно высокая стоимость вакцинного препарата и ограниченность набора эпитопов, предоставляемых иммунизируемому животному, размером аминокислотной цепи иммуногенного пептида.The invention RU 2202613 (1996.09.18) describes the immunogenic peptides of foot and mouth disease virus with sequences comprising at least eight amino acids corresponding to fragments of non-structural proteins that were selected due to immunoreactivity with virus-specific antibodies or due to immunoreactivity with virus-specific T lymphocytes. The main disadvantages of this approach are the relatively high cost of the vaccine preparation and the limited number of epitopes provided to the immunized animal by the size of the amino acid chain of the immunogenic peptide.
В заявке CN 1270839 (2000.10.25) предлагается вакцина против ящура, основанная на плазмидной конструкции химерного антитела, несущего эпитоп белка VP1, встроенного в вариабельную область тяжелой и легкой цепи иммуноглобулинов свиньи. Такой плазмидой трансфецируют клетки млекопитающих и получают линии, продуцирующие химерные антитела с высоким выходом. Недостатком этого подхода является относительно высокая стоимость конечного продукта и присутствие в вакцинном белке потенциальных невирусспецифических эпитопов антитела.CN 1270839 (2000.10.25) proposes a foot and mouth disease vaccine based on the plasmid construction of a chimeric antibody carrying the VP1 protein epitope integrated into the variable region of the heavy and light chain of pig immunoglobulins. Mammalian cells are transfected with such a plasmid and lines producing chimeric antibodies with high yield are obtained. The disadvantage of this approach is the relatively high cost of the final product and the presence in the vaccine protein of potential non-virus-specific epitopes of the antibody.
Сущность изобретенияSUMMARY OF THE INVENTION
Настоящее изобретение обеспечивает высокоэффективную рекомбинантную кандидатную вакцину против ящура. В основе изобретения лежит принцип увеличения эффективности индукции и сбалансированности иммунитета при использовании субъединичной вакцины иммуногенным белком, образованным набором наиболее действенных эпитопов вируса ящура в составе одной полипептидной цепи. Вакцинация такими полиэпитопными белками, содержащими комбинацию хорошо изученных В- и Т-клеточных эпитопов вируса, приводит к улучшению иммунного ответа у животного и способствует более эффективной защите.The present invention provides a highly effective recombinant candidate vaccine against foot and mouth disease. The invention is based on the principle of increasing the efficiency of induction and balancing immunity when using a subunit vaccine with an immunogenic protein formed by a set of the most effective epitopes of foot and mouth disease virus in one polypeptide chain. Vaccination with such polyepitope proteins containing a combination of well-studied B- and T-cell epitopes of the virus leads to an improvement in the immune response in the animal and contributes to more effective protection.
Изобретение включает в себя:The invention includes:
а) дизайн конструкций для экспрессии рекомбинантного полиэпитопного белка вируса ящура,a) design designs for the expression of recombinant polyepitope protein of the virus of foot and mouth disease,
б) синтез гена, кодирующего рекомбинантный полиэпитопный белок Н-РЕ, включающего эпитопы структурных белков VP4 и VP1 и неструктурных 2С и 3D, разделенных глицинбогатыми линкерами, а также шести аминокислотных остатков гистидина (6×His), позволяющих аффинную очистку белка, на N-конце,b) synthesis of a gene encoding a recombinant polyepitope protein H-PE, including epitopes of structural proteins VP4 and VP1 and non-structural 2C and 3D, separated by glycine rich linkers, as well as six amino acid residues of histidine (6 × His), allowing affinity purification of the protein, on N- the end
в) создание штамма Е.coli - продуцента рекомбинантного полиэпитопного белка Н-РЕ,C) the creation of a strain of E. coli - producer of recombinant polyepitope protein N-PE,
г) разработку протокола выделения и очистки рекомбинантного полиэпитопного белка Н-РЕ из бактерий и растений,g) development of a protocol for the isolation and purification of recombinant polyepitope protein H-PE from bacteria and plants,
д) результаты испытаний полученных препаратов на лабораторных животных, свидетельствующие о высокой иммуногенности рекомбинантного полиэпитопного белка Н-РЕ, обуславливающей защиту животных от ящура.e) the test results of the preparations obtained in laboratory animals, indicating the high immunogenicity of the recombinant polyepitope protein H-PE, which determines the protection of animals from foot and mouth disease.
Таким образом, первым аспектом настоящего изобретения является дизайн полиэпитопных белков для иммунизации животных против вируса ящура различных серотипов и подтипов. Рекомбинантный полиэпитопный белок состоит из фрагментов структурных белков VP4 и VP1 и неструктурных 2С и 3D, разделенных гибкими глицинбогатыми линкерами. Общая формула таких белков VP4(X1-X2)-GRL-VP1(X3-X4)-GRL-VP1(X5-X6)-GRL-2C(X7-X8)-GRL-3D(X9-X10)-GRL-3D(X11-X12) представлена на Фиг.1, где GRL обозначает глицинбогатый линкер, состоящий из последовательности четырех аминокислотных остатков глицина и двух серина или последовательности четырех аминокислотных остатков глицина, двух серина, глутаминовой кислоты и фенилаланина, следующих один за другим, a Xn-Xm - целые числа, отражающие номера аминокислотных остатков соответствующего белка вируса ящура (VP4, VP1, 2С, 3D) начиная со стартового метионина в последовательности белка-предшественника, закодированного в геноме вируса ящура данного серотипа. Аминокислотный состав индивидуальных фрагментов и числа X1-X12 индивидуальны и определяются исходя из множественного выравнивания известных белковых последовательностей вируса ящура и белковой последовательности вируса ящура, для которого создается субъединичная вакцина на основе полиэпитопного белка по принципу, описанному в данном изобретении (Фиг.2). Например, для дизайна полиэпитопного вакцинного белка против вируса ящура подтипа О/Тайвань/99 (аминокислотная последовательность Генбанка CAD62369) числа Х1-Х2, Х3-Х4, Х5-Х6, Х7-Х8, Х9-Х10 и Х11-Х12 равны 222-241, 859-883, 924-937, 1175-1183, 1863-1977 и 2283-2322 соответственно. Для возможности аффинной очистки рекомбинантного полиэпитопного белка на N- или С-конец последовательности могут быть добавлены аминокислотные последовательности из шести остатков гистидина, хитинсвязывающий домен и т.д.Thus, a first aspect of the present invention is the design of polyepitope proteins for immunizing animals against foot and mouth disease virus of various serotypes and subtypes. The recombinant polyepitope protein consists of fragments of structural proteins VP4 and VP1 and non-structural 2C and 3D, separated by flexible glycine-rich linkers. The general formula of such proteins is VP4 (X1-X2) -GRL-VP1 (X3-X4) -GRL-VP1 (X5-X6) -GRL-2C (X7-X8) -GRL-3D (X9-X10) -GRL-3D (X11-X12) is shown in FIG. 1, where GRL is a glycine rich linker consisting of a sequence of four amino acid residues of glycine and two serine or a sequence of four amino acid residues of glycine, two serine, glutamic acid and phenylalanine, one after the other, and Xn- Xm are integers reflecting the amino acid residue numbers of the corresponding FMD virus protein (VP4, VP1, 2C, 3D) starting from the starting methionine in the preceding protein sequence ennika encoded in the genome of FMDV serotype. The amino acid composition of the individual fragments and the numbers X1-X12 are individual and are determined based on the multiple alignment of the known protein sequences of foot and mouth disease virus and the protein sequence of foot and mouth disease virus, for which a subunit vaccine is created based on the polyepitope protein according to the principle described in this invention (Figure 2). For example, for the design of a polyepitope vaccine protein against foot and mouth disease virus subtype O / Taiwan / 99 (genebank amino acid sequence CAD62369), the numbers X1-X2, X3-X4, X5-X6, X7-X8, X9-X10 and X11-X12 are 222-241 , 859-883, 924-937, 1175-1183, 1863-1977 and 2283-2322, respectively. To allow affinity purification of the recombinant polyepitope protein, amino acid sequences of six histidine residues, a chitin binding domain, etc., can be added to the N- or C-terminus of the sequence.
Вторым аспектом настоящего изобретения является рекомбинантная ДНК с нуклеотидной последовательностью гена Н-РЕ (Фиг.3), которая кодирует рекомбинантный полиэпитопный вакцинный белок для вируса ящура серотипа О/Тайвань/99, имеющий формулу 6H-VP4(222-241)-4G2S-VP1(859-883)-4G2S-VP1(924-937)-4G2SEF-2C(1175-1183)-4G2S-3D(1863-1977)-4G2S-3D(2283-2322), где 6Н - последовательность шести аминокислотных остатков гистидина, a 4G2S и 4G2SEF - глицинбогатые линкеры, состоящие из последовательности четырех аминокислотных остатков глицина и двух серина или последовательности четырех аминокислотных остатков глицина, двух серина, глутаминовой кислоты и фенилаланина, следующих один за другим соответственно.The second aspect of the present invention is recombinant DNA with the nucleotide sequence of the H-PE gene (Figure 3), which encodes a recombinant polyepitope vaccine protein for foot and mouth disease virus serotype O / Taiwan / 99, having the formula 6H-VP4 (222-241) -4G2S-VP1 (859-883) -4G2S-VP1 (924-937) -4G2SEF-2C (1175-1183) -4G2S-3D (1863-1977) -4G2S-3D (2283-2322), where 6Н is the sequence of six amino acid residues of histidine , and 4G2S and 4G2SEF are glycine rich linkers consisting of a sequence of four amino acid residues of glycine and two serine or a sequence of four amino acid residues weights of glycine, two serine, glutamic acid and phenylalanine, one after another, respectively.
Третьим аспектом настоящего изобретения является рекомбинантная плазмида рЕТ-23а(+)-НРЕ, обеспечивающая синтез гибридного полиэпитопного вакцинного белка для вируса ящура серотипа О/Тайвань/99 в клетках бактерий Е.coli, состоящая из модифицированной в области полилинкера плазмиды рЕТ-23а(+) вставкой рекомбинантной ДНК гена Н-РЕ (Фиг.4).A third aspect of the present invention is a recombinant plasmid pET-23a (+) - HPE, which provides the synthesis of a hybrid polyepitope vaccine protein for foot and mouth disease virus serotype O / Taiwan / 99 in E. coli bacteria cells, consisting of the plasmid pET-23a modified in the polylinker region (+ ) insertion of recombinant DNA of the H-PE gene (Figure 4).
Четвертым аспектом настоящего изобретения является рекомбинантная плазмида pA7248-AMV-H-PE, обеспечивающая синтез гибридного полиэпитопного вакцинного белка для вируса ящура серотипа О/Тайвань/99 в растениях Nicotiana benthamiana, состоящая из модифицированной в области полилинкера плазмиды рА7248-AMV [22] вставкой рекомбинантной ДНК с последовательностью гена Н-РЕ (Фиг.5).A fourth aspect of the present invention is a recombinant plasmid pA7248-AMV-H-PE, which provides synthesis of a hybrid polyepitope vaccine protein for FMD virus serotype O / Taiwan / 99 in Nicotiana benthamiana plants, consisting of a plasmid modified in the polylinker region of pA7248-AMV [22] recombinant DNA with the sequence of the H-PE gene (Figure 5).
Пятым аспектом настоящего изобретения является рекомбинантный штамм бактерий E.coli, продуцента гибридного полиэпитопного вакцинного белка Н-РЕ против вируса ящура серотипа О/Тайвань/99.A fifth aspect of the present invention is a recombinant bacterial strain of E. coli, a producer of the hybrid polyepitope vaccine protein H-PE against foot and mouth disease virus serotype O / Taiwan / 99.
Шестым аспектом настоящего изобретения является состав раствора сольвента для вакцины против вируса ящура на основе полиэпитопного белка для иммунизации по принципу, описанному в данном изобретении. В качестве сольвента используется водный раствор, содержащий 10 мМ трис(гидроксиметил)аминометан - соляная кислота (Трис-HCl) рН 8,0 и 4 М мочевину.A sixth aspect of the present invention is the composition of a solvent solution for a vaccine against FMD virus based on a polyepitope protein for immunization according to the principle described in this invention. The solvent used is an aqueous solution containing 10 mM Tris (hydroxymethyl) aminomethane - hydrochloric acid (Tris-HCl) pH 8.0 and 4 M urea.
Седьмой аспект настоящего изобретения представлен результатами испытаний полученных препаратов полиэпитопных белков на лабораторных животных. При этом было показано, что (1) иммунизация морских свинок приводит к индукции иммунного ответа против вируса ящура серотипа О/Тайвань/99 и (2) иммунизация морских свинок препаратами полиэпитопных белков обеспечивает их защиту от заражения вирусом. Таким образом, полиэпитопные белки могут быть использованы в качестве основы вакцины против вируса ящура.A seventh aspect of the present invention is presented by the test results of the obtained preparations of polyepitope proteins in laboratory animals. It was shown that (1) immunization of guinea pigs leads to the induction of an immune response against foot and mouth disease virus serotype O / Taiwan / 99 and (2) immunization of guinea pigs with polyepitope protein preparations ensures their protection against virus infection. Thus, polyepitope proteins can be used as the basis for a foot and mouth disease vaccine.
Краткое описание фигурBrief Description of the Figures
Фиг.1 - Формула рекомбинантного полиэпитопного белка для индукции иммунного ответа против вируса ящура. GRL обозначает глицинбогатый линкер, состоящий из последовательности четырех аминокислотных остатков глицина и двух серина или последовательности четырех аминокислотных остатков глицина, двух серина, глутаминовой кислоты и фенилаланина, следующих один за другим, a Xn-Xm - целые числа, отражающие номера аминокислотных остатков соответствующего белка вируса ящура (VP4, VP1, 2С, 3D) начиная со стартового метионина в последовательности белка-предшественника, закодированного в геноме вируса ящура данного серотипа.Figure 1 - Formula of a recombinant polyepitope protein for the induction of an immune response against foot and mouth disease virus. GRL is a glycine rich linker consisting of a sequence of four amino acid residues of glycine and two serine or a sequence of four amino acid residues of glycine, two serine, glutamic acid and phenylalanine, one after the other, and Xn-Xm are integers representing the numbers of amino acid residues of the corresponding virus protein foot and mouth disease (VP4, VP1, 2C, 3D) starting from starting methionine in the sequence of the precursor protein encoded in the genome of the foot and mouth disease virus of this serotype.
Фиг.2 - Множественные выравнивания аминокислотных последовательностей белков-предшественников вируса ящура серотипов А, О, С, Asia1, SAT1, SAT2, SAT3 (FMDV_A, FMDV_O, FMDV_C, FMDV_Asia1, FMDV_SAT1, FMDV_SAT2 и FMDV_SAT3 соответственно) и эпитопов вируса ящура О/Тайвань/99 (HPE_VP4, HPE_VP1_1, HPE_VP1_2, HPE_2C, HPE_3D_1 и HPE_3D_2), составляющих рекомбинантный вакцинный белок по формуле VP4(X1-X2)-GRL-VP1(X3-X4)-GRL-VP1(X5-X6)-GRL-2C(X7-X8)-GRL-3D(X9-X10)-GRL-3D(X11-X12) и принципу, описанному в данном изобретении. Для дизайна полиэпитопного вакцинного белка против вируса ящура О/Тайвань/99 числа Х1-Х2, Х3-Х4, Х5-Х6, Х7-Х8, Х9-Х10 и Х11-Х12 равны 222-241 (А), 859-883 (Б), 924-937 (В), 1175-1183 (Г), 1863-1977 (Д) и 2283-2322 (Е) соответственно. Для иллюстрации множественного выравнивания последовательностей белков-предшественников вируса ящура О/Тайвань/99 и серотипов А, О, С, Asia1, SAT1, SAT2, SAT3 были использованы аминокислотные последовательности генбанка CAD62369 и Р03306, ААТ01748, Р03305, АСР44144, ААТ01786, ААТ01791 и ААТ01796 соответственно.Figure 2 - Multiple alignment of the amino acid sequences of the FMD virus precursor proteins of serotypes A, O, C, Asia1, SAT1, SAT2, SAT3 (FMDV_A, FMDV_O, FMDV_C, FMDV_Asia1, FMDV_SAT1, FMDV_SAT2, and FMDV_Sitopiv Taypov and Epivirus Tivitis) respectively / 99 (HPE_VP4, HPE_VP1_1, HPE_VP1_2, HPE_2C, HPE_3D_1 and HPE_3D_2), which comprise the recombinant vaccine protein according to the formula VP4 (X1-X2) -GRL-VP1 (X3-X4) -GRL-VP1 (X5-X6-GRL-VP1 (X5-X6-GR6-VP1 (X5-X6) (X7-X8) -GRL-3D (X9-X10) -GRL-3D (X11-X12) and the principle described in this invention. For the design of a polyepitope vaccine protein against FMD virus O / Taiwan / 99, the numbers X1-X2, X3-X4, X5-X6, X7-X8, X9-X10 and X11-X12 are 222-241 (A), 859-883 (B ), 924-937 (B), 1175-1183 (D), 1863-1977 (D) and 2283-2322 (E), respectively. To illustrate the multiple alignment of the sequences of the FMD virus precursor proteins O / Taiwan / 99 and serotypes A, O, C, Asia1, SAT1, SAT2, SAT3, the amino acid sequences of the CAD62369 and P03306, AAT01748, P03305, ACP44144, AAT01786, AAT01796 and AAT01796 were used respectively.
Фиг.3 - Нуклеотидная и аминокислотная последовательности рекомбинантного белка Н-РЕ.Figure 3 - Nucleotide and amino acid sequence of the recombinant protein N-PE.
Фиг.4 - Структура рекомбинантной вектора экспрессии рЕТ-23а(+)-Н-РЕ.Figure 4 - Structure of the recombinant expression vector pET-23a (+) - H-PE.
Фиг.5 - Структура рекомбинантной плазмиды pA7248-AMV-H-PE.Figure 5 - Structure of the recombinant plasmid pA7248-AMV-H-PE.
Фиг.6 - Экспрессия, выделение и очистка Н-РЕ белка, полученного в Е.coli. 1 - Маркер молекулярного веса; 2 - Суммарный белок клеток культуры, не трансформированной экспрессионной плазмидой; 3 - Суммарный белок клеток культуры, трансформированной плазмидой рЕТ-23а(+)-Н-РЕ.6 - Expression, isolation and purification of H-PE protein obtained in E. coli. 1 - molecular weight marker; 2 - The total protein of the cells of the culture, not transformed expression plasmid; 3 - Total protein of culture cells transformed with plasmid pET-23a (+) - H-PE.
Фиг.7 - Экспрессия белка Н-РЕ в растениях N.benthamiana. 1 - Маркер молекулярного веса; 2 - суммарный белок клеток культуры Е.coli, трансформированной плазмидой рЕТ-23а(+)-Н-РЕ, на геле примерно 0,5 мкг белка Н-РЕ; 3 - образец ткани листа из зоны, агроинокулированной смесью культур клеток, трансформированных pA7248-AMV-GUS и HCPro; 4 - образец ткани листа из зоны, агроинокулированной смесью культур клеток, трансформированных pA7248-AMV-H-PE и HCPro; 5 - препарат очищенного белка Н-РЕ, выделенный из растений.Figure 7 - Expression of the H-RE protein in N. benthamiana plants. 1 - molecular weight marker; 2 - total protein of cells of the E. coli culture transformed with plasmid pET-23a (+) - H-PE, on a gel about 0.5 μg of H-PE protein; 3 is a sample of leaf tissue from an area agroinoculated with a mixture of cell cultures transformed with pA7248-AMV-GUS and HCPro; 4 is a sample of leaf tissue from a zone agroinoculated with a mixture of cell cultures transformed with pA7248-AMV-H-PE and HCPro; 5 - preparation of purified protein N-PE isolated from plants.
Осуществление изобретенияThe implementation of the invention
Пример 1. Рекомбинантная белковая молекула Н-РЕ и кодирующая ее рекомбинантная нуклеиновая кислота.Example 1. Recombinant protein molecule H-PE and the recombinant nucleic acid encoding it.
Для создания нуклеотидной последовательности ДНК рекомбинатного гена, кодирующего белок, состоящий из эпитопов вируса ящура, были использованы аминокислотные последовательности известных В-клеточных эпитопов структурных белков и Т-клеточных эпитопов неструктурных белков вируса ящура серотипа О/Тайвань/99, перечисленные далее. В-клеточные эпитопы: VP4 (222-241) [23], VP1 (859-883) [24] и (924-937) [25]; и Т-клеточные эпитопы: 2С (1175-1183) [26], 3D (1863-1977) и (2283-2322) [27]. Во избежание потенциальных проблем сворачивания белка эпитопы были разделены «гибкими» глицинбогатыми линкерами G4S2. Для того чтобы повысить эффективность экспрессии рекомбинантного белка, кодоновый состав кодирующей последовательности ДНК был оптимизирован для экспрессии в растениях рода Nicotiana. Для клонирования гена в экспрессионные вектора на 5'-конец этой ДНК были добавлены последовательности сайтов рестрикции AscI и NdeI, а на 3'-конец - последовательности сайтов XhoI и XmaI. Между последовательностями, кодирующими В-клеточные и Т-клеточные эпитопы, была добавлена последовательность сайта EcoRI. ДНК гена была синтезирована компанией Евроген (Россия).To create the nucleotide DNA sequence of the recombinant gene encoding a protein consisting of FMD virus epitopes, the amino acid sequences of known B-cell epitopes of structural proteins and T-cell epitopes of non-structural FMD virus proteins of serotype O / Taiwan / 99, listed below, were used. B-cell epitopes: VP4 (222-241) [23], VP1 (859-883) [24] and (924-937) [25]; and T-cell epitopes: 2C (1175-1183) [26], 3D (1863-1977) and (2283-2322) [27]. In order to avoid potential problems of protein folding, epitopes were separated by “flexible” glycine-rich G4S2 linkers. In order to increase the efficiency of expression of the recombinant protein, the codon composition of the DNA coding sequence has been optimized for expression in plants of the genus Nicotiana. For gene cloning, expression sequences at the 5'end of this DNA were added with the sequences of the AscI and NdeI restriction sites, and at the 3'end with the sequences of the XhoI and XmaI sites. An EcoRI site sequence was added between sequences encoding B-cell and T-cell epitopes. Gene DNA was synthesized by the company Evrogen (Russia).
При помощи метода ПЦР и праймеров m13f (CGCCAGGGTTTTCCCAGTCACGAC), M13R (CAGGAAACAGCTATGAC), pHisPE (ACCTTGGGCGCGCCCATATGCATCATCACCATCACCATATAATCAATAACTATTATATG) на N-конец такой химерной последовательности была добавлена аминокислотная последовательность шести аминокислотных остатков гистидина для возможности выделения белка. ПЦР проводили при следующих условиях: (1) 98°С - 10 сек, (2) 56°С - 30 сек, (3) 72°С - 30 сек, шаги 1-3 повторяли 30 раз.Using the PCR method and primers m13f (CGCCAGGGTTTTCCCAGTCACGAC), M13R (CAGGAAACAGCTATGAC), pHisPE (ACCTTGGGCGCGCCCATATGCATCATCACCATCACCATCATATAATCAATAACTATTATATG) of the amino acid sequence of six amino acid residues was added. PCR was performed under the following conditions: (1) 98 ° C for 10 sec, (2) 56 ° C for 30 sec, (3) 72 ° C for 30 sec, steps 1-3 were repeated 30 times.
Полученный ПЦР продукт использовали для получения фрагмента, содержащего рекомбинантную нуклеиновую кислоту, кодирующую белок Н-РЕ. Для этого его обрабатывали рестриктазами NdeI и XhoI, выделяли фрагмент размером 0,77 т.п.н., представляющий собой искомую рекомбинантную нуклеиновую кислоту.The obtained PCR product was used to obtain a fragment containing a recombinant nucleic acid encoding an H-PE protein. For this, it was treated with restriction enzymes NdeI and XhoI, a fragment of 0.77 kb was isolated, which was the desired recombinant nucleic acid.
Пример 2. Создание рекомбинантного вектора экспрессии и штамма Е.coli - продуцента рекомбинантного белка Н-РЕ.Example 2. The creation of a recombinant expression vector and strain E. coli - producer of the recombinant protein H-PE.
Для создания рекомбинантного вектора экспрессии рекомбинантную нуклеиновую кислоту, представляющую собой фрагмент ДНК размером 0,77 т.п.н., вырезанный из ПЦР продукта с помощью рестриктаз NdeI и XhoI, клонировали в экспрессионном векторе рЕТ-23а(+) по сайтам рестрикции NdeI и XhoI. Полученный рекомбинантный вектор экспрессии был обозначен как рЕТ-23а(+)-Н-РЕ. В этом векторе рекомбинантная нуклеиновая кислота, кодирующая Н-РЕ, находится под контролем Т7 промотора, что обеспечивает ее экспрессию в клетке бактерии Escherichia coli методом самоиндукции. В результате рестрикционного анализа полученных клонов была обнаружена искомая плазмида, содержащая вставку нужного размера. Правильность нуклеотидной последовательности вставки плазмиды была подтверждена секвенированием.To create a recombinant expression vector, a recombinant nucleic acid representing a 0.77 kbp DNA fragment cut from the PCR product using NdeI and XhoI restriction enzymes was cloned into the pET-23a (+) expression vector at the NdeI restriction sites and XhoI. The resulting recombinant expression vector was designated as pET-23a (+) - H-PE. In this vector, the recombinant nucleic acid encoding the H-PE is under the control of the T7 promoter, which ensures its expression in the bacterium Escherichia coli by self-induction. As a result of restriction analysis of the obtained clones, the desired plasmid was found containing the insert of the desired size. The correct nucleotide sequence of the plasmid insert was confirmed by sequencing.
Полученная плазмида (рЕТ-23а(+)-Н-РЕ) была использована для трансформации штамма E.coli Rosetta2 с плазмидой pRARE2, позволяющей эффективную трансляцию редких кодонов. Экспрессия белка Н-РЕ была произведена методом самоиндукции [28]. Трансформировали клетки Rosetta2 и сеяли на LB агар с 1% глюкозой и инкубировали в течение 12 часов при 37°С. Одиночные колонии переносили в среду ZYP-0.8G, культуры растили 7 часов при температуре 37°С при постоянном перемешивании. Культуру клеток пересевали в среду ZYP-5052 и растили при температуре 37°С в течение 12-48 часов. Определение уровня экспрессии рекомбинантного белка Н-РЕ проводили путем анализа суммарных белковых препаратов, выделенных из бактериальных культур с помощью SDS-PAGE. Максимальный уровень продукции рекомбинантного белка Н-РЕ составлял около 80% общего клеточного белка (Фиг.6).The resulting plasmid (pET-23a (+) - H-PE) was used to transform E. coli Rosetta2 strain with plasmid pRARE2, which allows efficient translation of rare codons. The expression of H-RE protein was performed by self-induction [28]. Rosetta2 cells were transformed and plated on LB agar with 1% glucose and incubated for 12 hours at 37 ° C. Single colonies were transferred to ZYP-0.8G medium, cultures were grown for 7 hours at 37 ° C with constant stirring. The cell culture was reseeded in ZYP-5052 medium and grown at a temperature of 37 ° C for 12-48 hours. The expression level of the recombinant H-PE protein was determined by analyzing the total protein preparations isolated from bacterial cultures using SDS-PAGE. The maximum level of production of the recombinant protein N-PE was about 80% of the total cellular protein (Figure 6).
Пример 3. Выделение и очистка рекомбинантного белка Н-РЕExample 3. Isolation and purification of recombinant protein N-PE
Бактериальный белок с шестью аминокислотными остатками выделяли в денатурирующих условиях с помощью аффинной хроматографии на Ni-NTA сефарозе (Promega) в колонке (QIAGEN, Германия) по модифицированным методикам 10 и 17 из руководства The QIAexpressionist™ компании QIAGEN (Германия). Для этого экспрессирующую клеточную культуру центрифугировали при 13000 об/мин 5 минут и осадок ресуспендировали в буфере А рН 8.0, содержащего 100 мМ NaH2PO4, 10 мМ Tris·Cl, 6 М GuHCl из расчета 1 мл буфера на 80 мг осадка, перемешивали на вращающейся мешалке в течение 30 мин. Клеточный лизат центрифугировали при 14000 об/мин 15 мин и отбирали супернатант. Супернатант инкубировали с уравновешенной в буфере А суспензией Ni-NTA сефарозы в течение 30 мин при постоянном перемешивании. Переносили смесь лизата и сорбента в колонку. Промывали сорбент буфером А, двукратно буфером В рН 8.0, содержащим 100 мМ NaH2PO4, 10 мМ Tris·Cl, 8 М мочевина, двукратно буфером С рН 6.3, содержащим 100 мМ NaH2PO4, 10 мМ Tris·Cl, 8 М мочевина, буфером D рН 5.9, содержащим 100 мМ NaH2PO4, 10 мМ Tris·Cl, 8 М мочевина, буфером Е рН 4.5, содержащим 100 мМ NaH2PO4, 10 мМ Tris·Cl, 8 М мочевина. Элюировали белок буфером F, содержащим 6 М GuHCl, 0.2 М уксусной кислоты. Фракции элюата, содержащие максимальное количество белка, диализовали против раствора 4 М мочевины, 10 мМ Tris-HCl рН 8.0. Из 65 мг клеточного осадка выделяли примерно 1 мг Н-РЕ белка с достаточно высоким уровнем очистки - не менее 95%.A bacterial protein with six amino acid residues was isolated under denaturing conditions by affinity chromatography on Ni-NTA Sepharose (Promega) in a column (QIAGEN, Germany) according to modified procedures 10 and 17 from The QIAexpressionist ™ manual of QIAGEN (Germany). For this, the expressing cell culture was centrifuged at 13000 rpm for 5 minutes and the pellet was resuspended in buffer A, pH 8.0, containing 100 mM NaH 2 PO 4 , 10 mM Tris · Cl, 6 M GuHCl at the rate of 1 ml of buffer per 80 mg of pellet, mixed on a rotating mixer for 30 minutes The cell lysate was centrifuged at 14,000 rpm for 15 minutes and the supernatant was collected. The supernatant was incubated with a suspension of Ni-NTA Sepharose balanced in buffer A for 30 minutes with constant stirring. The mixture of lysate and sorbent was transferred to a column. Washed the sorbent with buffer A, twice with buffer B, pH 8.0, containing 100 mM NaH 2 PO 4 , 10 mM Tris · Cl, 8 M urea, twice with buffer C pH 6.3, containing 100 mm NaH 2 PO 4 , 10 mM Tris · Cl, 8 M urea, buffer D, pH 5.9, containing 100 mM NaH 2 PO 4 , 10 mM Tris · Cl, 8 M urea, buffer E pH 4.5, containing 100 mM NaH 2 PO 4 , 10 mM Tris · Cl, 8 M urea. Protein was eluted with buffer F containing 6 M GuHCl, 0.2 M acetic acid. The eluate fractions containing the maximum amount of protein were dialyzed against a solution of 4 M urea, 10 mM Tris-HCl pH 8.0. From 65 mg of the cell pellet, approximately 1 mg of H-PE protein was isolated with a fairly high purification level of at least 95%.
Пример 4. Иммуногенность кандидатной вакцины на основе Н-РЕ, полученного в Е.coli.Example 4. Immunogenicity of the candidate vaccine based on H-PE obtained in E. coli.
Для характеристики иммуногенности и протективного действия бактериального Н-РЕ белка масляную эмульсию вводили 3 группам морских свинок (каждая группа по 8 животных) внутримышечно в задние конечности с белками в разных дозах: первой группе по 350 мкг белка; второй - по 120 мкг; третьей - по 40 мкг. Препарат для иммунизации готовили из 30 частей водной фазы, содержащей Н-РЕ белок в 4 М мочевине, 10 мМ Tris рН 8.0 и 70 частей масляного адъюванта Montanide ISA 70 фирмы SEPPIC (Франция). Четвертая группа была контрольной - 8 морских свинок, которым белок не вводили.To characterize the immunogenicity and protective effect of the bacterial H-PE protein, an oil emulsion was injected into 3 groups of guinea pigs (each group of 8 animals) intramuscularly in the hind limbs with proteins in different doses: the first group of 350 μg of protein; the second - 120 mcg; the third - at 40 mcg. The immunization preparation was prepared from 30 parts of an aqueous phase containing H-PE protein in 4 M urea, 10 mM Tris pH 8.0 and 70 parts of Montanide ISA 70 oil adjuvant from SEPPIC (France). The fourth group was the control - 8 guinea pigs that were not injected with protein.
Через 17 сут после иммунизации у животных были отобраны сыворотки крови, которые тестировали с помощью реакции микронейтрализации (РМН) (табл.1).Seventeen days after immunization, blood serum was collected from animals, which were tested using the microneutralization reaction (PMN) (Table 1).
РМН проводили на культуральных 96-луночных планшетах фирмы "Costar" в перевиваемой культуре клеток почки свиньи IB-RS-2 против 100 ТЦД50 культурального вируса ящура типа О/Тайвань/99. Перед постановкой реакции сыворотки крови морских свинок разводили 1:4 поддерживающей средой Игла и инактивировали при температуре 56°С 30 мин для удаления неспецифических ингибиторов. Сыворотки титровали двукратным шагом, начиная с разведения 1:16, добавляли равный объем рабочей дозы вируса ящура и выдерживали 1 ч при 37°С. Затем в лунки планшета вносили суспензию культуры клеток с концентрацией 0,8×106 клеток/см3. Планшеты выдерживали 48 ч в СО2-инкубаторе при 5% CO2 и температуре 37°С. Реакцию учитывали под инвертированным микроскопом, титр сыворотки рассчитывали по методу Кербера. Вируснейтрализующим титром антител исследуемой сыворотки считали предельное разведение сыворотки, при котором происходила нейтрализация инфекционного действия 100 ТЦД50 вируса в 50% зараженной культуры клеток IB-RS-2. Положительными считали сыворотки с активностью антител в разведении 1:45 и выше.RMN was performed on Costar culture 96-well plates in a transplantable culture of IB-RS-2 pig kidney cells versus 100 TCD 50 of foot and mouth disease culture virus type O / Taiwan / 99. Before staging the reaction, the serum of guinea pigs was diluted 1: 4 with Eagle's support medium and inactivated at 56 ° C for 30 min to remove non-specific inhibitors. Serum was titrated in two steps, starting with a 1:16 dilution, an equal volume of the working dose of foot-and-mouth disease virus was added and kept for 1 h at 37 ° С. Then, a cell culture suspension with a concentration of 0.8 × 10 6 cells / cm 3 was added to the wells of the plate. The plates were incubated for 48 hours in a CO 2 incubator at 5% CO 2 and a temperature of 37 ° C. The reaction was taken into account under an inverted microscope, the serum titer was calculated by the method of Kerber. The virus neutralization titer of the studied serum was considered the limiting dilution of serum at which the infection effect of 100 TCD 50 of the virus was neutralized in 50% of the infected IB-RS-2 cell culture. Serum with antibody activity at a dilution of 1:45 and higher was considered positive.
Через 21 сут после иммунизации группы морских свинок были подвергнуты контрольному заражению адаптированным к этим животным вирусом ящура О/Тайвань/99 гомологичным вакцинному штамму интрадермально в плантарную поверхность задних конечностей в дозе 104,0 ГД50/0,2 см3. Учет результатов заражения проводили через 7 суток и оценивали по генерализации ящурного процесса. Генерализацией считали образование вторичных афт на передних конечностях, в которые не вводили вирус. Контроль вакцины считали действительным, если из 8 невакцинированных свинок генерализованной формой заболевали не менее 7 животных.21 days after immunization, groups of guinea pigs were subjected to control infection with foot and mouth disease virus adapted O / Taiwan / 99 homologous to the vaccine strain intradermally into the plantar surface of the hind limbs at a dose of 10 4.0 GD 50 / 0.2 cm 3 . Accounting for the results of infection was carried out after 7 days and evaluated by generalization of the foot-and-mouth disease process. The generalization was the formation of secondary aphthae on the forelimbs into which the virus was not introduced. Vaccine control was considered valid if, out of 8 unvaccinated pigs, at least 7 animals fell ill with a generalized form.
Однократная иммунизация морских свинок эмульсионной вакциной, содержащей в прививном объеме бактериальный Н-РЕ белок в количествах 350 мкг и 120 мкг, индуцировала у животных формирование вируснейтрализующих антител к вирусу ящура типа О/Тайвань/99, выявляемых в РМН. Данные по протективности животных согласуются с данными РМН их сывороток. У всех иммунизированных такими дозами белка животных не происходило появления вторичных афт на передних лапах через 7 сут после заражения. У группы свинок иммунизированных бактериальным Н-РЕ в количестве 40 мкг вторичные афты регистрировали у 4 из 8 свинок. Симптомы ящура появлялись у 8 неиммунизированных (контрольных) морских свинок.A single immunization of guinea pigs with an emulsion vaccine containing in a graft volume bacterial H-PE protein in amounts of 350 μg and 120 μg induced the formation of neutralizing antibodies to FMD virus type O / Taiwan / 99 detected in the RMN in animals. The data on the animal protectiveness are consistent with the BMP data of their sera. In all animals immunized with such doses of protein, secondary aphthae did not appear on the forepaws 7 days after infection. In the group of pigs immunized with bacterial H-PE in an amount of 40 μg, secondary aphthae were recorded in 4 out of 8 pigs. Symptoms of foot and mouth disease appeared in 8 non-immunized (control) guinea pigs.
Пример 5. Создание рекомбинантного вектора экспрессии рекомбинантного белка Н-РЕ в растениях Nicotiana benthamiana.Example 5. The creation of a recombinant expression vector of recombinant protein H-RE in plants of Nicotiana benthamiana.
Для создания рекомбинантного вектора для экспрессии Н-РЕ белка в клетках Nicotiana benthamiana рекомбинантную нуклеиновую кислоту, представляющую собой фрагмент ДНК размером 0,77 т.п.н., вырезанный из ПНР продукта с помощью рестриктаз AscI и XmaI, клонировали в бинарном векторе pA7248-AMV по сайтам рестрикции AscI и XmaI. Полученный рекомбинантный вектор экспрессии был обозначен как pA7248-AMV-Н-РЕ. Правильность нуклеотидной последовательности вставки плазмиды была подтверждена секвенированием. Полученная плазмида pA7248-AMV-H-PE была использована для трансформации Agrobacterium tumefaciens штамма ЕНА105. Трансформацию осуществляли по стандартным методикам [31]. На ледяной бане к компетентным клеткам добавляли 0,5 мкг плазмидной ДНК. Клетки выдерживали 5 мин при 37°С, затем добавляли 500 мкл среды LB и растили 4 часа при 28°С при постоянном перемешивании. Клетки высевали на LB-агар и инкубировали при 28°С в течение 3-4 дней. Колония агробактерий, трансформированных конструкцией pA7248-AMV-H-PE, была отобрана с помощью ПНР скрининга с парой специфичных праймеров PVXseq456 (GAGAGAAATTGGCAAGGGCT) и PVXdAvr (CAGTCAGGCGCATAATTGAT). ПЦР проводили при следующих условиях: (1) 94°С - 30 сек, (2) 42°С - 30 сек, (3) 72°С - 2 мин, шаги 1-3 повторяли 25 раз.To create a recombinant vector for expression of the H-PE protein in Nicotiana benthamiana cells, a recombinant nucleic acid, which is a 0.77 kbp DNA fragment, cut from the product's PNR using restriction enzymes AscI and XmaI, was cloned in the binary vector pA7248- AMV at AscI and XmaI restriction sites. The resulting recombinant expression vector was designated as pA7248-AMV-H-PE. The correct nucleotide sequence of the plasmid insert was confirmed by sequencing. The resulting plasmid pA7248-AMV-H-PE was used to transform Agrobacterium tumefaciens strain EHA105. Transformation was carried out according to standard methods [31]. In an ice bath, 0.5 μg of plasmid DNA was added to the competent cells. The cells were kept for 5 min at 37 ° C, then 500 μl of LB medium was added and grown for 4 hours at 28 ° C with constant stirring. Cells were seeded on LB agar and incubated at 28 ° C for 3-4 days. A colony of agrobacteria transformed with the pA7248-AMV-H-PE construct was selected by PNR screening with a pair of specific primers PVXseq456 (GAGAGAAATTGGCAAGGGCT) and PVXdAvr (CAGTCAGGCGCATAATTGAT). PCR was performed under the following conditions: (1) 94 ° C for 30 sec, (2) 42 ° C for 30 sec, (3) 72 ° C for 2 min, steps 1-3 were repeated 25 times.
Для повышения эффективности транзиентной экспрессии целевого белка растения агроинокулировали смесью культур, трансформированных вектором с целевым геном и вектором-продуцентом супрессора РНК сайленсинга - белка р24 вируса, ассоциированного со скручиванием листьев винограда 2 (GLRaV-2) или HCPro вируса мозайки турнепса, клонированные в модифицированную плазмиду pCambia2301. В этих плазмидах нуклеотидная последовательность Т-ДНК, фланкированная участками, необходимыми для ее переноса в ядро, была заменена на следующие последовательности: сайт узнавания рестриктазы AscI, последовательность 35S промотера, сайт узнавания рестриктазы PmeI, последовательность открытой рамки считывания, кодирующей белок-супрессор, сайты узнавания рестриктаз PstI и StuI, последовательности nos и 35S терминаторов транскрипции. Полученные конструкции были названы рССар24 и pCCaHCPro и использовали для трансформации Agrobacterium tumefaciens штамма ЕНА105.To increase the efficiency of transient expression of the target protein, the plants were agroinoculated with a mixture of cultures transformed with the vector with the target gene and the producer vector of the suppressor RNA silencing - protein p24 of the virus associated with twisting of vine leaves 2 (GLRaV-2) or HCPro turnip mosaic virus cloned into a modified plasmid pCambia2301. In these plasmids, the T-DNA nucleotide sequence flanked by the regions necessary for its transfer to the nucleus was replaced by the following sequences: AscI restriction enzyme recognition site, 35S promoter sequence, PmeI restriction enzyme recognition site, open suppressor sequence encoding a protein suppressor, sites recognition of PstI and StuI restriction enzymes, nos and 35S sequences of transcription terminators. The resulting constructs were named pCCar24 and pCCaHCPro and used to transform Agrobacterium tumefaciens strain EHA105.
Культуры клеток агробактерии, трансформированной конструкциями рА7248-AMV-H-PE, pA7248-AMV-GUS (см. далее), pCCaHCPro или рССар24, выращивали в среде LB с антибиотиками (канамицин, рифампицин, гентамицин) и с 10 мМ MES (2-(N-Морфолино)-этансульфоновая кислота) 12 часов на качалке при 28°С. Клетки осаждали при 4000 об/мин в течение 5 минут, осадок ресуспендировали в индуцирующем буфере, содержащем 10 мМ MgSO4, 10 мМ MES. Определяли оптическую плотность, готовили суспензию клеток в индуцирующем буфере с оптической плотностью (ОП600) 0,2. Добавляли раствор ацетосирингона (конечная концентрация 150 мкМ) и выдерживали 3 часа при комнатной температуре. Суспензии клеток агробактерии, трансформированных конструкцией, кодирующей целевой ген (pA7248-AMV-H-PE), и конструкцией супрессора РНК сайленсинга (HCPro или р24) смешивали и вводили шприцем без иглы в межклеточное пространство листьев растений.Cell cultures of an agrobacterium transformed with the constructs pA7248-AMV-H-PE, pA7248-AMV-GUS (see below), pCCaHCPro or pCCar24 were grown in LB medium with antibiotics (kanamycin, rifampicin, gentamicin) and with 10 mM MES (2- (N-Morpholino) ethanesulfonic acid) 12 hours on a rocking chair at 28 ° C. Cells were pelleted at 4000 rpm for 5 minutes, and the pellet was resuspended in induction buffer containing 10 mM MgSO 4 , 10 mM MES. The optical density was determined, a cell suspension was prepared in an induction buffer with an optical density (OD 600 ) of 0.2. Acetosyringone solution (final concentration of 150 μM) was added and kept at room temperature for 3 hours. Suspensions of agrobacterial cells transformed with the construct encoding the target gene (pA7248-AMV-H-PE) and the RNA silencing suppressor construct (HCPro or p24) were mixed and injected without a needle into the intercellular space of plant leaves.
В качестве отрицательного контроля была использована ткань того же листа, инфильтрированная культурой агробактерий, трансформированных конструкцией pA7248-AMV-GUS, несущей последовательность β-глюкуронидазы. Для получения вектора pA7248-AMV-GUS последовательность, кодирующая β-глюкуронидазу, была клонирована в плазмиду pA7248-AMV по сайтам рестрикции AscI и XhoI.As a negative control, tissue of the same sheet infiltrated with a culture of agrobacteria transformed with the pA7248-AMV-GUS construct carrying the β-glucuronidase sequence was used. To obtain the pA7248-AMV-GUS vector, the sequence encoding β-glucuronidase was cloned into the pA7248-AMV plasmid at the AscI and XhoI restriction sites.
Клетки растений, агроинокулированных конструкцией pA7248-AMV-H-PE и HCPro или р24, были способны экспрессировать белок с электрофоретической подвижностью, как у белка Н-РЕ, экспрессированного в бактериях (Фиг.7). Доля белка Н-РЕ в растении составляла 0,7-1% от общего количества белка листа.Plant cells agroinoculated with the construct pA7248-AMV-H-PE and HCPro or p24 were able to express the protein with electrophoretic mobility, as in the H-PE protein expressed in bacteria (Figure 7). The proportion of H-RE protein in the plant was 0.7-1% of the total amount of leaf protein.
Выделение и очистку Н-РЕ белка из растения проводили по методике, аналогичной выделению белка Н-РЕ из бактерий. Из 120 г свежей растительной ткани выделяли примерно 8 мг Н-РЕ белка (67 мг белка из 1 кг растительной ткани).Isolation and purification of the H-RE protein from the plant was carried out by a method similar to the isolation of the H-PE protein from bacteria. About 120 mg of H-PE protein (67 mg of protein from 1 kg of plant tissue) was isolated from 120 g of fresh plant tissue.
Пример 6. Иммуногенность кандидатной вакцины на основе Н-РЕ, полученного в растениях.Example 6. Immunogenicity of a candidate vaccine based on H-PE obtained in plants.
Для характеристики иммуногенности и протективного действия бактериального Н-РЕ белка, полученного в растительной системе экспрессии путем иммунизации морских свинок в концентрациях, аналогичных при вакцинации бактериальным белком Н-РЕ (300, 120 и 40 мкг).To characterize the immunogenicity and protective effect of the bacterial H-PE protein obtained in the plant expression system by immunization of guinea pigs at concentrations similar to vaccination with the bacterial H-PE protein (300, 120, and 40 μg).
Через 17 сут после вакцинации у 24 иммунизированных разными дозами антигена и 4 контрольных морских свинок были отобраны пробы крови. Полученные сыворотки крови морских свинок были протестированы в непрямом варианте иммунного ферментного анализа (ИФА) с антигеном вируса ящура О/Тайвань/99 (тест-система ФГУ «ВНИИЗЖ») и с использованием набора О FMDV Ab PrioCHECK (табл.2).17 days after vaccination, 24 blood samples were taken from 24 antigens and 4 control guinea pigs immunized with different doses. The obtained serum from guinea pigs was tested in an indirect version of the immune enzyme assay (ELISA) with FMD virus antigen O / Taiwan / 99 (test system FSI "ARRIAH") and using the O FMDV Ab PrioCHECK kit (Table 2).
Непрямой вариант ИФА проводили по стандартной схеме с некоторыми модификациями. Антигены вируса ящура штаммов О/Приморский/ОО, О/Маниса и О/Тайвань/99 получали из суспензии зараженной перевиваемой культуры клеток ПГСК-30 в процессе преципитации инактивированных вирусных частиц 8% раствором полиэтиленгликоля (м.м. 6000 Д) с добавлением NaCl до конечной концентрации 0,9% и обработки хлороформом с последующей очисткой и концентрированием антигена ультрацентрифугированием через 20% раствор сахарозы. Анализ препаратов антигена вируса ящура проводили в 12%-15% ПААГ [29].An indirect ELISA was carried out according to the standard scheme with some modifications. FMD virus antigens of strains O / Primorsky / OO, O / Manisa and O / Taiwan / 99 were obtained from a suspension of infected transplanted cell culture PGSC-30 in the process of precipitation of inactivated viral particles with 8% polyethylene glycol solution (m.m. 6000 D) with the addition of NaCl to a final concentration of 0.9% and treatment with chloroform, followed by purification and concentration of the antigen by ultracentrifugation through a 20% sucrose solution. Analysis of FMD virus antigen preparations was performed in 12% –15% PAAG [29].
Концентрированный и очищенный антиген вируса ящура адсорбировали в лунках 96-луночного полистиролового планшета фирмы "Nunc" MaxiSorp (Дания) в карбонатнобикарбонатном буфере (рН 9,6) в количестве 1-2 мкг белка на лунку. Несвязавшиеся с антигеном участки в лунках планшета блокировали буфером БСА-ТБСТ (0,02 М Трис-HCl, 0,15 М NaCl, 0,05% Твин-20, 1% БСА). Пробы наносили на планшет в буфере ТБСТ с 5% фетальной сывороткой (ФС-ТБСТ) методом двукратных последовательных разведений. Инкубировали в течение 30 мин при 37°С. После четырехкратного промывания планшета буфером ТБСТ в каждую лунку вносили по 50 мкл антивидового иммунопероксидазного конъюгата (филиал «МЕДГАМАЛ» ГУ НИИЭМ им. Н.Ф.Гамалеи РАМН), разведенного в ФС-ТБСТ 1:1000. Инкубировали еще 30 мин при 37°С. Затем планшет снова промывали. Окрашивание производили с помощью субстратной смеси ABTS (МР Biomedicals, США). Через 10-15 мин реакцию останавливали 1% Ds-Na. Реакцию учитывали с помощью многоканального спектрофотометра путем измерения оптической плотности (ОП) при длине волны 405 нм. Титром сыворотки считали конечное разведение, в котором ОП лунки было меньше или равно удвоенному среднему значению ОП отрицательного контроля.The concentrated and purified FMD virus antigen was adsorbed in the wells of a 96-well polystyrene Nunc MaxiSorp tablet (Denmark) in carbonate-bicarbonate buffer (pH 9.6) in an amount of 1-2 μg protein per well. Antigen-unrelated areas in the plate wells were blocked with BSA-TBST buffer (0.02 M Tris-HCl, 0.15 M NaCl, 0.05% Tween-20, 1% BSA). Samples were applied to a plate in TBST buffer with 5% fetal serum (FS-TBST) by double serial dilutions. Incubated for 30 min at 37 ° C. After washing the tablet four times with TBST buffer, 50 μl of the antispecies immunoperoxidase conjugate (branch MEDGAMAL, NF Gamalei RAMS RAMI) diluted in FS-TBST 1: 1000 was added to each well. Incubated for another 30 min at 37 ° C. Then the tablet was washed again. Staining was performed using an ABTS substrate mixture (MP Biomedicals, USA). After 10-15 minutes, the reaction was stopped with 1% Ds-Na. The reaction was taken into account using a multichannel spectrophotometer by measuring the optical density (OD) at a wavelength of 405 nm. The serum titer was considered the final dilution in which the OD of the well was less than or equal to twice the average OD value of the negative control.
В качестве референтного теста для выявления антител против вируса ящура типа О использовали коммерческий набор О FMDV Ab PrioCHECK (Нидерланды). Постановку реакции проводили согласно инструкции производителя, а положительным значением считали процент ингибирования (PI) ≥50%.As a reference test for the detection of antibodies against FMD virus type O, commercial kit O FMDV Ab PrioCHECK (Netherlands) was used. The reaction was carried out according to the manufacturer's instructions, and the inhibition percentage (PI) ≥50% was considered a positive value.
Через 17 сут после однократной иммунизации морских свинок дозой препарата в 350 мкг выработка антител, определяемая согласно референтному тесту О FMDV Ab PrioCHECK, индуцировалась у всех привитых животных.17 days after a single immunization of guinea pigs with a drug dose of 350 μg, antibody production, determined according to the reference test O FMDV Ab PrioCHECK, was induced in all vaccinated animals.
Однократная иммунизация свинок вакциной, изготовленной на основе масляного адъюванта Montanide ISA 70 с содержанием в прививном объеме растительный Н-РЕ белок в количествах 350 мкг и 120 мкг, вызывала образование у животных вируснейтрализующих антител к вирусу ящура типа О/Тайвань/99, выявляемых в ИФА. У всех иммунизированных такими дозами белка животных не происходило появления вторичных афт на передних лапах через 7 суток после заражения. У группы свинок, иммунизированных растительным Н-РЕ в количестве 40 мкг, вторичные афты появлялась у 2 из 8 свинок. Симптомы ящура появлялись у 8 неиммунизированных морских свинок.A single immunization of pigs with a vaccine made on the basis of Montanide ISA 70 oil adjuvant containing grafted plant H-PE protein in quantities of 350 μg and 120 μg caused the formation of virus-neutralizing antibodies to FMD virus type O / Taiwan / 99 detected in ELISA . In all animals immunized with such doses of protein, secondary aphthae did not appear on the forepaws 7 days after infection. In a group of pigs immunized with plant H-PE in an amount of 40 μg, secondary aphthae appeared in 2 out of 8 pigs. Symptoms of foot and mouth disease appeared in 8 non-immunized guinea pigs.
Результаты оценки иммуногенности бактериального и растительного полиэпитопных белков Н-РЕ на морских свинках свидетельствуют о том, что при однократной иммунизации дозой 120 мкг в комбинации масляным адъювантом Montanide ISA 70, он способен индуцировать иммунный ответ у животных, детектируемый методами ИФА и РМН, а также вызывать устойчивость к контрольному заражению гомологичным адаптированным вирусом ящура типа О/Тайвань/99. Следовательно, полученный препарат может рассматриваться в качестве кандидата на вакцину против вируса ящура.The results of the immunogenicity assessment of the bacterial and plant polyepitope H-PE proteins in guinea pigs indicate that with a single immunization with a dose of 120 μg in combination with Montanide ISA 70 oil adjuvant, it is able to induce an immune response in animals detected by ELISA and RMN, as well as induce resistance to control infection with homologous adapted foot and mouth disease virus type O / Taiwan / 99. Therefore, the resulting preparation can be considered as a candidate for a vaccine against foot and mouth disease virus.
Полученные результаты на морских свинках позволяют экстраполировать достигнутый эффект и на сельскохозяйственных животных.The results obtained on guinea pigs can extrapolate the achieved effect on farm animals.
Полученные данные об эффективности кандидатной вакцины против вируса ящура на основе белка, состоящего из эффективных эпитопов вируса, позволяют предположить, что данный подход может быть успешно использован в создании других (противовирусных вакцин) препаратов для иммунизации животных против вируса ящура различных серотипов и подтипов.The data on the effectiveness of the candidate vaccine against foot and mouth disease virus based on a protein consisting of effective epitopes of the virus suggest that this approach can be successfully used to create other (antiviral vaccines) preparations for immunizing animals against foot and mouth disease virus of various serotypes and subtypes.
При осуществлении изобретения, помимо методов, раскрытых в данных примерах, использовали хорошо известные специалистам методики, описанные в руководствах по молекулярной биологии и генетической инженерии [30, 31].In the implementation of the invention, in addition to the methods disclosed in these examples, the techniques well-known to those skilled in the art described in the manuals of molecular biology and genetic engineering were used [30, 31].
Claims (15)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2010144885/10A RU2453557C1 (en) | 2010-11-03 | 2010-11-03 | Polyepitope protein composition for inducing immune response against foot-and-mouth disease virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2010144885/10A RU2453557C1 (en) | 2010-11-03 | 2010-11-03 | Polyepitope protein composition for inducing immune response against foot-and-mouth disease virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| RU2010144885A RU2010144885A (en) | 2012-05-10 |
| RU2453557C1 true RU2453557C1 (en) | 2012-06-20 |
Family
ID=46311963
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2010144885/10A RU2453557C1 (en) | 2010-11-03 | 2010-11-03 | Polyepitope protein composition for inducing immune response against foot-and-mouth disease virus |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2453557C1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110624100A (en) * | 2019-09-06 | 2019-12-31 | 中国农业科学院兰州兽医研究所 | Application of foot-and-mouth disease virus 3D protein as TLR3 pathway activator |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SU1730151A1 (en) * | 1990-06-20 | 1992-04-30 | Институт биоорганической химии им.М.М.Шемякина | Recombinant plasmid dna p9fmd, encoding hybridous polypeptide p199- asp-pro-cys-cys-vp1(200-213)-pro-pro-ser-pro-vp1(131-152)-pro-cys-- gly and a strain of bacteria escherichia coli - a producer of hybridous polypeptide p199-asp-pro-cys-gly-vp1(200-213)-pro-pro-ser -pro-vp1(131-152)-pro-cys-gly |
| RU2143921C1 (en) * | 1999-04-21 | 2000-01-10 | Всероссийский научно-исследовательский институт защиты животных | Vaccine against foot and mouth of type a and method of its preparing |
| CN1270839A (en) * | 1999-04-15 | 2000-10-25 | 香港科技大学 | Antigenic antibody vaccine of foot-and-mouth disease |
| RU2202613C2 (en) * | 1996-09-18 | 2003-04-20 | Байер Акциенгезелльшафт | Foot and mouth virus immunogenic peptides |
| RU2212895C2 (en) * | 2001-11-01 | 2003-09-27 | Федеральное государственное учреждение Всероссийский научно-исследовательский институт защиты животных | Vaccine against o-type foot-and-mouth disease and method for its preparing |
| RU2220744C1 (en) * | 2002-07-01 | 2004-01-10 | Федеральное государственное учреждение Всероссийский научно-исследовательский институт защиты животных | Vaccine against foot-and-mouth asia-1 type and method for it preparing |
| WO2006063445A1 (en) * | 2004-12-14 | 2006-06-22 | Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Health | Recombinant foot and mouth disease vaccine |
-
2010
- 2010-11-03 RU RU2010144885/10A patent/RU2453557C1/en not_active IP Right Cessation
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SU1730151A1 (en) * | 1990-06-20 | 1992-04-30 | Институт биоорганической химии им.М.М.Шемякина | Recombinant plasmid dna p9fmd, encoding hybridous polypeptide p199- asp-pro-cys-cys-vp1(200-213)-pro-pro-ser-pro-vp1(131-152)-pro-cys-- gly and a strain of bacteria escherichia coli - a producer of hybridous polypeptide p199-asp-pro-cys-gly-vp1(200-213)-pro-pro-ser -pro-vp1(131-152)-pro-cys-gly |
| RU2202613C2 (en) * | 1996-09-18 | 2003-04-20 | Байер Акциенгезелльшафт | Foot and mouth virus immunogenic peptides |
| CN1270839A (en) * | 1999-04-15 | 2000-10-25 | 香港科技大学 | Antigenic antibody vaccine of foot-and-mouth disease |
| RU2143921C1 (en) * | 1999-04-21 | 2000-01-10 | Всероссийский научно-исследовательский институт защиты животных | Vaccine against foot and mouth of type a and method of its preparing |
| RU2212895C2 (en) * | 2001-11-01 | 2003-09-27 | Федеральное государственное учреждение Всероссийский научно-исследовательский институт защиты животных | Vaccine against o-type foot-and-mouth disease and method for its preparing |
| RU2220744C1 (en) * | 2002-07-01 | 2004-01-10 | Федеральное государственное учреждение Всероссийский научно-исследовательский институт защиты животных | Vaccine against foot-and-mouth asia-1 type and method for it preparing |
| WO2006063445A1 (en) * | 2004-12-14 | 2006-06-22 | Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Health | Recombinant foot and mouth disease vaccine |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110624100A (en) * | 2019-09-06 | 2019-12-31 | 中国农业科学院兰州兽医研究所 | Application of foot-and-mouth disease virus 3D protein as TLR3 pathway activator |
Also Published As
| Publication number | Publication date |
|---|---|
| RU2010144885A (en) | 2012-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10421790B2 (en) | Feline calicivirus vaccine | |
| CN107337718B (en) | Gene for coding porcine circovirus type 2Cap protein and application thereof | |
| CN108456663B (en) | Type 1 bovine viral diarrhea virus-like particle and preparation and application thereof | |
| JP2009524699A (en) | Novel plant virus particles and methods for their inactivation | |
| CN109867727B (en) | Flagellin-fiber2 fusion protein, and preparation method and application thereof | |
| CN113461788B (en) | Cat coronavirus recombinant antigen, genetic engineering subunit vaccine thereof and application | |
| Dong et al. | Promising MS2 mediated virus-like particle vaccine against foot-and-mouth disease | |
| Guo et al. | Self-assembly of virus-like particles of rabbit hemorrhagic disease virus capsid protein expressed in Escherichia coli and their immunogenicity in rabbits | |
| US20210388366A1 (en) | Plant-produced chimaeric orbivirus vlps | |
| KR102336158B1 (en) | Vaccine Composition Against Porcine Epidemic Diarrhea Virus and Porcine Rotavirus | |
| CN110452889B (en) | Construction method and primary application of recombinant bovine enterovirus expressing BVDV-E0 | |
| Andrianova et al. | Foot and mouth disease virus polyepitope protein produced in bacteria and plants induces protective immunity in guinea pigs | |
| CA2707919A1 (en) | A subunit vaccine for aquaculture | |
| RU2467014C2 (en) | Polyepitope protein, nucleotide sequence coding polyepitope protein, plasmid with sequence coding polyepitope protein, and preparation of polyepitope protein for induction of immune response on murrain virus | |
| RU2453557C1 (en) | Polyepitope protein composition for inducing immune response against foot-and-mouth disease virus | |
| Chu et al. | Construction of a bovine enterovirus-based vector expressing a foot-and-mouth disease virus epitope | |
| CN117897170A (en) | FMDV virus-like particles with stabilizing mutations | |
| KR102451412B1 (en) | Novel immunopotent recombinant protein with simultaneous induction of cellular and humoral immune responses and broad spectrum of protective efficacy, and foot-and-mouth disease (FMD) vaccine composition comprising the same | |
| Meshcheryakova et al. | Cowpea mosaic virus chimeric particles bearing the ectodomain of matrix protein 2 (M2E) of the influenza A virus: production and characterization | |
| CN106046123A (en) | Chicken infectious bursal disease virus VP2 protein and preparation method and application thereof and kit | |
| CN111560386A (en) | Soluble porcine circovirus type 2 Cap protein and application thereof | |
| Lee et al. | Characterization of particles formed by the precursor protein VPX of infectious bursal disease virus in insect Hi-5 cells: implication on its proteolytic processing | |
| CN116102660B (en) | Porcine parvovirus gene engineering epitope vaccine and preparation method thereof | |
| CN115894718B (en) | Antigen epitope peptide of African swine fever virus and application thereof | |
| CN114891120B (en) | Bivalent avian adenovirus specific antigen fusion protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| MM4A | The patent is invalid due to non-payment of fees |
Effective date: 20141104 |